• THAT   AND

Sequence in raw or FASTA format:


Blast Method:


Homo sapiens solute carrier family 26 (anion exchanger), member 3 (SLC26A3), mRNA.

Clone ID Definition Vector Stock Status Price *Turnaround time Order
OHu26676 Homo sapiens solute carrier family 26 (anion exchanger), member 3 (SLC26A3), mRNA. pcDNA3.1+-DYK On-demand $279.00 12-14
OHu26676C Homo sapiens solute carrier family 26 (anion exchanger), member 3 (SLC26A3), mRNA. Customized vector On-demand $329.00 12-14

*Business Day

Mutation services

Sequence Information ORF Nucleotide Sequence
Protein sequence
Vector pcDNA3.1+-DYK or customized vector
Clone information Data sheet
Tag on pcDNA3.1+-DYK N terminal DYKDDDK tags
Restriction Sites Hind III- EcoR I
RefSeq Version NM_000111.2, 171543859
Length 2295 bp
Structure linear
Update Date 25-MAY-2014
Organism Homo sapiens (human)
Definition Homo sapiens solute carrier family 26 (anion exchanger), member 3 (SLC26A3), mRNA.
Product chloride anion exchanger

Summary: The protein encoded by this gene is a transmembrane glycoprotein that transports chloride ions across the cell membrane in exchange for bicarbonate ions. It is localized to the mucosa of the lower intestinal tract, particularly to the apical membrane of columnar epithelium and some goblet cells. The protein is essential for intestinal chloride absorption, and mutations in this gene have been associated with congenital chloride diarrhea. [provided by RefSeq, Oct 2008].

