• THAT   AND

Sequence in raw or FASTA format:


Blast Method:


Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 1, mRNA.

RefSeq Accession Definition Service Stock Status Price *Turnaround time Order
NM_005228 Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 1, mRNA. GenEZ ORF Cloning On-demand $1699.00 25

*Business Day

Related Services

RefSeq Version NM_005228.3, 41327737
Length 5616 bp
Structure linear
Update Date 29-APR-2013
Organism Homo sapiens (human)
Definition Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 1, mRNA.
Product epidermal growth factor receptor isoform a precursor

Summary: The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. Multiple alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2010].

Transcript Variant: This variant (1) is the longest transcript and it encodes the longest isoform (a).

RefSeq NP_005219.2
CDS 247..3879
Misc Feature(1)208..210
Misc Feature(2)order(337..339,418..420)
Misc Feature(3)412..414
Misc Feature(4)415..750
Misc Feature(5)469..1146
Misc Feature(6)628..630
Misc Feature(7)order(715..717,805..807)
Misc Feature(8)769..771
Misc Feature(9)799..1257
Misc Feature(10)order(814..816,841..843)
Misc Feature(11)order(826..828,865..867)
Misc Feature(12)832..834
Misc Feature(13)order(889..891,913..915)
Misc Feature(14)order(901..903,937..939)
Misc Feature(15)931..933
Misc Feature(16)937..1068
Misc Feature(17)order(940..942,964..966)
Misc Feature(18)order(952..954,988..990)
Misc Feature(19)order(997..999,1024..1026)
Misc Feature(20)order(1036..1038,1117..1119)
Misc Feature(21)order(1129..1131,1165..1167)
Misc Feature(22)order(1177..1179,1222..1224)
Misc Feature(23)order(1231..1233,1243..1245)
Misc Feature(24)order(1255..1257,1330..1332)
Misc Feature(25)1300..1302
Misc Feature(26)1327..1689
Misc Feature(27)1327..1329
Misc Feature(28)1414..2046
Misc Feature(29)1483..1485
Misc Feature(30)1576..1578
Misc Feature(31)order(1654..1656,1741..1743)
Misc Feature(32)1756..1866
Misc Feature(33)order(1762..1764,1789..1791)
Misc Feature(34)order(1774..1776,1813..1815)
Misc Feature(35)order(1822..1824,1849..1851)
Misc Feature(36)1828..1830
Misc Feature(37)order(1861..1863,1909..1911)
Misc Feature(38)1918..>2040
Misc Feature(39)order(1918..1920,1957..1959)
Misc Feature(40)order(1930..1932,1981..1983)
Misc Feature(41)1948..1950
Misc Feature(42)order(1990..1992,2017..2019)
Misc Feature(43)order(2029..2031,2095..2097)
Misc Feature(44)2053..2055
Misc Feature(45)order(2104..2106,2128..2130)
Misc Feature(46)2113..2115
Misc Feature(47)order(2116..2118,2152..2154)
Misc Feature(48)2146..2268
Misc Feature(49)order(2176..2184,2188..2205,2212..2217)
Misc Feature(50)2182..2250
Misc Feature(51)2278..2280
Misc Feature(52)2278..2280
Misc Feature(53)2308..2358
Misc Feature(54)2323..2325
Misc Feature(55)2323..2325
Misc Feature(56)2329..2331
Misc Feature(57)2356..3303
Misc Feature(58)2383..3150
Misc Feature(59)order(2389..2397,2428..2436,2626..2631,2635..2637,
Misc Feature(60)order(2398..2403,2410..2415,2479..2481,2617..2619,
Misc Feature(61)order(2398..2403,2422..2424,2473..2475,2479..2481,
Misc Feature(62)2425..2427
Misc Feature(63)2548..2550
Misc Feature(64)2806..2883
Misc Feature(65)2851..2853
