• THAT   AND

Sequence in raw or FASTA format:


Blast Method:


Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA.

Clone ID Definition Vector Stock Status Price *Turnaround time Select
OHu26603 Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA. pcDNA3.1+-DYK In-stock Starting from $99 5-7
OHu26603M Mutant Clone for Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA. pcDNA3.1+-DYK In-stock Starting from $149 Additional 5 days
OHu26603CM Mutant Clone for Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA. Your vector of choice In-stock Starting from $149 Additional 5 days

*Business Day

Related Services

Sequence Information ORF Nucleotide Sequence
Protein sequence
Vector pcDNA3.1+-DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+-DYK N terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
RefSeq Version NM_000249.3, 263191547
Length 2271 bp
Structure linear
Update Date 25-MAY-2014
Organism Homo sapiens (human)
Definition Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA.
Product DNA mismatch repair protein Mlh1 isoform 1

Summary: This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+phenotype) found in HNPCC. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described, but their full-length natures have not been determined.[provided by RefSeq, Nov 2009].

Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).

RefSeq NP_000240.1
CDS 199..2469
Misc Feature(1)160..162
Misc Feature(2)202..204
Misc Feature(3)202..204
Misc Feature(4)214..1143
Misc Feature(5)289..564
Misc Feature(6)order(298..300,310..312,319..321,379..381,385..387,
Misc Feature(7)310..312
Misc Feature(8)order(391..393,397..399,499..501,505..507)
Misc Feature(9)829..1203
Misc Feature(10)1129..1131
Misc Feature(11)1426..2148
Misc Feature(12)1450..1452
Misc Feature(13)1627..1629
Exon (1)1..314
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (2)315..405
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (3)406..504
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (4)505..578
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (5)579..651
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (6)652..743
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (7)744..786
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (8)787..875
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (9)876..988
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (10)989..1082
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (11)1083..1236
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (12)1237..1607
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (13)1608..1756
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (14)1757..1865
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (15)1866..1929
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (16)1930..2094
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (17)2095..2187
