• THAT   AND

Sequence in raw or FASTA format:


Blast Method:


Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant 1, mRNA.

Clone ID Definition Vector Stock Status Price *Turnaround time Order
OHu18572 Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant 1, mRNA. pcDNA3.1+-DYK On-demand $2699.00 30
OHu18572C Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant 1, mRNA. Customized vector On-demand $2699.00 30

*Business Day

Mutation services

Sequence Information ORF Nucleotide Sequence
Protein sequence
Vector pcDNA3.1+-DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+-DYK N terminal DYKDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
RefSeq Version NM_007294.3, 237757283
Length 5592 bp
Structure linear
Update Date 03-MAY-2014
Organism Homo sapiens (human)
Definition Homo sapiens breast cancer 1, early onset (BRCA1), transcript variant 1, mRNA.
Product breast cancer type 1 susceptibility protein isoform 1

Summary: This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009].

Transcript Variant: This variant (1, also known as BRCA1a) represents the more frequently occurring transcript. It encodes the full-length BRCA1 protein (isoform 1), which is also known as p220.

RefSeq NP_009225.1
CDS 233..5824
Misc Feature(1)93
Misc Feature(2)209..211
Misc Feature(3)233..235
Misc Feature(4)233..235
Misc Feature(5)299..436
Misc Feature(6)order(302..304,311..313,347..349,353..355,362..364,
Misc Feature(7)572..574
Misc Feature(8)1154..1156
Misc Feature(9)1154..1156
Misc Feature(10)1262..1753
Misc Feature(11)1415..1417
Misc Feature(12)1424..1426
Misc Feature(13)1499..1501
Misc Feature(14)1757..1759
Misc Feature(15)2174..3166
Misc Feature(16)2312..2314
Misc Feature(17)2489..2491
Misc Feature(18)3194..3196
Misc Feature(19)3194..3196
Misc Feature(20)3659..3661
Misc Feature(21)3659..3661
Misc Feature(22)3695..3697
Misc Feature(23)3797..3799
Misc Feature(24)3863..3865
Misc Feature(25)3863..3865
Misc Feature(26)3866..3868
Misc Feature(27)3881..3883
Misc Feature(28)3881..3883
Misc Feature(29)3884..3886
Misc Feature(30)3884..3886
Misc Feature(31)3947..3949
Misc Feature(32)3965..3967
Misc Feature(33)4070..4072
Misc Feature(34)4070..4072
Misc Feature(35)4214..4216
Misc Feature(36)4220..4222
Misc Feature(37)4238..4240
Misc Feature(38)4238..4240
Misc Feature(39)4256..4258
Misc Feature(40)4256..4258
Misc Feature(41)4391..4393
Misc Feature(42)4391..4393
Misc Feature(43)4391..4393
Misc Feature(44)4412..4414
Misc Feature(45)4412..4414
Misc Feature(46)4421..4504
Misc Feature(47)4499..4501
Misc Feature(48)4499..4501
Misc Feature(49)4499..4501
Misc Feature(50)4601..4603
Misc Feature(51)4601..4603
Misc Feature(52)4601..4603
Misc Feature(53)4628..4630
Misc Feature(54)4721..4723
Misc Feature(55)4727..4729
Misc Feature(56)4802..4804
Misc Feature(57)4802..4804
Misc Feature(58)4802..4804
Misc Feature(59)4856..4858
Misc Feature(60)4946..4948
Misc Feature(61)5180..5404
Misc Feature(62)order(5219..5221,5231..5233,5240..5242,5249..5251,
Misc Feature(63)5330..5332
Misc Feature(64)order(5384..5386,5396..5398)
Misc Feature(65)5390..5392
Misc Feature(66)5519..5758
Misc Feature(67)order(5564..5566,5576..5578,5585..5587,5594..5596,
Misc Feature(68)order(5741..5743,5753..5755)
Exon (1)1..213
Exon (2)214..312
Exon (3)313..366
Exon (4)367..444
Exon (5)445..533
Exon (6)534..673
Exon (7)674..779
Exon (8)780..825
Exon (9)826..902
Exon (10)903..4328
Exon (11)4329..4417
Exon (12)4418..4589
Exon (13)4590..4716
Exon (14)4717..4907
Exon (15)4908..5218
Exon (16)5219..5306
Exon (17)5307..5384
Exon (18)5385..5425
Exon (19)5426..5509
Exon (20)5510..5564
Exon (21)5565..5638
Exon (22)5639..5699
Exon (23)5700..7207
Order your protein of interest with our Guaranteed or It's Free Service now! For details, please click here.
Position Chain Variation Link
complement(41)-g, adbSNP:113323025
87+, tdbSNP:8176075
complement(98..99)-, tdbSNP:35436937
complement(108)-g, adbSNP:148196794
complement(110)-c, adbSNP:190861568
complement(129..130)-, adbSNP:34191881
complement(137)-c, adbSNP:187992882
complement(147)-g, adbSNP:143160357
219+c, tdbSNP:273897661
220+a, gdbSNP:431825383
222+a, cdbSNP:273897654
230+c, gdbSNP:273900720
231+a, tdbSNP:273899693
233+a, gdbSNP:80357287
234+c, g, tdbSNP:80357111
235+g, tdbSNP:80357475
240+g, tdbSNP:397509332
250..251+, gdbSNP:398122648
251..279+, cgcgttgaagaagtacaaaatgtcattaadbSNP:80359871
251+c, tdbSNP:80356994
252..260+, gcgttgaagdbSNP:80359887
complement(252)-t, cdbSNP:144792613
complement(253)-g, adbSNP:149402012
264..265+, cdbSNP:80357811
264+c, tdbSNP:80357017
266+c, tdbSNP:80357134
269..272+, aatgdbSNP:80357530
274+a, cdbSNP:80356827
275+a, cdbSNP:80357031
276+c, tdbSNP:80357316
285+a, c, tdbSNP:80356929
287+c, tdbSNP:397509299
complement(292)-t, cdbSNP:202168814
293+, adbSNP:273902778
293+a, gdbSNP:80357406
294..295+, tdbSNP:397509303
296..297+, ttdbSNP:397509304
296+, tdbSNP:80357803
297..298+, ttdbSNP:80357642
297+c, tdbSNP:80357438
complement(298..299)-, ctdbSNP:386626651
complement(299)-g, cdbSNP:372047427
300..301+, adbSNP:397509309
300..301+, agdbSNP:386833395
301..311+, gtgtcccatctdbSNP:80357696
301..302+, agdbSNP:80357914
302..312+, tgtcccatctgdbSNP:80359877
302..303+, a, tgtcdbSNP:80357536
302+c, tdbSNP:80357410
303+a, gdbSNP:80357198
304..305+, tcdbSNP:397509311
305..306+, ccdbSNP:80357633
305..306+, tgtcdbSNP:397509310
305+a, cdbSNP:397509313
307+c, tdbSNP:80356839
310..311+, catctgdbSNP:273902787
313+, tdbSNP:397507257
315..316+, tgdbSNP:80357728
315+c, tdbSNP:80357266
317+g, tdbSNP:80357443
321+a, tdbSNP:397509331
325+c, gdbSNP:80357000
329+c, gdbSNP:80357066
333+, cdbSNP:80357750
complement(339)-t, gdbSNP:183557525
342+a, c, gdbSNP:80356880
344..345+, aadbSNP:80357949
347+a, c, g, tdbSNP:80357164
348+a, g, tdbSNP:80357498
349..350+, tgdbSNP:80357972
354+, adbSNP:397508847
354+a, gdbSNP:80357276
356+, adbSNP:80357943
356+a, gdbSNP:80357163
362..363+, tdbSNP:431825385
362+a, c, g, tdbSNP:80357327
362+, tdbSNP:80357951
363+a, g, tdbSNP:80357446
365..366+, aadbSNP:397508857
366+a, cdbSNP:80356863
367+a, tdbSNP:80356883
371..372+, tdbSNP:80357734
371+g, tdbSNP:80357370
372+a, g, tdbSNP:80357150
373+a, cdbSNP:398122635
375+, tdbSNP:80357637
376+, gdbSNP:80357682
378+g, tdbSNP:273897660
382+, adbSNP:273897662
386+a, c, tdbSNP:80357084
392+a, c, tdbSNP:80356864
392+, cdbSNP:397508890
393+a, gdbSNP:397507189
398..399+, gadbSNP:80357550
399+a, gdbSNP:397508897
400+a, tdbSNP:397508898
403+, gdbSNP:80357660
404+c, gdbSNP:397508904
complement(408)-g, adbSNP:199522616
410..411+, cadbSNP:397508907
410+c, tdbSNP:80357471
411+, adbSNP:80357591
complement(411)-t, cdbSNP:373655067
complement(413)-t, cdbSNP:386576380
414..415+, gtdbSNP:397508912
414+a, gdbSNP:80357093
420+a, c, tdbSNP:80357086
421..422+, adbSNP:273897665
421+a, tdbSNP:80356956
422..425+, tgtadbSNP:397508917
422+c, g, tdbSNP:80357064
423+a, gdbSNP:55851803
427+, gdbSNP:80357869
431+a, g, tdbSNP:80357102
433+g, tdbSNP:80357033
435..436+, adbSNP:273898673
435..436+, tadbSNP:398122651
435+a, g, tdbSNP:80357116
438+a, cdbSNP:273898675
443..444+, adbSNP:397508938
443+a, gdbSNP:80357382
444+a, gdbSNP:80356913
448+a, cdbSNP:80356967
452+c, tdbSNP:80357234
456..459+, aaagdbSNP:80357697
462+c, g, tdbSNP:80357209
462+c, gtcaacttgttdbSNP:397508957
463+g, tdbSNP:80356847
464+, adbSNP:80357884
473..483+, caacttgttgadbSNP:398122659
473+c, tdbSNP:80357350
475+, adbSNP:273899684
482+g, tdbSNP:398122661
491+g, tdbSNP:80357091
498+c, tdbSNP:80357097
499+c, gdbSNP:80356963
501..513+, tttgtgcttttcadbSNP:80359879
501+c, tdbSNP:80357174
505+g, tdbSNP:397509006
518+a, gdbSNP:80357110
complement(520)-g, adbSNP:146085503
522..523+, cadbSNP:80357738
522+c, gdbSNP:431825393
524+c, g, tdbSNP:80357409
535+g, tdbSNP:80356936
537+c, gdbSNP:80357190
complement(546)-g, adbSNP:386576381
549+, adbSNP:80357950
553+, tdbSNP:80357544
561..562+, adbSNP:80357604
561..562+, agdbSNP:80357754
561+, adbSNP:397507214
561+a, cdbSNP:397509053
564+a, cdbSNP:80357312
572+c, tdbSNP:397509062
574..575+, tcdbSNP:80357881
578+a, gdbSNP:397509071
complement(598)-c, adbSNP:190900046
600+, cdbSNP:431825397
602+a, gdbSNP:80357448
604+a, cdbSNP:273900715
607..608+, tdbSNP:397509101
612+a, gdbSNP:80357189