Misc Feature(66)order(2872..2886,2899..2901,2911..2913)
Misc Feature(67)2917..2919
Misc Feature(68)2989..2991
Misc Feature(69)3076..3078
Misc Feature(70)3178..3180
Misc Feature(71)3217..3219
Misc Feature(72)3217..3219
Misc Feature(73)3229..3231
Misc Feature(74)3229..3231
Misc Feature(75)3238..3240
Misc Feature(76)3238..3240
Misc Feature(77)3292..3294
Misc Feature(78)3292..3294
Misc Feature(79)3292..3294
Misc Feature(80)3292..3294
Misc Feature(81)3292..3294
Misc Feature(82)3322..3324
Misc Feature(83)3322..3324
Misc Feature(84)3352..3354
Misc Feature(85)3355..3357
Misc Feature(86)3361..3363
Misc Feature(87)3361..3363
Misc Feature(88)3367..3369
Misc Feature(89)3367..3369
Misc Feature(90)3370..3372
Misc Feature(91)3370..3372
Misc Feature(92)3379..3381
Misc Feature(93)3436..3438
Misc Feature(94)3436..3438
Misc Feature(95)3451..3453
Misc Feature(96)3451..3453
Misc Feature(97)3451..3453
Misc Feature(98)3451..3453
Misc Feature(99)3454..3456
Misc Feature(100)3454..3456
Misc Feature(101)3454..3456
Misc Feature(102)3457..3459
Misc Feature(103)3457..3459
Misc Feature(104)3457..3459
Misc Feature(105)3487..3489
Misc Feature(106)3487..3489
Misc Feature(107)3520..3522
Misc Feature(108)3520..3522
Misc Feature(109)3520..3522
Misc Feature(110)3574..3576
Misc Feature(111)3574..3576
Misc Feature(112)3604..3606
Misc Feature(113)3619..3621
Misc Feature(114)3658..3660
Misc Feature(115)3742..3744
Misc Feature(116)3742..3744
Misc Feature(117)3760..3762
Misc Feature(118)3760..3762
Misc Feature(119)3835..3837
Misc Feature(120)3835..3837
Misc Feature(121)3835..3837
Misc Feature(122)3841..3843
Exon (1)1..334
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (2)335..486
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (3)487..670
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (4)671..805
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (5)806..874
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (6)875..993
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (7)994..1135
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (8)1136..1252
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (9)1253..1379
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (10)1380..1453
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (11)1454..1544
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (12)1545..1744
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (13)1745..1877
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (14)1878..1968
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (15)1969..2126
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (16)2127..2165
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (17)2166..2307
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (18)2308..2430
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (19)2431..2529
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (20)2530..2715
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (21)2716..2871
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (22)2872..2947
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (23)2948..3094
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (24)3095..3192
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (25)3193..3360
