• THAT   AND

Sequence in raw or FASTA format:


Blast Method:


Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA.

Clone ID Definition Vector Stock Status Price *Turnaround time Select
OHu20874 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. pcDNA3.1+-DYK In-stock Starting from $99 7-9
OHu20874C Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. Your vector of choice In-stock Starting from $99 7-9
OHu20874M Mutant Clone for Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. pcDNA3.1+-DYK In-stock Starting from $149 Additional 5 days
OHu20874CM Mutant Clone for Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. Your vector of choice In-stock Starting from $149 Additional 5 days

*Business Day

Sequence Information ORF Nucleotide Sequence
Protein sequence
Vector pcDNA3.1+-DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+-DYK N terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
RefSeq Version NM_002121.5, 334688863
Length 777 bp
Structure linear
Update Date 04-MAY-2014
Organism Homo sapiens (human)
Definition Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA.
Product HLA class II histocompatibility antigen, DP beta 1 chain precursor

Summary: HLA-DPB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DPA) and a beta chain (DPB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DP molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to 4 different molecules. [provided by RefSeq, Jul 2008].

Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

RefSeq NP_002112.3
CDS 117..893
Misc Feature(1)57..59
Misc Feature(2)57..59
Misc Feature(3)204..479
Misc Feature(4)243..455
Misc Feature(5)480..761
Misc Feature(6)486..767
Misc Feature(7)order(501..503,555..560,564..566,642..665)
Misc Feature(8)540..758
Misc Feature(9)order(564..566,648..656,660..662)
Misc Feature(10)762..791
Misc Feature(11)792..854
Exon (1)1..216
Gene Synonym:DPB1; HLA-DP; HLA-DP1B; HLA-DPB
Exon (2)217..480
Gene Synonym:DPB1; HLA-DP; HLA-DP1B; HLA-DPB
Exon (3)481..762
Gene Synonym:DPB1; HLA-DP; HLA-DP1B; HLA-DPB
Exon (4)763..873
Gene Synonym:DPB1; HLA-DP; HLA-DP1B; HLA-DPB
Exon (5)874..897
Gene Synonym:DPB1; HLA-DP; HLA-DP1B; HLA-DPB
Exon (6)898..4055
Gene Synonym:DPB1; HLA-DP; HLA-DP1B; HLA-DPB
Order your protein of interest with our Guaranteed or It's Free Service now! For details, please click here.
Position Chain Variation Link
91+c, tdbSNP:144456909
102+c, tdbSNP:146638354
103+c, gdbSNP:149181738
140+a, gdbSNP:41540314
163+c, tdbSNP:41558014
167+a, gdbSNP:146214653
176+a, gdbSNP:376742482
187+c, tdbSNP:11551416
197+c, tdbSNP:139072161
225..229+ctttt, gtgca, gtgtadbSNP:386699868
225+c, gdbSNP:1126504
226+c, tdbSNP:202176660
227+g, tdbSNP:1126506
228+c, g, tdbSNP:12722013
229+a, tdbSNP:1126509
231+c, tdbSNP:79389600
234..235+gg, ttdbSNP:386699869
234+g, tdbSNP:1126511
235+g, tdbSNP:1126513
238+g, tdbSNP:41540313
251+c, tdbSNP:188627284
252+a, c, gdbSNP:41555313
