• THAT   AND

Sequence in raw or FASTA format:


Blast Method:


Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH1), transcript variant 1, mRNA.

RefSeq Accession Definition Service Stock Status Price *Turnaround time Order
NM_000249 Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH1), transcript variant 1, mRNA. GenEZ ORF Cloning In-stock $639.00 $590.00 15

*Business Day

Related Services

RefSeq Version NM_000249.3, 263191547
Length 2662 bp
Structure linear
Update Date 21-APR-2013
Organism Homo sapiens (human)
Definition Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH1), transcript variant 1, mRNA.
Product DNA mismatch repair protein Mlh1 isoform 1

Summary: This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+phenotype) found in HNPCC. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described, but their full-length natures have not been determined.[provided by RefSeq, Nov 2009].

Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).

RefSeq NP_000240.1
CDS 199..2469
Misc Feature(1)160..162
Misc Feature(2)214..1143
Misc Feature(3)214..1143
Misc Feature(4)289..564
Misc Feature(5)order(298..300,310..312,319..321,379..381,385..387,
Misc Feature(6)310..312
Misc Feature(7)order(391..393,397..399,499..501,505..507)
Misc Feature(8)829..1203
Misc Feature(9)1129..1131
Misc Feature(10)1426..2148
Misc Feature(11)1450..1452
Misc Feature(12)1627..1629
Exon (1)1..314
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (2)315..405
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (3)406..504
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (4)505..578
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (5)579..651
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (6)652..743
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (7)744..786
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (8)787..875
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (9)876..988
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (10)989..1082
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (11)1083..1236
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (12)1237..1607
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (13)1608..1756
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (14)1757..1865
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (15)1866..1929
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (16)1930..2094
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (17)2095..2187
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (18)2188..2301
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (19)2302..2662
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Order your protein of interest with our Guaranteed or It's Free Service now! For details, please click here.