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (18)2188..2301
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Exon (19)2302..2662
Gene Synonym:COCA2; FCC2; hMLH1; HNPCC; HNPCC2
Order your protein of interest with our Guaranteed or It's Free Service now! For details, please click here.
Position Chain Variation Link
81+a, gdbSNP:372252588
99+c, tdbSNP:4647204
106+a, gdbSNP:1800734
157+c, tdbSNP:41285097
166+g, tdbSNP:201247839
171+a, g, tdbSNP:56198082
192+c, tdbSNP:104894994
200+a, g, tdbSNP:111052004
201+a, gdbSNP:72481822
207+, cdbSNP:63750745
213..226+, aggggttattcggcdbSNP:63751891
216..232+, ggttattcggcggctggdbSNP:63751892
217..233+, gttattcggcggctggadbSNP:267607702
229+, cdbSNP:63749816
235+, gdbSNP:63750081
236..237+, cccadbSNP:63750057
237+a, gdbSNP:1800143
240+a, cdbSNP:369737664
242..243+, tdbSNP:63751131
250+, cdbSNP:63749804
250+c, tdbSNP:367654552
253+a, tdbSNP:63750648
259+, gdbSNP:63750581
260+c, tdbSNP:63750706
263+c, gdbSNP:41295280
265+, gdbSNP:63750822
265+g, tdbSNP:63750823
267+a, tdbSNP:63750555
268+, gdbSNP:63751396
271+, adbSNP:63749839
271+a, tdbSNP:63749838
272+c, tdbSNP:63750514
274+, cdbSNP:63749828
274+c, tdbSNP:63749827
278+a, c, gdbSNP:138705565
281+c, tdbSNP:63750792
283+g, tdbSNP:63750656
284+c, gdbSNP:63750216
289..290+gc, tgdbSNP:63749994
292+a, gdbSNP:2020872
299+a, cdbSNP:63750044
300..301+, gadbSNP:63749813
302..303+ac, tgdbSNP:121912965
302+g, tdbSNP:63749906
304..305+, aadbSNP:63750371
305+a, c, tdbSNP:267607707
307+a, g, tdbSNP:63751012
310+a, c, gdbSNP:63750580
312+c, gdbSNP:267607706
314+a, gdbSNP:63751701
319+c, gdbSNP:267607713
320+a, gdbSNP:63751094
327+, adbSNP:63750867
328+g, tdbSNP:63750939
329..330+, aatcdbSNP:63751431
329+c, tdbSNP:63751109
335+g, tdbSNP:63749833
342+a, cdbSNP:147342421
344+a, tdbSNP:63750098
348..349+, tdbSNP:63749956
352..355+, aaagdbSNP:267607714
352+a, tdbSNP:63751401
354..355+, adbSNP:63750028
355+g, tdbSNP:63751199
356+a, cdbSNP:63750263
359+a, gdbSNP:63751267
359+, gdbSNP:63751266
367+a, tdbSNP:63750877
378+a, gdbSNP:63751398
382+a, c, tdbSNP:63751428
385+a, gdbSNP:63750850
388..389+, aadbSNP:63750469
389..390+, adbSNP:63751255
389+a, gdbSNP:63750952
392+a, gdbSNP:63751465
393+, cdbSNP:267607715
396+c, tdbSNP:61751642
397+a, g, tdbSNP:63750206
398+a, gdbSNP:63749939
400+a, gdbSNP:63750452
401+a, tdbSNP:63750281
403+, adbSNP:63751704
403+a, gdbSNP:63750719
404+a, gdbSNP:63751661
408..411+, agaadbSNP:267607723
408+a, cdbSNP:63751191
409..411+, gaadbSNP:267607724
409+c, g, tdbSNP:63749829
411..413+, agadbSNP:63751642
414+c, tdbSNP:63750621
416+g, tdbSNP:397514684
427+c, tdbSNP:63749859
428+a, gdbSNP:63750437
429..430+, tgdbSNP:63750052
429+a, tdbSNP:63750856
436+g, tdbSNP:63749990
440+c, tdbSNP:63751069
442..443+, adbSNP:267607729
443+c, tdbSNP:63750005
448+a, gdbSNP:63750641
451+c, tdbSNP:63750659
454+c, tdbSNP:63751421
459+, cdbSNP:267607728
459+c, tdbSNP:63750923
462+g, tdbSNP:182963667