621+a, g, tdbSNP:56055578
622+a, c, tdbSNP:80356888
623+a, tdbSNP:80357207
628+a, cdbSNP:80357413
629+a, c, tdbSNP:80357457
630..631+, gtdbSNP:80357568
630+a, gdbSNP:80357357
631..632+, tgdbSNP:397509126
638..639+, adbSNP:80357709
644..650+, ctacagadbSNP:80357816
complement(645)-g, adbSNP:200449040
647+c, tdbSNP:80357372
656+c, gdbSNP:397509156
657+a, cdbSNP:55971303
659+a, g, tdbSNP:80356991
661+a, cdbSNP:397507228
663+, adbSNP:397509162
669..672+, ccttdbSNP:397509168
674..676+, cagdbSNP:397509175
678+a, cdbSNP:397507233
complement(686)-t, cdbSNP:41286288
687+c, tdbSNP:80357275
688..689+, cadbSNP:80357882
689..690+, agdbSNP:397509185
complement(689)-c, adbSNP:386576382
695+c, g, tdbSNP:80357180
698..699+, cdbSNP:397507236
701+c, tdbSNP:80356897
702..709+, ctaaccttdbSNP:397509190
702..703+, ctdbSNP:80357887
702+c, gdbSNP:80357045
704+a, tdbSNP:397509192
710+a, gdbSNP:62625285
716+c, gdbSNP:55816927
717..718+, tgdbSNP:80357708
720+, gdbSNP:397509202
722+a, cdbSNP:80357384
725..726+, ctdbSNP:397509206
725+, cdbSNP:80357551
726..727+, tdbSNP:80357762
735+a, cdbSNP:273901743
737+c, tdbSNP:80357133
740+c, tdbSNP:80357325
741+a, gdbSNP:80357264
746+, cdbSNP:80357872
746+c, tdbSNP:80356947
752+, cdbSNP:80357639
760+a, gdbSNP:34545365
761+, tdbSNP:80357758
768+, adbSNP:397509273
775+a, gdbSNP:397507250
780+, gdbSNP:397509289
788+g, tdbSNP:397509298
799+c, tdbSNP:80356845
801..802+, aacgdbSNP:397509300
complement(802)-g, adbSNP:201536070
803+a, gdbSNP:80357090
804+a, tdbSNP:80357142
833+a, gdbSNP:80357109
839+a, gdbSNP:398122703
844+c, gdbSNP:80357394
848+c, tdbSNP:397509301
856..857+, agggatgaaatcaggagccadbSNP:397509302
complement(858)-g, adbSNP:201596327
869+a, gdbSNP:80357081
873+a, gdbSNP:55680408
878+a, gdbSNP:398122704
887+a, gdbSNP:273902779
891+c, gdbSNP:431825418
893+g, tdbSNP:80357088
complement(895)-t, cdbSNP:375952040
897+a, gdbSNP:398122705
899..900+, aadbSNP:397509305
900..901+, adbSNP:80357537
900+, adbSNP:80357745
900+a, gdbSNP:397509306
902+a, gdbSNP:431825419
908+, tdbSNP:80357941
909..910+, cdbSNP:397509307
910+a, tdbSNP:397509308
complement(915)-t, adbSNP:191872612
917+, tdbSNP:80357824
924+c, tdbSNP:80357001
925+a, g, tdbSNP:62625298
926+a, gdbSNP:55975699
927+a, tdbSNP:398122708
929..930+, gtdbSNP:80357747
939+c, gdbSNP:80356990
948+a, gdbSNP:80357396
949+g, tdbSNP:56310439
954+c, tdbSNP:80357351
963+, adbSNP:80357700
complement(965)-c, adbSNP:147519994
966+a, tdbSNP:80356865
969+, tdbSNP:397509312
974..975+, adbSNP:397509314
975+a, cdbSNP:80357062
977+a, tdbSNP:397507256
986+c, tdbSNP:273902786
987+a, gdbSNP:80357138
989+a, gdbSNP:80357293
995+g, tdbSNP:80357009
997+a, gdbSNP:62625299
complement(999)-c, adbSNP:11658785
1000..1001+, a, agdbSNP:397509316
1005+c, gdbSNP:80357225
1007+, gdbSNP:80357628
1015+g, tdbSNP:80357321
1018+a, gdbSNP:397509317
1019+g, tdbSNP:397509318
1020+c, g, tdbSNP:397509319
1021+c, tdbSNP:397509320
1022+a, tdbSNP:397509321
1023..1026+, gttcdbSNP:80357707
1023+a, gdbSNP:397509322
1024+g, tdbSNP:80357214
1026..1027+, ctdbSNP:80357955
complement(1027)-g, adbSNP:201441987
1029..1030+, ttdbSNP:80357789
1030..1031+, ttdbSNP:80357724
1031..1032+, tdbSNP:397509323
1032+c, gdbSNP:80357392
complement(1039)-t, cdbSNP:149867679
1041+, adbSNP:80357965
1043+a, c, gdbSNP:80357244
1054+a, tdbSNP:80357331
1055+a, gdbSNP:8176153
complement(1055)-g, adbSNP:386615762
1056..1057+, agccatgtgg, gagccatgtggdbSNP:387906563
1056+a, gdbSNP:397509327
1057+c, tdbSNP:397509328
1059..1060+, tdbSNP:397509329
1059+c, gdbSNP:80357436
complement(1060)-t, cdbSNP:186274774
1067+, cdbSNP:80357523
1068+a, gdbSNP:80357482
1071+c, gdbSNP:80357199
1074..1075+, agdbSNP:80357792
1075..1078+, ctcadbSNP:80357919
1080+a, g, tdbSNP:273902792
1082..1083+, tcattacdbSNP:80357989
1082+c, tdbSNP:397509330
1083..1084+, agdbSNP:80357719
1083+a, gdbSNP:80357039
complement(1111)-c, adbSNP:139433219
1114+, adbSNP:80357587
1121+a, cdbSNP:80357196
1122+a, tdbSNP:80356924
1123+a, gdbSNP:80357103
1126..1127+, tgdbSNP:80357759
1127..1128+, aatgdbSNP:80357806
1127..1128+, gtdbSNP:80357670
1132+a, cdbSNP:80356861
1134..1135+, tdbSNP:80357726
1135..1136+, cdbSNP:397509333
1136+, gdbSNP:273903793
1141+, adbSNP:397509334
1143+, tdbSNP:80357622
1154..1156+agc, tdbSNP:397509335
1154..1155+, agdbSNP:80357644
1154+a, gdbSNP:55767801
1155+, gdbSNP:80357953
1156+, cdbSNP:397509336
1158+a, cdbSNP:80356877
1159+, adbSNP:397509337
1160+c, tdbSNP:397509338
1161+, adbSNP:80357844
1162+, gdbSNP:80357689
1168+, cdbSNP:398122709
1175+a, gdbSNP:80357050
1178+a, gdbSNP:55874646
1181..1185+, caacadbSNP:80357555
1181+c, tdbSNP:80357211
1185..1186+, tgdbSNP:80357690
1188+a, gdbSNP:397507258
1191..1192+, gadbSNP:397509339
1193+, tdbSNP:397509340
1194+a, gdbSNP:80357292
1196+a, c, gdbSNP:80357252
1196+, gdbSNP:273903794
1201+a, tdbSNP:45586033
1212..1213+, cadbSNP:80357610
1213..1214+, atdbSNP:80357772
1216..1217+, cdbSNP:80357775
1217..1218+, aadbSNP:397509341
1220+a, gdbSNP:397507259
1225+c, gdbSNP:80357140
1226+c, tdbSNP:80357176
1227+a, gdbSNP:80357464
1228+g, tdbSNP:80356836
1230+c, tdbSNP:431825420
1233+a, c, tdbSNP:41286290
complement(1240..1241)-, tdbSNP:67284603
1242..1243+, adbSNP:80357563
1242+, adbSNP:80357911
1244+a, tdbSNP:397508826
1247+a, gdbSNP:55842957
1248..1249+, adbSNP:80357569
1248+, adbSNP:80357618
1250+, gdbSNP:80357774
1265+g, tdbSNP:80356961
1268+c, tdbSNP:80357015
1271..1272+, ctdbSNP:397508827
1272+, tdbSNP:397508828
1277+g, tdbSNP:80357338
1286+g, tdbSNP:80357472
1290+a, gdbSNP:80356908
1291+a, gdbSNP:80356935
1295+a, tdbSNP:397508829
1296+a, gdbSNP:80357246
1297+a, gdbSNP:41286292
1298+c, tdbSNP:80357215
1299+, adbSNP:80357796
complement(1299)-g, adbSNP:386545563
1300..1309+, gaaactgccadbSNP:397508830
1304+, cdbSNP:80357836
complement(1304)-g, adbSNP:377310179
1308+c, tdbSNP:397508831
1312..1313+, adbSNP:397508832
1313+c, tdbSNP:80356946
1314..1324+, cagagaatcctdbSNP:80359880
1314+c, gdbSNP:397508833
1318..1319+, gadbSNP:80357897
1320+, adbSNP:80357954
1323+, cdbSNP:397508834
1325+a, tdbSNP:398122627
1331..1332+, adbSNP:397508835
1332..1333+, cdbSNP:397508836
1333..1334+, cdbSNP:80357665
1334+g, tdbSNP:80357139
1337..1339+, gatdbSNP:80358325
1337+a, gdbSNP:56056711
1338..1340+, atgdbSNP:80358326
1338+a, gdbSNP:80357416
1344+, cdbSNP:397508837
1347+a, gdbSNP:397508838
1348+a, gdbSNP:80357468
complement(1349)-t, cdbSNP:373218165
1353..1355+cac, tdbSNP:273897652
1353+, cdbSNP:80357612
1353+c, tdbSNP:80357235
1354..1355+, acdbSNP:397508839
1359+, adbSNP:80357821
1359+a, gdbSNP:80356976
1361..1362+, adbSNP:80357776
1362+a, gdbSNP:80357398
1370+c, tdbSNP:397508840
1373+a, tdbSNP:80357385
1380..1381+, atdbSNP:431825384
1384..1385+, gdbSNP:397508841
1390..1391+, ttdbSNP:397508842
1391..1392+, tdbSNP:397508843
complement(1394)-t, cdbSNP:111312760
1397+, adbSNP:80357985
1398+, gdbSNP:273897653
1407..1450+, tgttaggttctgatgactcacatgatggggagtctgaatcaaatdbSNP:397507183
1407..1449+, tgttaggttctgatgactcacatgatggggagtctgaatcaaadbSNP:397507182
1407..1448+, tgttaggttctgatgactcacatgatggggagtctgaatcaadbSNP:397507181
1407..1447+, tgttaggttctgatgactcacatgatggggagtctgaatcadbSNP:397507180
1407..1446+, tgttaggttctgatgactcacatgatggggagtctgaatcdbSNP:80359874
1407..1410+, tgttdbSNP:397508844
1420+, tdbSNP:397508845
1425+a, c, gdbSNP:80357068
1434+a, c, gdbSNP:397507184
1436+, gdbSNP:80357859
1436+g, tdbSNP:273897655
1440+c, tdbSNP:80356934
complement(1441)-g, adbSNP:369363742
1446+a, c, gdbSNP:80357481
1449+, adbSNP:397508846
1454+a, gdbSNP:80357253
complement(1457)-g, cdbSNP:144698700
complement(1459)-t, cdbSNP:149349675
1463+a, gdbSNP:80357301
1464..1465+, atdbSNP:397508848
1465+g, tdbSNP:80357024
1472..1478+, gacgttcdbSNP:80357964
1473..1474+, adbSNP:80357514
complement(1474)-g, adbSNP:372400428
1482+a, gdbSNP:80357113
1483+g, tdbSNP:80357197
1484+g, tdbSNP:80357083
1487+, gdbSNP:80357535
1488+g, tdbSNP:398122628
1490+g, tdbSNP:80357488
1493+a, gdbSNP:80357046
1494+a, gdbSNP:397508849
1497..1498+, adbSNP:80357809
1498..1499+, atdbSNP:397508850
1498+g, tdbSNP:80357417
1508+, tdbSNP:80357766
1511+g, tdbSNP:397508851
1519..1520+, adbSNP:80357576
1524..1525+, tdbSNP:80357528
1524+g, tdbSNP:80357346
1524+, tdbSNP:398122629
1525..1527+act, gadbSNP:397508852