Position Chain Variation Link
99+c, tdbSNP:4647204
106+a, gdbSNP:1800734
157+c, tdbSNP:41285097
166+g, tdbSNP:201247839
171+a, g, tdbSNP:56198082
192+c, tdbSNP:104894994
200+a, g, tdbSNP:111052004
201+a, gdbSNP:72481822
207+, cdbSNP:63750745
213..226+, aggggttattcggcdbSNP:63751891
216..232+, ggttattcggcggctggdbSNP:63751892
217..233+, gttattcggcggctggadbSNP:267607702
229+, cdbSNP:63749816
235+, gdbSNP:63750081
236..237+, cccadbSNP:63750057
237+a, gdbSNP:1800143
242..243+, tdbSNP:63751131
250+, cdbSNP:63749804
253+a, tdbSNP:63750648
259+, gdbSNP:63750581
260+c, tdbSNP:63750706
263+c, gdbSNP:41295280
265+, gdbSNP:63750822
265+g, tdbSNP:63750823
267+a, tdbSNP:63750555
268+, gdbSNP:63751396
271+, adbSNP:63749839
271+a, tdbSNP:63749838
272+c, tdbSNP:63750514
274+, cdbSNP:63749828
274+c, tdbSNP:63749827
278+a, c, gdbSNP:138705565
281+c, tdbSNP:63750792
283+g, tdbSNP:63750656
284+c, gdbSNP:63750216
289..290+gc, tgdbSNP:63749994
292+a, gdbSNP:2020872
299+a, cdbSNP:63750044
300..301+, gadbSNP:63749813
302..303+ac, tgdbSNP:121912965
302+g, tdbSNP:63749906
304..305+, aadbSNP:63750371
305+a, tdbSNP:267607707
307+a, g, tdbSNP:63751012
310+a, c, gdbSNP:63750580
312+c, gdbSNP:267607706
314+a, gdbSNP:63751701
319+c, gdbSNP:267607713
320+a, gdbSNP:63751094
327+, adbSNP:63750867
328+g, tdbSNP:63750939
329..330+, aatcdbSNP:63751431
329+c, tdbSNP:63751109
335+g, tdbSNP:63749833
342+a, cdbSNP:147342421
344+a, tdbSNP:63750098
348..349+, tdbSNP:63749956
352..355+, aaagdbSNP:267607714
352+a, tdbSNP:63751401
354..355+, adbSNP:63750028
355+g, tdbSNP:63751199
356+a, cdbSNP:63750263
359+a, gdbSNP:63751267
359+, gdbSNP:63751266
367+a, tdbSNP:63750877
378+a, gdbSNP:63751398
382+a, c, tdbSNP:63751428
385+a, gdbSNP:63750850
388..389+, aadbSNP:63750469
389..390+, adbSNP:63751255
389+a, gdbSNP:63750952
392+a, gdbSNP:63751465
393+, cdbSNP:267607715
396+c, tdbSNP:61751642
397+a, g, tdbSNP:63750206
398+a, gdbSNP:63749939
400+a, gdbSNP:63750452
401+a, tdbSNP:63750281
403+, adbSNP:63751704
403+a, gdbSNP:63750719
404+a, gdbSNP:63751661
408..411+, agaadbSNP:267607723
408+a, cdbSNP:63751191
409..411+, gaadbSNP:267607724
409+c, g, tdbSNP:63749829
411..413+, agadbSNP:63751642
414+c, tdbSNP:63750621
427+c, tdbSNP:63749859
428+a, gdbSNP:63750437
429..430+, tgdbSNP:63750052
429+a, tdbSNP:63750856
436+g, tdbSNP:63749990
440+c, tdbSNP:63751069
442..443+, adbSNP:267607729
443+c, tdbSNP:63750005
448+a, gdbSNP:63750641
451+c, tdbSNP:63750659
454+c, tdbSNP:63751421
459+, cdbSNP:267607728
459+c, tdbSNP:63750923
462+g, tdbSNP:182963667
463+c, g, tdbSNP:11541859
470+a, tdbSNP:63751137
472+c, gdbSNP:63750133
475+a, gdbSNP:41295282
481+g, tdbSNP:63751070
489+a, tdbSNP:63750651
490+c, g, tdbSNP:267607725
491..502+, gctttcgaggtgdbSNP:63751691