463+c, g, tdbSNP:11541859
470+a, tdbSNP:63751137
472+c, gdbSNP:63750133
475+a, gdbSNP:41295282
481+g, tdbSNP:63751070
489+a, tdbSNP:63750651
complement(490)-t, g, cdbSNP:267607725
491..502+, gctttcgaggtgdbSNP:63751691
495+a, tdbSNP:267607730
496+c, tdbSNP:63751221
497+a, c, gdbSNP:63750266
499+a, gdbSNP:267607726
500+a, gdbSNP:267607727
501+g, tdbSNP:4647220
502+a, gdbSNP:63750453
504+g, tdbSNP:63751665
509+a, tdbSNP:63751397
515+a, gdbSNP:368208495
516+c, gdbSNP:63750297
518+g, tdbSNP:63750507
525+g, tdbSNP:63749803
530+c, tdbSNP:63750539
536+a, tdbSNP:63750559
539+, cdbSNP:63750645
541+a, gdbSNP:371667663
544..545+, adbSNP:267607739
544+, adbSNP:63750906
545+a, c, gdbSNP:63750465
548+c, g, tdbSNP:63750781
549+a, gdbSNP:61751643
553..554+, aadbSNP:63750658
554..555+, aadbSNP:63750841
557+c, tdbSNP:267607740
565+a, tdbSNP:63750542
573+a, gdbSNP:1800144
574+a, tdbSNP:200076893
575+a, gdbSNP:267607741
576+, cdbSNP:63751607
576+c, g, tdbSNP:63751606
578+a, gdbSNP:63751595
580..600+gcaagttactcagatggaaaa, tdbSNP:267607746
580+c, gdbSNP:63750866
580+, gdbSNP:63750865
583..584+ag, gttdbSNP:63751710
590+a, cdbSNP:63749818
592+c, gdbSNP:28930073
595+g, tdbSNP:63751124
601+c, gdbSNP:63751052
608+c, tdbSNP:63750817
619+c, gdbSNP:63750977
621+a, gdbSNP:201176051
626..627+, cdbSNP:63751045
634+c, tdbSNP:63749820
636+a, gdbSNP:377279035
637+c, gdbSNP:267607747
643+c, tdbSNP:63751302
645+c, gdbSNP:63750638
651+a, gdbSNP:369521379
660+c, tdbSNP:192938577
662+g, tdbSNP:63750891
666..667+, ttdbSNP:267607758
667+, tdbSNP:63751101
complement(669)-c, adbSNP:74396541
670+a, cdbSNP:63751242
672+c, tdbSNP:4647256
673+a, gdbSNP:370900909
677+c, tdbSNP:63749924
686+, gdbSNP:267607754
695+a, tdbSNP:267607755
696+a, cdbSNP:267607757
700..701+, aadbSNP:267607756
701..702+, adbSNP:63749959
704+c, tdbSNP:63750834
711+, adbSNP:63749944
721..722+, agdbSNP:63749799
729..730+at, ct, ggdbSNP:63750903
737+g, tdbSNP:63750102
742+a, gdbSNP:63750211
750+a, tdbSNP:35225190
751+c, gdbSNP:63750012
752+g, tdbSNP:63750515
754+c, tdbSNP:11541862
756+c, tdbSNP:63751050
770+g, tdbSNP:267607766
775+c, tdbSNP:63751021
776+c, gdbSNP:63751480
781+, adbSNP:35847123
784+a, tdbSNP:63750500
786+, adbSNP:63751653
793+c, gdbSNP:63749887
794..795+, agdbSNP:267607704
795..796+, gadbSNP:63751637
805+a, gdbSNP:63750085
824+a, gdbSNP:150478207
830..831+, tdbSNP:63750908
834+c, tdbSNP:138735345
835+a, g, tdbSNP:2308317
842+a, gdbSNP:267607775
845+g, tdbSNP:267607776
847+, cdbSNP:63750380
847+c, tdbSNP:4986984
853+a, c, gdbSNP:1799977
863..864+, adbSNP:63750385
863+, adbSNP:63751286
871..874+, agtcdbSNP:267607774
872+, gdbSNP:63749842
874+c, tdbSNP:63751615
875+a, g, tdbSNP:63751711
881..882+, tdbSNP:63751659
891+c, tdbSNP:63750765
891+, tdbSNP:63750764
893+g, tdbSNP:149302013
895+c, tdbSNP:63751170
899+a, gdbSNP:63750696
900+a, gdbSNP:35908749
915+a, cdbSNP:63749901
925..928+, aatgdbSNP:267607787
929+a, g, tdbSNP:63750303