285+g, tdbSNP:41553416
297+a, cdbSNP:41545716
298+c, gdbSNP:41561114
300+c, gdbSNP:12722018
302+a, gdbSNP:41555423
306+c, tdbSNP:9277348
307+a, tdbSNP:1042117
308+c, tdbSNP:41555415
310+c, tdbSNP:1042121
318+g, tdbSNP:77062860
330+g, tdbSNP:41552915
332+a, gdbSNP:12722022
337+a, tdbSNP:145190720
343+a, cdbSNP:147611944
349+c, gdbSNP:200784721
351+c, gdbSNP:200055547
352+a, tdbSNP:200572113
361+g, tdbSNP:201374258
367..368+ag, ctdbSNP:386699870
367+a, c, tdbSNP:707958
368+c, g, tdbSNP:9277351
370+a, cdbSNP:1042131
371+a, c, gdbSNP:80330773
374+c, gdbSNP:1042133
375+c, tdbSNP:114493737
381+a, cdbSNP:41550319
393+c, gdbSNP:41560812
396+a, c, tdbSNP:1042136
399+c, tdbSNP:41547418
402+g, tdbSNP:41553216
405+c, gdbSNP:199865386
406+a, gdbSNP:201237929
408+a, c, g, tdbSNP:1042140
409+a, gdbSNP:12722027
411+c, tdbSNP:41554314
413+g, tdbSNP:41560217
417+g, tdbSNP:41546618
419+g, tdbSNP:41556420
421+c, tdbSNP:41551920
422+g, tdbSNP:377295463
425+c, tdbSNP:61759928
429..431+atg, gtadbSNP:386699871
429+a, gdbSNP:1042151
430+c, tdbSNP:111596796
431+a, gdbSNP:1042153
454+a, g, tdbSNP:1042169
456..457+, adbSNP:141530233
461..462+ca, gdbSNP:386699872
462+, adbSNP:202162010
470+a, gdbSNP:41542615
475+a, gdbSNP:41541915
476+c, tdbSNP:41563418
490+a, gdbSNP:1126537
497+c, tdbSNP:1126541
517+a, gdbSNP:61736937
522+a, c, g, tdbSNP:1042187
547+a, gdbSNP:61736936
557+a, gdbSNP:1042212
571+a, gdbSNP:61736935
574+a, gdbSNP:140447065
586+a, gdbSNP:368841277
590+c, gdbSNP:61736934
620+g, tdbSNP:372905365
668+c, tdbSNP:376906908
673+a, tdbSNP:61736938
702+c, gdbSNP:144181653
704+c, tdbSNP:1042331
712+c, tdbSNP:1042335
731+c, tdbSNP:370864722
735+a, cdbSNP:14362
740+c, tdbSNP:1071597
752+c, tdbSNP:41559424
766+c, tdbSNP:143091535
768+c, tdbSNP:148208390
783+c, tdbSNP:142745911
784+a, c, g, tdbSNP:9276
784+a, gdbSNP:397701590
794+a, cdbSNP:376840874
800+a, gdbSNP:137879953
811+a, gdbSNP:199834306
complement(816)-t, cdbSNP:11551421
847+a, c, tdbSNP:3097675
847+c, tdbSNP:397839652
878+a, gdbSNP:150818884
886+c, tdbSNP:201552902
892+, adbSNP:67523850
907..937+cctcaccgaaaagactaatgtgccttagaac, gctcactgaaaagactattgtgccttaggaadbSNP:386699892
907+c, gdbSNP:1126719
907+c, gdbSNP:1139559
907+c, gdbSNP:386479334
913+c, tdbSNP:1126723
913+c, tdbSNP:1139560
924+a, tdbSNP:1042448
924+a, tdbSNP:1062618
935..937+aac, gaadbSNP:386699893
935+a, gdbSNP:9277522
937+a, cdbSNP:9277523
955..996+cgttagcatctggctccaggacagaccttcaacttccaaatt, tgttagcacctggttccaggacagaccctcagcttcccaagadbSNP:386699894
955+c, tdbSNP:1042467
955+c, tdbSNP:397808521
956+a, gdbSNP:3749984
960+a, gdbSNP:6760
960+a, gdbSNP:113779453
963+c, tdbSNP:1042488
963+c, tdbSNP:1062621
968+c, tdbSNP:1042497
968+c, tdbSNP:397724348
982+c, tdbSNP:1042502
982+c, tdbSNP:397769878
986+a, gdbSNP:1042507
986+a, gdbSNP:397772884
992+a, cdbSNP:1042508
992+a, cdbSNP:397791200
995+g, tdbSNP:1042511
995+g, tdbSNP:397688234
996+a, tdbSNP:1042516
