• THAT   AND

Sequence in raw or FASTA format:


Blast Method:


Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 1, mRNA.

Clone ID Definition Vector Stock Status Price *Turnaround time Order
OHu25437 Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 1, mRNA. pcDNA3.1+-DYK On-demand TBD 25
OHu25437C Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 1, mRNA. Customized vector On-demand TBD 25

*Business Day

Mutation services

Sequence Information ORF Nucleotide Sequence
Protein sequence
Vector pcDNA3.1+-DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+-DYK N terminal DYKDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
RefSeq Version NM_005228.3, 41327737
Length 3633 bp
Update Date 18-MAY-2014
Organism Homo sapiens (human)
Definition Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 1, mRNA.
Product epidermal growth factor receptor isoform a precursor

Summary: The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. Multiple alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2010].

Transcript Variant: This variant (1) is the longest transcript and it encodes the longest isoform (a).

RefSeq NP_005219.2
CDS 247..3879
Misc Feature(1)208..210
Misc Feature(2)order(337..339,418..420)
Misc Feature(3)412..414
Misc Feature(4)415..750
Misc Feature(5)469..1146
Misc Feature(6)628..630
Misc Feature(7)order(715..717,805..807)
Misc Feature(8)769..771
Misc Feature(9)799..1257
Misc Feature(10)order(814..816,841..843)
Misc Feature(11)order(826..828,865..867)
Misc Feature(12)832..834
Misc Feature(13)order(889..891,913..915)
Misc Feature(14)order(901..903,937..939)
Misc Feature(15)931..933
Misc Feature(16)937..1068
Misc Feature(17)order(940..942,964..966)
Misc Feature(18)order(952..954,988..990)
Misc Feature(19)order(997..999,1024..1026)
Misc Feature(20)order(1036..1038,1117..1119)
Misc Feature(21)order(1129..1131,1165..1167)
Misc Feature(22)order(1177..1179,1222..1224)
Misc Feature(23)order(1231..1233,1243..1245)
Misc Feature(24)order(1255..1257,1330..1332)
Misc Feature(25)1300..1302
Misc Feature(26)1327..1689
Misc Feature(27)1327..1329
Misc Feature(28)1414..2046
Misc Feature(29)1483..1485
Misc Feature(30)1576..1578
Misc Feature(31)order(1654..1656,1741..1743)
Misc Feature(32)1759..2157
Misc Feature(33)1762..1923
Misc Feature(34)order(1762..1764,1789..1791)
Misc Feature(35)order(1774..1776,1813..1815)
Misc Feature(36)order(1822..1824,1849..1851)
Misc Feature(37)1828..1830
Misc Feature(38)order(1861..1863,1909..1911)
Misc Feature(39)1918..>2040
Misc Feature(40)order(1918..1920,1957..1959)
Misc Feature(41)order(1930..1932,1981..1983)
Misc Feature(42)1948..1950
Misc Feature(43)order(1990..1992,2017..2019)
Misc Feature(44)order(2029..2031,2095..2097)
Misc Feature(45)2053..2055
Misc Feature(46)order(2104..2106,2128..2130)
Misc Feature(47)2113..2115
Misc Feature(48)order(2116..2118,2152..2154)
Misc Feature(49)2146..2277
Misc Feature(50)order(2176..2184,2188..2205,2212..2217)
Misc Feature(51)2182..2250
Misc Feature(52)2278..2280
Misc Feature(53)2278..2280
Misc Feature(54)2308..2358
Misc Feature(55)2323..2325
Misc Feature(56)2323..2325
Misc Feature(57)2329..2331
Misc Feature(58)2356..3303
Misc Feature(59)2380..3150
Misc Feature(60)order(2389..2397,2428..2436,2626..2631,2635..2637,