937+c, g, tdbSNP:63750948
943..944+, gdbSNP:63750819
951+c, tdbSNP:63750310
953+a, cdbSNP:63750198
963+a, gdbSNP:63751276
967+, adbSNP:63750338
974+c, tdbSNP:56250509
976+c, tdbSNP:63750642
977+g, tdbSNP:63751283
982..984+, atcdbSNP:63751623
986+a, cdbSNP:104894997
988+c, g, tdbSNP:63751597
989..992+, atcgdbSNP:267607799
989+a, gdbSNP:63751664
991+a, c, tdbSNP:63751194
992+a, gdbSNP:63751448
1001+a, gdbSNP:63750650
1004+c, gdbSNP:63750691
1006..1009+, acttdbSNP:267607801
1006+a, gdbSNP:371302926
1012+g, tdbSNP:63751252
1013+c, tdbSNP:63750584
1022..1023+, aagcdbSNP:63751439
1038+a, tdbSNP:63750938
1040+c, tdbSNP:63749950
1041+a, cdbSNP:146796765
1043+c, gdbSNP:63750360
1046+a, gdbSNP:201931669
1049+a, tdbSNP:63750889
1053+c, tdbSNP:63751154
1054..1055+, tdbSNP:63750212
1054+a, cdbSNP:63750395
1057..1058+, aadbSNP:63750034
1058..1059+, adbSNP:63750814
1059+c, tdbSNP:63750421
1070+, tdbSNP:63750429
1073+c, tdbSNP:63750517
1080+c, tdbSNP:63751707
1081+a, c, gdbSNP:63751598
1082+a, c, gdbSNP:63750144
1085..1086+, tdbSNP:63751620
1085+g, tdbSNP:63750547
1086..1087+, tcctgacagtttdbSNP:63751636
1086+, adbSNP:267607809
1087+g, tdbSNP:63750736
1099+c, tdbSNP:63750489
1106+a, tdbSNP:267607813
1109+a, tdbSNP:63750993
1120..1121+, gcdbSNP:63750962
1123+c, tdbSNP:267607808
1125+a, c, tdbSNP:63749896
1133..1134+, adbSNP:63750319
1137..1138+, adbSNP:63751259
1141+c, tdbSNP:151119913
1147+a, cdbSNP:267607814
1152+, cdbSNP:63749926
1152+c, tdbSNP:146777069
1153+a, g, tdbSNP:63750796
1158+c, gdbSNP:267607811
1160+a, g, tdbSNP:63750286
1169..1177+, agcgggtgcdbSNP:63751404
1172+a, gdbSNP:63750268
1175+c, tdbSNP:63751049
1183+a, cdbSNP:267607810
1184+a, cdbSNP:63750710
1185..1187+, catdbSNP:267607807
1186..1188+, atcdbSNP:63751197
1188+c, tdbSNP:372578171
1192+, adbSNP:63750533
1201+c, tdbSNP:267607812
1205+, gdbSNP:63750434
1209..1210+, cdbSNP:63750677
1209+, cdbSNP:63750853
1211+a, gdbSNP:63751467
1215+, cdbSNP:63750339
1217+c, tdbSNP:191257018
1218+c, gdbSNP:374770981
1221+, gdbSNP:63749837
1235+a, gdbSNP:63751609
1236+a, c, g, tdbSNP:63751715
1238+a, cdbSNP:201541505
1244..1245+, tdbSNP:267607822
1248+a, gdbSNP:137937003
1254+a, tdbSNP:63750156
1256+c, tdbSNP:63751265
1259+, gdbSNP:63750472
1266..1273+, tggggagadbSNP:63750038
1288+a, gdbSNP:63749864
1299+, cdbSNP:63750715
1301+c, tdbSNP:201673334
1326..1327+, atdbSNP:63750305
1326+c, tdbSNP:267607824
1334+a, gdbSNP:143009528
1339+c, tdbSNP:63750557
1346+c, tdbSNP:141344760
1348+, gdbSNP:63749965
1349+a, tdbSNP:63750447
1351+c, tdbSNP:63750760
1352+a, c, gdbSNP:63750430
1363+a, c, tdbSNP:61751644
1364+a, gdbSNP:63750361
1388+, tdbSNP:63750749
1389+g, tdbSNP:35164771
1390+c, tdbSNP:63750483
1396+c, gdbSNP:63751485
1408..1409+, ctdbSNP:63751015
1415+a, gdbSNP:41294980
1423+c, tdbSNP:63751153
1424+a, c, gdbSNP:104895000
1434+c, tdbSNP:369576099
1436+c, tdbSNP:63750766
1441+a, gdbSNP:373767220
1444+a, gdbSNP:267607823
1450..1451+, gadbSNP:63751118