complement(1527)-g, adbSNP:369394098
1529+, gdbSNP:80357794
1542+a, cdbSNP:80357255
1551..1552+, tdbSNP:397508853
1551+c, tdbSNP:273897656
1551+, tdbSNP:80357683
1555..1556+, atdbSNP:80357570
1558..1559+, gtdbSNP:80357543
1558+a, tdbSNP:397508854
1559+a, tdbSNP:398122630
1565+c, g, tdbSNP:80356915
1567..1568+, aadbSNP:80357978
1568..1569+, adbSNP:398122631
1571..1572+, gdbSNP:397508855
1572..1573+, gdbSNP:80357597
1584+a, c, gdbSNP:80356891
1588+, adbSNP:80357939
1592..1593+, agdbSNP:80357969
1593+a, gdbSNP:80357181
1593+, gdbSNP:398122632
1595..1596+, gadbSNP:397508860
1599+c, tdbSNP:80357360
1603+, adbSNP:397508861
1606+, cdbSNP:397508862
1609..1610+, aadbSNP:398122633
1611+g, tdbSNP:398122634
1612..1613+, adbSNP:80357714
1612+, adbSNP:397508863
1613+c, tdbSNP:62625300
1615+a, tdbSNP:56046357
1615+, tdbSNP:80357879
1616+a, gdbSNP:80357221
1618..1619+, gdbSNP:397508865
1618+, gdbSNP:80357722
1619..1622+aaaa, gaaagdbSNP:397508866
1619+, adbSNP:273897658
1621..1622+aa, gdbSNP:273897659
1622..1623+, gdbSNP:397508867
1622+, adbSNP:80357770
1623+c, tdbSNP:62625301
1624..1625+, cdbSNP:80357592
1624+, cdbSNP:397508868
1625..1626+, gggaaaacctdbSNP:397508864
1625+g, tdbSNP:397508869
1628+c, g, tdbSNP:80356964
complement(1629)-t, cdbSNP:199540030
1631+a, tdbSNP:80357279
1635+, adbSNP:397508870
1637+a, gdbSNP:397507187
1637+, gdbSNP:397508871
1638+c, gdbSNP:80357073
1653+g, tdbSNP:80357490
1659+a, gdbSNP:55720177
1666+, tdbSNP:431825386
1671..1672+, adbSNP:80357505
1672..1673+, adbSNP:80357778
1676..1679+, attadbSNP:80357801
1676+, adbSNP:80357648
1678..1680+, tatdbSNP:80358327
1680+c, tdbSNP:80357489
1682+g, tdbSNP:80357304
1690+a, g, tdbSNP:80357400
complement(1691)-c, adbSNP:369588942
1694..1695+, adbSNP:80357599
1697+a, g, tdbSNP:80357167
1703+c, tdbSNP:62625303
1704+a, gdbSNP:80357376
1712+c, tdbSNP:80357010
1715..1730+, gagcgtcccctcacaadbSNP:397508872
1718+a, c, tdbSNP:28897676
1724+, cdbSNP:80357527
1729..1732+, aaatdbSNP:80357632
1731+, adbSNP:397508874
complement(1734)-t, cdbSNP:113656989
1736..1750+, ttaaagcgtaaaaggdbSNP:397508875
1736..1740+, ttaaadbSNP:80357888
1738..1742+, aaagcdbSNP:397508876
1740..1741+, ataaattaaadbSNP:397508873
1740+, adbSNP:80357506
1740+a, gdbSNP:62625304
1742+, cdbSNP:80357908
1742+c, tdbSNP:80357445
1743..1744+, gdbSNP:80357817
1743+a, gdbSNP:56272539
1744..1745+, tdbSNP:398122636
1745..1746+, tdbSNP:397508878
1745+a, tdbSNP:397508877
1749..1753+, ggagadbSNP:397508879
1750+, gdbSNP:80357947
1751+a, tdbSNP:397508880
1752+g, tdbSNP:80357224
1755+, cdbSNP:80357782
1755+c, tdbSNP:398122637
complement(1756)-g, adbSNP:200616937
1761+c, gdbSNP:80357427
1762+, adbSNP:80357735
1764+g, tdbSNP:397507188
1766+c, tdbSNP:41286294
1773+c, gdbSNP:56100707
1776+a, gdbSNP:397508881
1783+, tdbSNP:80357630
1787+a, cdbSNP:397508882
1788+, adbSNP:80357662
1793..1796+gcag, taaadbSNP:397508883
1793..1794+gc, tadbSNP:273897663
1793+a, gdbSNP:80357122
1796+a, gdbSNP:80357453
1797..1798+, cdbSNP:397508884
1800+g, tdbSNP:397508885
1802+, gdbSNP:397508886
1803+c, tdbSNP:80357333
1805+a, gdbSNP:80357273
1808+c, tdbSNP:80356984
1811..1812+, aadbSNP:431825387
1813+c, gdbSNP:80357493
1814..1820+, actcctgdbSNP:80357613
1815..1821+, ctcctgadbSNP:397508887
1827..1833+, taaatcadbSNP:397508888
complement(1832)-g, c, adbSNP:142074233
1833..1834+, adbSNP:397508889
1833+a, gdbSNP:80357173
1839+c, gdbSNP:398122638
1840..1843+, taacdbSNP:80357698
1841+a, gdbSNP:398122639
1844+c, tdbSNP:80356893
1848+c, tdbSNP:80357374
complement(1849)-t, cdbSNP:372002119
1853+c, tdbSNP:80356904
1855..1856+, gdbSNP:397508891
1860+, gdbSNP:398122640
1862+c, tdbSNP:80356952
1863+a, cdbSNP:397508892
1868..1886+, atgaatattactaatagtgdbSNP:80359881
1874+a, gdbSNP:80356981
1881+, adbSNP:80357619
1887+g, tdbSNP:397508893
1892+g, tdbSNP:397508894
1901+a, gdbSNP:397508895
1904+a, cdbSNP:397507190
1905..1906+, aadbSNP:397508896
1906+, adbSNP:80357600
1908+g, tdbSNP:80356980
1919+c, tdbSNP:80356898
1922+a, c, tdbSNP:397507191
1927..1928+, gdbSNP:273897664
1932..1933+, adbSNP:80357784
1932+, adbSNP:397508899
1935+c, g, tdbSNP:80356910
1944+c, tdbSNP:80357159
1945..1949+, agaatdbSNP:80357640
1948..1949+, adbSNP:397508901
1948+, adbSNP:397508900
1955+a, gdbSNP:397508902
complement(1956)-t, cdbSNP:111539978
1960..1961+, adbSNP:397507192
1961..1962+, gadbSNP:80357834
1961+g, tdbSNP:397508903
1963+a, gdbSNP:28897678
1965+a, cdbSNP:80356939
1973+a, tdbSNP:397508905
1976+, adbSNP:398122641
1976+a, gdbSNP:397508906
1979+a, g, tdbSNP:80356928
1988+c, tdbSNP:80357153
1989+, cdbSNP:80357723
1991+, adbSNP:398122642
2000+a, gdbSNP:80357454
2004+c, tdbSNP:80356859
2004+, tdbSNP:80357901
2018+c, g, tdbSNP:80357371
2025+a, g, tdbSNP:80357118
2031+g, tdbSNP:398122643
2032+c, gdbSNP:80357452
complement(2034)-t, cdbSNP:371631805
2037+, adbSNP:397508908
2040+c, gdbSNP:397508909
2044+, adbSNP:80357927
2049+, cdbSNP:397508910
2051+a, tdbSNP:80357220
2053..2056+, aaagdbSNP:80357585
2055..2058+, agaadbSNP:80357952
2055+, adbSNP:397508911
2057+, adbSNP:80357736
2058+a, gdbSNP:80357236
2060+a, gdbSNP:398122644
2063+, cdbSNP:397508913
2066+a, gdbSNP:80357245
2069+, adbSNP:80357652
2072+a, tdbSNP:80357282
2076+c, tdbSNP:398122645
2078..2079+, tdbSNP:397508914
2081+a, gdbSNP:45564238
2086+, gdbSNP:397507193
2097+c, tdbSNP:56039126
2098+g, tdbSNP:1800064
2100+c, tdbSNP:397508915
2102+a, g, tdbSNP:80356950
2107+, adbSNP:398122646
2109..2110+, tagtdbSNP:80357516
2110+a, gdbSNP:8176154
complement(2110)-t, cdbSNP:386615763
2111+a, gdbSNP:80357425
2113..2116+, cagtdbSNP:80357567
2113+c, gdbSNP:80356838
2116+g, tdbSNP:80357495
2124..2125+, tdbSNP:80357932
2125..2126+, tdbSNP:80357768
2125+a, gdbSNP:80356834
2127+a, gdbSNP:80356983
2129+a, c, tdbSNP:80356902
2130+, cdbSNP:80357851
2130+c, tdbSNP:398122647
2132+c, tdbSNP:80357056
2133+c, gdbSNP:80357121
complement(2137)-g, adbSNP:369373293
2138+, tdbSNP:397508916
2139+a, gdbSNP:398122649
2143+c, tdbSNP:62625305
2144+a, g, tdbSNP:80357005
2144+, gdbSNP:80357933
2148+a, tdbSNP:80357267
2153..2154+, adbSNP:397507194
2153+, adbSNP:398122650
2156+c, gdbSNP:80357344
2159+a, gdbSNP:80357105
2164+g, tdbSNP:397508918
2166+a, cdbSNP:80357129
2168+, adbSNP:397508919
2170..2179+, cagtgaagagdbSNP:397508920
2177+c, g, tdbSNP:80356907
2181..2182+, tadbSNP:397508921
2184..2185+, adbSNP:80357885
2184+, adbSNP:397508922
2185..2188+, gaaadbSNP:80357526
2185..2186+, gdbSNP:80357753
2190..2193+, aaaadbSNP:397508923
2192..2193+, aadbSNP:80357643
2192+a, g, tdbSNP:80357355
2193..2194+, adbSNP:80357853
2193+, adbSNP:80357522
2195..2196+, g, tdbSNP:397508924
2195+g, tdbSNP:80357166
2196+a, tdbSNP:80357193
2199+a, gdbSNP:397508925
2201+c, tdbSNP:397508926
2204+, adbSNP:397507195
2204+a, gdbSNP:55932871
2206+c, gdbSNP:55678461
2216+c, tdbSNP:397508927
2217+a, gdbSNP:80357494
2227+c, gdbSNP:80357238
2228+, cdbSNP:80357922
2231+c, tdbSNP:80356889
2233..2234+, adbSNP:80357521
2234+c, tdbSNP:80357250
2238+c, tdbSNP:80356895
2240+a, gdbSNP:80357029
2245..2246+, gtdbSNP:397508928
2246+a, tdbSNP:397508929
2249+, gdbSNP:80357638
2249+g, tdbSNP:80357391
2251+, adbSNP:80357626
2253+, cdbSNP:397508930
2260..2261+, tgdbSNP:397508931
2267+a, tdbSNP:80357082
2269+cc, gdbSNP:397508932
2270..2271+, ccdbSNP:80357940
complement(2275)-c, adbSNP:143920945
2280+, adbSNP:397508933
2282+c, tdbSNP:397508934
2291+c, tdbSNP:273898674
complement(2292)-c, adbSNP:386576383
2295..2298+, caagdbSNP:397508935
2300+, adbSNP:80357733
2302..2303+, aadbSNP:273898676
2303+, adbSNP:80357688
2306+, cdbSNP:80357554
2307..2308+, atdbSNP:397508936
2309..2310+, tadbSNP:80357595
complement(2309)-g, adbSNP:386597001
2311..2312+, cadbSNP:80357773
2311+c, tdbSNP:80356835
2313+a, gdbSNP:431825388
2314+c, tdbSNP:1799949
2315+a, g, tdbSNP:28897681
2318+, adbSNP:397508937
2318+a, gdbSNP:80357441
2333..2334+, aadbSNP:431825389
2335+a, gdbSNP:273898677
2337..2338+, tdbSNP:80357880
2337+g, tdbSNP:80357298
2342..2343+, aadbSNP:80357814
2352+a, gdbSNP:80357192
2355+a, c, tdbSNP:80357182
2357..2358+, adbSNP:80357871
2358..2359+, ttdbSNP:397508939
2362+g, tdbSNP:273898678
2363..2364+, aadbSNP:398122653
2370+c, gdbSNP:80357233
2374+, tdbSNP:273898679
2387..2400+, aaagaatttgtcaadbSNP:397508941