495+a, tdbSNP:267607730
496+c, tdbSNP:63751221
497+a, c, gdbSNP:63750266
499+a, gdbSNP:267607726
500+a, gdbSNP:267607727
501+g, tdbSNP:4647220
502+a, gdbSNP:63750453
504+g, tdbSNP:63751665
509+a, tdbSNP:63751397
516+c, gdbSNP:63750297
518+g, tdbSNP:63750507
525+g, tdbSNP:63749803
530+c, tdbSNP:63750539
536+a, tdbSNP:63750559
539+, cdbSNP:63750645
544..545+, adbSNP:267607739
544+, adbSNP:63750906
545+a, c, gdbSNP:63750465
548+c, g, tdbSNP:63750781
549+a, gdbSNP:61751643
553..554+, aadbSNP:63750658
554..555+, aadbSNP:63750841
557+c, tdbSNP:267607740
565+a, tdbSNP:63750542
573+a, gdbSNP:1800144
574+a, tdbSNP:200076893
575+a, gdbSNP:267607741
576+, cdbSNP:63751607
576+c, g, tdbSNP:63751606
578+a, gdbSNP:63751595
580..600+gcaagttactcagatggaaaa, tdbSNP:267607746
580+c, gdbSNP:63750866
580+, gdbSNP:63750865
583..584+ag, gttdbSNP:63751710
590+a, cdbSNP:63749818
592+c, gdbSNP:28930073
595+g, tdbSNP:63751124
601+c, gdbSNP:63751052
608+c, tdbSNP:63750817
619+c, gdbSNP:63750977
621+a, gdbSNP:201176051
626..627+, cdbSNP:63751045
634+c, tdbSNP:63749820
637+c, gdbSNP:267607747
643+c, tdbSNP:63751302
645+c, gdbSNP:63750638
660+c, tdbSNP:192938577
662+g, tdbSNP:63750891
666..667+, ttdbSNP:267607758
667+, tdbSNP:63751101
669+a, cdbSNP:74396541
670+a, cdbSNP:63751242
672+c, tdbSNP:4647256
677+c, tdbSNP:63749924
686+, gdbSNP:267607754
695+a, tdbSNP:267607755
696+a, cdbSNP:267607757
700..701+, aadbSNP:267607756
701..702+, adbSNP:63749959
704+c, tdbSNP:63750834
711+, adbSNP:63749944
721..722+, agdbSNP:63749799
729..730+at, ct, ggdbSNP:63750903
737+g, tdbSNP:63750102
742+a, gdbSNP:63750211
750+a, tdbSNP:35225190
751+c, gdbSNP:63750012
752+g, tdbSNP:63750515
754+c, tdbSNP:11541862
756+c, tdbSNP:63751050
770+g, tdbSNP:267607766
775+c, tdbSNP:63751021
776+c, gdbSNP:63751480
781+, adbSNP:35847123
784+a, tdbSNP:63750500
786+, adbSNP:63751653
793+c, gdbSNP:63749887
794..795+, agdbSNP:267607704
795..796+, gadbSNP:63751637
805+a, gdbSNP:63750085
824+a, gdbSNP:150478207
830..831+, tdbSNP:63750908
832+a, gdbSNP:149196672
834+c, tdbSNP:138735345
835+a, g, tdbSNP:2308317
842+a, gdbSNP:267607775
845+g, tdbSNP:267607776
847+, cdbSNP:63750380
847+c, tdbSNP:4986984
853+a, c, gdbSNP:1799977
863..864+, adbSNP:63750385
863+, adbSNP:63751286
871..874+, agtcdbSNP:267607774
872+, gdbSNP:63749842
874+c, tdbSNP:63751615
875+a, g, tdbSNP:63751711
881..882+, tdbSNP:63751659
891+c, tdbSNP:63750765
891+, tdbSNP:63750764
893+g, tdbSNP:149302013
895+c, tdbSNP:63751170
899+a, gdbSNP:63750696
900+a, gdbSNP:35908749
915+a, cdbSNP:63749901
925..928+, aatgdbSNP:267607787
929+a, g, tdbSNP:63750303
937+c, g, tdbSNP:63750948
943..944+, gdbSNP:63750819
951+c, tdbSNP:63750310
953+a, cdbSNP:63750198
963+a, gdbSNP:63751276
967+, adbSNP:63750338