1452+a, g, tdbSNP:63751440
1454+c, tdbSNP:377484262
1457+c, gdbSNP:63751179
1459+, adbSNP:63750293
1464+c, tdbSNP:63750791
1466+a, gdbSNP:370687064
1467+a, gdbSNP:373076967
1468+a, gdbSNP:377433038
1474+c, tdbSNP:63750316
1495+c, gdbSNP:63750443
1502+c, tdbSNP:63751414
1508+, cdbSNP:63750748
1519+a, gdbSNP:63750365
1525+a, cdbSNP:34213726
1532+, adbSNP:63749845
1541+, adbSNP:63749981
1552+, adbSNP:63750071
1552+a, tdbSNP:34285587
1558+c, gdbSNP:63750527
1560..1561+, gdbSNP:267607821
1571+a, tdbSNP:63750390
1575..1576+, adbSNP:63750020
1577+a, cdbSNP:202038499
1578..1579+, tdbSNP:267607697
1579+a, tdbSNP:63750540
1581+c, g, tdbSNP:63751293
1590+c, tdbSNP:63750201
1596+, cdbSNP:63750713
1600+a, gdbSNP:267607820
1604+c, tdbSNP:63750932
1608..1611+, aaagdbSNP:267607828
1609..1612+, aagadbSNP:63751592
1610..1611+, adbSNP:63751677
1611..1614+, gagadbSNP:281864936
1611+a, gdbSNP:63750616
1612..1613+, adbSNP:63751468
1613..1614+, gadbSNP:281864937
1613+g, tdbSNP:63750498
1618+, cdbSNP:63750482
1618+c, g, tdbSNP:147939838
1619+a, gdbSNP:63751083
1643+c, tdbSNP:376642306
1651+c, gdbSNP:63750314
1653+a, tdbSNP:63750956
1657+c, tdbSNP:63749795
1661+, adbSNP:63749876
1669+, adbSNP:63751014
1672+a, gdbSNP:63751145
1685+c, g, tdbSNP:63750226
1687..1688+, cdbSNP:63751031
1687+, cdbSNP:63750855
1687+c, tdbSNP:200830026
1689+, gdbSNP:63751435
1695+, gdbSNP:63749793
1697..1699+, tcadbSNP:63751146
1705+c, tdbSNP:145679961
1715+c, tdbSNP:63749909
1718..1719+, tdbSNP:63749916
1723+c, tdbSNP:267607829
1726+c, tdbSNP:63749923
1732+g, tdbSNP:63751472
1740..1741+, tdbSNP:63750317
1741+a, gdbSNP:63750746
1747+g, tdbSNP:63751705
1749+a, gdbSNP:373322226
1752..1753+, tdbSNP:63751689
1759+a, cdbSNP:63751688
1762+c, tdbSNP:63751703
1763+g, tdbSNP:63751630
1767+g, tdbSNP:63751680
1771..1772+, ttdbSNP:63751613
1771+c, tdbSNP:63750137
1774+c, tdbSNP:63751281
1789..1790+, gtdbSNP:63750076
1794+c, tdbSNP:63750000
1807+c, tdbSNP:63751277
1812+a, gdbSNP:267607842
1814+a, cdbSNP:267607843
1818..1819+, ggdbSNP:63750036
1820+, cdbSNP:63750824
1822+c, tdbSNP:63750192
1823+a, c, tdbSNP:63750511
1828+c, tdbSNP:63750413
1831+a, gdbSNP:267607840
1838+a, tdbSNP:63750300
1842+c, gdbSNP:63751087
1844+c, tdbSNP:63750289
1847+c, tdbSNP:63750193
1850+a, cdbSNP:63750271
1854..1856+, cacdbSNP:267607841
1856..1858+, ccadbSNP:63751641
1862..1863+, aagtdbSNP:267607699
1864+a, gdbSNP:63751633
1865+g, tdbSNP:63751596
1867+g, tdbSNP:63751244
1870+g, tdbSNP:63751081
1874+g, tdbSNP:63750059
1879+c, tdbSNP:267607847
1881+c, gdbSNP:63751393
1882+c, tdbSNP:63751460
1887..1888+, adbSNP:63750464
1888..1891+, ctcadbSNP:267607849
1891+a, tdbSNP:63750062
1900+a, tdbSNP:267607848
1907+a, gdbSNP:375853155
1909+c, tdbSNP:267607846
1915..1916+, gtdbSNP:63751709
1919+c, tdbSNP:63751608
1923+, gdbSNP:63751685
1928+c, tdbSNP:56185292
1929+a, gdbSNP:63751657
1931+a, gdbSNP:63751612
1940+c, tdbSNP:63751684
1942+c, g, tdbSNP:63751713