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (26)3361..3408
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (27)3409..3517
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (28)3518..5600
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Order your protein of interest with our Guaranteed or It's Free Service now! For details, please click here.
Position Chain Variation Link
31+g, tdbSNP:712829
56+a, cdbSNP:712830
164+, adbSNP:67170120
203+a, tdbSNP:17288945
347+c, gdbSNP:144158123
348+a, gdbSNP:148679319
373+a, gdbSNP:147740818
468+c, tdbSNP:200383389
477+c, gdbSNP:61731794
515+a, tdbSNP:142061256
529+a, cdbSNP:35515689
539+a, gdbSNP:17289589
561+a, gdbSNP:141271101
572+c, gdbSNP:145113601
600+c, tdbSNP:147726446
618+c, tdbSNP:142553829
680+a, gdbSNP:150234987
684+c, gdbSNP:199637112
687+c, gdbSNP:138946543
714+g, tdbSNP:149006234
720+c, tdbSNP:2072454
759+c, tdbSNP:17289686
777+a, gdbSNP:17336437
893..894+, cdbSNP:68153550
906+c, tdbSNP:45621033
921+, cdbSNP:145506643
977+a, gdbSNP:200664836
1014+c, tdbSNP:146098757
1015+a, gdbSNP:138847501
1020+c, tdbSNP:142569931
1043+c, gdbSNP:17336639
1090+a, gdbSNP:199796955
1112+c, tdbSNP:149840192
1120+a, gdbSNP:150549265
1158+c, tdbSNP:182002674
1164+a, gdbSNP:202182545
1167+c, tdbSNP:17289893
1184+c, tdbSNP:149321481
1215+a, cdbSNP:201040971
1228+a, cdbSNP:144460286
1234+a, gdbSNP:139429793
1245+, cdbSNP:67784074
1252+a, gdbSNP:144997037
1347+c, tdbSNP:185327606
1365+a, gdbSNP:2302536
1522+a, gdbSNP:201364864
1559+, tdbSNP:67679412
1563+a, gdbSNP:17290005
1620+c, g, tdbSNP:146711874
1628+c, tdbSNP:200592648
1641+a, cdbSNP:199754312
1684+c, tdbSNP:147732025
1755+c, tdbSNP:17336800
1800+a, gdbSNP:142429250
1803+g, tdbSNP:116057045
1808+a, c, g, tdbSNP:2227983
1826+a, gdbSNP:150477666
1878+c, tdbSNP:17290103
1995+c, tdbSNP:141232284
2020+a, gdbSNP:144943614
2021+c, tdbSNP:28384375
2034+a, gdbSNP:17290162
2039+g, tdbSNP:139236063
2045+c, tdbSNP:149375515
2048+a, gdbSNP:201498575
2062+c, gdbSNP:143152775
2064+a, gdbSNP:148242307
2076+c, tdbSNP:115350205
2077+a, gdbSNP:201061916
2082+c, tdbSNP:150803480
2085+c, tdbSNP:17290169
2097+c, tdbSNP:143422127
2105+a, gdbSNP:150899403
2117+g, tdbSNP:28384376
2133+a, tdbSNP:2227984
2160+a, gdbSNP:146783627
2164+g, tdbSNP:200989322
2182+a, cdbSNP:140516819
2221+c, gdbSNP:201580890
2238+c, tdbSNP:200855539
2249+g, tdbSNP:76946721
2266+a, gdbSNP:17337079
2270+a, gdbSNP:150423237
2279+c, tdbSNP:138193597
2293+c, tdbSNP:55669340
2401+a, g, tdbSNP:28929495
2402+a, c, gdbSNP:121913428
2421+a, gdbSNP:55959834
2426+a, gdbSNP:138240620
2434+c, tdbSNP:121913434
2439+a, gdbSNP:121913467
2444+c, tdbSNP:121913446
2446+a, gdbSNP:121913420
2449+a, gdbSNP:121913430
2471+c, tdbSNP:121913466
2480+a, gdbSNP:121913433
2481..2495+, ggaattaagagaagcdbSNP:121913421
2482..2499+, gaattaagagaagcaacadbSNP:121913426
2482+a, gdbSNP:121913427
2483..2502+aattaagagaagcaacatct, tcdbSNP:121913424
2483..2500+, aattaagagaagcaacatdbSNP:121913422
2483..2497+, aattaagagaagcaadbSNP:121913425
2484..2501+, attaagagaagcaacatcdbSNP:121913423
2484..2494+attaagagaag, gcdbSNP:121913435
2485..2504+ca, ttaagagaagcaacatctccdbSNP:121913437
2485..2502+, ttaagagaagcaacatctdbSNP:121913440
2485..2493+, ttaagagaadbSNP:121913436