Misc Feature(61)order(2398..2403,2410..2415,2479..2481,2617..2619,
Misc Feature(62)order(2398..2403,2422..2424,2473..2475,2479..2481,
Misc Feature(63)2425..2427
Misc Feature(64)2548..2550
Misc Feature(65)2806..2883
Misc Feature(66)2851..2853
Misc Feature(67)order(2872..2886,2899..2901,2911..2913)
Misc Feature(68)2917..2919
Misc Feature(69)2989..2991
Misc Feature(70)3076..3078
Misc Feature(71)3178..3180
Misc Feature(72)3217..3219
Misc Feature(73)3217..3219
Misc Feature(74)3229..3231
Misc Feature(75)3229..3231
Misc Feature(76)3238..3240
Misc Feature(77)3238..3240
Misc Feature(78)3292..3294
Misc Feature(79)3292..3294
Misc Feature(80)3292..3294
Misc Feature(81)3292..3294
Misc Feature(82)3292..3294
Misc Feature(83)3322..3324
Misc Feature(84)3322..3324
Misc Feature(85)3352..3354
Misc Feature(86)3355..3357
Misc Feature(87)3361..3363
Misc Feature(88)3361..3363
Misc Feature(89)3367..3369
Misc Feature(90)3367..3369
Misc Feature(91)3370..3372
Misc Feature(92)3370..3372
Misc Feature(93)3379..3381
Misc Feature(94)3436..3438
Misc Feature(95)3436..3438
Misc Feature(96)3451..3453
Misc Feature(97)3451..3453
Misc Feature(98)3451..3453
Misc Feature(99)3451..3453
Misc Feature(100)3454..3456
Misc Feature(101)3454..3456
Misc Feature(102)3454..3456
Misc Feature(103)3457..3459
Misc Feature(104)3457..3459
Misc Feature(105)3457..3459
Misc Feature(106)3487..3489
Misc Feature(107)3487..3489
Misc Feature(108)3520..3522
Misc Feature(109)3520..3522
Misc Feature(110)3520..3522
Misc Feature(111)3574..3576
Misc Feature(112)3574..3576
Misc Feature(113)3604..3606
Misc Feature(114)3619..3621
Misc Feature(115)3658..3660
Misc Feature(116)3742..3744
Misc Feature(117)3742..3744
Misc Feature(118)3760..3762
Misc Feature(119)3760..3762
Misc Feature(120)3835..3837
Misc Feature(121)3835..3837
Misc Feature(122)3835..3837
Misc Feature(123)3841..3843
Exon (1)1..334
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (2)335..486
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (3)487..670
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (4)671..805
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (5)806..874
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (6)875..993
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (7)994..1135
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (8)1136..1252
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (9)1253..1379
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (10)1380..1453
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (11)1454..1544
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (12)1545..1744
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (13)1745..1877
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (14)1878..1968
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (15)1969..2126
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (16)2127..2165
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (17)2166..2307
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (18)2308..2430
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (19)2431..2529
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (20)2530..2715
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (21)2716..2871
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (22)2872..2947