996+a, tdbSNP:397701400
complement(1003)-c, adbSNP:34087328
1003+g, tdbSNP:113390552
1015+c, gdbSNP:3749985
1015+c, gdbSNP:397840445
1039+a, gdbSNP:1042544
1045+c, tdbSNP:114068468
complement(1064)-c, adbSNP:11551420
1101+c, tdbSNP:1042644
1132..1134+aag, gacdbSNP:386699895
1132+a, gdbSNP:931
1132+a, gdbSNP:397830691
1134+c, gdbSNP:928
1134+c, gdbSNP:397717650
1137+c, tdbSNP:186748908
1141+c, tdbSNP:1042634
1141+c, tdbSNP:112596157
1161+c, tdbSNP:935
1161+c, tdbSNP:397748581
1168+a, gdbSNP:932
1177+c, tdbSNP:933
1182..1186+, ttctcdbSNP:144401610
1183..1187+, tctctdbSNP:3833672
1191+a, gdbSNP:1014
1201+a, gdbSNP:929
1209+a, gdbSNP:367833675
1238+a, cdbSNP:930
1241+a, gdbSNP:934
1241+a, gdbSNP:397840446
1257+c, gdbSNP:9277529
1258+a, cdbSNP:143935385
1265+a, gdbSNP:9277530
1269+a, gdbSNP:9277531
1293+g, tdbSNP:9277532
1303+c, tdbSNP:9277533
1353+c, gdbSNP:375176024
1389+a, gdbSNP:9277534
1409+a, gdbSNP:148631508
1443+a, gdbSNP:9277535
1457+c, gdbSNP:142130667
1467+a, tdbSNP:115991335
1472+c, tdbSNP:9277536
1506+g, tdbSNP:3097677
1591+a, cdbSNP:9277537
1616+c, tdbSNP:372571124
1629..1661+atagacgtcatttgtcgtctaagtctgcattca, gtagacgtcatttgtcgtctaagtctgcattcgdbSNP:386699897
1629+a, gdbSNP:9277538
1661+a, gdbSNP:9277539
1680+c, tdbSNP:9501255
1694+a, gdbSNP:3097678
1705+a, gdbSNP:9277540
1740+a, gdbSNP:9277541
1768..1769+, tttdbSNP:67703005
1779+, cdbSNP:9280312
1779+c, tdbSNP:72500564
1809+c, tdbSNP:375342014
1829+c, tdbSNP:9277542
1862..1864+, ttcdbSNP:139610109
1864+c, tdbSNP:367734650
1870+c, tdbSNP:73740309
1876+a, gdbSNP:9277543
1890+c, tdbSNP:9277544
1892+c, tdbSNP:3097679
1892+c, tdbSNP:140259177
1905+c, tdbSNP:9277545
1928+g, tdbSNP:9277546
1937+a, gdbSNP:9501257
1937+a, gdbSNP:77250633
1942+a, gdbSNP:9501258
1942+a, gdbSNP:114394575
1949+a, cdbSNP:9277547
1972+c, tdbSNP:9277548
2001+a, gdbSNP:9277549
2022+a, gdbSNP:200599840
2053+c, gdbSNP:146520390
2069+c, tdbSNP:9277550
2076+g, tdbSNP:9277551
2076+g, tdbSNP:386621313
2081+a, tdbSNP:112119417
2083+c, tdbSNP:9277552
2098+c, tdbSNP:9277553
2120..2133+cacagacttgggcg, tacagacttgggcadbSNP:386699898
2120+c, tdbSNP:9277554
2133+a, gdbSNP:9501259
2187+a, gdbSNP:9277555
2251..2253+, cttdbSNP:376017737
2302..2303+, cdbSNP:112170964
2303..2304+, cdbSNP:60460211
2305..2306+, cdbSNP:369472644
2307+g, tdbSNP:192449683
2362+c, tdbSNP:3128963
2400+a, gdbSNP:3128964
2424..2427+, tttadbSNP:202073495
2426..2429+, tatcdbSNP:5875436
2426..2427+, tatcdbSNP:201709182
2426..2427+, tatcdbSNP:386600214
2427+a, gdbSNP:77339491
2481+a, gdbSNP:3128965
2502+a, gdbSNP:116508234
2528+a, gdbSNP:3128966
2598+c, gdbSNP:140975703
complement(2651)-t, cdbSNP:3117229
2678+c, tdbSNP:62407982
2679+a, g, tdbSNP:3128967
2702+g, tdbSNP:150147034
2710+c, tdbSNP:138605898
2713+c, tdbSNP:367967323
2728+a, gdbSNP:58649023
2742..2743+, acdbSNP:374289517
2789+c, tdbSNP:3130186
2835+a, tdbSNP:3128968
complement(2838)-g, cdbSNP:148951134