2486..2503+, taagagaagcaacatctcdbSNP:121913438
2486..2500+, taagagaagcaacatdbSNP:121913442
2486..2497+, taagagaagcaadbSNP:121913441
2487..2490+aaga, cccgdbSNP:121913439
2494+c, gdbSNP:121913229
2500..2523+, tctccgaaagccaacaaggaaatcdbSNP:121913463
2501+a, cdbSNP:121913464
2503+c, tdbSNP:121913231
2527+a, g, tdbSNP:121913418
2535+c, gdbSNP:117420095
2549..2550+, gcgtggacadbSNP:146024686
2549+g, tdbSNP:121913465
2551+a, gdbSNP:147149347
2558..2561+accc, gcgtggacaaccgdbSNP:121913445
2564+a, gdbSNP:121913432
2574+c, gdbSNP:142999400
2601+c, tdbSNP:148188503
2607+a, gdbSNP:1050171
2610+c, tdbSNP:201469865
2615+c, tdbSNP:121434569
2674+a, gdbSNP:121913230
2675+a, gdbSNP:121913431
2703+a, gdbSNP:56183713
2726+a, tdbSNP:150749913
2733+a, gdbSNP:41420046
2738+a, gdbSNP:150036236
2739+c, tdbSNP:182196240
2753+a, gdbSNP:146121458
2754+c, tdbSNP:2229066
2764+a, gdbSNP:143884981
2773+a, gdbSNP:146795390
2789+c, tdbSNP:148934350
2790+a, g, tdbSNP:104886012
2818+a, cdbSNP:121913443
2819+g, tdbSNP:121434568
2828+a, tdbSNP:121913444
2848+a, gdbSNP:104886013
2921+c, tdbSNP:151064287
2955+c, tdbSNP:1140475
2994+c, tdbSNP:41396448
3109+a, gdbSNP:201830126
3112+a, gdbSNP:104886026
3130+c, g, tdbSNP:17337451
3131+a, gdbSNP:144496976
3144+c, tdbSNP:142305759
3175+c, tdbSNP:1140476
3209+a, cdbSNP:17290699
3228+a, gdbSNP:2293347
3242+a, gdbSNP:149248025
3261+a, gdbSNP:55737335
3271+a, gdbSNP:148019583
3315+c, tdbSNP:147381148
3332+c, tdbSNP:182857647
3333+a, gdbSNP:141489713
3347+g, tdbSNP:34352568
3358+c, tdbSNP:138104726
3385+a, gdbSNP:142442994
3387..3388+, gdbSNP:148997565
3389+c, tdbSNP:78244461
3456+c, tdbSNP:41494749
3471+c, tdbSNP:140117937
3483+c, gdbSNP:184614596
3534+c, tdbSNP:143770509
3549+c, gdbSNP:55796214
3553+a, gdbSNP:139388758
3570+c, tdbSNP:113361141
3594..3595+, cdbSNP:72383055
3597+c, tdbSNP:149995949
3600+a, gdbSNP:199838215
3629+c, tdbSNP:199738264
3673+c, gdbSNP:145189325
3713+a, cdbSNP:149174093
3718+c, gdbSNP:140028234
3726+a, gdbSNP:201196771
3731+a, gdbSNP:41321844
3764+a, cdbSNP:147896627
3793+c, tdbSNP:199661469
3838+c, tdbSNP:142188270
3848+c, tdbSNP:201717672
3849+a, gdbSNP:202156403
3875+c, tdbSNP:35918369
3888+a, gdbSNP:200914796
3914+c, tdbSNP:17290755
3920+a, cdbSNP:183176784
3921+a, gdbSNP:201214891
3934+, adbSNP:68094917
3937+, ccacagcaggtdbSNP:41499845
3957+c, tdbSNP:17290762
3959+g, tdbSNP:201415685
4016+a, gdbSNP:17337528
4026+a, gdbSNP:112336528
4074+, tdbSNP:78669011
4093+a, gdbSNP:145703432
4101+a, gdbSNP:17337535
4120+g, tdbSNP:187461906
4160..4161+, adbSNP:5884404
4161..4162+, adbSNP:34043207
4173..4174+, adbSNP:202232274
4175+c, tdbSNP:201581453
4326+g, tdbSNP:201854406
4403+c, tdbSNP:117722337
4443+a, gdbSNP:192601649
4491+c, tdbSNP:148966706
4516+, gdbSNP:55998486
4600+c, tdbSNP:3807362
4653+a, gdbSNP:884225
4712+a, gdbSNP:185437934
4788+a, gdbSNP:1063486
4891+a, gdbSNP:17337549
4896+a, gdbSNP:111347164
4949+c, tdbSNP:41486949
4975+c, tdbSNP:954311
5114+a, gdbSNP:112622335
5131+c, tdbSNP:141571614
5159+, gdbSNP:35473039
5273+a, gdbSNP:150522314
5298+a, gdbSNP:116203092
5306..5307+, ccdbSNP:35700282
5313+c, tdbSNP:41454444
5482+c, tdbSNP:139451510
5513+c, tdbSNP:41347952
Gene SymbolEGFR
Gene SynonymERBB; ERBB1; HER1; mENA; PIG61
