• THAT   AND

Sequence in raw or FASTA format:


Blast Method:


Homo sapiens parkinson protein 7 (PARK7), transcript variant 1, mRNA.

Clone ID Definition Vector Stock Status Price *Turnaround time Select
OHu26877 Homo sapiens parkinson protein 7 (PARK7), transcript variant 1, mRNA. pcDNA3.1+-DYK In-stock $99.00 5-7
OHu26877C Homo sapiens parkinson protein 7 (PARK7), transcript variant 1, mRNA. Your vector of choice In-stock $149.00 5-7
OHu26877M Mutant Clone for Homo sapiens parkinson protein 7 (PARK7), transcript variant 1, mRNA. pcDNA3.1+-DYK In-stock Starting from $149 Additional 5 days
OHu26877CM Mutant Clone for Homo sapiens parkinson protein 7 (PARK7), transcript variant 1, mRNA. Your vector of choice In-stock Starting from $149 Additional 5 days

*Business Day

Related Services

Sequence Information ORF Nucleotide Sequence
Protein sequence
Vector pcDNA3.1+-DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+-DYK N terminal DYKDDDK tags
Restriction Sites Hind III- EcoR I
RefSeq Version NM_007262.4, 183227676
Length 570 bp
Structure linear
Update Date 25-MAY-2014
Organism Homo sapiens (human)
Definition Homo sapiens parkinson protein 7 (PARK7), transcript variant 1, mRNA.
Product protein DJ-1

Summary: The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008].

Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.