1943+c, tdbSNP:63751616
1947+, tdbSNP:63750309
1952+g, tdbSNP:267607865
1954+c, gdbSNP:63751176
1955..1956+, tdbSNP:267607695
1955+a, cdbSNP:63750587
1956..1957+, cdbSNP:367543283
1956+, cdbSNP:63749863
1957+a, gdbSNP:267607862
1961+c, tdbSNP:63750575
1962+, tdbSNP:63751486
1964+a, cdbSNP:63750016
1967..1970+, tagadbSNP:63750147
1967+, tdbSNP:63749979
1970..1973+, atagdbSNP:63749868
1976..1977+, cadbSNP:63750375
1981..1982+, agdbSNP:63750035
1986+c, tdbSNP:267607863
1988+a, gdbSNP:63750604
1997+a, gdbSNP:267607861
2000+a, gdbSNP:63750718
2006+c, gdbSNP:63750876
2008+a, tdbSNP:63750386
2010..2011+, adbSNP:63751240
2018+a, tdbSNP:41295284
2020+a, gdbSNP:147928948
2021+a, cdbSNP:267607864
2029..2030+, atdbSNP:63750150
2030+c, tdbSNP:141688321
2032..2034+, gttdbSNP:267607859
2033..2035+, ttgdbSNP:63750486
2044..2046+, aagdbSNP:121912962
2049..2051+, gaadbSNP:267607858
2050..2052+, aagdbSNP:63751247
2050..2051+aa, gcdbSNP:35502531
2050+a, g, tdbSNP:35001569
2051+a, c, gdbSNP:63750449
2053+c, gdbSNP:267607866
2053+, gdbSNP:63749986
2063+a, c, tdbSNP:63750693
2070+c, tdbSNP:145535636
2073+g, tdbSNP:63751415
2074+c, tdbSNP:377241633
2075..2081+, tctctttdbSNP:63751594
2075+, tdbSNP:63750152
2076+c, tdbSNP:63751214
2077..2080+, tcttdbSNP:267607860
2077+a, tdbSNP:63750846
2082..2086+, ggaaadbSNP:63751639
2090+a, cdbSNP:63750240
2094+a, gdbSNP:63751632
2094+, gdbSNP:63751631
2095+, gdbSNP:63751643
2098+a, gdbSNP:63750830
2100+a, gdbSNP:376866470
2102+a, gdbSNP:63751270
2103+c, gdbSNP:63751047
2105+c, tdbSNP:63750825
2106+a, gdbSNP:1800145
2110+a, g, tdbSNP:63750549
2114+g, tdbSNP:63750079
2115+a, gdbSNP:63750935
2116+c, tdbSNP:63749792
2117+c, tdbSNP:267607875
2122..2123+, ctdbSNP:63750884
2135+a, gdbSNP:35045067
2137+a, gdbSNP:63750109
2140+c, tdbSNP:63750899
2141+c, tdbSNP:63750610
2144..2146+, cttdbSNP:281864939
2144+, cdbSNP:281864938
2151..2154+, gggadbSNP:63751301
2156+g, tdbSNP:63751202
2157+g, tdbSNP:1800146
2159+c, tdbSNP:63750726
2161+a, gdbSNP:55907433
2162+c, tdbSNP:63751225
2165+c, tdbSNP:267607876
2169+, tdbSNP:63750115
2173..2174+, cgdbSNP:63750131
2173+c, tdbSNP:63751310
2174..2175+, gadbSNP:63751200
2174+a, c, g, tdbSNP:63749900
2186+, adbSNP:267607877
2186+a, c, gdbSNP:63751682
2187+a, g, tdbSNP:63751662
2194+c, tdbSNP:267607887
2196+a, gdbSNP:63750639
2198..2199+, adbSNP:63750282
2198+a, gdbSNP:63751162
2199+c, tdbSNP:63750014
2200+a, gdbSNP:63750292
2204..2208+, aaaagdbSNP:63750061
2207+, adbSNP:63750740
2209+g, tdbSNP:63750663
2225+g, tdbSNP:63750242
2236+c, g, tdbSNP:63750809
2238+a, c, tdbSNP:63749867
2239+a, gdbSNP:63750217
2240+c, tdbSNP:63750864
2249+a, gdbSNP:267607886
2257+c, tdbSNP:63751275
2263+a, cdbSNP:41542214
2264+a, gdbSNP:63750702
2265..2271+, gtacatadbSNP:63750420
2269+a, gdbSNP:201748079
2274..2275+, tgdbSNP:63750769
2278+g, tdbSNP:147542208
2279..2280+, tdbSNP:267607698
2279+a, cdbSNP:145565670
2282+a, cdbSNP:63749995
