• THAT   AND

Sequence in raw or FASTA format:


Blast Method:


Homo sapiens mediator complex subunit 12 (MED12), mRNA.

RefSeq Accession Definition Service Stock Status Price *Turnaround time Order
NM_005120 Homo sapiens mediator complex subunit 12 (MED12), mRNA. GenEZ ORF Cloning On-demand $TBD TBD

*Business Day

Related Services

RefSeq Version NM_005120.2, 110347428
Length 6985 bp
Structure linear
Update Date 17-APR-2013
Organism Homo sapiens (human)
Definition Homo sapiens mediator complex subunit 12 (MED12), mRNA.
Product mediator of RNA polymerase II transcription subunit 12

Summary: The initiation of transcription is controlled in part by a large protein assembly known as the preinitiation complex. A component of this preinitiation complex is a 1.2 MDa protein aggregate called Mediator. This Mediator component binds with a CDK8 subcomplex which contains the protein encoded by this gene, mediator complex subunit 12 (MED12), along with MED13, CDK8 kinase, and cyclin C. The CDK8 subcomplex modulates Mediator-polymerase II interactions and thereby regulates transcription initiation and reinitation rates. The MED12 protein is essential for activating CDK8 kinase. Defects in this gene cause X-linked Opitz-Kaveggia syndrome, also known as FG syndrome, and Lujan-Fryns syndrome. [provided by RefSeq, Aug 2009].