974+c, tdbSNP:56250509
976+c, tdbSNP:63750642
977+g, tdbSNP:63751283
982..984+, atcdbSNP:63751623
986+a, cdbSNP:104894997
988+c, g, tdbSNP:63751597
989..992+, atcgdbSNP:267607799
989+a, gdbSNP:63751664
991+a, c, tdbSNP:63751194
992+a, gdbSNP:63751448
1001+a, gdbSNP:63750650
1004+c, gdbSNP:63750691
1006..1009+, acttdbSNP:267607801
1012+g, tdbSNP:63751252
1013+c, tdbSNP:63750584
1022..1023+, aagcdbSNP:63751439
1038+a, tdbSNP:63750938
1040+c, tdbSNP:63749950
1041+a, cdbSNP:146796765
1043+c, gdbSNP:63750360
1046+a, gdbSNP:201931669
1049+a, tdbSNP:63750889
1053+c, tdbSNP:63751154
1054..1055+, tdbSNP:63750212
1054+a, cdbSNP:63750395
1057..1058+, aadbSNP:63750034
1058..1059+, adbSNP:63750814
1059+c, tdbSNP:63750421
1070+, tdbSNP:63750429
1073+c, tdbSNP:63750517
1080+c, tdbSNP:63751707
1081+a, c, gdbSNP:63751598
1082+a, c, gdbSNP:63750144
1085..1086+, tdbSNP:63751620
1085+g, tdbSNP:63750547
1086..1087+, tcctgacagtttdbSNP:63751636
1086+, adbSNP:267607809
1087+g, tdbSNP:63750736
1099+c, tdbSNP:63750489
1106+a, tdbSNP:267607813
1109+a, tdbSNP:63750993
1120..1121+, gcdbSNP:63750962
1123+c, tdbSNP:267607808
1125+a, c, tdbSNP:63749896
1133..1134+, adbSNP:63750319
1137..1138+, adbSNP:63751259
1141+c, tdbSNP:151119913
1147+a, cdbSNP:267607814
1152+, cdbSNP:63749926
1152+c, tdbSNP:146777069
1153+a, g, tdbSNP:63750796
1158+c, gdbSNP:267607811
1160+a, g, tdbSNP:63750286
1169..1177+, agcgggtgcdbSNP:63751404
1172+a, gdbSNP:63750268
1175+c, tdbSNP:63751049
1183+a, cdbSNP:267607810
1184+a, cdbSNP:63750710
1185..1187+, catdbSNP:267607807
1186..1188+, atcdbSNP:63751197
1192+, adbSNP:63750533
1201+c, tdbSNP:267607812
1205+, gdbSNP:63750434
1209..1210+, cdbSNP:63750677
1209+, cdbSNP:63750853
1211+a, gdbSNP:63751467
1215+, cdbSNP:63750339
1217+c, tdbSNP:191257018
1221+, gdbSNP:63749837
1235+a, gdbSNP:63751609
1236+a, c, g, tdbSNP:63751715
1238+a, cdbSNP:201541505
1244..1245+, tdbSNP:267607822
1248+a, gdbSNP:137937003
1254+a, tdbSNP:63750156
1256+c, tdbSNP:63751265
1259+, gdbSNP:63750472
1266..1273+, tggggagadbSNP:63750038
1288+a, gdbSNP:63749864
1299+, cdbSNP:63750715
1301+c, tdbSNP:201673334
1326..1327+, atdbSNP:63750305
1326+c, tdbSNP:267607824
1334+a, gdbSNP:143009528
1339+c, tdbSNP:63750557
1346+c, tdbSNP:141344760
1348+, gdbSNP:63749965
1349+a, tdbSNP:63750447
1351+c, tdbSNP:63750760
1352+a, c, gdbSNP:63750430
1363+a, c, tdbSNP:61751644
1364+a, gdbSNP:63750361
1388+, tdbSNP:63750749
1389+g, tdbSNP:35164771
1390+c, tdbSNP:63750483
1396+c, gdbSNP:63751485
1402+, adbSNP:66839241
1408..1409+, ctdbSNP:63751015
1415+a, gdbSNP:41294980
1423+c, tdbSNP:63751153
1424+a, cdbSNP:104895000
1436+c, tdbSNP:63750766
1444+a, gdbSNP:267607823
1450..1451+, gadbSNP:63751118
1452+a, g, tdbSNP:63751440
1457+c, gdbSNP:63751179
1459+, adbSNP:63750293