2387..2388+, adbSNP:80357715
2387+a, g, tdbSNP:80357147
2389..2390+, adbSNP:397508942
2390+a, g, tdbSNP:80356875
2398+, cdbSNP:397508943
2406+, gdbSNP:397508944
2407+c, tdbSNP:273898680
2408..2409+, ctdbSNP:397508945
2408+, cdbSNP:80357668
2412+c, tdbSNP:80356912
2415+a, gdbSNP:80357335
2420..2433+, gaaaaagaagagaadbSNP:273898681
2420..2421+, gdbSNP:80357566
2420+g, tdbSNP:80357058
2424..2428+, aagaadbSNP:397508946
2425..2429+, agaagdbSNP:80357507
2425..2428+, agaadbSNP:397508947
2426..2430+, gaagadbSNP:80357755
2426+g, tdbSNP:80357426
2427..2431+, aagagdbSNP:80357771
2428+, adbSNP:397508948
2429..2433+, gagaadbSNP:80357539
2429+g, tdbSNP:397508949
2431+, gdbSNP:80357944
2434+, adbSNP:80357982
2435+, cdbSNP:80357936
2438+, gdbSNP:80357860
2439+a, cdbSNP:397507196
2442..2443+, cadbSNP:80357654
2442+, cdbSNP:80357793
2443..2444+, agdbSNP:397508950
2444..2447+, gttadbSNP:397508951
2446..2447+, ttdbSNP:397507197
2446+, tdbSNP:80357574
2447..2448+, ctdbSNP:80357930
2447+a, g, tdbSNP:56329598
2448..2449+, aadbSNP:397508952
2449..2450+, adbSNP:80357802
complement(2449)-t, cdbSNP:200521980
2450+c, gdbSNP:80357415
2454+c, g, tdbSNP:80357051
2468..2469+, gdbSNP:80357909
2473..2474+, cdbSNP:397508953
2473+, cdbSNP:80357650
2477+g, tdbSNP:80357114
2478..2479+, gadbSNP:398122654
2480..2484+, ctcatdbSNP:397508954
2485..2486+, gtdbSNP:80357602
2488..2489+, tadbSNP:80357557
2495+, gdbSNP:80357960
2495+g, tdbSNP:41286296
2500+c, gdbSNP:80356884
2501+, gdbSNP:80357583
2505..2506+, tdbSNP:80357681
2507+c, tdbSNP:80356999
2513+a, gdbSNP:397507198
2514+a, cdbSNP:80356869
2515..2516+, aadbSNP:80357657
2518+a, tdbSNP:273898682
2525+g, tdbSNP:80357449
2526+a, gdbSNP:80357085
complement(2527)-t, cdbSNP:201875054
2528..2529+, agdbSNP:80357780
2528+a, gdbSNP:398122655
2531+, adbSNP:80357786
2531+a, g, tdbSNP:80357194
2534+a, gdbSNP:398122656
complement(2538)-t, adbSNP:372366481
2540+, tdbSNP:397508956
2541+a, c, tdbSNP:80357063
2542..2543+, agagagtagcagtatttca, cdbSNP:397508955
2543+c, tdbSNP:16940
complement(2543)-g, adbSNP:386541412
2546+, gdbSNP:80357957
2554+a, tdbSNP:397508958
2557..2558+, adbSNP:397508959
2561+g, tdbSNP:397507199
2561+, tdbSNP:80357725
2563+a, tdbSNP:80357444
2564..2565+, tgdbSNP:431825390
2569..2570+, tcdbSNP:80357515
2570+a, c, g, tdbSNP:80356945
2579+a, gdbSNP:80356948
2582..2583+, tcdbSNP:397508960
2582+g, tdbSNP:80357399
2583..2589+, cgttactdbSNP:80357820
2583+c, tdbSNP:55914168
complement(2584)-t, cdbSNP:372017932
2586+a, tdbSNP:397508961
2587..2588+, adbSNP:80357990
2588+, cdbSNP:397508962
2589+, tdbSNP:397508963
2591..2592+, gdbSNP:80357739
2591+, gdbSNP:397508964
2594+a, gdbSNP:80357060
2600+a, gdbSNP:41286298
2608+, gdbSNP:80357913
complement(2613)-g, adbSNP:7502059
2618..2619+, adbSNP:398122657
2619+c, tdbSNP:80357364
2621..2622+, gadbSNP:80357695
2621+a, g, tdbSNP:62625306
2621+, gdbSNP:397508965
2622..2623+, aadbSNP:80357546
2624+c, tdbSNP:398122658
2625+, cdbSNP:80357850
2629+a, tdbSNP:80357203
2633..2634+, tgdbSNP:80357999
2635+a, tdbSNP:80357381
2637..2638+, tgdbSNP:80357706
2638..2641+, gagtdbSNP:80357674
2642+c, tdbSNP:80356982
2643..2644+, agdbSNP:80357664
2644+c, gdbSNP:55746541
2645+c, tdbSNP:397508966
2648+a, gdbSNP:80357144
2651+g, tdbSNP:80357240
2652+a, cdbSNP:273899683
2655+c, tdbSNP:398122660
2656+, tdbSNP:397507200
2658+a, gdbSNP:397507201
2660+a, tdbSNP:28897682
2661+, adbSNP:397508967
2665+, cdbSNP:80357524
2666+a, tdbSNP:397508968
2669+g, tdbSNP:80357186
2670..2671+, gdbSNP:80357503
2672..2673+, adbSNP:397508969
2675+, adbSNP:80357598
2679+a, gdbSNP:80357108
2682+, gdbSNP:80357679
complement(2688)-g, cdbSNP:192655097
2689+, cdbSNP:80357669
2700+, gdbSNP:80357799
2705+g, tdbSNP:80357328
2706..2707+, adbSNP:80357830
2706+a, tdbSNP:80357249
2707+, cdbSNP:80357970
2708+, adbSNP:80357631
2709..2710+, cadbSNP:80357800
2709+a, cdbSNP:28897683
complement(2709)-t, gdbSNP:386576384
2709+, cdbSNP:80357740
2713+a, cdbSNP:397508970
2714+a, gdbSNP:80357185
2715..2717+, gctdbSNP:80358331
2718..2719+, ttdbSNP:397508971
2719..2720+, tdbSNP:397508972
2719+, tdbSNP:80357658
2721..2722+, aadbSNP:273899685
2729..2730+, aagtatccatdbSNP:397508973
2739..2740+, aadbSNP:273899686
2745+, adbSNP:80357863
2747+, cdbSNP:80357607
2749..2750+, cadbSNP:397508974
2750+, adbSNP:397508975
complement(2750)-t, cdbSNP:377475866
complement(2753)-t, cdbSNP:386545597
2754+a, gdbSNP:80357337
complement(2757)-t, cdbSNP:386576385
2759+a, gdbSNP:80357435
2763+a, gdbSNP:56051266
2766+c, tdbSNP:397508976
2773+a, gdbSNP:80357195
2777+g, tdbSNP:80356951
2783+a, gdbSNP:398122662
2783+, gdbSNP:397508977
2788..2789+, tdbSNP:397508979
2788+, tdbSNP:397508978
2789..2790+, adbSNP:80357835
2790..2791+, adbSNP:397508980
2793..2797+, ctcagdbSNP:397508981
2793..2794+, gcdbSNP:80357968
2793+c, tdbSNP:80357315
2795+c, tdbSNP:80357131
2796..2797+, ttgatdbSNP:397508982
2800+c, g, tdbSNP:80356832
2804+c, tdbSNP:397508983
complement(2810)-t, cdbSNP:373207084
2814+g, tdbSNP:80357098
2816+a, gdbSNP:80356927
2818..2825+, ggtttcaadbSNP:80357675
2822+g, tdbSNP:80357285
2823+c, g, tdbSNP:80357003
2824+, adbSNP:80357756
2826+, adbSNP:397508984
2828+c, tdbSNP:41286300
2829+a, gdbSNP:80356911
2832+a, gdbSNP:397508985
2835+a, c, gdbSNP:80356925
2836..2837+, gtcadbSNP:80357603
2843..2844+, ccdbSNP:80357962
2844..2845+, c, tdbSNP:80357948
2844+a, c, g, tdbSNP:799917
complement(2844)-t, cdbSNP:386614652
2844+c, ttdbSNP:397508986
2848..2849+, tdbSNP:80357912
2849..2850+, tdbSNP:397508987
2864+a, gdbSNP:80357230
2867+a, g, tdbSNP:80357251
2873+g, tdbSNP:397508988
2875+, adbSNP:397508989
complement(2876)-t, adbSNP:184374817
2878..2880+, tgcdbSNP:80357513
2880+c, tdbSNP:431825391
2882+a, gdbSNP:80357120
2886+, tdbSNP:398122663
2889..2890+, ctdbSNP:397508990
2890..2891+, adbSNP:80357541
2891..2892+, a, gdbSNP:397508991
2894+c, tdbSNP:80357480
2897..2898+, tdbSNP:397508992
2900+a, gdbSNP:80357200
2901+g, tdbSNP:80356874
2902+, gdbSNP:80357659
2903+, tdbSNP:397508993
complement(2906)-g, adbSNP:137998759
2907..2910+, taaadbSNP:80357518
2907+c, tdbSNP:397508994
2908..2911+, aaagdbSNP:80357891
2909+a, c, tdbSNP:80357170
2911..2914+, gaaadbSNP:80357596
2911..2912+, gadbSNP:397508995
2913..2914+, aadbSNP:80357971
2914+, adbSNP:397508996
2915..2918+, caaadbSNP:397508998
2915+c, tdbSNP:397508997
2917..2918+, aadbSNP:80357636
2918..2919+, adbSNP:398122664
2918+, adbSNP:273899687
2918+a, tdbSNP:80357188
2921..2922+, adbSNP:397508999
2922..2923+, adbSNP:80357549
2924+a, gdbSNP:80357420
2926..2927+, adbSNP:397509000
2932..2933+, ttdbSNP:80357899
2934..2935+, ttdbSNP:397509001
2934+c, tdbSNP:397507202
2938+a, cdbSNP:398122665
2939..2940+, atdbSNP:80357717
2941+, tdbSNP:80357594
2942+g, tdbSNP:80357035
2945+c, tdbSNP:397509002
2946+a, gdbSNP:397507203
2951..2954+, gaagdbSNP:80357731
2954+g, tdbSNP:80356978
2956..2960+, aaatcdbSNP:80357712
2957..2960+, aatcdbSNP:80357917
2958..2962+, atcaadbSNP:397509003
2958..2959+, adbSNP:80357685
2958+, adbSNP:80357614
2958+a, tdbSNP:80357127
2959..2962+, tcaadbSNP:80357605
2960+, cdbSNP:397509005
2960+c, tdbSNP:397509004
2964+a, gdbSNP:431825392
2965+a, gdbSNP:1800740
2967+a, gdbSNP:397507204
complement(2970)-t, cdbSNP:199954851
2971+a, tdbSNP:273899688
2972+g, tdbSNP:80357419
2975..2976+, tcdbSNP:80357540
2976..2977+, ctdbSNP:397509007
2977..2978+, tdbSNP:397509008
2978+a, tdbSNP:398122666
2980..2981+, adbSNP:80357942
2980+, tdbSNP:398122667
2981..2982+, adbSNP:397509009
2984+a, cdbSNP:397509010
2986+g, tdbSNP:398122668
2990+a, gdbSNP:80357361
2991+c, tdbSNP:80357008
2993+c, tdbSNP:80357377
2994+, adbSNP:80357703
2996..2999+, acagdbSNP:80357822
2997+c, gdbSNP:80357460
2998+, adbSNP:80357812
2999..3002+, gttadbSNP:80357661
3005+a, c, gdbSNP:4986847
3006+, tdbSNP:398122669
3014+a, gdbSNP:80356995
complement(3015)-t, cdbSNP:202004680
3021+c, tdbSNP:80357256
3028..3031+, tggtdbSNP:80357840
3030..3031+, gtdbSNP:397509011
3030+a, gdbSNP:80356941
3031+, tdbSNP:80357998
3032+c, tdbSNP:80357223
3037+, adbSNP:397509012
3038..3041+, gatadbSNP:80357832
3040..3043+, taagdbSNP:397509013
3044..3045+, cc, gdbSNP:273899689
3050+g, tdbSNP:80357077
3062+, tdbSNP:397509014
3064+a, tdbSNP:80357458
3066..3068+c, gtadbSNP:386134270
3066..3068+, gtadbSNP:80358332