2956+a, gdbSNP:3128969
2966+a, gdbSNP:9461832
2978..2979+, gdbSNP:11440264
2979..2980+, gdbSNP:9282413
2981..2982+, gdbSNP:370425045
2987+c, tdbSNP:3130187
complement(3017)-c, adbSNP:3117228
3138+c, tdbSNP:371575614
3148+c, tdbSNP:3091281
3232+c, tdbSNP:9501260
3235+c, tdbSNP:368192351
3267+c, tdbSNP:35717031
3267+c, tdbSNP:79441029
3276+c, tdbSNP:9277557
3293+c, tdbSNP:9277558
3313+c, tdbSNP:9277559
3320+c, gdbSNP:9277560
3331+c, tdbSNP:9277561
3344..3348+caaca, tgatgdbSNP:386699899
3344+c, tdbSNP:9277562
3345..3348+aaca, gatgdbSNP:386699900
3345+a, gdbSNP:9277563
3346+a, gdbSNP:111656434
3347+c, tdbSNP:9277564
complement(3348)-t, c, adbSNP:3117227
3348+c, tdbSNP:386579729
3370+a, gdbSNP:9296075
3372+a, gdbSNP:143732348
3422+c, tdbSNP:9296076
3479+c, tdbSNP:9277565
3498+g, tdbSNP:9277566
3521+a, gdbSNP:116233905
3544+c, tdbSNP:3097649
3547+c, tdbSNP:373781933
3572+c, tdbSNP:9501262
3576+c, gdbSNP:73743105
3595+a, cdbSNP:9277567
3608+c, gdbSNP:184799022
3635+c, tdbSNP:376534841
3636..3637+, ttdbSNP:66953188
3637+c, tdbSNP:9277568
3638..3639+, ttdbSNP:370163351
3663+c, gdbSNP:35824566
3686+c, tdbSNP:73743106
3696+a, gdbSNP:112303369
3706+a, gdbSNP:116633358
3713+c, tdbSNP:73743107
complement(3717)-g, adbSNP:138293641
3758+c, tdbSNP:3130188
3763+c, tdbSNP:372822875
complement(3780)-g, cdbSNP:3091282
3795+c, tdbSNP:3091283
3814+c, tdbSNP:3128970
3826+g, tdbSNP:3091284
3905+a, gdbSNP:181449363
3932+c, tdbSNP:9296077
3933+a, gdbSNP:9501263
3945+a, cdbSNP:9296078
4022+c, tdbSNP:3097650
Gene SymbolHLA-DPB1
Locus Map6p21.3
All Transcripts
RefSeq Accession Definition Stock Status Price Turnaround time Business Day Select
NM_002121 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. In-stock $159.00 7-9
NM_002121 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. In-stock $159.00 7-9
NM_002121 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. In-stock $159.00 7-9
NM_002121 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. In-stock $159.00 7-9
NM_002121 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. In-stock $159.00 7-9
NM_002121 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. In-stock $159.00 7-9
NM_002121 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. In-stock $159.00 7-9
NM_002121 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. In-stock $159.00 7-9
NM_002121 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. In-stock $159.00 7-9
NM_002121 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. In-stock $159.00 7-9
NM_002121 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. In-stock $159.00 7-9
NM_002121 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. In-stock $159.00 7-9
NM_002121 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. In-stock $159.00 7-9
NM_002121 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. In-stock $159.00 7-9
NM_002121 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA. In-stock $159.00 7-9