1464+c, tdbSNP:63750791
1474+c, tdbSNP:63750316
1495+c, gdbSNP:63750443
1502+c, tdbSNP:63751414
1508+, cdbSNP:63750748
1519+a, gdbSNP:63750365
1525+a, cdbSNP:34213726
1532+, adbSNP:63749845
1541+, adbSNP:63749981
1552+, adbSNP:63750071
1552+a, tdbSNP:34285587
1558+c, gdbSNP:63750527
1560..1561+, gdbSNP:267607821
1571+a, tdbSNP:63750390
1575..1576+, adbSNP:63750020
1577+a, cdbSNP:202038499
1578..1579+, tdbSNP:267607697
1579+a, tdbSNP:63750540
1581+c, g, tdbSNP:63751293
1590+c, tdbSNP:63750201
1596+, cdbSNP:63750713
1600+a, gdbSNP:267607820
1602..1603+, cdbSNP:68171484
1604+c, tdbSNP:63750932
1608..1611+, aaagdbSNP:267607828
1609..1612+, aagadbSNP:63751592
1610..1611+, adbSNP:63751677
1611..1614+, gagadbSNP:281864936
1611+a, gdbSNP:63750616
1612..1613+, adbSNP:63751468
1613..1614+, gadbSNP:281864937
1613+g, tdbSNP:63750498
1618+, cdbSNP:63750482
1618+c, g, tdbSNP:147939838
1619+a, gdbSNP:63751083
1651+c, gdbSNP:63750314
1653+a, tdbSNP:63750956
1657+c, tdbSNP:63749795
1661+, adbSNP:63749876
1669+, adbSNP:63751014
1672+a, gdbSNP:63751145
1685+c, g, tdbSNP:63750226
1687..1688+, cdbSNP:63751031
1687+, cdbSNP:63750855
1687+c, tdbSNP:200830026
1689+, gdbSNP:63751435
1695+, gdbSNP:63749793
1697..1699+, tcadbSNP:63751146
1705+c, tdbSNP:145679961
1715+c, tdbSNP:63749909
1718..1719+, tdbSNP:63749916
1723+c, tdbSNP:267607829
1726+c, tdbSNP:63749923
1732+g, tdbSNP:63751472
1740..1741+, tdbSNP:63750317
1741+a, gdbSNP:63750746
1747+g, tdbSNP:63751705
1752..1753+, tdbSNP:63751689
1759+a, cdbSNP:63751688
1762+c, tdbSNP:63751703
1763+g, tdbSNP:63751630
1767+g, tdbSNP:63751680
1771..1772+, ttdbSNP:63751613
1771+c, tdbSNP:63750137
1774+c, tdbSNP:63751281
1789..1790+, gtdbSNP:63750076
1794+c, tdbSNP:63750000
1807+c, tdbSNP:63751277
1812+a, gdbSNP:267607842
1814+a, cdbSNP:267607843
1818..1819+, ggdbSNP:63750036
1820+, cdbSNP:63750824
1822+c, tdbSNP:63750192
1823+a, c, tdbSNP:63750511
1828+c, tdbSNP:63750413
1831+a, gdbSNP:267607840
1838+a, tdbSNP:63750300
1842+c, gdbSNP:63751087
1844+c, tdbSNP:63750289
1847+c, tdbSNP:63750193
1850+a, cdbSNP:63750271
1854..1856+, cacdbSNP:267607841
1856..1858+, ccadbSNP:63751641
1862..1863+, aagtdbSNP:267607699
1864+a, gdbSNP:63751633
1865+g, tdbSNP:63751596
1867+g, tdbSNP:63751244
1870+g, tdbSNP:63751081
1874+g, tdbSNP:63750059
1879+c, tdbSNP:267607847
1881+c, gdbSNP:63751393
1882+c, tdbSNP:63751460
1887..1888+, adbSNP:63750464
1888..1891+, ctcadbSNP:267607849
1891+a, tdbSNP:63750062
1900+a, tdbSNP:267607848
1909+c, tdbSNP:267607846
1915..1916+, gtdbSNP:63751709
1919+c, tdbSNP:63751608
1923+, gdbSNP:63751685
1928+c, tdbSNP:56185292
1929+a, gdbSNP:63751657
1931+a, gdbSNP:63751612
1940+c, tdbSNP:63751684
1942+c, g, tdbSNP:63751713
1943+c, tdbSNP:63751616
1947+, tdbSNP:63750309