3066..3067+, gtdbSNP:397509015
3067..3068+, tdbSNP:80357519
3068..3069+, atdbSNP:397509016
3072..3073+, aadbSNP:80357984
3076..3085+, aggctctaggdbSNP:397509017
3080..3081+, tdbSNP:397509018
3088..3089+, ttdbSNP:397509019
3095..3099+, tcatcdbSNP:80357819
3096..3097+, tdbSNP:397507205
3096+a, cdbSNP:80357295
3098..3102+, tctcadbSNP:80357961
3100+, tdbSNP:80357929
3101+c, tdbSNP:80356973
3102..3103+, adbSNP:397509020
3103..3104+, adbSNP:80357693
3104..3108+, ttcagdbSNP:397509021
3104+a, tdbSNP:80356878
3111+a, gdbSNP:397509022
complement(3115)-g, adbSNP:201190540
3116+a, gdbSNP:80356955
3119+, adbSNP:80357559
3121..3122+, tgdbSNP:80357890
3131+a, tdbSNP:273899690
3134..3135+, tcdbSNP:398122670
3142+, adbSNP:80357893
3142+a, cdbSNP:431825394
3143+a, cdbSNP:80357478
3146+g, tdbSNP:397509023
3147+, gdbSNP:80357573
3149+c, gdbSNP:80357080
3152..3153+, ttdbSNP:80357611
3153..3154+, tdbSNP:397509024
3153+a, c, tdbSNP:80356872
3155+c, tdbSNP:80357497
3162..3163+, ccdbSNP:397509025
complement(3162)-g, adbSNP:141465583
3163+a, gdbSNP:273899691
3166+g, tdbSNP:80357115
3166+, tdbSNP:80357741
3167+c, tdbSNP:80356970
3168+a, gdbSNP:80356985
3172+, adbSNP:80357876
3184..3185+, tdbSNP:397509026
3184+, tdbSNP:80357627
3187+, cdbSNP:397509027
3195+a, c, tdbSNP:397507206
complement(3198)-t, cdbSNP:4986848
complement(3198)-t, cdbSNP:386596999
3199+, tdbSNP:397509028
3200+a, gdbSNP:397509029
3205..3211+, aactaaadbSNP:397509030
3206..3222+, actaaatgtaagaaaaadbSNP:397509031
complement(3211..3212)-, tdbSNP:34725869
complement(3212)-g, adbSNP:144853230
3212+, tdbSNP:80357502
3213..3214+, gtdbSNP:397507207
3222..3223+, aadbSNP:80357829
3222+, adbSNP:397509032
3227..3228+ct, tadbSNP:273899692
3227+a, c, tdbSNP:80356848
3230..3235+, gaggaadbSNP:80358333
3230+a, gdbSNP:80357124
3231+, adbSNP:80357991
3234+, adbSNP:80357601
3237+, adbSNP:80357846
3240..3241+, ttdbSNP:80357617
3245+, gdbSNP:80357937
3248..3251+, cattdbSNP:80357994
3250..3253+, ttcadbSNP:80357749
3252+c, gdbSNP:80357168
3254+a, gdbSNP:56321129
complement(3256)-t, cdbSNP:386545594
3258+a, cdbSNP:273899696
3261..3262+, ctdbSNP:80357510
3269..3270+, gadbSNP:397507208
3272+a, g, tdbSNP:80356933
3273+a, c, tdbSNP:80357020
3276..3277+, gdbSNP:80357746
3278+a, gdbSNP:80357154
3279..3280+, tgagadbSNP:80357866
3281+g, tdbSNP:80357004
3284..3285+, tgagadbSNP:80357856
3285..3286+, tgagadbSNP:80357547
3287+a, gdbSNP:80357311
3304+c, gdbSNP:397509033
3306+c, tdbSNP:397509034
3312+a, gdbSNP:80357386
3314+c, tdbSNP:80357049
3315+a, gdbSNP:80357459
3316..3326+, taataacattadbSNP:80357647
3329+g, tdbSNP:273899698
3332..3333+, taacattagagaaadbSNP:80357967
3336..3337+, tdbSNP:273899699
3339..3344+, ttaaagdbSNP:80357920
3340..3341+, tdbSNP:397507209
3340+, tdbSNP:80357841
3344+g, tdbSNP:80357161
3345+a, gdbSNP:16941
complement(3345)-t, cdbSNP:386541420
3346..3349+agcc, gadbSNP:273899700
complement(3351)-t, cdbSNP:386597002
3354+c, gdbSNP:397509035
3357..3366+, gcaatattaadbSNP:397509036
3362+a, gdbSNP:80357271
3372+c, tdbSNP:397509037
3375+a, g, tdbSNP:80356899
3376+c, tdbSNP:80356837
3377+, tdbSNP:397509038
3383+a, gdbSNP:398122671
3384+c, gdbSNP:397509039
3387+, adbSNP:397509040
3387+a, gdbSNP:398122672
3389..3390+, gdbSNP:397509042
3389+, gdbSNP:397509041
3390..3391+, gdbSNP:80357769
3396+, gdbSNP:397509043
3400+, cdbSNP:397509044
3401..3404+, agtadbSNP:397509045
3401+a, gdbSNP:80357479
3406+, tdbSNP:397507210
3410+g, tdbSNP:80357424
3411+a, cdbSNP:80357184
3413+, adbSNP:80357702
3415+, adbSNP:397509046
3417+g, tdbSNP:397507211
3420..3421+cc, gdbSNP:273899701
3422+a, tdbSNP:273899702
3425..3426+, gdbSNP:80357511
3426..3427+, gdbSNP:80357883
3436+, tdbSNP:398122673
3441+c, gdbSNP:397507212
3443..3444+, gdbSNP:397509047
3443+a, gdbSNP:41293445
3446+, cdbSNP:80357923
3452+a, gdbSNP:80357263
3458+, adbSNP:273899703
3459+c, gdbSNP:80357313
3460..3461+, agdbSNP:80357635
3460+a, tdbSNP:397509048
3471+a, tdbSNP:80357145
3479+a, cdbSNP:397507213
3485..3486+, adbSNP:80357517
3486..3487+, adbSNP:80357625
3487..3488+, a, gadbSNP:80357624
3488..3489+, gadbSNP:80357764
3489..3490+, tdbSNP:80357858
3489+a, c, g, tdbSNP:80357006
3492+c, gdbSNP:80357172
3494+, gdbSNP:397509049
3495+a, tdbSNP:80356901
3500+c, tdbSNP:80357402
complement(3502)-t, adbSNP:369925993
3511+, cdbSNP:397509050
3517+, adbSNP:397509051
3518+, cdbSNP:80357533
3518+c, tdbSNP:80357485
3519+a, gdbSNP:273899704
3520..3521+, aadbSNP:80357686
3521+, adbSNP:397509052
3524..3525+, ctdbSNP:80357992
3528+, cdbSNP:80357815
3534+a, gdbSNP:41293447
3537+a, gdbSNP:80356900
3540+g, tdbSNP:80357135
3541+a, tdbSNP:80357317
3545+a, cdbSNP:80357288
3546+, adbSNP:397509054
3548+c, tdbSNP:45599040
3551+g, tdbSNP:80357106
3552..3555+, aaatdbSNP:80357763
3555..3558+, taaadbSNP:397509055
3557..3561+, aaaaadbSNP:80357680
3558..3561+, aaaadbSNP:80357575
3559..3561+, aaadbSNP:80358334
3559+a, c, gdbSNP:41293449
3560..3563+, aagcdbSNP:80357777
3560..3562+, aagdbSNP:80358335
3561..3564+, agcadbSNP:80357701
3561..3562+, adbSNP:80357692
3561..3562+, agdbSNP:80357525
3561+, adbSNP:397509056
3562..3563+, adbSNP:80357996
3563..3566+, caagdbSNP:80357903
3563+c, tdbSNP:80357089
3565..3568+, agaadbSNP:397509057
3565+, adbSNP:80357966
3571+g, tdbSNP:80357421
3572+g, tdbSNP:80357278
3574..3577+, agaadbSNP:397509058
3575+, gdbSNP:273899705
3576..3578+, aagdbSNP:80358336
3578+c, gdbSNP:55909400
3583..3584+, tdbSNP:80357785
3584+c, tdbSNP:397507215
3586..3587+, gadbSNP:397509059
3586+g, tdbSNP:80357334
3587+a, tdbSNP:80356949
3589+, tdbSNP:80357827
3590..3591+, gtdbSNP:80357945
3591..3595+, ttaatdbSNP:397509060
3591..3592+, ttdbSNP:80357843
3594+, adbSNP:80357865
3594+a, gdbSNP:80356919
3597..3598+, cadbSNP:80357892
3599+g, tdbSNP:80356867
3607..3608+, tcdbSNP:80357828
3609+, cdbSNP:397509061
3609+c, tdbSNP:80356887
3621+c, gdbSNP:80357405
3622+, adbSNP:80357900
3629..3630+, ttdbSNP:80357577
3630+a, g, tdbSNP:80356971
3632+g, tdbSNP:80357018
3635+c, tdbSNP:80357136
3638+a, cdbSNP:431825395
3639+c, gdbSNP:80357329
3642+c, tdbSNP:80357297
3645+, gdbSNP:397509063
3648+, gdbSNP:397509064
3648+g, tdbSNP:80357228
3649+, tdbSNP:273899706
3650..3652+, agtdbSNP:80358337
complement(3650)-g, adbSNP:386561654
3652..3653+, tdbSNP:397509065
3656+c, gdbSNP:80357101
3658+a, gdbSNP:80356843
3660+c, tdbSNP:80357434
3660+c, tadbSNP:397509066
3662+c, tdbSNP:80357369
3664+g, tdbSNP:80356922
3665+g, tdbSNP:431825396
3668..3671+, tgttdbSNP:397509067
3669+a, c, gdbSNP:80357247
3674+, gdbSNP:80357808
3682..3683+, tdbSNP:397509069
3682+, tdbSNP:397509068
3686+a, gdbSNP:80357175
3694..3695+, adbSNP:80357857
3695+c, gdbSNP:80357484
3700+, tdbSNP:397509070
3704+g, tdbSNP:397509072
3709..3712+, aaagdbSNP:80357781
3709..3711+aaa, cdbSNP:273899707
3711..3721+, aggaagatactdbSNP:80357910
3711..3720+, aggaagatacdbSNP:397509073
3713..3723+, gaagatactagdbSNP:80357877
3713+, gdbSNP:397509074
3717+, adbSNP:80357509
3720+c, tdbSNP:80356918
3723+g, tdbSNP:397509075
3726..3727+, ttdbSNP:397509076
3735..3736+, adbSNP:397509077
3735+, adbSNP:397507216
3737..3741+, gacatdbSNP:397509078
3740+a, tdbSNP:273899708
complement(3742)-c, adbSNP:183119644
3746+g, tdbSNP:397509079
3747+a, gdbSNP:80357206
3759+a, tdbSNP:80357027
3763+, tdbSNP:80357621
3772..3773+, cgdbSNP:397509080
3774+c, tdbSNP:80357032
3776+c, tdbSNP:80357296
3780..3781+, aadbSNP:80357956
complement(3780)-g, adbSNP:386541424
3781..3782+, ag, tdbSNP:273899709
3785+g, tdbSNP:397509081
3792+a, gdbSNP:80356975
3801..3802+, ctdbSNP:80357845
3807..3808+, aadbSNP:397509082
3810..3811+, tdbSNP:397509083
3812+, adbSNP:80357663
complement(3812)-t, cdbSNP:369982706
3813+, cdbSNP:273900710
3813+c, tdbSNP:80357290
3815+, cdbSNP:397509084
3816+a, gdbSNP:28897685
complement(3816)-t, cdbSNP:386576386
3818..3819+, adbSNP:80357531
3819+a, c, tdbSNP:80356944
3825..3826+, ttdbSNP:80357562
3825+a, tdbSNP:397509085
3828..3834+, ctcagggdbSNP:397509086
3830+c, tdbSNP:62625307
3831..3832+, agdbSNP:398122674
3832+c, g, tdbSNP:56214134
3833+a, gdbSNP:55725337
3835+g, tdbSNP:80356830
3839+c, g, tdbSNP:62625308
3840+a, gdbSNP:55930959
3844+, adbSNP:80357980
3845+a, c, gdbSNP:80357294
3851+a, tdbSNP:80357455
3852..3853+, adbSNP:80357926
3853..3858+aa, gaaattdbSNP:397509087