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (23)2948..3094
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (24)3095..3192
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (25)3193..3360
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (26)3361..3408
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (27)3409..3517
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Exon (28)3518..5600
Gene Synonym:ERBB; ERBB1; HER1; mENA; PIG61
Order your protein of interest with our Guaranteed or It's Free Service now! For details, please click here.
Position Chain Variation Link
31+g, tdbSNP:712829
56+a, cdbSNP:712830
203+a, tdbSNP:17288945
215+g, tdbSNP:375923119
267+c, tdbSNP:369581368
307+g, tdbSNP:373129709
339+c, tdbSNP:372917131
347+c, gdbSNP:144158123
348+g, tdbSNP:148679319
362+c, tdbSNP:375919121
373+a, gdbSNP:147740818
458+a, gdbSNP:369580836
468+c, tdbSNP:200383389
477+c, gdbSNP:61731794
487+a, gdbSNP:374986786
515+a, tdbSNP:142061256
529+a, cdbSNP:35515689
539+a, gdbSNP:17289589
545+a, cdbSNP:376963968
561+a, gdbSNP:141271101
572+c, gdbSNP:145113601
585+c, tdbSNP:374582814
600+c, tdbSNP:147726446
618+c, tdbSNP:142553829
625+a, gdbSNP:377444977
684+c, gdbSNP:199637112
687+c, gdbSNP:138946543
714+g, tdbSNP:149006234
720+c, tdbSNP:2072454
759+c, tdbSNP:17289686
777+a, gdbSNP:17336437
804+c, tdbSNP:375037710
840+c, tdbSNP:370376501
879+c, tdbSNP:373970245
906+c, tdbSNP:45621033
921+, cdbSNP:145506643
968+c, tdbSNP:370744986
972+c, tdbSNP:374561933
977+a, gdbSNP:200664836
1004+a, gdbSNP:374084791
1010+a, gdbSNP:372202099
1014+c, tdbSNP:146098757
1015+a, gdbSNP:138847501
1020+c, tdbSNP:142569931
1043+a, c, gdbSNP:17336639
1090+a, gdbSNP:199796955
1112+c, tdbSNP:149840192
1120+a, gdbSNP:150549265
1158+c, tdbSNP:182002674
1164+a, gdbSNP:202182545
1167+c, tdbSNP:17289893
1184+c, tdbSNP:149321481
1214+c, tdbSNP:367680488
1215+a, cdbSNP:201040971
1228+a, cdbSNP:144460286
1234+a, gdbSNP:139429793
1289+c, tdbSNP:371234907
1347+c, tdbSNP:185327606
1365+a, gdbSNP:2302536
1522+a, gdbSNP:201364864
1527+c, tdbSNP:367896493
1563+a, gdbSNP:17290005
1579+a, gdbSNP:372990493
1597+c, tdbSNP:377567759
1620+c, g, tdbSNP:146711874
1628+c, tdbSNP:200592648
1641+a, cdbSNP:199754312
1684+c, tdbSNP:147732025
1755+c, tdbSNP:17336800
1778+a, cdbSNP:371114444
1782+c, tdbSNP:374670788
1798+c, tdbSNP:368484180
1800+a, gdbSNP:142429250
1803+g, tdbSNP:116057045
1808+a, c, g, tdbSNP:2227983
1826+a, gdbSNP:150477666
1878+c, tdbSNP:17290103
1967+a, gdbSNP:370810719
1995+c, tdbSNP:141232284
2020+a, gdbSNP:144943614
2021+c, tdbSNP:28384375
2023+a, cdbSNP:371483915
2034+a, gdbSNP:17290162
2039+g, tdbSNP:139236063
2045+c, tdbSNP:149375515
2048+a, gdbSNP:201498575
2062+c, gdbSNP:143152775
2064+a, gdbSNP:148242307
2067+c, tdbSNP:377048120
2076+c, tdbSNP:115350205
2077+a, gdbSNP:201061916
2082+c, tdbSNP:150803480
2085+c, tdbSNP:17290169
2097+c, tdbSNP:143422127
2105+a, gdbSNP:150899403
2117+g, tdbSNP:28384376
2133+a, tdbSNP:2227984
2151+c, tdbSNP:371148125
2160+a, gdbSNP:146783627
2164+g, tdbSNP:200989322
2178+a, gdbSNP:367909827
2182+a, cdbSNP:140516819
2221+c, gdbSNP:201580890
2232+g, tdbSNP:377187758
2238+c, tdbSNP:200855539
2249+g, tdbSNP:76946721
2266+a, gdbSNP:17337079