1952+g, tdbSNP:267607865
1954+c, gdbSNP:63751176
1955..1956+, g, tdbSNP:267607695
1955+a, cdbSNP:63750587
1956+, cdbSNP:63749863
1957+a, gdbSNP:267607862
1961+c, tdbSNP:63750575
1962+, tdbSNP:63751486
1964+a, cdbSNP:63750016
1967..1970+, tagadbSNP:63750147
1967+, tdbSNP:63749979
1970..1973+, atagdbSNP:63749868
1976..1977+, cadbSNP:63750375
1981..1982+, agdbSNP:63750035
1986+c, tdbSNP:267607863
1988+a, gdbSNP:63750604
1997+a, gdbSNP:267607861
2000+a, gdbSNP:63750718
2006+c, gdbSNP:63750876
2008+a, tdbSNP:63750386
2010..2011+, adbSNP:63751240
2018+a, tdbSNP:41295284
2020+a, gdbSNP:147928948
2021+a, cdbSNP:267607864
2029..2030+, atdbSNP:63750150
2030+c, tdbSNP:141688321
2032..2034+, gttdbSNP:267607859
2033..2035+, ttgdbSNP:63750486
2044..2046+, aagdbSNP:121912962
2049..2051+, gaadbSNP:267607858
2050..2052+, aagdbSNP:63751247
2050..2051+aa, gcdbSNP:35502531
2050+a, g, tdbSNP:35001569
2051+a, c, gdbSNP:63750449
2053+c, gdbSNP:267607866
2053+, gdbSNP:63749986
2063+a, c, tdbSNP:63750693
2070+c, tdbSNP:145535636
2073+g, tdbSNP:63751415
2075..2081+, tctctttdbSNP:63751594
2075+, tdbSNP:63750152
2076+c, tdbSNP:63751214
2077..2080+, tcttdbSNP:267607860
2077+a, tdbSNP:63750846
2082..2086+, ggaaadbSNP:63751639
2090+a, cdbSNP:63750240
2094+a, gdbSNP:63751632
2094+, gdbSNP:63751631
2095+, gdbSNP:63751643
2098+a, gdbSNP:63750830
2102+a, gdbSNP:63751270
2103+c, gdbSNP:63751047
2105+c, tdbSNP:63750825
2106+a, gdbSNP:1800145
2110+a, g, tdbSNP:63750549
2114+g, tdbSNP:63750079
2115+a, gdbSNP:63750935
2116+c, tdbSNP:63749792
2117+c, tdbSNP:267607875
2122..2123+, ctdbSNP:63750884
2135+a, gdbSNP:35045067
2137+a, gdbSNP:63750109
2140+c, tdbSNP:63750899
2141+c, tdbSNP:63750610
2144..2146+, cttdbSNP:281864939
2144+, cdbSNP:281864938
2151..2154+, gggadbSNP:63751301
2156+g, tdbSNP:63751202
2157+g, tdbSNP:1800146
2159+c, tdbSNP:63750726
2161+a, gdbSNP:55907433
2162+c, tdbSNP:63751225
2165+c, tdbSNP:267607876
2169+, tdbSNP:63750115
2173..2174+, cgdbSNP:63750131
2173+c, tdbSNP:63751310
2174..2175+, gadbSNP:63751200
2174+a, c, g, tdbSNP:63749900
2186+, adbSNP:267607877
2186+a, c, gdbSNP:63751682
2187+a, g, tdbSNP:63751662
2194+c, tdbSNP:267607887
2196+a, gdbSNP:63750639
2198..2199+, adbSNP:63750282
2198+a, gdbSNP:63751162
2199+c, tdbSNP:63750014
2200+a, gdbSNP:63750292
2204..2208+, aaaagdbSNP:63750061
2207+, adbSNP:63750740
2209+g, tdbSNP:63750663
2225+g, tdbSNP:63750242
2236+c, g, tdbSNP:63750809
2238+a, c, tdbSNP:63749867
2239+a, gdbSNP:63750217
2240+c, tdbSNP:63750864
2249+a, gdbSNP:267607886
2257+c, tdbSNP:63751275
2263+a, cdbSNP:41542214
2264+a, gdbSNP:63750702
2265..2271+, gtacatadbSNP:63750420
2269+a, gdbSNP:201748079
2274..2275+, tgdbSNP:63750769
2278+g, tdbSNP:147542208
2279..2280+, tdbSNP:267607698
2279+a, cdbSNP:145565670