RefSeq NP_000102.1
CDS 212..2506
Misc Feature(1)11
Misc Feature(2)11
Misc Feature(3)131..133
Misc Feature(4)383..634
Misc Feature(5)383..634
Misc Feature(6)386..2359
Misc Feature(7)440..502
Misc Feature(8)509..571
Misc Feature(9)584..646
Misc Feature(10)737..799
Misc Feature(11)788..1624
Misc Feature(12)803..865
Misc Feature(13)986..1048
Misc Feature(14)1067..1129
Misc Feature(15)1238..1300
Misc Feature(16)1334..1396
Misc Feature(17)1445..1507
Misc Feature(18)1526..1588
Misc Feature(19)1619..1681
Misc Feature(20)1718..1720
Misc Feature(21)1736..1738
Misc Feature(22)1769..1771
Misc Feature(23)1787..2347
Misc Feature(24)2141..2203
Misc Feature(25)2315..2377
Exon (1)1..123
Gene Synonym:CLD; DRA
Exon (2)124..342
Gene Synonym:CLD; DRA
Exon (3)343..482
Gene Synonym:CLD; DRA
Exon (4)483..593
Gene Synonym:CLD; DRA
Exon (5)594..781
Gene Synonym:CLD; DRA
Exon (6)782..946
Gene Synonym:CLD; DRA
Exon (7)947..1099
Gene Synonym:CLD; DRA
Exon (8)1100..1182
Gene Synonym:CLD; DRA
Exon (9)1183..1330
Gene Synonym:CLD; DRA
Exon (10)1331..1444
Gene Synonym:CLD; DRA
Exon (11)1445..1522
Gene Synonym:CLD; DRA
Exon (12)1523..1618
Gene Synonym:CLD; DRA
Exon (13)1619..1725
Gene Synonym:CLD; DRA
Exon (14)1726..1795
Gene Synonym:CLD; DRA
Exon (15)1796..1888
Gene Synonym:CLD; DRA
Exon (16)1889..1984
Gene Synonym:CLD; DRA
Exon (17)1985..2218
Gene Synonym:CLD; DRA
Exon (18)2219..2273
Gene Synonym:CLD; DRA
Exon (19)2274..2416
Gene Synonym:CLD; DRA
Exon (20)2417..2482
Gene Synonym:CLD; DRA
Exon (21)2483..2894
Gene Synonym:CLD; DRA
Order your protein of interest with our Guaranteed or It's Free Service now! For details, please click here.
Position Chain Variation Link
complement(124)-t, cdbSNP:375869839
complement(161)-t, gdbSNP:370340588
complement(172)-g, adbSNP:187600896
complement(245)-c, adbSNP:201803182
complement(259)-c, adbSNP:182526650
complement(285)-t, adbSNP:375084378
complement(315)-g, adbSNP:144627478
complement(330)-t, cdbSNP:78133952
complement(340)-g, adbSNP:199700484
356..368+, aaggccaagagaadbSNP:386833456
complement(358)-c, adbSNP:200940608
complement(378)-g, adbSNP:369767483
complement(386)-g, adbSNP:371476952
388..389+, cdbSNP:386833468
complement(414)-t, cdbSNP:10280704
complement(452)-t, cdbSNP:116793431
complement(460)-t, gdbSNP:201503990
complement(472)-t, gdbSNP:202020458
481..482+, aadbSNP:386833476
complement(505)-g, adbSNP:368890058
complement(506)-t, cdbSNP:150004100
complement(543)-g, adbSNP:75733585
543+, tdbSNP:386833477
555+, tdbSNP:386833478
complement(568)-t, g, adbSNP:73419912
569+a, gdbSNP:386833479
complement(577)-g, adbSNP:373999154
582+a, tdbSNP:121913030
complement(589)-g, adbSNP:142349142
complement(590)-t, cdbSNP:142116047
597+c, tdbSNP:386833480
603+, cdbSNP:386833482
603+c, g, tdbSNP:386833481
complement(604)-t, cdbSNP:140184294
complement(608)-g, adbSNP:146149806
619+a, gdbSNP:386833483
complement(669)-t, cdbSNP:142400087
complement(670)-t, adbSNP:372822974
complement(724)-g, adbSNP:367588993
complement(725)-t, cdbSNP:71566741
736+c, gdbSNP:386833484
complement(741)-g, adbSNP:147974764
complement(744)-g, adbSNP:143515876
complement(745)-t, cdbSNP:149275142
complement(748..750)-, gccdbSNP:369893693
complement(748)-t, cdbSNP:374927524
770+g, tdbSNP:121913032
complement(801)-t, cdbSNP:201844799
821+g, tdbSNP:386833487
827+c, tdbSNP:386833488
complement(866)-c, adbSNP:138427715
870+a, cdbSNP:386833489
complement(872)-t, cdbSNP:370662677
complement(922)-g, cdbSNP:145962719
complement(952)-t, cdbSNP:188437289
complement(1004)-t, cdbSNP:375650310
complement(1035)-g, adbSNP:142128989