RefSeq NP_009193.2
CDS 164..733
Misc Feature(1)146..148
Misc Feature(2)176..715
Misc Feature(3)176..715
Misc Feature(4)179..679
Misc Feature(5)362..364
Misc Feature(6)362..364
Misc Feature(7)479..481
Misc Feature(8)479..481
Misc Feature(9)551..553
Exon (1)1..140
Gene Synonym:DJ-1; DJ1; HEL-S-67p
Exon (2)141..253
Gene Synonym:DJ-1; DJ1; HEL-S-67p
Exon (3)254..355
Gene Synonym:DJ-1; DJ1; HEL-S-67p
Exon (4)356..415
Gene Synonym:DJ-1; DJ1; HEL-S-67p
Exon (5)416..485
Gene Synonym:DJ-1; DJ1; HEL-S-67p
Exon (6)486..572
Gene Synonym:DJ-1; DJ1; HEL-S-67p
Exon (7)573..961
Gene Synonym:DJ-1; DJ1; HEL-S-67p
Order your protein of interest with our Guaranteed or It's Free Service now! For details, please click here.
Position Chain Variation Link
27..65+aaggccggacggcgcgcgtgcgtgctggcgtgcgttcac, gaggccggacggcgcgcgtgcgtgctggcgtgcgttcatdbSNP:386628237
27+a, gdbSNP:17523802
65..66+c, tdbSNP:11548935
65+c, tdbSNP:226249
80..81+gg, tcdbSNP:367687042
84+a, tdbSNP:140230911
94+c, tdbSNP:11121064
142+a, gdbSNP:386440377
142+c, g, tdbSNP:11548933
153+a, gdbSNP:200286981
174+a, gdbSNP:190738218
212+a, c, gdbSNP:147698459
222+c, tdbSNP:370430693
241+a, gdbSNP:74315351
245+a, cdbSNP:374429170
246+a, gdbSNP:142405016
249+c, gdbSNP:376428939
265+c, tdbSNP:374236728
278+g, tdbSNP:137853051
306+a, gdbSNP:145727915
324+a, cdbSNP:368405677
329+a, gdbSNP:114601558
355+c, gdbSNP:74315353
361+a, gdbSNP:201258798
371+a, gdbSNP:200113696
381+c, tdbSNP:367584305
397+c, tdbSNP:11548937
398+a, gdbSNP:45601537
410..411+, adbSNP:35566631
425+a, gdbSNP:377263767
455+c, tdbSNP:182164240
456+a, gdbSNP:71653619
461+a, gdbSNP:200696147
462+c, gdbSNP:199529022
464+c, gdbSNP:199719494
472+c, tdbSNP:368221790
482+c, gdbSNP:145196092
491+a, gdbSNP:45577037
534+c, gdbSNP:371246061
542+c, gdbSNP:373618614
557+a, gdbSNP:200894731
559+a, gdbSNP:200099666
562+c, gdbSNP:398124657
563+a, gdbSNP:202097100
566+a, gdbSNP:201016410
581+a, gdbSNP:199728189
592+a, gdbSNP:140517273
597+a, gdbSNP:148682310
599+a, gdbSNP:375023875
609+a, cdbSNP:74315352
610+c, tdbSNP:144764347
611+a, gdbSNP:368420490
629+c, tdbSNP:61772692
643+c, tdbSNP:370308517
650+a, gdbSNP:74315354
657+c, tdbSNP:371514726
660+c, tdbSNP:28938172
664+a, gdbSNP:71653621
665+a, gdbSNP:374962638
670+g, tdbSNP:368818999
697+a, gdbSNP:149974320
698+a, gdbSNP:71653622
715+a, cdbSNP:3203837
770+c, tdbSNP:199752316
771+a, gdbSNP:375081848
782+a, gdbSNP:371482698
817+a, tdbSNP:112196008
857+c, tdbSNP:147437667
920+c, tdbSNP:1044766
Gene SymbolPARK7
Gene SynonymDJ-1; DJ1; HEL-S-67p
Locus Map1p36.23
All Transcripts
RefSeq Accession Definition Stock Status Price Turnaround time Business Day Select
NM_007262 Homo sapiens parkinson protein 7 (PARK7), transcript variant 1, mRNA. In-stock $99.00 5-7
NM_007262 Homo sapiens parkinson protein 7 (PARK7), transcript variant 1, mRNA. In-stock $99.00 5-7
NM_007262 Homo sapiens parkinson protein 7 (PARK7), transcript variant 1, mRNA. In-stock $99.00 5-7
Title Altered expression of DJ-1 and PINK1 in sporadic ALS and in the SOD1(G93A) ALS mouse model .
Author Knippenberg S, Sipos J, Thau-Habermann N, Korner S, Rath KJ, Dengler R and Petri S.
Journal J. Neuropathol. Exp. Neurol. 72 (11), 1052-1061 (2013)
Title High-expression of DJ-1 and loss of PTEN associated with tumor metastasis and correlated with poor prognosis of gastric carcinoma .
Author Li Y, Cui J, Zhang CH, Yang DJ, Chen JH, Zan WH, Li B, Li Z and He YL.
Journal Int J Med Sci 10 (12), 1689-1697 (2013)
Title Identification of the recognition sequence and target proteins for DJ-1 protease .
Author Mitsugi H, Niki T, Takahashi-Niki K, Tanimura K, Yoshizawa-Kumagaye K, Tsunemi M, Iguchi-Ariga SM and Ariga H.
Journal FEBS Lett. 587 (16), 2493-2499 (2013)
Title DJ-1-dependent regulation of oxidative stress in the retinal pigment epithelium (RPE) .
Author Shadrach KG, Rayborn ME, Hollyfield JG and Bonilha VL.
Journal PLoS ONE 8 (7), E67983 (2013)
Title Incidence of mutations in the PARK2, PINK1, PARK7 genes in Polish early-onset Parkinson disease patients .
Author Koziorowski D, Hoffman-Zacharska D, Slawek J, Jamrozik Z, Janik P, Potulska-Chromik A, Roszmann A, Tataj R, Bal J and Friedman A.
Journal Neurol. Neurochir. Pol. 47 (4), 319-324 (2013)
Title DJ-1 positively regulates the androgen receptor by impairing the binding of PIASx alpha to the receptor .
Author Takahashi K, Taira T, Niki T, Seino C, Iguchi-Ariga SM and Ariga H.
Journal J. Biol. Chem. 276 (40), 37556-37563 (2001)
Title Park7, a novel locus for autosomal recessive early-onset parkinsonism, on chromosome 1p36 .
Author van Duijn CM, Dekker MC, Bonifati V, Galjaard RJ, Houwing-Duistermaat JJ, Snijders PJ, Testers L, Breedveld GJ, Horstink M, Sandkuijl LA, van Swieten JC, Oostra BA and Heutink P.
Journal Am. J. Hum. Genet. 69 (3), 629-634 (2001)
Title Molecular cloning of human and mouse DJ-1 genes and identification of Sp1-dependent activation of the human DJ-1 promoter .
Author Taira T, Takahashi K, Kitagawa R, Iguchi-Ariga SM and Ariga H.
Journal Gene 263 (1-2), 285-292 (2001)
Title DJ-1, a novel oncogene which transforms mouse NIH3T3 cells in cooperation with ras .
Author Nagakubo D, Taira T, Kitaura H, Ikeda M, Tamai K, Iguchi-Ariga SM and Ariga H.
Journal Biochem. Biophys. Res. Commun. 231 (2), 509-513 (1997)
Title Parkinson Disease Overview .
Author Farlow,J., Pankratz,N.D., Wojcieszek,J. and Foroud,T.
Journal (in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)

Our customer service representatives are available 24 hours a day, Monday through Friday; please contact us anytime for assistance.