Title A novel family of human leukocyte antigen class II receptors may have its origin in archaic human species .
Author Temme S, Zacharias M, Neumann J, Wohlfromm S, Konig A, Temme N, Springer S, Trowsdale J and Koch N.
Journal J. Biol. Chem. 289 (2), 639-653 (2014)
Title HLA-DPB1*04:01 allele is associated with non-obstructive azoospermia in Japanese patients .
Author Jinam TA, Nakaoka H, Hosomichi K, Mitsunaga S, Okada H, Tanaka A, Tanaka K and Inoue I.
Journal Hum. Genet. 132 (12), 1405-1411 (2013)
Title A genome-wide association study in Han Chinese identifies a susceptibility locus for primary Sjogren's syndrome at 7q11.23 .
Author Li Y, Zhang K, Chen H, Sun F, Xu J, Wu Z, Li P, Zhang L, Du Y, Luan H, Li X, Wu L, Li H, Wu H, Li X, Li X, Zhang X, Gong L, Dai L, Sun L, Zuo X, Xu J, Gong H, Li Z, Tong S, Wu M, Li X, Xiao W, Wang G, Zhu P, Shen M, Liu S, Zhao D, Liu W, Wang Y, Huang C, Jiang Q, Liu G, Liu B, Hu S, Zhang W, Zhang Z, You X, Li M, Hao W, Zhao C, Leng X, Bi L, Wang Y, Zhang F, Shi Q, Qi W, Zhang X, Jia Y, Su J, Li Q, Hou Y, Wu Q, Xu D, Zheng W, Zhang M, Wang Q, Fei Y, Zhang X, Li J, Jiang Y, Tian X, Zhao L, Wang L, Zhou B, Li Y, Zhao Y, Zeng X, Ott J, Wang J and Zhang F.
Journal Nat. Genet. 45 (11), 1361-1365 (2013)
Title A genome-wide association study identified new variants associated with the risk of chronic hepatitis B .
Author Kim,Y.J., Kim,H.Y., Lee,J.H., Yu,S.J., Yoon,J.H., Lee,H.S., Kim,C.Y., Cheong,J.Y., Cho,S.W., Park,N.H., Park,B.L., Namgoong,S., Kim,L.H., Cheong,H.S. and Shin,H.D.
Journal Hum. Mol. Genet. 22 (20), 4233-4238 (2013)
Title Correlation between human leukocyte antigen class II alleles and .
Author Moss AJ, Gaughran FP, Karasu A, Gilbert AS, Mann AJ, Gelder CM, Oxford JS, Stephens HA and Lambkin-Williams R.
Journal PLoS ONE 8 (8), E71376 (2013)
Title HLA class II nucleotide sequences, 1992 .
Author Marsh SG and Bodmer JG.
Journal Tissue Antigens 40 (5), 229-243 (1992)
Title A novel HLA-DPB1 sequence, DPB1*2301 .
Author Eiermann TH, Uhl S, Fakler J and Goldmann SF.
Journal Tissue Antigens 40 (2), 108-110 (1992)
Title Family study on HLA-DPB1 polymorphism: linkage analysis with HLA-DR/DQ and two 'new' alleles .
Author Mitsunaga S, Kuwata S, Tokunaga K, Uchikawa C, Takahashi K, Akaza T, Mitomi Y and Juji T.
Journal Hum. Immunol. 34 (3), 203-211 (1992)
Title A new HLA-DPB1 allele from a patient with systemic lupus erythematosus .
Author Korioth F, Hartung K, Deicher H and Frey J.
Journal Tissue Antigens 39 (4), 216-219 (1992)
Title Positive correlation between oligonucleotide typing and T-cell recognition of HLA-DP molecules .
Author de Koster HS, Kenter MJ, D'Amaro J, Luiten RM, Schroeijers WE, Giphart MJ and Termijtelen A.
Journal Immunogenetics 34 (1), 12-22 (1991)

Our customer service representatives are available 24 hours a day, Monday through Friday; please contact us anytime for assistance.