complement(1102)-g, adbSNP:367700437
1126+a, c, tdbSNP:386833490
complement(1127)-t, cdbSNP:138234173
complement(1132)-c, adbSNP:34407351
1134+c, tdbSNP:80222394
complement(1151)-t, gdbSNP:372165246
complement(1158)-g, cdbSNP:368292176
1160..1162+, gtgdbSNP:121913029
1161+a, cdbSNP:78983942
1162..1164+, ggtdbSNP:386833491
complement(1196)-t, cdbSNP:369516311
complement(1206)-t, cdbSNP:140952086
complement(1207)-g, adbSNP:35576676
complement(1217)-c, adbSNP:142761906
complement(1228)-g, adbSNP:376695368
complement(1237)-g, adbSNP:148961545
1239+a, gdbSNP:386833444
1241..1258+gatgcc, ttcggcatcgcaatggttdbSNP:386833445
complement(1249)-g, adbSNP:373747349
complement(1255)-c, adbSNP:369910571
complement(1324)-g, adbSNP:146803737
1347+c, gdbSNP:386833446
1359..1360+, tadbSNP:386833447
complement(1399)-g, adbSNP:139145429
complement(1404)-g, adbSNP:143839547
complement(1425)-g, cdbSNP:199638708
complement(1468)-g, adbSNP:140126824
complement(1484)-t, cdbSNP:146161125
complement(1509)-g, adbSNP:200724013
1510+a, gdbSNP:3735605
1517+c, tdbSNP:386833448
complement(1525)-g, adbSNP:117703371
complement(1526)-t, cdbSNP:183357373
1553..1554+, ttdbSNP:386833450
complement(1565)-g, adbSNP:374372529
1571+c, tdbSNP:386833451
1573+, gdbSNP:386833452
1597+a, gdbSNP:121913033
1598+c, tdbSNP:386833453
1614+a, tdbSNP:386833454
complement(1663)-g, adbSNP:200404042
1698+g, tdbSNP:386833457
complement(1706)-t, cdbSNP:150724234
complement(1709)-t, cdbSNP:375977220
complement(1720)-g, adbSNP:111750004
complement(1723)-t, cdbSNP:199870537
1728+, cdbSNP:386833459
1737..1738+, gcdbSNP:386833460
complement(1740)-g, adbSNP:60147601
1762..1765+, caacdbSNP:386833461
1770+a, gdbSNP:386833462
1774+c, gdbSNP:386833463
complement(1783)-t, cdbSNP:148222595
1790..1792+, tatdbSNP:386833464
complement(1805)-g, adbSNP:372157278
1820+, adbSNP:386833465
complement(1830)-c, adbSNP:147164102
complement(1834)-t, cdbSNP:368930571
1835..1837+c, tctdbSNP:386833466
1842+a, tdbSNP:386833467
complement(1856)-t, cdbSNP:184317244
complement(1860)-g, cdbSNP:201414043
complement(1872)-t, cdbSNP:2301635
complement(1879)-g, adbSNP:373684245
complement(1883)-t, cdbSNP:370246673
complement(1894)-g, adbSNP:376707926
complement(1913)-g, cdbSNP:143677801
complement(1932)-g, adbSNP:370732546
complement(1939)-g, cdbSNP:138094082
complement(1947)-t, cdbSNP:201969535
complement(1964)-t, cdbSNP:147019341
complement(1997)-c, adbSNP:201220816
complement(2012)-t, cdbSNP:201078396
complement(2013)-g, adbSNP:35776303
complement(2023)-g, adbSNP:372871858
complement(2062)-t, gdbSNP:138629546
complement(2093)-g, cdbSNP:369667941
complement(2116)-g, adbSNP:202216109
complement(2148)-t, cdbSNP:200559868
complement(2164)-g, adbSNP:41669
complement(2165)-t, cdbSNP:140426439
2201+, gdbSNP:386833469
complement(2232)-t, adbSNP:368047696
2236..2237+, atcdbSNP:121913031
2237..2238+, tcadbSNP:386833470
complement(2249..2250)-, cdbSNP:35617203
complement(2254)-g, cdbSNP:143786154
complement(2256)-t, cdbSNP:370006510
complement(2260)-g, adbSNP:376554543
complement(2261)-t, cdbSNP:199895223
complement(2262)-g, adbSNP:183775228
complement(2273)-g, cdbSNP:191547831
complement(2276)-c, adbSNP:146830301
complement(2278)-g, adbSNP:143670801
complement(2303)-g, cdbSNP:138002384
2315..2316+accggttttgaagtgaaaattcaaaattt, ggdbSNP:386833472
2327+, adbSNP:386833473
complement(2327)-t, adbSNP:146610949
2343+g, tdbSNP:386833474
complement(2380)-g, cdbSNP:142908255
complement(2386)-g, adbSNP:201137330
complement(2404)-g, adbSNP:148586598
complement(2469)-t, cdbSNP:35342296