2282+a, cdbSNP:63749995
2283+a, gdbSNP:191505871
2290..2291+, tcdbSNP:63750859
2297..2300+, agcadbSNP:63751652
2299+a, c, tdbSNP:63750114
2301+c, gdbSNP:63750603
2302..2303+, agdbSNP:63751651
2316+c, tdbSNP:1800147
2332+a, tdbSNP:267607909
2333+a, gdbSNP:63750561
2334+a, gdbSNP:63750499
2339+a, gdbSNP:63751022
2340+a, gdbSNP:63750978
2344+a, gdbSNP:35831931
2350+c, tdbSNP:2020873
2352..2353+, cadbSNP:63750971
2352+c, tdbSNP:1800148
2353..2354+, atgtgttccaca, cadbSNP:281864940
2361+a, tdbSNP:63750484
2364..2365+, tataaadbSNP:63751075
2368+a, tdbSNP:63749875
2370+a, gdbSNP:146519039
2371+c, g, tdbSNP:138584384
2377..2380+, cacadbSNP:267607898
2377..2378+, cadbSNP:267607905
2378+a, tdbSNP:104895002
2380+a, tdbSNP:143279525
2383+c, gdbSNP:1800149
2388..2389+, aacadbSNP:267607902
2392+a, tdbSNP:267607906
2395..2396+, aaacdbSNP:267607899
2396..2397+, aacadbSNP:267607903
2408+a, tdbSNP:267607885
2411+a, gdbSNP:148317871
2421..2431+, gcagcttgctadbSNP:267607897
2422+, cdbSNP:267607896
2444+a, c, tdbSNP:267607894
2448+c, gdbSNP:267607893
2450..2451+, aadbSNP:267607907
2450+a, gdbSNP:140195825
2451..2452+, aadbSNP:267607901
2460+, gdbSNP:267607904
2461+a, tdbSNP:267607900
2463+c, gdbSNP:267607895
2467..2468+, tdbSNP:267607892
2469+a, tdbSNP:267607908
2484+g, tdbSNP:75682204
2490+g, tdbSNP:79406218
2499..2501+, gaa, ttcdbSNP:200919928
2499+, ttcdbSNP:72299848
2501+c, tdbSNP:200903126
2501+, cttdbSNP:55711899
2504..2506+, cttdbSNP:193922366
2570+g, tdbSNP:1803985
2606+a, tdbSNP:267607910
2627..2630+, gattdbSNP:201518804
2627+, gattdbSNP:2234891
2638..2641+, aatadbSNP:56329536
Gene SymbolMLH1
Gene SynonymCOCA2; FCC2; hMLH1; HNPCC; HNPCC2
Locus Map3p21.3
All Transcripts
RefSeq Accession Definition Stock Status Price Turnaround time Business Day Select
NM_000249 Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH1), transcript variant 1, mRNA. In-stock $639.00 $590.00 15
NM_001167617 Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH1), transcript variant 2, mRNA. On-demand $849.00 20
NM_001167618 Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH1), transcript variant 3, mRNA. In-stock $509.00 $460.00 12
NM_001167619 Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH1), transcript variant 4, mRNA. In-stock $509.00 $460.00 12
NM_001258271 Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH1), transcript variant 5, mRNA. On-demand $849.00 20
NM_001258273 Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH1), transcript variant 6, mRNA. In-stock $509.00 $460.00 12
NM_001258274 Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH1), transcript variant 7, mRNA. In-stock $509.00 $460.00 12
Title Human mismatch repair protein hMutLalpha is required to repair short slipped-DNAs of trinucleotide repeats .