RefSeq NP_005111.2
CDS 200..6733
Misc Feature(1)500..682
Misc Feature(2)500..682
Misc Feature(3)695..697
Misc Feature(4)1052..2470
Misc Feature(5)2102..2104
Misc Feature(6)2102..2104
Misc Feature(7)3971..3973
Misc Feature(8)4004..4006
Misc Feature(9)5045..6352
Misc Feature(10)5648..6259
Exon (1)1..298
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (2)299..403
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (3)404..595
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (4)596..752
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (5)753..934
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (6)935..1045
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (7)1046..1300
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (8)1301..1447
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (9)1448..1547
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (10)1548..1684
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (11)1685..1816
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (12)1817..1943
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (13)1944..2173
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (14)2174..2254
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (15)2255..2425
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (16)2426..2570
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (17)2571..2621
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (18)2622..2740
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (19)2741..2884
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (20)2885..3048
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (21)3049..3180
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (22)3181..3408
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (23)3409..3553
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (24)3554..3674
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (25)3675..3776
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (26)3777..3890
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (27)3891..4066
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (28)4067..4246
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (29)4247..4318
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (30)4319..4452
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (31)4453..4614
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (32)4615..4726
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (33)4727..4816
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (34)4817..4926
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (35)4927..5062
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (36)5063..5224
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (37)5225..5599
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (38)5600..5750
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (39)5751..5947
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (40)5948..6025
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (41)6026..6243
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (42)6244..6466
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (43)6467..6607
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (44)6608..6689
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Exon (45)6690..6969
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Order your protein of interest with our Guaranteed or It's Free Service now! For details, please click here.
Position Chain Variation Link
302..337+, gaactgacggccttgaatgtaaaacaaggtttcaatdbSNP:199469678
306..310+gc, tgacgdbSNP:199469679
306+g, tdbSNP:199469667
310..354+, ggccttgaatgtaaaacaaggtttcaataaccagcctgctgtctcdbSNP:199469681
312..320+, ccttgaatgdbSNP:199469682
316..321+, gaatgtdbSNP:199469683
317..345+aatgtaaaacaaggtttcaataaccagcc, ttdbSNP:199469685
317..333+aatgtaaaacaaggttt, tadbSNP:199469680
317..331+, aatgtaaaacaaggtdbSNP:199469684
321..362+, taaaacaaggtttcaataaccagcctgctgtctctggggatgdbSNP:199469687
321..347+, taaaacaaggtttcaataaccagcctgdbSNP:199469686
322..351+, aaaacaaggtttcaataaccagcctgctgtdbSNP:199469688
325..339+, acaaggtttcaataadbSNP:199469690
325..330+, acaaggdbSNP:199469689
327+a, cdbSNP:199469668
328..342+, aggtttcaataaccadbSNP:199469692
328..336+, aggtttcaadbSNP:199469691
329+a, c, g, tdbSNP:199469669
330+a, c, g, tdbSNP:199469672
332..343+, ttcaataaccagdbSNP:199469693
348..362+, ctgtctctggggatgdbSNP:199469694
505+c, tdbSNP:2471968
580+a, gdbSNP:202125318
583+a, gdbSNP:201566660
637+c, tdbSNP:35068602
836+a, gdbSNP:200333229
907+a, gdbSNP:34668206
1061..1062+, gdbSNP:35454896
1108+a, gdbSNP:184426039
1523+c, gdbSNP:5981075
1552..1553+, cdbSNP:36079314
1585+g, tdbSNP:186153976
1629+c, tdbSNP:75527463
1894+a, tdbSNP:138984044
1901+g, tdbSNP:188593863
2094+a, gdbSNP:199582086
2155+c, tdbSNP:199873151
2167+a, gdbSNP:201473962
2211+a, gdbSNP:5937067
2371+c, tdbSNP:187478018
2378+a, gdbSNP:192331892
2458+a, gdbSNP:61752446
2507+a, gdbSNP:199860580
3080+c, tdbSNP:80338758
3085+a, gdbSNP:34761462
3188+c, tdbSNP:2503120
3219+a, gdbSNP:80338759
3310+a, gdbSNP:185658730
3403+c, tdbSNP:201807437
3422+g, tdbSNP:41303701
3696+a, tdbSNP:2503121
3898+a, gdbSNP:184162709
3984+a, gdbSNP:202120461
4129+a, cdbSNP:5030619
4141+c, tdbSNP:3810670
4227+a, gdbSNP:201044355
4314+a, gdbSNP:202009066
4374+a, gdbSNP:1139013
4459+c, tdbSNP:34299769
4834+c, tdbSNP:151316557
5287+a, gdbSNP:202167558
5466+c, tdbSNP:201843482
5709+c, gdbSNP:200328506
5734+a, gdbSNP:34784349
5783+c, tdbSNP:200279192
5849+a, gdbSNP:147354926
5907+a, cdbSNP:7473655
5910+c, tdbSNP:200663107
5911+a, gdbSNP:189962028
6004+c, tdbSNP:201608537
6271+a, tdbSNP:200692655
6349+, gcadbSNP:77728008
6434+a, gdbSNP:200820997
6440+, cagdbSNP:76330205
6529+a, tdbSNP:80213780
6539..6540+, agcaacaccagdbSNP:5030620
6547+c, gdbSNP:79912241
6922+c, gdbSNP:190398158
Gene SymbolMED12
Gene SynonymARC240; CAGH45; FGS1; HOPA; MED12S; OKS; OPA1; TNRC11; TRAP230
Locus MapXq13
All Transcripts
RefSeq Accession Definition Stock Status Price Turnaround time Business Day Select
NM_005120 Homo sapiens mediator complex subunit 12 (MED12), mRNA. On-demand TBD TBD
Title MED12 mutations link intellectual disability syndromes with dysregulated GLI3-dependent Sonic Hedgehog signaling .
Author Zhou,H., Spaeth,J.M., Kim,N.H., Xu,X., Friez,M.J., Schwartz,C.E. and Boyer,T.G.
Journal Proc. Natl. Acad. Sci. U.S.A. 109 (48), 19763-19768 (2012)
Title MED12 controls the response to multiple cancer drugs through regulation of TGF-beta receptor signaling .
Author Huang,S., Holzel,M., Knijnenburg,T., Schlicker,A., Roepman,P., McDermott,U., Garnett,M., Grernrum,W., Sun,C., Prahallad,A., Groenendijk,F.H., Mittempergher,L., Nijkamp,W., Neefjes,J., Salazar,R., Ten Dijke,P., Uramoto,H., Tanaka,F., Beijersbergen,R.L., Wessels,L.F. and Bernards,R.
Journal Cell 151 (5), 937-950 (2012)
Title Somatic MED12 mutations in uterine leiomyosarcoma and colorectal cancer .
Author Kampjarvi,K., Makinen,N., Kilpivaara,O., Arola,J., Heinonen,H.R., Bohm,J., Abdel-Wahab,O., Lehtonen,H.J., Pelttari,L.M., Mehine,M., Schrewe,H., Nevanlinna,H., Levine,R.L., Hokland,P., Bohling,T., Mecklin,J.P., Butzow,R., Aaltonen,L.A. and Vahteristo,P.
Journal Br. J. Cancer 107 (10), 1761-1765 (2012)
Title Mutational analysis of MED12 exon 2 in uterine leiomyoma and other common tumors .
Author Je,E.M., Kim,M.R., Min,K.O., Yoo,N.J. and Lee,S.H.
Journal Int. J. Cancer 131 (6), E1044-E1047 (2012)
Title MED12 alterations in both human benign and malignant uterine soft tissue tumors .
Author Perot,G., Croce,S., Ribeiro,A., Lagarde,P., Velasco,V., Neuville,A., Coindre,J.M., Stoeckle,E., Floquet,A., MacGrogan,G. and Chibon,F.
Journal PLoS ONE 7 (6), E40015 (2012)
Title Association of an X-chromosome dodecamer insertional variant allele with mental retardation .
Author Philibert,R.A., King,B.H., Winfield,S., Cook,E.H., Lee,Y.H., Stubblefield,B., Damschroder-Williams,P., Dea,C., Palotie,A., Tengstrom,C., Martin,B.M. and Ginns,E.I.
Journal Mol. Psychiatry 3 (4), 303-309 (1998)
Title A gene for FG syndrome maps in the Xq12-q21.31 region .
Author Briault,S., Hill,R., Shrimpton,A., Zhu,D., Till,M., Ronce,N., Margaritte-Jeannin,P., Baraitser,M., Middleton-Price,H., Malcolm,S., Thompson,E., Hoo,J., Wilson,G., Romano,C., Guichet,A., Pembrey,M., Fontes,M., Poustka,A. and Moraine,C.
Journal Am. J. Med. Genet. 73 (1), 87-90 (1997)
Title cDNAs with long CAG trinucleotide repeats from human brain .
Author Margolis,R.L., Abraham,M.R., Gatchell,S.B., Li,S.H., Kidwai,A.S., Breschel,T.S., Stine,O.C., Callahan,C., McInnis,M.G. and Ross,C.A.
Journal Hum. Genet. 100 (1), 114-122 (1997)
Title Ligand induction of a transcriptionally active thyroid hormone receptor coactivator complex .
Author Fondell,J.D., Ge,H. and Roeder,R.G.
Journal Proc. Natl. Acad. Sci. U.S.A. 93 (16), 8329-8333 (1996)
Title Searching for NIDDM susceptibility genes: studies of genes with triplet repeats expressed in skeletal muscle .
Author Yamagata,K., Takeda,J., Menzel,S., Chen,X., Eng,S., Lim,L.R., Concannon,P., Hanis,C.L., Spielman,R.S., Cox,N.J. and Bell,G.I.
Journal Diabetologia 39 (6), 725-730 (1996)

Our customer service representatives are available 24 hours a day, Monday through Friday; please contact us anytime for assistance.

Learn more about the GenEZ ORF Cloning Service.