3854..3855+, adbSNP:80357512
3854+a, gdbSNP:80357152
3856..3857+, adbSNP:397509088
3857+g, tdbSNP:273900711
3857+, tdbSNP:387906564
3858..3859+, tdbSNP:397509089
3858+, tdbSNP:80357571
3859..3860+, adbSNP:80357729
3860+, gdbSNP:397509090
3861..3862+, agdbSNP:80357589
complement(3868)-t, cdbSNP:148038877
3872+a, g, tdbSNP:80356923
3874..3875+, gadbSNP:80357805
3874+g, tdbSNP:398122675
3879+g, tdbSNP:397509091
3880..3881+, adbSNP:80357902
3881..3882+, a, tdbSNP:80357831
3881+c, tdbSNP:273900712
3882+c, gdbSNP:398122676
3884+a, g, tdbSNP:80356894
3887+a, gdbSNP:80356921
3889+c, gdbSNP:80356876
3893+g, tdbSNP:80357310
3894+a, cdbSNP:273900713
3896+g, tdbSNP:80357356
3903..3904+, ttccdbSNP:80357797
3904+, cdbSNP:398122677
3908..3911+, ttccdbSNP:80357671
complement(3913)-, tdbSNP:35999570
3915+, adbSNP:397507217
3921+g, tdbSNP:80357162
3923+c, tdbSNP:41293451
3925..3926+, tdbSNP:397509092
3927..3930+, gtaadbSNP:397509093
3930+a, gdbSNP:80357141
3931+, adbSNP:80357873
complement(3931)-t, cdbSNP:368690455
3932..3936+, gtaaadbSNP:80357609
3936..3939+, acaadbSNP:397509094
3936+, adbSNP:397509095
3938..3945+, aatataccdbSNP:80357552
3938..3939+, aadbSNP:80357666
complement(3940)-c, adbSNP:386576388
3942+, tdbSNP:80357564
3943+a, gdbSNP:80357388
3945+c, g, tdbSNP:28897688
complement(3946)-g, adbSNP:140777892
3947..3949+c, tctdbSNP:273900714
3947+, tdbSNP:397509096
3948..3949+, cdbSNP:397509097
3950+c, tdbSNP:80356903
3954..3972+, ctactaggcatagcaccgtdbSNP:80359882
3954+a, c, gdbSNP:80357143
3956+a, gdbSNP:80357037
3968+, adbSNP:80357578
3971+a, gdbSNP:80357191
3978+c, gdbSNP:80357099
complement(3980)-g, adbSNP:386576387
complement(3982)-g, cdbSNP:145903082
3985+a, tdbSNP:397509098
3987..3990+, tgtcdbSNP:80357963
3988..3991+, gtctdbSNP:80357868
3988..3989+, gtdbSNP:397509099
3990+a, cdbSNP:397509100
3991..3992+, tdbSNP:80357687
3991..3992+, tadbSNP:80357520
3991+g, tdbSNP:80356852
3991+, tdbSNP:431825398
3992..3993+, tdbSNP:80357986
3992+a, gdbSNP:80357362
3993..3994+, agdbSNP:80357645
3993..3994+, ttdbSNP:80357928
3994..3995+, gadbSNP:397509102
3995..3996+, aadbSNP:397509103
3996..3997+, adbSNP:80357848
3998..3999+, adbSNP:80357704
4001..4002+, gadbSNP:80357579
4002..4003+, agdbSNP:80357993
4003..4010+, ggagaattdbSNP:397509104
4003..4004+c, ggdbSNP:397507218
4003..4004+, ggdbSNP:80357810
4004+g, tdbSNP:397509105
4006..4007+, gadbSNP:397509106
4006+g, tdbSNP:431825399
4009+, tdbSNP:80357798
4010..4011+, adbSNP:80357849
4011+, tdbSNP:397509107
4014+c, g, tdbSNP:397507219
4014+, tdbSNP:80357545
4017+a, c, tdbSNP:80357269
4026+, adbSNP:80357767
4029+c, gdbSNP:80357160
complement(4030)-g, c, adbSNP:200648498
4035+a, gdbSNP:273900716
complement(4036)-g, adbSNP:140588714
4045..4046+, tdbSNP:397509108
4046..4047+, tdbSNP:397509109
4049+c, tdbSNP:80357208
4050+a, gdbSNP:431825400
4052..4053+, gdbSNP:80357616
4052+, gdbSNP:397509110
4054..4055+, tdbSNP:397509111
complement(4054)-t, gdbSNP:372396487
4057..4058+, adbSNP:397507220
4061+c, gdbSNP:397509112
4062..4063+, cdbSNP:80357878
4067+a, gdbSNP:80357036
4071..4075+aggc, ctcagdbSNP:273900717
4073..4075+, cagdbSNP:80358338
4073..4074+, cadbSNP:80357584
4073+c, tdbSNP:80356866
4074+a, cdbSNP:80357483
4076+, gdbSNP:397509113
4077+a, tdbSNP:80357217
4080+a, gdbSNP:80357047
4083+a, gdbSNP:80357499
4084..4085+, acdbSNP:397507221
4084+, cdbSNP:397507222
4088..4091+, agtgdbSNP:80357842
4088+, adbSNP:80357855
complement(4089)-g, cdbSNP:142383077
4090..4093+, tgagdbSNP:80357889
4094+, gdbSNP:273900718
4099..4103+, aaaatdbSNP:80357560
4100+a, g, tdbSNP:80357254
4101..4102+, aadbSNP:80357918
4101+a, cdbSNP:431825401
4103..4104+, cdbSNP:397509114
4108+, tdbSNP:397509115
4109+c, gdbSNP:397507223
4110+a, c, tdbSNP:80357213
4112..4115+, agctdbSNP:397509116
4123..4125+, ttcdbSNP:80358339
4125+a, cdbSNP:80357440
4127+c, tdbSNP:80357038
4129+g, tdbSNP:398122678
4133..4134+, agdbSNP:80357646
4135+a, tdbSNP:273900719
4136+g, tdbSNP:80357461
4140..4141+, tdbSNP:80357634
4142+, gdbSNP:397509117
4146+, adbSNP:397509118
4146+a, tdbSNP:431825402
4148..4149+, ttdbSNP:80357678
4158+, adbSNP:397509119
4159..4162+, tacadbSNP:397509120
4161+a, cdbSNP:80357257
4163..4166+, aacadbSNP:80357864
4164+, adbSNP:80357504
4169+c, tdbSNP:80357318
4172+a, gdbSNP:80356954
4176+a, c, gdbSNP:80357500
4184+a, gdbSNP:397509121
4187+a, gdbSNP:431825403
4190+c, tdbSNP:80356855
4194+c, gdbSNP:386833394
4196+a, tdbSNP:80357343
4197+a, tdbSNP:80357042
4198+, adbSNP:80357979
4199+, cdbSNP:397509122
4199+c, tdbSNP:80357262
4204+, gdbSNP:80357987
4205+, adbSNP:80357904
4213+, gdbSNP:397509123
4214..4215+, tdbSNP:397509124
4223+c, tdbSNP:397507224
4225+c, gdbSNP:70953658
4231+, tdbSNP:397509125
4233+, gdbSNP:397509127
4234..4237+, tctgdbSNP:397509128
4243+c, gdbSNP:80356886
complement(4244)-t, gdbSNP:12946486
4247+g, tdbSNP:80357021
4258+a, gdbSNP:80356828
4263+a, gdbSNP:55639854
4264..4266+, tgadbSNP:397509129
4267+, adbSNP:80357711
4268..4270+, gaadbSNP:80358340
4268+a, gdbSNP:80357407
4269..4270+, aadbSNP:273900721
4270..4273+, aagadbSNP:431825404
complement(4271)-g, adbSNP:386576389
4272+a, gdbSNP:80357210
4273..4274+, agdbSNP:80357727
4275+, gdbSNP:397509130
4277+a, cdbSNP:80357231
4278+c, tdbSNP:80357345
4281..4282+, gdbSNP:397509131
complement(4283)-g, adbSNP:139858874
4284..4285+, tdbSNP:80357779
4284+a, tdbSNP:397509132
4286+a, g, tdbSNP:80357202
4289..4293+, gaaaadbSNP:397509133
4289+g, tdbSNP:80357178
4294..4300+, taatcaadbSNP:397509134
4294..4297+, taatdbSNP:398122679
4295..4297+, aatdbSNP:80358341
4297..4300+, tcaadbSNP:80357508
4298..4301+, caagdbSNP:397509135
4304+a, g, tdbSNP:397509136
4305+a, gdbSNP:397507225
4306+a, gdbSNP:80356846
4307+c, g, tdbSNP:80357456
4313+a, cdbSNP:80357218
complement(4315)-t, cdbSNP:374192364
4317+, adbSNP:80357737
4320+c, tdbSNP:398122680
4324..4325+, ctdbSNP:397509137
4326+g, tdbSNP:398122681
4326+, tdbSNP:397509138
4328+a, gdbSNP:431825405
4342..4343+, atctdbSNP:397509139
4342..4343+, tgdbSNP:80357529
4343..4344+, atctdbSNP:80357935
complement(4345)-t, cdbSNP:147448807
4345+, gdbSNP:80357861
4347+a, gdbSNP:55848034
4348..4349+, tgdbSNP:80357804
4348..4349+, ttdbSNP:398122682
4348+a, tdbSNP:397509140
4349+g, tdbSNP:80357259
4352..4353+, agdbSNP:80357787
4354..4355+, tgdbSNP:80357691
4355+g, tdbSNP:80357397
4359+c, gdbSNP:80356986
4360..4361+, aadbSNP:80357921
4363+a, cdbSNP:80356871
4364+a, gdbSNP:28897690
4368..4369+, ctdbSNP:397509141
4380+c, gdbSNP:80357071
4390..4394+, ctctcdbSNP:397509142
4393..4394+, tcdbSNP:80357565
4395..4398+, agagdbSNP:80357532
4395..4396+, adbSNP:80357788
4397..4398+, agdbSNP:80357572
4398..4399+, agdbSNP:397509143
complement(4398)-t, cdbSNP:78951648
4399..4402+, tgacdbSNP:80357538
4399..4400+, agdbSNP:80357847
4399..4400+, tgdbSNP:397509144
4399+, tdbSNP:397509145
4404+c, tdbSNP:397509146
4413+c, tdbSNP:397507226
4415..4417+, cagdbSNP:397509147
4415..4416+, tcdbSNP:80357742
4415+c, tdbSNP:80357260
4416+a, gdbSNP:80356972
4417+a, gdbSNP:80356857
4418+c, tdbSNP:80357011
4427..4428+, acdbSNP:80357649
4430+a, gdbSNP:80357306
4431+c, tdbSNP:80357473
complement(4432)-g, cdbSNP:374416358
4433+c, tdbSNP:397509151
4436+c, tdbSNP:80357365
4437+a, gdbSNP:80356882
4442+, cdbSNP:80357765
4443+c, tdbSNP:80356916
4445+a, gdbSNP:80357353
4446+, tdbSNP:273900728
4450+g, tdbSNP:1800707
complement(4450)-c, adbSNP:386545596
4451+c, gdbSNP:397507227
4452+c, tdbSNP:80357492
4454+c, tdbSNP:80356989
4460+g, tdbSNP:397509152
4464+c, tdbSNP:273900729
4469+g, tdbSNP:397509153
4472..4473+, cdbSNP:397509154
4474..4475+, tdbSNP:397509155
4475+, gdbSNP:80357981
4477+a, gdbSNP:41293453
complement(4478)-t, cdbSNP:370999077
4483..4484+, gtdbSNP:80357977
4485+g, tdbSNP:397509157
4487+c, gdbSNP:80357309
4490+c, tdbSNP:80357305
4493+c, tdbSNP:80357013
4494+a, g, tdbSNP:80357079
4498..4499+, gdbSNP:397509158
4504+c, gdbSNP:398122684
4514..4515+, agdbSNP:397509159
4517..4518+, gdbSNP:80357716
4519+a, cdbSNP:397509160
4520+c, tdbSNP:80357466
4521..4522+, cdbSNP:80357556
4526+a, cdbSNP:80357157
4532..4533+, adbSNP:80357790
4539..4540+, ctdbSNP:397509161
4540+c, tdbSNP:1060915
complement(4540)-g, adbSNP:386514544
4546+c, gdbSNP:80356856
4553..4554+, gdbSNP:80357748
4559+c, g, tdbSNP:41293455
