• THAT   AND

Sequence in raw or FASTA format:


Blast Method:


Homo sapiens mediator complex subunit 12 (MED12), mRNA.

Clone ID Definition Vector Stock Status Price *Turnaround time Order
OHu19668 Homo sapiens mediator complex subunit 12 (MED12), mRNA. pcDNA3.1+-DYK On-demand TBD TBD
OHu19668C Homo sapiens mediator complex subunit 12 (MED12), mRNA. Customized vector On-demand TBD TBD

*Business Day

Mutation services

Sequence Information ORF Nucleotide Sequence
Protein sequence
Vector pcDNA3.1+-DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+-DYK N terminal DYKDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
RefSeq Version NM_005120.2, 110347428
Length 6534 bp
Update Date 03-MAY-2014
Organism Homo sapiens (human)
Definition Homo sapiens mediator complex subunit 12 (MED12), mRNA.
Product mediator of RNA polymerase II transcription subunit 12

Summary: The initiation of transcription is controlled in part by a large protein assembly known as the preinitiation complex. A component of this preinitiation complex is a 1.2 MDa protein aggregate called Mediator. This Mediator component binds with a CDK8 subcomplex which contains the protein encoded by this gene, mediator complex subunit 12 (MED12), along with MED13, CDK8 kinase, and cyclin C. The CDK8 subcomplex modulates Mediator-polymerase II interactions and thereby regulates transcription initiation and reinitation rates. The MED12 protein is essential for activating CDK8 kinase. Defects in this gene cause X-linked Opitz-Kaveggia syndrome, also known as FG syndrome, and Lujan-Fryns syndrome. [provided by RefSeq, Aug 2009].