2270+a, gdbSNP:150423237
2271+a, gdbSNP:372471129
2279+c, tdbSNP:138193597
2281+c, tdbSNP:374117790
2284+c, tdbSNP:369399038
2285+a, gdbSNP:373336251
2293+c, tdbSNP:55669340
2311+c, gdbSNP:397517083
2340+c, tdbSNP:370409092
2363+c, tdbSNP:397517084
2372+a, cdbSNP:397517085
2373..2376+aact, cdbSNP:397517087
2373..2375+, aacdbSNP:397517086
2384+a, cdbSNP:373578289
2400+a, g, tdbSNP:397517088
2401+a, c, g, tdbSNP:28929495
2402+a, c, gdbSNP:121913428
2412+a, c, gdbSNP:367694667
2415+c, tdbSNP:370590012
2421+a, gdbSNP:55959834
2426+a, gdbSNP:138240620
2434+c, tdbSNP:121913434
2438+a, gdbSNP:397517089
2439+a, gdbSNP:121913467
2444+c, tdbSNP:121913446
2446+a, gdbSNP:121913420
2449+a, gdbSNP:121913430
2465+c, tdbSNP:397517092
2469+a, cdbSNP:372772241
2471+c, tdbSNP:121913466
2478..2495+aaa, caaggaattaagagaagcdbSNP:397517094
2478..2479+, aaaattcccgtcgctatcdbSNP:397517090
2478+c, tdbSNP:397517093
2480..2481+, aattcccgtcgctatcaadbSNP:397517091
2480+a, gdbSNP:121913433
2481..2495+, ggaattaagagaagcdbSNP:121913421
2482..2499+, gaattaagagaagcaacadbSNP:121913426
2482+a, gdbSNP:121913427
2483..2502+aattaagagaagcaacatct, tcdbSNP:121913424
2483..2500+, aattaagagaagcaacatdbSNP:121913422
2483..2497+, aattaagagaagcaadbSNP:121913425
2484..2501+, attaagagaagcaacatcdbSNP:121913423
2484..2494+attaagagaag, gcdbSNP:121913435
2485..2504+ca, ttaagagaagcaacatctccdbSNP:121913437
2485..2502+, ttaagagaagcaacatctdbSNP:121913440
2485..2497+c, ttaagagaagcaadbSNP:397509368
2485..2493+, ttaagagaadbSNP:121913436
2485..2486+cc, ttdbSNP:397517096
2485+c, tdbSNP:397517095
2486..2503+, taagagaagcaacatctcdbSNP:121913438
2486..2500+, taagagaagcaacatdbSNP:121913442
2486..2497+, taagagaagcaadbSNP:121913441
2486..2494+, taagagaagdbSNP:397517098
2486+c, tdbSNP:397517097
2487..2490+aaga, cccgdbSNP:121913439
2493..2510+, agcaacatctccgaaagcdbSNP:397517099
2494+c, gdbSNP:121913229
2498..2523+aa, catctccgaaagccaacaaggaaatcdbSNP:397517100
2500..2523+, tctccgaaagccaacaaggaaatcdbSNP:121913463
2501+a, cdbSNP:121913464
2503+c, tdbSNP:121913231
2506+a, gdbSNP:397517101
2516+a, tdbSNP:397517102
2526+c, tdbSNP:397517103
2527+a, g, tdbSNP:121913418
2535+c, gdbSNP:117420095
2536..2537+, tccaggaagcctdbSNP:397517106
2539+c, gdbSNP:374873413
2546+c, tdbSNP:397517107
2549..2550+, gcgtggacadbSNP:146024686
2549..2550+gc, ttdbSNP:397517108
2549+g, tdbSNP:121913465
2551+a, c, g, tdbSNP:147149347
2556..2557+, gggttgdbSNP:397517111
2556+c, tdbSNP:397517110
2557..2558+, gcgtggacadbSNP:397517109
2558..2561+accc, gcgtggacaaccgdbSNP:121913445
2560..2561+, accdbSNP:397517112
2564+a, gdbSNP:121913432
2565..2566+, cacdbSNP:397517115
2566..2567+, cccacg, gccacgdbSNP:397517114
2567..2568+, cccccacgtdbSNP:397517113
2568..2569+, cacgtgdbSNP:397517116
2574+a, c, gdbSNP:142999400
2575+c, tdbSNP:397517117
2580+g, tdbSNP:397517118
2581+g, tdbSNP:397517119
2582+g, tdbSNP:397517120
2586+c, tdbSNP:397517121
2595+c, tdbSNP:397517122
2601+c, tdbSNP:148188503
2607+a, gdbSNP:1050171
2610+c, tdbSNP:201469865
2615+c, tdbSNP:121434569
2616+a, gdbSNP:376452156
2626+a, cdbSNP:370289230
2631+c, tdbSNP:375332959
2655+a, gdbSNP:397517123
2674+a, gdbSNP:121913230
2675+a, gdbSNP:121913431
2685+c, tdbSNP:397517124
2703+a, gdbSNP:56183713
2709+c, tdbSNP:367859869
2710+a, gdbSNP:397517125
2726+a, tdbSNP:150749913