complement(4560)-t, cdbSNP:386597000
4563..4570+, atccagaadbSNP:80357825
4563..4564+, atdbSNP:397509163
4570..4571+, agaadbSNP:397509164
4571+c, tdbSNP:80357067
4574+a, gdbSNP:80357486
4575+a, c, gdbSNP:80357354
4579+a, gdbSNP:80356840
4580..4581+, tdbSNP:80357548
4586+a, tdbSNP:398122685
4602+c, gdbSNP:80357130
4604..4620+, cagaaaagtagtgaatadbSNP:80359885
4604+c, tdbSNP:80356932
4605..4621+, agaaaagtagtgaatacdbSNP:397509166
4611+a, gdbSNP:397509167
4615+a, tdbSNP:431825408
complement(4616)-t, cdbSNP:141255461
4619+, tdbSNP:397507229
4621+a, cdbSNP:80356997
4623..4635+ctataagccagaa, ttdbSNP:273900731
4623..4625+cta, ttdbSNP:273900730
4623..4624+, cdbSNP:397509169
4623+, cdbSNP:80357916
4625+, adbSNP:397507230
4628+, adbSNP:397509170
4631+c, tdbSNP:397509171
4634+a, c, gdbSNP:80357022
4637+c, tdbSNP:80356960
4642+a, tdbSNP:80357075
complement(4646)-g, adbSNP:200582930
4648..4649+g, ttdbSNP:397509174
4649+c, tdbSNP:398122686
4659..4660+, adbSNP:397507231
4667+, gdbSNP:397509176
4679+, adbSNP:397509177
4682+a, tdbSNP:80357404
4684..4687+, taccdbSNP:397509178
4686+c, tdbSNP:80356870
4688+, adbSNP:397509179
4688+a, tdbSNP:397507232
4689+, gdbSNP:397509180
4692+a, gdbSNP:80357126
4695..4696+, adbSNP:80357620
complement(4700)-c, adbSNP:138608489
4703+a, c, gdbSNP:111034213
4712+a, g, tdbSNP:80357148
4714..4715+, aadbSNP:80357854
4716+a, g, tdbSNP:80357389
4719+a, c, gdbSNP:80356953
4725+, cdbSNP:398122687
4736+c, tdbSNP:80357383
4737+c, tdbSNP:56335406
4740+a, cdbSNP:80357437
4748+, gdbSNP:273900736
complement(4750)-g, adbSNP:73983787
4752+c, gdbSNP:80357470
4756+a, gdbSNP:80356885
4760+, adbSNP:397509182
4765..4766+, cadbSNP:80357534
4766..4767+, agdbSNP:397509183
4766+a, tdbSNP:80357137
4776+a, gdbSNP:398122688
complement(4781)-g, adbSNP:137894496
4784+c, tdbSNP:80356881
4797+a, gdbSNP:80357379
4806..4807+, aadbSNP:80357813
4807..4817+, agaggagctcadbSNP:397509184
4811+a, gdbSNP:80357237
4817+a, gdbSNP:80357095
4819..4822+, taagdbSNP:431825409
4821+a, cdbSNP:398122689
4826..4827+, tcdbSNP:80357826
4827..4828+, ctdbSNP:80357699
4832+a, gdbSNP:55815649
4835+g, tdbSNP:80357366
4841+c, tdbSNP:80357229
4842+a, gdbSNP:70953659
4843..4844+, gdbSNP:80357915
4844+c, tdbSNP:80356992
complement(4848)-g, adbSNP:377629427
4850+g, tdbSNP:80357277
4853+g, tdbSNP:80357248
4857..4858+, ctdbSNP:80357542
4857+c, gdbSNP:41293457
4863+c, tdbSNP:80356917
complement(4867)-g, adbSNP:373686790
complement(4868)-t, gdbSNP:386576390
4868+a, g, tdbSNP:28897691
4870+g, tdbSNP:397507235
4875+c, tdbSNP:273900737
4876+a, gdbSNP:28897692
4878..4897+, aaacatcttacttgccaaggdbSNP:397509186
4881+c, tdbSNP:80357076
4887..4890+, acttdbSNP:80357561
4888+c, gdbSNP:80357151
4889+a, tdbSNP:80357431
4901+c, gdbSNP:80356906
4907+a, c, gdbSNP:80356988
4910+g, tdbSNP:80357349
4913+, adbSNP:397509187
4915+c, tdbSNP:55688400
4916..4917+, ccdbSNP:397509188
4917+c, tdbSNP:80357096
4921+c, gdbSNP:80357433
4927..4928+, adbSNP:397509189
4934+a, gdbSNP:80357119
complement(4940)-g, adbSNP:147703239
4944..4948+, tctctdbSNP:80357718
4944+c, tdbSNP:273901740
4956+a, cdbSNP:80357052
4956+, cdbSNP:397509191
4961+c, tdbSNP:80356909
4962+a, cdbSNP:273901741
4965+a, gdbSNP:80356930
complement(4967)-g, cdbSNP:145466894
4971+c, tdbSNP:80357411
4973+g, tdbSNP:397509193
4975+a, cdbSNP:397509194
4977+, adbSNP:80357907
4981..4982+, agdbSNP:80357641
4982+g, tdbSNP:80357070
complement(4985)-g, adbSNP:267604892
4986..4987+, cadbSNP:80357837
4992+c, gdbSNP:397509195
4996..4997+, tcdbSNP:80357795
4996+, tdbSNP:397509196
4997+c, tdbSNP:80357002
4998+a, gdbSNP:80357341
5007..5011+acata, cdbSNP:397507237
5009+a, g, tdbSNP:397509197
5019+c, tdbSNP:80357429
5021+a, gdbSNP:80357187
5030..5044+, ttgaaagttccccaadbSNP:80359888
5033+a, tdbSNP:80357303
5039..5053+, ccccaattgaaagttdbSNP:397507238
5042+c, tdbSNP:80357352
5043+a, gdbSNP:80357439
5045+c, g, tdbSNP:80356833
5048+a, gdbSNP:80356943
5055+c, tdbSNP:80357072
5065+c, tdbSNP:80356842
5068..5069+, gdbSNP:397509198
5069+, adbSNP:397509199
5069+a, g, tdbSNP:1799966
5070..5071+, cdbSNP:397509200
5072+c, tdbSNP:70953660
5075..5076+, gdbSNP:80357615
5075+a, gdbSNP:80356987
complement(5077)-g, adbSNP:144588397
5090+a, gdbSNP:8176219
complement(5090)-t, cdbSNP:386615777
5100+c, gdbSNP:80356862
5104+g, tdbSNP:11555992
5105..5117+, tataatgcaatggdbSNP:397509201
5114+a, gdbSNP:80357465
5116+g, tdbSNP:80357158
5123..5124+, adbSNP:80357656
5124+a, gdbSNP:273901742
5125+c, tdbSNP:80356850
complement(5135)-t, c, adbSNP:200432771
5137..5138+, gadbSNP:397509203
5142+, cdbSNP:397509204
5142+c, tdbSNP:80357048
5153+a, c, gdbSNP:1800726
5162+g, tdbSNP:397509205
5163+a, gdbSNP:80357016
5165..5166+, aadbSNP:80357833
5165+a, gdbSNP:80356926
5166+c, g, tdbSNP:70953661
5166+, gdbSNP:80357653
5167+c, gdbSNP:80357373
5168+, gdbSNP:80357705
5169+a, tdbSNP:28897694
5173+a, cdbSNP:80357302
5173+, cdbSNP:80357905
5174+, adbSNP:80357761
complement(5175)-t, cdbSNP:201810810
5176..5177+, aadbSNP:80357655
5177..5179+aga, ttttdbSNP:397509207
5177+, adbSNP:397509208
5184+c, tdbSNP:80356938
5187+c, tdbSNP:80356968
complement(5188)-g, adbSNP:386545564
5189+a, gdbSNP:80357261
5196..5214+, ctggcctgaccccagaagadbSNP:80359876
5196..5211+, ctggcctgaccccagadbSNP:397509209
5196+c, tdbSNP:80357390
5198..5216+, ggcctgaccccagaagaatdbSNP:80359884
5199+a, gdbSNP:80357414
5213+g, tdbSNP:80357401
complement(5217)-t, cdbSNP:386576391
5219+a, tdbSNP:80357117
5220+a, tdbSNP:80357205
5223+c, tdbSNP:80357314
complement(5224)-g, adbSNP:142459158
5225+a, gdbSNP:80357169
5228+c, tdbSNP:397509215
5229+a, gdbSNP:397509216
5231+a, tdbSNP:80357204
5237+, gdbSNP:80357938
5249..5251+, cacdbSNP:80358343
complement(5256)-g, adbSNP:150729791
5258..5268+, ttaactaatctdbSNP:80357894
5258..5262+, ttaacdbSNP:431825410
5259..5262+, taacdbSNP:80357580
5259..5260+, tdbSNP:397509217
5260..5263+, aactdbSNP:80357924
5262..5265+, ctaadbSNP:80357862
5267..5271+, ctaatdbSNP:80357623
5267+, cdbSNP:80357896
5272+, tdbSNP:80357673
5276+a, gdbSNP:80356958
5277+a, tdbSNP:80357265
5279+g, tdbSNP:80356879
5285+a, gdbSNP:80356890
5286+c, tdbSNP:80357043
5288..5289+, cdbSNP:80357974
5290+a, tdbSNP:397509218
5294..5296+, gttdbSNP:80358344
5298+c, g, tdbSNP:80357061
5300+a, c, tdbSNP:397507239
5303..5304+, adbSNP:80357672
5303+a, gdbSNP:397509219
5304+a, c, g, tdbSNP:80357034
5305+a, gdbSNP:80356853
5307..5310+, atgcdbSNP:397509223
5307+a, tdbSNP:397509222
5309..5312+gctg, ttcattctgcdbSNP:397509224
5309..5311+, gctdbSNP:80358345
5310..5312+, ctgdbSNP:397509225
5312+g, tdbSNP:80356896
5316..5317+, ttdbSNP:80357760
5317+a, tdbSNP:80357387
5318+c, gdbSNP:80357125
5319+a, tdbSNP:397509226
5321+c, tdbSNP:80356993
5322+a, gdbSNP:397507241
5323..5324+, tgdbSNP:80357710
5327+a, c, tdbSNP:55770810
5330+a, gdbSNP:397509227
5332+a, gdbSNP:45519437
5334..5335+, tgdbSNP:80357608
5338+, adbSNP:80357553
5341+g, tdbSNP:80356974
5344+, tdbSNP:397509228
5345+c, g, tdbSNP:80356858
5346+c, tdbSNP:397507242
5349+a, c, gdbSNP:80356860
5354+a, gdbSNP:397507243
5355+a, c, tdbSNP:28897696
complement(5355)-c, adbSNP:386576392
5358+, gdbSNP:80357874
5360+g, tdbSNP:397509229
5361+a, gdbSNP:398122691
5368+a, gdbSNP:80357418
5369+, gdbSNP:80357997
5370+c, tdbSNP:80357132
5373+g, tdbSNP:80357243
5375+a, c, tdbSNP:80357222
5377+a, c, gdbSNP:80357094
5377+, cdbSNP:80357870
5380+g, tdbSNP:397509230
5382+, tdbSNP:80357720
5386+a, g, tdbSNP:80357239
5387+, gdbSNP:80357743
5388..5389+, tgdbSNP:80357895
complement(5389)-t, gdbSNP:28897697
5390+a, gdbSNP:56195342
complement(5392)-g, cdbSNP:376736915
5393..5395+, cagdbSNP:80358346
5394+, adbSNP:397509233
5397+c, tdbSNP:80357104
5405..5408+, gaaadbSNP:80357867
5405+g, tdbSNP:80357291
complement(5407)-t, cdbSNP:191373374
5408+a, gdbSNP:80357501
5409..5412+, gaaadbSNP:80357975
5409..5410+, gadbSNP:80357730
5411..5424+, aaaatgctgaatgadbSNP:397509234
5411+a, tdbSNP:80357347
complement(5414..5415)-, tdbSNP:34570933
5414+, adbSNP:397509235
5418+, tdbSNP:398122692
5421+a, gdbSNP:80357171
5423+a, g, tdbSNP:397507244
5429+a, gdbSNP:398122693
5430+a, gdbSNP:80357270
5432+c, tdbSNP:80356957
5433+c, tdbSNP:397509237
5435+a, gdbSNP:397509238
5437+a, tdbSNP:431825412
complement(5438)-g, cdbSNP:377595653
5439+c, g, tdbSNP:45553935
5439+, tdbSNP:397509239