complement(2486)-g, adbSNP:369916664
complement(2514)-t, cdbSNP:377169910
complement(2619)-g, adbSNP:192893142
complement(2622)-g, adbSNP:374422181
complement(2736..2738)-, aatdbSNP:375666941
complement(2769)-g, cdbSNP:116732405
complement(2888)-g, cdbSNP:188158351
complement(2892)-t, cdbSNP:183578733
complement(2894)-t, gdbSNP:369781711
Gene SymbolSLC26A3
Gene SynonymCLD; DRA
Locus Map7q31
All Transcripts
RefSeq Accession Definition Stock Status Price Turnaround time Business Day Select
NM_000111 Homo sapiens solute carrier family 26 (anion exchanger), member 3 (SLC26A3), mRNA. On-demand $279.00 12-14
XM_006715873 PREDICTED: Homo sapiens solute carrier family 26 (anion exchanger), member 3 (SLC26A3), transcript variant X1, mRNA. On-demand $279.00 12-14
Title N-glycosylation and topology of the human SLC26 family of anion transport membrane proteins .
Author Li J, Xia F and Reithmeier RA.
Journal Am. J. Physiol., Cell Physiol. 306 (10), C943-C960 (2014)
Title Sulfate secretion and chloride absorption are mediated by the anion exchanger DRA (Slc26a3) in the mouse cecum .
Author Whittamore JM, Freel RW and Hatch M.
Journal Am. J. Physiol. Gastrointest. Liver Physiol. 305 (2), G172-G184 (2013)
Title Congenital chloride diarrhea in Korean children: novel mutations and genetic characteristics .
Author Hong J, Seo JK, Ko JS, Cheong HI, Choi JH, Lee JH and Seo JW.
Journal Eur. J. Pediatr. 172 (4), 545-550 (2013)
Title SLC26A3 gene analysis in patients with Bartter and Gitelman syndromes and the clinical characteristics of patients with unidentified mutations .
Author Ishimori S, Kaito H, Matsunoshita N, Otsubo H, Hashimoto F, Ninchoji T, Nozu K, Morisada N and Iijima K.
Journal Kobe J Med Sci 59 (2), E36-E43 (2013)
Title Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers .
Author Lauc G, Huffman JE, Pucic M, Zgaga L, Adamczyk B, Muzinic A, Novokmet M, Polasek O, Gornik O, Kristic J, Keser T, Vitart V, Scheijen B, Uh HW, Molokhia M, Patrick AL, McKeigue P, Kolcic I, Lukic IK, Swann O, van Leeuwen FN, Ruhaak LR, Houwing-Duistermaat JJ, Slagboom PE, Beekman M, de Craen AJ, Deelder AM, Zeng Q, Wang W, Hastie ND, Gyllensten U, Wilson JF, Wuhrer M, Wright AF, Rudd PM, Hayward C, Aulchenko Y, Campbell H and Rudan I.
Journal PLoS Genet. 9 (1), E1003225 (2013)
Title Human DRA functions as a sulfate transporter in Sf9 insect cells .
Author Byeon MK, Frankel A, Papas TS, Henderson KW and Schweinfest CW.
Journal Protein Expr. Purif. 12 (1), 67-74 (1998)
Title Mutations of the Down-regulated in adenoma (DRA) gene cause congenital chloride diarrhoea .
Author Hoglund P, Haila S, Socha J, Tomaszewski L, Saarialho-Kere U, Karjalainen-Lindsberg ML, Airola K, Holmberg C, de la Chapelle A and Kere J.
Journal Nat. Genet. 14 (3), 316-319 (1996)
Title Localization of a candidate colon tumor-suppressor gene (DRA) to 7q22-q31.1 by fluorescence in situ hybridization .
Author Taguchi T, Testa JR, Papas TS and Schweinfest C.
Journal Genomics 20 (1), 146-147 (1994)
Title Similarities between a soybean nodulin, Neurospora crassa sulphate permease II and a putative human tumour suppressor .
Author Sandal NN and Marcker KA.
Journal Trends Biochem. Sci. 19 (1), 19 (1994)
Title Identification of a colon mucosa gene that is down-regulated in colon adenomas and adenocarcinomas .
Author Schweinfest CW, Henderson KW, Suster S, Kondoh N and Papas TS.
Journal Proc. Natl. Acad. Sci. U.S.A. 90 (9), 4166-4170 (1993)

Our customer service representatives are available 24 hours a day, Monday through Friday; please contact us anytime for assistance.