RefSeq NP_005111.2
CDS 200..6733
Misc Feature(1)500..682
Misc Feature(2)500..682
Misc Feature(3)695..697
Misc Feature(4)1052..2470
Misc Feature(5)2102..2104
Misc Feature(6)2102..2104
Misc Feature(7)3971..3973
Misc Feature(8)4004..4006
Misc Feature(9)5045..6352
Misc Feature(10)5648..6259
Exon (1)1..298
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (2)299..403
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (3)404..595
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (4)596..752
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (5)753..934
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (6)935..1045
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (7)1046..1300
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (8)1301..1447
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (9)1448..1547
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (10)1548..1684
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (11)1685..1816
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (12)1817..1943
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (13)1944..2173
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (14)2174..2254
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (15)2255..2425
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (16)2426..2570
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (17)2571..2621
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (18)2622..2740
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (19)2741..2884
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (20)2885..3048
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (21)3049..3180
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (22)3181..3408
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (23)3409..3553
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (24)3554..3674
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (25)3675..3776
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (26)3777..3890
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (27)3891..4066
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (28)4067..4246
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (29)4247..4318
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (30)4319..4452
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (31)4453..4614
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (32)4615..4726
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (33)4727..4816
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (34)4817..4926
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (35)4927..5062
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (36)5063..5224
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (37)5225..5599
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (38)5600..5750
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (39)5751..5947
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (40)5948..6025
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (41)6026..6243
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (42)6244..6466
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (43)6467..6607
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (44)6608..6689
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Exon (45)6690..6969
Gene Synonym:ARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Order your protein of interest with our Guaranteed or It's Free Service now! For details, please click here.
Position Chain Variation Link
172+g, tdbSNP:373552360
226+c, tdbSNP:376743527
281+a, gdbSNP:371385969
302..337+, gaactgacggccttgaatgtaaaacaaggtttcaatdbSNP:199469678
306..310+gc, tgacgdbSNP:199469679
306+g, tdbSNP:199469667
310..354+, ggccttgaatgtaaaacaaggtttcaataaccagcctgctgtctcdbSNP:199469681
312..320+, ccttgaatgdbSNP:199469682
316..321+, gaatgtdbSNP:199469683
317..345+aatgtaaaacaaggtttcaataaccagcc, ttdbSNP:199469685
317..333+aatgtaaaacaaggttt, tadbSNP:199469680
317..331+, aatgtaaaacaaggtdbSNP:199469684
321..362+, taaaacaaggtttcaataaccagcctgctgtctctggggatgdbSNP:199469687
321..347+, taaaacaaggtttcaataaccagcctgdbSNP:199469686
322..351+, aaaacaaggtttcaataaccagcctgctgtdbSNP:199469688
325..339+, acaaggtttcaataadbSNP:199469690
325..330+, acaaggdbSNP:199469689
327+a, cdbSNP:199469668
328..342+, aggtttcaataaccadbSNP:199469692
328..336+, aggtttcaadbSNP:199469691
329+a, c, g, tdbSNP:199469669
330+a, c, g, tdbSNP:199469672
332..343+, ttcaataaccagdbSNP:199469693
348..362+, ctgtctctggggatgdbSNP:199469694
400+c, gdbSNP:374555675
505+c, tdbSNP:2471968
580+a, gdbSNP:202125318
583+a, gdbSNP:201566660
complement(637)-t, cdbSNP:35068602
767+a, gdbSNP:374780236
836+a, gdbSNP:200333229
852+c, tdbSNP:369083173
907+a, gdbSNP:34668206
1061..1062+, gdbSNP:35454896
1108+a, gdbSNP:184426039
1133+c, gdbSNP:377403264
1165+c, tdbSNP:370616416
1366+a, gdbSNP:374324656
1402+a, gdbSNP:368546216
1463+c, tdbSNP:368913305
1522+c, tdbSNP:371928861
1523+c, gdbSNP:5981075
1543+g, tdbSNP:375202766
1552..1553+, cdbSNP:36079314
1585+g, tdbSNP:186153976
1629+c, tdbSNP:75527463
1637+c, gdbSNP:369762911
1703+a, gdbSNP:370204234
1838+a, gdbSNP:370812643
1883+a, gdbSNP:374138730
1894+a, tdbSNP:138984044