5441..5480+agaggagatgtggtcaatggaagaaaccaccaaggtccaa, tcdbSNP:273901753
5441+a, tdbSNP:80357496
5444+a, gdbSNP:80356937
5445..5447+, gagdbSNP:80358347
5445+a, gdbSNP:80357450
5447+g, tdbSNP:80357283
5448+a, g, tdbSNP:80357227
5449+g, tdbSNP:80357340
5454+g, tdbSNP:80357023
5461..5462+, aadbSNP:80357852
5462+, adbSNP:397509240
5463+, gdbSNP:397509241
5468+a, cdbSNP:80357146
5471+c, tdbSNP:80357367
5473+, adbSNP:80357791
5473+a, cdbSNP:397509242
5474+a, g, tdbSNP:397507245
5475+a, gdbSNP:397509243
5475+, gdbSNP:80357676
5477+c, gdbSNP:397509244
5478+c, gdbSNP:80357462
5483+c, tdbSNP:80357123
5484+a, c, gdbSNP:80357442
5486+a, c, gdbSNP:80357074
5487+c, tdbSNP:80357028
5488+a, cdbSNP:80356844
5489..5490+, adbSNP:397509245
5490+a, c, gdbSNP:397509246
5491+, adbSNP:80357925
5492+g, tdbSNP:80357432
5496..5497+, cdbSNP:431825413
5497..5498+, cdbSNP:397507246
5498..5499+, cdbSNP:397507247
5498+c, tdbSNP:397509247
5500..5501+, cdbSNP:431825414
5502..5508+, acagaaadbSNP:397509248
5506+, adbSNP:80357732
5508+a, gdbSNP:431825415
5509+a, gdbSNP:80356854
5514+c, tdbSNP:80356905
5516+, adbSNP:80357684
5517..5518+, gdbSNP:80357886
5517+g, tdbSNP:398122694
5520+g, tdbSNP:80357007
5521..5522+, gdbSNP:397507248
5521+, gdbSNP:397509255
5523+c, tdbSNP:80357281
5525+g, tdbSNP:397509256
5529+g, tdbSNP:80357463
5534+g, tdbSNP:431825416
5536+, cdbSNP:80357959
complement(5536)-g, adbSNP:138493864
5538+a, gdbSNP:397509257
5539+a, tdbSNP:397509258
5540+, gdbSNP:80357581
5542..5543+, gdbSNP:397509260
5542+a, gdbSNP:273901761
5542+, gdbSNP:397509259
5544+c, g, tdbSNP:80357025
5547+, tdbSNP:397509261
5549+a, tdbSNP:80357324
5550+c, tdbSNP:80357428
5551..5552+, cdbSNP:80357823
5552..5553+, aadbSNP:80357818
5555..5556+, atdbSNP:397509262
5556+a, g, tdbSNP:41293463
5558+c, tdbSNP:1800757
5559+c, tdbSNP:398122695
5560..5561+, cdbSNP:80357751
5562+c, tdbSNP:398122696
5564+a, c, g, tdbSNP:80357112
5565+a, gdbSNP:80357041
5567+, cdbSNP:80357590
5567+c, tdbSNP:397509267
5571+c, g, tdbSNP:80357474
5573+, gdbSNP:80357694
5573+g, tdbSNP:397509268
5577+a, gdbSNP:80357219
5578+a, gdbSNP:80357284
5579+a, cdbSNP:80357012
5580+c, tdbSNP:55808233
5584..5585+, adbSNP:80357744
5585+c, tdbSNP:80356969
5587+g, tdbSNP:397509269
5589+c, tdbSNP:398122697
5591+a, tdbSNP:80357065
5592..5593+ag, gtdbSNP:397509270
5594+g, tdbSNP:397509271
5595+a, g, tdbSNP:80357069
5597+a, g, tdbSNP:80357078
5601..5617+, ctgtggtgaaggagcttdbSNP:397509272
5602..5629+, tgtggtgaaggagctttcatcattcaccdbSNP:80359878
complement(5603)-c, adbSNP:145758886
5609+a, tdbSNP:397509274
5614+g, tdbSNP:397509275
5615..5616+, tdbSNP:80357838
5618..5619+, tdbSNP:397509276
5618+, tdbSNP:397507249
5619+a, cdbSNP:80357055
complement(5620)-t, cdbSNP:373810778
5640+c, gdbSNP:80357149
5643+a, tdbSNP:80356920
5646+a, cdbSNP:397509281
5648+c, gdbSNP:80357241
5649+, cdbSNP:80357558
5650+, adbSNP:80357934
5651+, adbSNP:397509282
5655+c, tdbSNP:80357358
5657..5662+, gttgtgdbSNP:80358348
5657+g, tdbSNP:28897698
5658+c, tdbSNP:80357216
5661+g, tdbSNP:80357451
5663+c, tdbSNP:397509283
5664+a, gdbSNP:80357040
5665+a, gdbSNP:4438367
5666+c, g, tdbSNP:1800751
5672+, gdbSNP:80357946
5676+a, gdbSNP:80356962
5677+a, gdbSNP:397509284
5680+a, gdbSNP:397509285
5681+g, tdbSNP:80356868
5682..5683+, agdbSNP:397509286
5685+a, gdbSNP:80357477
5688+a, gdbSNP:80357286
5690+a, gdbSNP:398122698
5696..5697+, tdbSNP:273902769
5699+a, gdbSNP:80357212
5702..5709+, attgggcadbSNP:80357973
5703+a, tdbSNP:70953662
5705+a, gdbSNP:398122700
5710+g, tdbSNP:80357332
5711..5712+, gadbSNP:80357757
5715+, gdbSNP:397509288
5720+a, gdbSNP:80357393
5722+, adbSNP:80357976
5724+, cdbSNP:80357582
5728..5738+a, ggtgacccgagdbSNP:273902775
5729..5738+, gtgacccgagdbSNP:397509290
5729+a, gdbSNP:80357268
5730..5743+, tgacccgagagtggdbSNP:80359873
5735+, cdbSNP:397509291
5735+c, tdbSNP:41293465
5736+a, gdbSNP:273902776
5738+a, g, tdbSNP:80356942
5741+c, g, tdbSNP:80356959
5742+a, gdbSNP:80357307
5742+, gdbSNP:80357839
5743+a, g, tdbSNP:80356914
5744+, gdbSNP:397509292
5745+a, tdbSNP:80357107
5748+c, tdbSNP:398122702
5753+, adbSNP:80357721
5753+a, cdbSNP:80357299
5754+a, gdbSNP:80357368
5759+c, gdbSNP:80357019
5763+g, tdbSNP:80357323
5764..5765+, gdbSNP:397509293
5764+c, tdbSNP:80356829
5765..5766+, tdbSNP:397509294
5767+a, cdbSNP:80356977
5768+c, tdbSNP:80356873
5770+a, gdbSNP:80356849
5773+a, cdbSNP:397509295
5780+, cdbSNP:397509296
5785..5786+, cdbSNP:397509297
5785+a, cdbSNP:80357326
5788+c, gdbSNP:80356841
5790..5791+, adbSNP:80357629
5790+a, gdbSNP:80357258
5791+a, c, gdbSNP:80357336
5793+c, tdbSNP:80356996
5797..5805+, accccagatdbSNP:397507253
5798+c, tdbSNP:80357274
complement(5803)-t, gdbSNP:386576393
5803+g, tdbSNP:28897699
5808+c, gdbSNP:80357322
5810..5811+, cdbSNP:397507254
complement(5811)-t, gdbSNP:201196020
complement(5812..5813)-, gggggggggdbSNP:138690298
5817+a, tdbSNP:80357183
complement(5844)-g, adbSNP:375042815
5866+a, tdbSNP:273902777
5882+a, gdbSNP:137892861
5926..5929+, ctgtdbSNP:431825382
complement(5930)-g, c, adbSNP:189442183
complement(6052)-t, cdbSNP:56108540
complement(6088)-g, adbSNP:371540942
6096+a, gdbSNP:8176317
complement(6096)-t, cdbSNP:386615790
6245+g, tdbSNP:8176318
6287+, tdbSNP:397507255
complement(6387)-t, gdbSNP:373323531
complement(6406)-g, adbSNP:141850147
complement(6574)-t, cdbSNP:138782023
complement(6602)-g, cdbSNP:11655841
6605+c, tdbSNP:8176319
complement(6678..6679)-, tdbSNP:397967320
complement(6679)-, t, ttdbSNP:33947868
complement(6696..6697)-, tdbSNP:397857225
complement(6696..6697)-, ttdbSNP:59541324
complement(6697)-, tdbSNP:397857709
complement(6713)-t, cdbSNP:55834099
complement(6715)-t, cdbSNP:56056327
6718+a, gdbSNP:1060920
6724+a, tdbSNP:1060921
complement(6872)-g, adbSNP:375357592
complement(6894)-g, cdbSNP:185966495
complement(6937)-t, cdbSNP:111791349
complement(6984..6985)-, gdbSNP:34214126
7111+c, tdbSNP:12516
complement(7116)-g, adbSNP:182218567
complement(7147)-t, cdbSNP:189382442
complement(7151)-t, cdbSNP:184237074
complement(7156)-g, adbSNP:8176320
Gene SymbolBRCA1
Locus Map17q21
Title Emerging roles of BRCA1 alternative splicing .
Author Orban TI and Olah E.
Journal MP, Mol. Pathol. 56 (4), 191-197 (2003)
Title Expression profiles of BRCA1 splice variants in asynchronous and in G1/S synchronized tumor cell lines .
Author Orban TI and Olah E.
Journal Biochem. Biophys. Res. Commun. 280 (1), 32-38 (2001)
Title BRCA1: a review of structure and putative functions .
Author Paterson JW.
Journal Dis. Markers 13 (4), 261-274 (1998)
Title Mutations and alternative splicing of the BRCA1 gene in UK breast/ovarian cancer families .
Author Xu CF, Chambers JA, Nicolai H, Brown MA, Hujeirat Y, Mohammed S, Hodgson S, Kelsell DP, Spurr NK, Bishop DT and Solomon E.
Journal Genes Chromosomes Cancer 18 (2), 102-110 (1997)
Title Localization of BRCA1 and a splice variant identifies the nuclear localization signal .
Author Thakur S, Zhang HB, Peng Y, Le H, Carroll B, Ward T, Yao J, Farid LM, Couch FJ, Wilson RB and Weber BL.
Journal Mol. Cell. Biol. 17 (1), 444-452 (1997)
Title Characterization of functional messenger RNA splice variants of BRCA1 expressed in nonmalignant and tumor-derived breast cells .
Author Lu M, Conzen SD, Cole CN and Arrick BA.
Journal Cancer Res. 56 (20), 4578-4581 (1996)
Title Growth retardation and tumour inhibition by BRCA1 .
Author Holt JT, Thompson ME, Szabo C, Robinson-Benion C, Arteaga CL, King
Journal Nat. Genet. 12 (3), 298-302 (1996)
Title Distinct transcription start sites generate two forms of BRCA1 mRNA .
Author Xu CF, Brown MA, Chambers JA, Griffiths B, Nicolai H and Solomon E.
Journal Hum. Mol. Genet. 4 (12), 2259-2264 (1995)
Title A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1 .
Author Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, Harshman K, Tavtigian S, Liu Q, Cochran C, Bennett LM and Ding W.
Journal Science 266 (5182), 66-71 (1994)
Title BRCA1 and BRCA2 Hereditary Breast and Ovarian Cancer .
Author Petrucelli,N., Daly,M.B. and Feldman,G.L.
Journal (in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)

Our customer service representatives are available 24 hours a day, Monday through Friday; please contact us anytime for assistance.