2733+a, gdbSNP:41420046
2737+c, tdbSNP:371228501
2738+a, gdbSNP:150036236
2739+c, tdbSNP:182196240
2743+g, tdbSNP:397517126
2746+c, g, tdbSNP:397517127
2750+a, tdbSNP:397517128
2752+c, tdbSNP:374952732
2753+a, gdbSNP:146121458
2754+c, tdbSNP:2229066
2764+a, gdbSNP:143884981
2773+a, gdbSNP:146795390
2789+c, tdbSNP:148934350
2790+a, g, tdbSNP:104886012
2818+a, c, tdbSNP:121913443
2819+g, tdbSNP:121434568
2820+g, tdbSNP:397517129
2826+a, tdbSNP:397517130
2828+a, g, tdbSNP:121913444
2838+a, gdbSNP:397517131
2843+a, tdbSNP:397517132
2844+a, gdbSNP:397517133
2848+a, gdbSNP:104886013
2858+c, gdbSNP:397517134
2888+c, tdbSNP:397517136
2900+c, tdbSNP:397517137
2921+c, tdbSNP:151064287
2945+a, tdbSNP:376176117
2955+c, tdbSNP:1140475
2992+a, gdbSNP:376822837
2994+c, tdbSNP:41396448
3025+c, tdbSNP:374672672
3085+a, gdbSNP:368698152
3108+c, tdbSNP:397517138
3109+a, gdbSNP:201830126
3112+a, gdbSNP:104886026
3130+c, gdbSNP:17337451
3131+a, gdbSNP:144496976
3144+c, tdbSNP:142305759
3175+c, tdbSNP:1140476
3209+a, cdbSNP:17290699
3228+a, gdbSNP:386564009
complement(3228)-g, adbSNP:2293347
3242+a, gdbSNP:149248025
3261+a, gdbSNP:55737335
3271+a, gdbSNP:148019583
3315+c, tdbSNP:147381148
3332+c, tdbSNP:182857647
3333+a, gdbSNP:141489713
3345+c, tdbSNP:370198879
3347+g, tdbSNP:34352568
3358+c, tdbSNP:138104726
3374+a, gdbSNP:375035197
3385+a, gdbSNP:142442994
3387..3388+, gdbSNP:148997565
3389+c, tdbSNP:78244461
3449+a, gdbSNP:374501041
3456+c, tdbSNP:41494749
3471+c, tdbSNP:140117937
3477+a, gdbSNP:367750834
3483+c, gdbSNP:184614596
3490+a, tdbSNP:371229748
3495+a, cdbSNP:373990043
3514+c, tdbSNP:367870311
3534+c, tdbSNP:143770509
3549+c, gdbSNP:55796214
3553+a, gdbSNP:139388758
3556+c, tdbSNP:376598259
3570+c, tdbSNP:113361141
3580+a, cdbSNP:369498625
3597+c, tdbSNP:149995949
3600+a, gdbSNP:199838215
3629+c, tdbSNP:199738264
3673+c, gdbSNP:145189325
3696+a, gdbSNP:377189448
3700+c, gdbSNP:368892932
3713+a, cdbSNP:149174093
3718+c, gdbSNP:140028234
3726+a, gdbSNP:201196771
3731+a, gdbSNP:41321844
3764+a, cdbSNP:147896627
3793+c, tdbSNP:199661469
3818+c, tdbSNP:372948989
3837+c, tdbSNP:376541336
3838+c, tdbSNP:142188270
3847+a, gdbSNP:369585356
3848+c, tdbSNP:201717672
3849+a, gdbSNP:202156403
3875+c, tdbSNP:35918369
3888+a, gdbSNP:200914796
3900+c, tdbSNP:372860080
3914+c, tdbSNP:17290755
3920+a, cdbSNP:183176784
3921+a, gdbSNP:201214891
3949..3950+, acagcaggtccdbSNP:370844927
3957+c, tdbSNP:17290762
3959+g, tdbSNP:201415685
4016+a, gdbSNP:17337528
4026+a, gdbSNP:112336528
4074+, tdbSNP:78669011
4093+a, gdbSNP:145703432
4101+a, gdbSNP:17337535
4120+g, tdbSNP:187461906
4160..4161+, adbSNP:5884404
4175+c, tdbSNP:201581453
4271..4272+, gdbSNP:377284607
4326+g, tdbSNP:201854406
4367+c, gdbSNP:370498791
4403+c, tdbSNP:117722337
4443+a, gdbSNP:192601649
4491+c, tdbSNP:148966706
4517+, gdbSNP:55998486
4561+c, gdbSNP:372331538
4600+c, tdbSNP:3807362
complement(4653)-g, adbSNP:884225
4659+a, tdbSNP:376712694
4712+a, gdbSNP:185437934
4788+a, gdbSNP:1063486
4891+a, gdbSNP:17337549
4896+a, gdbSNP:111347164
4949+c, tdbSNP:41486949
4975+c, tdbSNP:954311
5040+c, tdbSNP:368494495
5046+a, gdbSNP:372235181
5114+a, gdbSNP:112622335
5131+c, tdbSNP:141571614
5159+, gdbSNP:35473039
5160+, gdbSNP:397740131