1901+g, tdbSNP:188593863
2020+a, tdbSNP:375897167
2068+c, tdbSNP:367973899
2094+a, gdbSNP:199582086
2101+c, tdbSNP:372068010
2134+a, gdbSNP:376986062
2155+c, tdbSNP:199873151
2167+a, gdbSNP:201473962
2211+a, gdbSNP:5937067
2335+c, tdbSNP:377207665
2371+c, tdbSNP:187478018
2378+a, gdbSNP:192331892
2419+c, tdbSNP:370195616
2458+a, gdbSNP:61752446
2507+a, gdbSNP:199860580
2770+a, gdbSNP:368090262
2812+a, gdbSNP:372344160
2926+c, tdbSNP:372816429
2977+c, tdbSNP:375971110
3072+a, gdbSNP:397515554
3080+c, tdbSNP:80338758
complement(3085)-g, adbSNP:34761462
3103+a, gdbSNP:369276718
3188+c, tdbSNP:2503120
3208+a, cdbSNP:375493995
3214+c, tdbSNP:370685994
3219+a, gdbSNP:80338759
3309+c, tdbSNP:377078179
3310+a, gdbSNP:185658730
3403+c, tdbSNP:201807437
3421+c, tdbSNP:374156594
3422+g, tdbSNP:41303701
3580+g, tdbSNP:369946933
3642+a, gdbSNP:387907360
3692+c, tdbSNP:387907361
3696+a, tdbSNP:2503121
3898+a, gdbSNP:184162709
3984+a, gdbSNP:202120461
4042+c, tdbSNP:369268877
4043+a, gdbSNP:398124197
4048+g, tdbSNP:377409217
4063+a, gdbSNP:370431544
4075+a, tdbSNP:368144948
4117+c, tdbSNP:372389957
4129+a, cdbSNP:5030619
4141+c, tdbSNP:3810670
4156+a, cdbSNP:368549870
4200+a, gdbSNP:372238830
4227+a, gdbSNP:201044355
4243+c, tdbSNP:367674919
4314+a, gdbSNP:202009066
4374+a, gdbSNP:1139013
4378+a, cdbSNP:376058351
complement(4459)-t, cdbSNP:34299769
4579+c, tdbSNP:377119772
4624+a, gdbSNP:370211858
4834+c, tdbSNP:151316557
4864+a, gdbSNP:375001801
4960+c, tdbSNP:369563649
5039+a, gdbSNP:374216233
5050+a, gdbSNP:377210068
5170+c, tdbSNP:398124198
5173+c, tdbSNP:376179450
5203+c, tdbSNP:370610104
5287+a, gdbSNP:202167558
5337+a, gdbSNP:374390933
5384+a, cdbSNP:387907362
5447+a, gdbSNP:368542728
5466+c, tdbSNP:201843482
5515+a, gdbSNP:398124199
5604+a, gdbSNP:375152466
5616+c, tdbSNP:368093012
5621+c, tdbSNP:372271659
5709+c, gdbSNP:200328506
5734+a, gdbSNP:34784349
5783+c, tdbSNP:200279192
5816+a, gdbSNP:372326268
5843+a, gdbSNP:376830660
5849+a, gdbSNP:147354926
5907+a, cdbSNP:7473655
5910+c, tdbSNP:200663107
5911+a, gdbSNP:189962028
5974+a, gdbSNP:376753995
6004+c, tdbSNP:201608537
6073+c, tdbSNP:370235478
6147+c, tdbSNP:374901524
6271+a, tdbSNP:200692655
6296+a, gdbSNP:372606012
6310+c, tdbSNP:370522888
6400+a, gdbSNP:375793297
6434+a, gdbSNP:200820997
6529+a, tdbSNP:80213780
6539..6540+, agcaacaccagdbSNP:5030620
6547+c, gdbSNP:79912241
6558..6559+, ccagcagcaacadbSNP:398124200
6758+a, gdbSNP:369519934
6771+c, tdbSNP:373723581
6922+c, gdbSNP:190398158
Gene SymbolMED12
Gene SynonymARC240; CAGH45; FGS1; HOPA; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Locus MapXq13
Title Exomic landscape of MED12 mutation-negative and -positive uterine leiomyomas .
Author Makinen N, Vahteristo P, Butzow R, Sjoberg J and Aaltonen LA.
Journal Int. J. Cancer 134 (4), 1008-1012 (2014)
Title MED12 exon 2 mutations in uterine and extrauterine smooth muscle tumors .
Author Schwetye KE, Pfeifer JD and Duncavage EJ.
Journal Hum. Pathol. 45 (1), 65-70 (2014)
Title Lack of evidence for frequent MED12 p.L1224F mutation in prostate tumours from Caucasian patients .
Author Stoehr R, Taubert H, Gaisa NT, Smeets D, Kneitz B, Giedl J, Ruemmele P, Wieland WF, Rau TT and Hartmann A.
Journal J. Pathol. 230 (4), 453-456 (2013)
Title Mediator complex subunit 12 exon 2 mutation analysis in different subtypes of smooth muscle tumors confirms genetic heterogeneity .
Author de Graaff MA, Cleton-Jansen AM, Szuhai K and Bovee JV.
Journal Hum. Pathol. 44 (8), 1597-1604 (2013)
Title Mutation status of the mediator complex subunit 12 (MED12) in uterine leiomyomas and concurrent/metachronous multifocal peritoneal smooth muscle nodules (leiomyomatosis peritonealis disseminata) .
Author Rieker RJ, Agaimy A, Moskalev EA, Hebele S, Hein A, Mehlhorn G, Beckmann MW, Hartmann A and Haller F.
Journal Pathology 45 (4), 388-392 (2013)
Title A gene for FG syndrome maps in the Xq12-q21.31 region .
Author Briault S, Hill R, Shrimpton A, Zhu D, Till M, Ronce N, Margaritte-Jeannin P, Baraitser M, Middleton-Price H, Malcolm S, Thompson E, Hoo J, Wilson G, Romano C, Guichet A, Pembrey M, Fontes M, Poustka A and Moraine C.
Journal Am. J. Med. Genet. 73 (1), 87-90 (1997)
Title cDNAs with long CAG trinucleotide repeats from human brain .
Author Margolis RL, Abraham MR, Gatchell SB, Li SH, Kidwai AS, Breschel TS, Stine OC, Callahan C, McInnis MG and Ross CA.
Journal Hum. Genet. 100 (1), 114-122 (1997)
Title Ligand induction of a transcriptionally active thyroid hormone receptor coactivator complex .
Author Fondell JD, Ge H and Roeder RG.
Journal Proc. Natl. Acad. Sci. U.S.A. 93 (16), 8329-8333 (1996)
Title Searching for NIDDM susceptibility genes: studies of genes with triplet repeats expressed in skeletal muscle .
Author Yamagata K, Takeda J, Menzel S, Chen X, Eng S, Lim LR, Concannon P, Hanis CL, Spielman RS, Cox NJ and Bell GI.
Journal Diabetologia 39 (6), 725-730 (1996)
Title MED12-Related Disorders .
Author Lyons,M.J.
Journal (in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)

Our customer service representatives are available 24 hours a day, Monday through Friday; please contact us anytime for assistance.