Author Panigrahi,G.B., Slean,M.M., Simard,J.P. and Pearson,C.E.
Journal J. Biol. Chem. 287 (50), 41844-41850 (2012)
Title Demethylation of the region around exon 2 of MLH1 gene in gastrointestinal cancer .
Author Tang,Y., Liu,C., Wang,X., Liu,D., Ingvarsson,S. and Chen,H.
Journal Anticancer Res. 32 (11), 4861-4864 (2012)
Title DNA mismatch repair deficiency in breast carcinoma: a pilot study of triple-negative and non-triple-negative tumors .
Author Wen,Y.H., Brogi,E., Zeng,Z., Akram,M., Catalano,J., Paty,P.B., Norton,L. and Shia,J.
Journal Am. J. Surg. Pathol. 36 (11), 1700-1708 (2012)
Title Evaluation of MLH1 I219V polymorphism in unrelated South American individuals suspected of having Lynch syndrome .
Author Valentin,M.D., Da Silva,F.C., Santos,E.M., Da Silva,S.D., De Oliveira Ferreira,F., Aguiar Junior,S., Gomy,I., Vaccaro,C., Redal,M.A., Della Valle,A., Sarroca,C., Rasmussen,L.J., Carraro,D.M. and Rossi,B.M.
Journal Anticancer Res. 32 (10), 4347-4351 (2012)
Title Promoter methylation status of DNA repair gene (hMLH1) in gastric carcinoma patients of the Kashmir valley .
Author Wani,M., Afroze,D., Makhdoomi,M., Hamid,I., Wani,B., Bhat,G., Wani,R. and Wani,K.
Journal Asian Pac. J. Cancer Prev. 13 (8), 4177-4181 (2012)
Title Founding mutations and Alu-mediated recombination in hereditary colon cancer .
Author Nystrom-Lahti,M., Kristo,P., Nicolaides,N.C., Chang,S.Y., Aaltonen,L.A., Moisio,A.L., Jarvinen,H.J., Mecklin,J.P., Kinzler,K.W., Vogelstein,B. et al.
Journal Nat. Med. 1 (11), 1203-1206 (1995)
Title Alternative splicing of MLH1 messenger RNA in human normal cells .
Author Charbonnier,F., Martin,C., Scotte,M., Sibert,L., Moreau,V. and Frebourg,T.
Journal Cancer Res. 55 (9), 1839-1841 (1995)
Title Clinicopathological relevance of the association between gastrointestinal and sebaceous neoplasms: the Muir-Torre syndrome .
Author Paraf,F., Sasseville,D., Watters,A.K., Narod,S., Ginsburg,O., Shibata,H. and Jothy,S.
Journal Hum. Pathol. 26 (4), 422-427 (1995)
Title The molecular basis of Turcot's syndrome .
Author Hamilton,S.R., Liu,B., Parsons,R.E., Papadopoulos,N., Jen,J., Powell,S.M., Krush,A.J., Berk,T., Cohen,Z., Tetu,B. et al.
Journal N. Engl. J. Med. 332 (13), 839-847 (1995)
Title Genomic structure of human mismatch repair gene, hMLH1, and its mutation analysis in patients with hereditary non-polyposis colorectal cancer (HNPCC) .
Author Han,H.J., Maruyama,M., Baba,S., Park,J.G. and Nakamura,Y.
Journal Hum. Mol. Genet. 4 (2), 237-242 (1995)

Our customer service representatives are available 24 hours a day, Monday through Friday; please contact us anytime for assistance.

Learn more about the GenEZ ORF Cloning Service.