2283+a, gdbSNP:191505871
2290..2291+, tcdbSNP:63750859
2297..2300+, agcadbSNP:63751652
2299+a, c, tdbSNP:63750114
2301+c, gdbSNP:63750603
2302..2303+, agdbSNP:63751651
2316+c, tdbSNP:1800147
2332+a, tdbSNP:267607909
2333+a, gdbSNP:63750561
2334+a, gdbSNP:63750499
2339+a, gdbSNP:63751022
2340+a, gdbSNP:63750978
2344+a, gdbSNP:35831931
2350+c, tdbSNP:2020873
2352..2353+, cadbSNP:63750971
2352+c, tdbSNP:1800148
2353..2354+, atgtgttccaca, cadbSNP:281864940
2361+a, tdbSNP:63750484
2364..2365+, tataaadbSNP:63751075
2368+a, tdbSNP:63749875
2371+c, tdbSNP:138584384
2377..2380+, cacadbSNP:267607898
2377..2378+, cadbSNP:267607905
2378+a, tdbSNP:104895002
2383+c, gdbSNP:1800149
2388..2389+, aacadbSNP:267607902
2392+a, tdbSNP:267607906
2395..2396+, aaacdbSNP:267607899
2396..2397+, aacadbSNP:267607903
2403+a, cdbSNP:371263535
2408+a, tdbSNP:267607885
2411+a, gdbSNP:148317871
2421..2431+, gcagcttgctadbSNP:267607897
2422+, cdbSNP:267607896
2440+c, gdbSNP:374380262
2444+a, c, tdbSNP:267607894
2448+c, gdbSNP:267607893
2450..2451+, aadbSNP:267607907
2450+a, gdbSNP:140195825
2451..2452+, aadbSNP:267607901
2460+, gdbSNP:267607904
2461+a, tdbSNP:267607900
2463+c, gdbSNP:267607895
2467..2468+, tdbSNP:267607892
2469+a, tdbSNP:267607908
complement(2484)-t, gdbSNP:75682204
2490+g, tdbSNP:79406218
complement(2499..2501)-, ttc, gaadbSNP:200919928
2501..2503+, cttdbSNP:281875167
2501+c, tdbSNP:200903126
2504..2506+, cttdbSNP:193922366
2570+g, tdbSNP:1803985
2606+a, tdbSNP:267607910
2627..2630+, gattdbSNP:201518804
2631..2632+, gattdbSNP:201866587
2631..2632+, gattdbSNP:386561998
2642..2645+, aatadbSNP:56329536
2660+c, tdbSNP:368443548
Gene SymbolMLH1
Gene SynonymCOCA2; FCC2; hMLH1; HNPCC; HNPCC2
Locus Map3p21.3
All Transcripts
RefSeq Accession Definition Stock Status Price Turnaround time Business Day Select
NM_000249 Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA. In-stock $99.00 5-7
NM_000249 Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA. In-stock $99.00 5-7
NM_000249 Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA. In-stock $99.00 5-7
NM_000249 Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA. In-stock $99.00 5-7
NM_000249 Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA. In-stock $99.00 5-7
NM_000249 Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA. In-stock $99.00 5-7
NM_000249 Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA. In-stock $99.00 5-7
NM_000249 Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA. In-stock $99.00 5-7
NM_000249 Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA. In-stock $99.00 5-7
NM_000249 Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA. In-stock $99.00 5-7
NM_000249 Homo sapiens mutL homolog 1 (MLH1), transcript variant 1, mRNA. In-stock $99.00 5-7
Title Mismatch repair protein expression in 1049 endometrial carcinomas, associations with body mass index, and other clinicopathologic variables .