Locus Map7p12
All Transcripts
RefSeq Accession Definition Stock Status Price Turnaround time Business Day Select
NM_005228 Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 1, mRNA. On-demand $1699.00 25
NM_201282 Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 2, mRNA. On-demand $849.00 20
NM_201283 Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 3, mRNA. On-demand $549.00 14
NM_201284 Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 4, mRNA. On-demand $849.00 20
Title TGF-alpha/HA complex promotes tympanic membrane keratinocyte migration and proliferation via ErbB1 receptor .
Author Mei Teh,B., Redmond,S.L., Shen,Y., Atlas,M.D., Marano,R.J. and Dilley,R.J.
Journal Exp. Cell Res. 319 (6), 790-799 (2013)
Title Malignant peripheral nerve sheath tumor invasion requires aberrantly expressed EGF receptors and is variably enhanced by multiple EGF family ligands .
Author Byer,S.J., Brossier,N.M., Peavler,L.T., Eckert,J.M., Watkins,S., Roth,K.A. and Carroll,S.L.
Journal J. Neuropathol. Exp. Neurol. 72 (3), 219-233 (2013)
Title Architecture and membrane interactions of the EGF receptor .
Author Arkhipov,A., Shan,Y., Das,R., Endres,N.F., Eastwood,M.P., Wemmer,D.E., Kuriyan,J. and Shaw,D.E.
Journal Cell 152 (3), 557-569 (2013)
Title Conformational coupling across the plasma membrane in activation of the EGF receptor .
Author Endres,N.F., Das,R., Smith,A.W., Arkhipov,A., Kovacs,E., Huang,Y., Pelton,J.G., Shan,Y., Shaw,D.E., Wemmer,D.E., Groves,J.T. and Kuriyan,J.
Journal Cell 152 (3), 543-556 (2013)
Title Gene amplification of epidermal growth factor receptor in atypical glottic hyperplasia .
Author Braut,T., Kujundzic,M., Vukelic,J., Manestar,D., Krstulja,M., Starcevic,R. and Grahovac,B.
Journal Coll Antropol 36 (SUPPL 2), 87-91 (2012)
Title The SH2 and SH3 domain-containing Nck protein is oncogenic and a common target for phosphorylation by different surface receptors .
Author Li,W., Hu,P., Skolnik,E.Y., Ullrich,A. and Schlessinger,J.
Journal Mol. Cell. Biol. 12 (12), 5824-5833 (1992)
Title Identification of the two major epidermal growth factor-induced tyrosine phosphorylation sites in the microvillar core protein ezrin .
Author Krieg,J. and Hunter,T.
Journal J. Biol. Chem. 267 (27), 19258-19265 (1992)
Title The SH2 and SH3 domain-containing protein GRB2 links receptor tyrosine kinases to ras signaling .
Author Lowenstein,E.J., Daly,R.J., Batzer,A.G., Li,W., Margolis,B., Lammers,R., Ullrich,A., Skolnik,E.Y., Bar-Sagi,D. and Schlessinger,J.
Journal Cell 70 (3), 431-442 (1992)
Title Two chromosome 7 dinucleotide repeat polymorphisms at gene loci epidermal growth factor receptor (EGFR) and pro alpha 2 (I) collagen (COL1A2) .
Author Chi,D.D., Hing,A.V., Helms,C., Steinbrueck,T., Mishra,S.K. and Donis-Keller,H.
Journal Hum. Mol. Genet. 1 (2), 135 (1992)
Title Mechanism of desensitization of the epidermal growth factor receptor protein-tyrosine kinase .
Author Countaway,J.L., Nairn,A.C. and Davis,R.J.
Journal J. Biol. Chem. 267 (2), 1129-1140 (1992)

Our customer service representatives are available 24 hours a day, Monday through Friday; please contact us anytime for assistance.

Learn more about the GenEZ ORF Cloning Service.