Email to GenScript

pRNA-H1.3/Neo


*This product has been discontinued! *

Description

pRNA-H1.3/Neo

Description
pRNA-H1.3/Neo is a GenScript siRNA expression vector. It is designed for mammalian transfection. It uses an enhanced H1 promoter (enhanced by a CMV enhancer just before H1 promoter) for siRNA expression. The siRNA insert can be cloned between BamH I and Hind III sites.


Storage Store at -20°C
Forward Sequencing Primer DA0024: pRNA-H1.3 Forward (GACGTCAATGGGAGTTTGTT)
Reverse Sequencing Primer DA0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map CMV IE: 4559 - 5042
siFluc: 5148 - 5205
Polylinker: 5142 - 5211
H1 Promoter: 5049 - 5143
SV40 Promoter: 647 - 992
Neomycin: 1033 - 1827
pUC ori: 2541 - 3181
Ampicillin: 3329 - 4189

Vector Sequence and Restriction Enzyme Map





Notice there is no results found, you can visit "Citations Database" for other results.




For more documents, please visit "Technical Support".