5177+a, gdbSNP:367884402
5273+a, gdbSNP:150522314
5298+a, gdbSNP:116203092
5306..5307+, ccdbSNP:35700282
5313+c, tdbSNP:41454444
5482+c, tdbSNP:139451510
5513+c, tdbSNP:41347952
5526..5534+, agcccctacdbSNP:377500657
5529..5537+, ccctacagcdbSNP:368218939
5559+g, tdbSNP:371801373
5596+c, tdbSNP:373680498
Gene SymbolEGFR
Gene SynonymERBB; ERBB1; HER1; mENA; PIG61
Locus Map7p12
Title MET is a potential target for use in combination therapy with EGFR inhibition in triple-negative/basal-like breast cancer .
Author Kim,Y.J., Choi,J.S., Seo,J., Song,J.Y., Lee,S.E., Kwon,M.J., Kwon,M.J., Kundu,J., Jung,K., Oh,E., Shin,Y.K. and Choi,Y.L.
Journal Int. J. Cancer 134 (10), 2424-2436 (2014)
Title Assessment and prognostic significance of the epidermal growth factor receptor vIII mutation in glioblastoma patients treated with concurrent and adjuvant temozolomide radiochemotherapy .
Author Weller M, Kaulich K, Hentschel B, Felsberg J, Gramatzki D, Pietsch T, Simon M, Westphal M, Schackert G, Tonn JC, von Deimling A, Davis T, Weiss WA, Loeffler M and Reifenberger G.
Journal Int. J. Cancer 134 (10), 2437-2447 (2014)
Title A glioma classification scheme based on coexpression modules of .
Author Sun Y, Zhang W, Chen D, Lv Y, Zheng J, Lilljebjorn H, Ran L, Bao Z, Soneson C, Sjogren HO, Salford LG, Ji J, French PJ, Fioretos T, Jiang T and Fan X.
Journal Proc. Natl. Acad. Sci. U.S.A. 111 (9), 3538-3543 (2014)
Title Oncogenic potential of CK2alpha and its regulatory role in EGF-induced HDAC2 expression in human liver cancer .
Author Kim,H.S., Chang,Y.G., Bae,H.J., Eun,J.W., Shen,Q., Park,S.J., Shin,W.C., Lee,E.K., Park,S., Ahn,Y.M., Park,W.S., Lee,J.Y. and Nam,S.W.
Journal FEBS J. 281 (3), 851-861 (2014)
Title Assessment of expression of epidermal growth factor receptor and p53 in meningiomas .
Author Narla S, Uppin MS, Saradhi MV, Sahu BP, Purohit AK and Sundaram C.
Journal Neurol India 62 (1), 37-41 (2014)
Title The SH2 and SH3 domain-containing Nck protein is oncogenic and a common target for phosphorylation by different surface receptors .
Author Li W, Hu P, Skolnik EY, Ullrich A and Schlessinger J.
Journal Mol. Cell. Biol. 12 (12), 5824-5833 (1992)
Title Identification of the two major epidermal growth factor-induced tyrosine phosphorylation sites in the microvillar core protein ezrin .
Author Krieg J and Hunter T.
Journal J. Biol. Chem. 267 (27), 19258-19265 (1992)
Title The SH2 and SH3 domain-containing protein GRB2 links receptor tyrosine kinases to ras signaling .
Author Lowenstein EJ, Daly RJ, Batzer AG, Li W, Margolis B, Lammers R, Ullrich A, Skolnik EY, Bar-Sagi D and Schlessinger J.
Journal Cell 70 (3), 431-442 (1992)
Title Two chromosome 7 dinucleotide repeat polymorphisms at gene loci epidermal growth factor receptor (EGFR) and pro alpha 2 (I) collagen (COL1A2) .
Author Chi DD, Hing AV, Helms C, Steinbrueck T, Mishra SK and Donis-Keller H.
Journal Hum. Mol. Genet. 1 (2), 135 (1992)
Title Mechanism of desensitization of the epidermal growth factor receptor protein-tyrosine kinase .
Author Countaway JL, Nairn AC and Davis RJ.
Journal J. Biol. Chem. 267 (2), 1129-1140 (1992)

Our customer service representatives are available 24 hours a day, Monday through Friday; please contact us anytime for assistance.