Author Joehlin-Price AS, Perrino CM, Stephens J, Backes FJ, Goodfellow PJ, Cohn DE and Suarez AA.
Journal Gynecol. Oncol. 133 (1), 43-47 (2014)
Title Tumor mismatch repair immunohistochemistry and DNA MLH1 methylation testing of patients with endometrial cancer diagnosed at age younger than 60 years optimizes triage for population-level germline mismatch repair gene mutation testing .
Author Buchanan DD, Tan YY, Walsh MD, Clendenning M, Metcalf AM, Ferguson K, Arnold ST, Thompson BA, Lose FA, Parsons MT, Walters RJ, Pearson SA, Cummings M, Oehler MK, Blomfield PB, Quinn MA, Kirk JA, Stewart CJ, Obermair A, Young JP, Webb PM and Spurdle AB.
Journal J. Clin. Oncol. 32 (2), 90-100 (2014)
Title GLI1 interferes with the DNA mismatch repair system in pancreatic cancer through BHLHE41-mediated suppression of MLH1 .
Author Inaguma S, Riku M, Hashimoto M, Murakami H, Saga S, Ikeda H and Kasai K.
Journal Cancer Res. 73 (24), 7313-7323 (2013)
Title Excess of extracolonic non-endometrial multiple primary cancers in MSH2 germline mutation carriers over MLH1 .
Author Lin-Hurtubise KM, Yheulon CG, Gagliano RA Jr and Lynch HT.
Journal J Surg Oncol 108 (7), 433-437 (2013)
Title Expression of genes responsible for the repair of mispaired bases of the DNA (MLH1) in invasive ductal breast carcinoma .
Author Milanovic R, Stanec S, Stanec M, Korusic A, Husedzinovic I and Razumovic JJ.
Journal Coll Antropol 37 (3), 929-935 (2013)
Title Founding mutations and Alu-mediated recombination in hereditary colon cancer .
Author Nystrom-Lahti M, Kristo P, Nicolaides NC, Chang SY, Aaltonen LA, Moisio AL, Jarvinen HJ, Mecklin JP, Kinzler KW and Vogelstein B.
Journal Nat. Med. 1 (11), 1203-1206 (1995)
Title Alternative splicing of MLH1 messenger RNA in human normal cells .
Author Charbonnier F, Martin C, Scotte M, Sibert L, Moreau V and Frebourg T.
Journal Cancer Res. 55 (9), 1839-1841 (1995)
Title Clinicopathological relevance of the association between gastrointestinal and sebaceous neoplasms: the Muir-Torre syndrome .
Author Paraf F, Sasseville D, Watters AK, Narod S, Ginsburg O, Shibata H and Jothy S.
Journal Hum. Pathol. 26 (4), 422-427 (1995)
Title The molecular basis of Turcot's syndrome .
Author Hamilton SR, Liu B, Parsons RE, Papadopoulos N, Jen J, Powell SM, Krush AJ, Berk T, Cohen Z and Tetu B.
Journal N. Engl. J. Med. 332 (13), 839-847 (1995)
Title Lynch Syndrome .
Author Kohlmann,W. and Gruber,S.B.
Journal (in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)

Our customer service representatives are available 24 hours a day, Monday through Friday; please contact us anytime for assistance.