• THAT   AND

Sequence in raw or FASTA format:


Blast Method:


Homo sapiens solute carrier organic anion transporter family, member 1B3 (SLCO1B3), mRNA.

Clone ID Definition Vector Stock Status Price *Turnaround time Select
OHu21499 Homo sapiens solute carrier organic anion transporter family, member 1B3 (SLCO1B3), mRNA. pcDNA3.1+-DYK In-stock Starting from $99 5-7
OHu21499C Homo sapiens solute carrier organic anion transporter family, member 1B3 (SLCO1B3), mRNA. Your vector of choice In-stock Starting from $99 5-7
OHu21499M Mutant Clone for Homo sapiens solute carrier organic anion transporter family, member 1B3 (SLCO1B3), mRNA. pcDNA3.1+-DYK In-stock Starting from $149 Additional 5 days
OHu21499CM Mutant Clone for Homo sapiens solute carrier organic anion transporter family, member 1B3 (SLCO1B3), mRNA. Your vector of choice In-stock Starting from $149 Additional 5 days

*Business Day

Sequence Information ORF Nucleotide Sequence
Protein sequence
Vector pcDNA3.1+-DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+-DYK N terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
RefSeq Version NM_019844.3, 375065831
Length 2109 bp
Structure linear
Update Date 05-MAY-2014
Organism Homo sapiens (human)
Definition Homo sapiens solute carrier organic anion transporter family, member 1B3 (SLCO1B3), mRNA.
Product solute carrier organic anion transporter family member 1B3

Summary: This gene encodes a liver-specific member of the organic anion transporter family. The encoded protein is a transmembrane receptor that mediates the sodium-independent uptake of endogenous and xenobiotic compounds and plays a critical role in bile acid and bilirubin transport. Mutations in this gene are a cause of Rotor type hyperbilirubinemia. [provided by RefSeq, Feb 2012].

Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

RefSeq NP_062818.1
CDS 242..2350
Misc Feature(1)209..211
Misc Feature(2)320..2107
Misc Feature(3)320..2107
Misc Feature(4)326..385
Misc Feature(5)332..>1528
Misc Feature(6)order(374..376,383..391,395..400,449..451,458..463,
Misc Feature(7)443..505
Misc Feature(8)524..598
Misc Feature(9)746..832
Misc Feature(10)890..952
Misc Feature(11)1007..1081
Misc Feature(12)1235..1300
Misc Feature(13)1361..1432
Misc Feature(14)1445..1516
Misc Feature(15)1604..1765
Misc Feature(16)1853..1921
Misc Feature(17)1949..2026
Misc Feature(18)2129..2182
Exon (1)1..61
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (2)62..176
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (3)177..325
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (4)326..467
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (5)468..600
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (6)601..722
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (7)723..869
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (8)870..968
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (9)969..1211
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (10)1212..1376
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (11)1377..1572
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (12)1573..1738
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (13)1739..1923
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (14)1924..1988
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (15)1989..2106
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (16)2107..3014
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Order your protein of interest with our Guaranteed or It's Free Service now! For details, please click here.
Position Chain Variation Link
1+a, gdbSNP:59312184
112+, cdbSNP:373018826
152+c, tdbSNP:7305323
180+a, gdbSNP:189089836
210+, adbSNP:200104106
213..214+, tagdbSNP:376671816
214..238+atattcacttggtatctgtagttta, tagdbSNP:71581943
214..235+, atattcacttggtatctgtagtdbSNP:201656982
235..238+, tttadbSNP:4149158
237+a, tdbSNP:201503539
238+a, gdbSNP:201943559
252+a, gdbSNP:61612406
267+a, cdbSNP:200793002
292+c, gdbSNP:376673811
308+c, tdbSNP:369736559
310+c, tdbSNP:149944473
321+g, tdbSNP:377570761
340+c, tdbSNP:144143469
349+c, gdbSNP:79042365
368+c, tdbSNP:11045565
395+a, gdbSNP:57325543
403+a, gdbSNP:117554616
406+a, gdbSNP:374761449
422+a, tdbSNP:190960788
431+a, tdbSNP:151295214
450+a, gdbSNP:374641951
452+a, gdbSNP:368817817
454+a, gdbSNP:200473248
468+g, tdbSNP:368091191
505+a, cdbSNP:374616195
516+a, gdbSNP:144099822
522+c, tdbSNP:371512520
558+a, cdbSNP:150007972
575+g, tdbSNP:4149117
576+a, cdbSNP:145334570
632+a, cdbSNP:374152690
634+a, gdbSNP:200835380
638+a, gdbSNP:369609436
645+c, tdbSNP:150039066
649+a, gdbSNP:377002062
654+g, tdbSNP:369529563
675+a, gdbSNP:146623116
680+a, gdbSNP:57585902
693+a, gdbSNP:77922474
700+a, gdbSNP:370334648
725+g, tdbSNP:140353351
783+a, gdbSNP:180875376
791+a, gdbSNP:374117010
801+c, gdbSNP:368572652
822+c, tdbSNP:148029725
825+a, cdbSNP:199849487
827+a, gdbSNP:147555114
828+c, tdbSNP:141703938
833+a, gdbSNP:368649517
844+a, gdbSNP:138661039
886+a, gdbSNP:142673817
888+a, gdbSNP:375847286
904+c, tdbSNP:369915589
917+c, gdbSNP:115227445
940+a, gdbSNP:7311358
943+c, tdbSNP:374015229
977+a, gdbSNP:149427388
1000+a, tdbSNP:61736830
1008+c, gdbSNP:60140950
1042+a, gdbSNP:373432026
1113+a, cdbSNP:200068079
1114+a, cdbSNP:142873062
1176+c, tdbSNP:371298832
1189+a, gdbSNP:373072758
1190+a, gdbSNP:146565174
1213+a, tdbSNP:199532359
1229+a, gdbSNP:146780296
1240+c, tdbSNP:140410796
1272+, tdbSNP:149063204
1309+c, tdbSNP:150373728
1315+c, tdbSNP:145036538
1333+a, gdbSNP:149072672
1343+g, tdbSNP:370237473
1348+a, gdbSNP:375605848
1360+c, tdbSNP:200150730
1377+a, gdbSNP:202070259
1388+a, gdbSNP:372972480
1391+a, cdbSNP:145877520
1395+c, tdbSNP:138702607
1396+a, gdbSNP:142709481
1441+c, tdbSNP:267603412
1458+a, gdbSNP:374932005
1482+c, tdbSNP:146940490
1485+a, cdbSNP:369045586
1493+c, tdbSNP:137901490
1499+g, tdbSNP:201866779
1513+a, gdbSNP:4149143
1530+a, gdbSNP:376788743
1531+c, tdbSNP:369799686
1532+a, gdbSNP:141602442
1544+c, gdbSNP:373665461
1549+c, tdbSNP:147428265
1550+a, gdbSNP:61673910
1554+c, tdbSNP:189943255
1588+a, gdbSNP:79382866
1607+c, tdbSNP:61736817
1614+a, gdbSNP:140093214
1685+c, tdbSNP:377513667
1702+a, gdbSNP:199802324
1756+c, tdbSNP:374081229
1792+c, gdbSNP:367949187
1795+a, gdbSNP:371851895
1798+a, gdbSNP:2053098
1805+g, tdbSNP:72559743
1829+c, tdbSNP:188500840
1834+a, gdbSNP:142694767
1851+a, gdbSNP:150998576
1855+c, tdbSNP:77851390
1878..1879+, tdbSNP:78627909
1889+a, gdbSNP:144378120
1912+a, gdbSNP:201358042
1920+c, tdbSNP:12299012
1953+c, gdbSNP:76963574
1961+c, tdbSNP:369136047
1983+a, cdbSNP:369584908
2006+a, gdbSNP:369164160
2015+g, tdbSNP:143362002
2050+c, gdbSNP:137912239
complement(2074)-t, cdbSNP:3764006
2096+a, gdbSNP:202234562
2098+a, tdbSNP:143827641
2102+c, tdbSNP:77265855
2116+a, cdbSNP:200412791
2122+c, tdbSNP:267603413
2150+c, tdbSNP:376393874
2158+a, gdbSNP:370819902
2163+c, tdbSNP:374189599
2184+a, gdbSNP:200774414
2205+a, gdbSNP:371574727
2217+c, tdbSNP:200539697
2218+a, gdbSNP:60571683
2223+a, gdbSNP:367827357
2229+a, gdbSNP:371725645
2243+a, gdbSNP:267603414
2282+a, gdbSNP:377270851
2324..2325+, cdbSNP:72559744
2331+a, gdbSNP:143038862
2346+a, gdbSNP:368439565
2358+c, tdbSNP:372418887
2384+c, gdbSNP:376969190
2400+a, cdbSNP:369766680
2468+a, gdbSNP:112861267
2493+a, gdbSNP:188100388
2495+g, tdbSNP:112931172
2668+a, cdbSNP:145346893
2689+c, gdbSNP:191491660
2697..2698+, tdbSNP:3834935
2705..2706+, adbSNP:397689574
2849+c, tdbSNP:369234665
2898+a, tdbSNP:117703648
2922+a, gdbSNP:147670653
2977+a, gdbSNP:79132805
2992+a, gdbSNP:77957556
3009+a, gdbSNP:377573287
Gene SymbolSLCO1B3
Gene SynonymHBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Locus Map12p12
All Transcripts
RefSeq Accession Definition Stock Status Price Turnaround time Business Day Select
NM_019844 Homo sapiens solute carrier organic anion transporter family, member 1B3 (SLCO1B3), mRNA. In-stock $99.00 5-7
Title OATP1B3 is expressed in pancreatic beta-islet cells and enhances the insulinotropic effect of the sulfonylurea derivative glibenclamide .
Author Meyer Zu Schwabedissen HE, Boettcher K, Steiner T, Schwarz UI, Keiser M, Kroemer HK and Siegmund W.
Journal Diabetes 63 (2), 775-784 (2014)
Title Role of hypoxia inducible factor-1alpha in the regulation of the cancer-specific variant of organic anion transporting polypeptide 1B3 (OATP1B3), in colon and pancreatic cancer .
Author Han S, Kim K, Thakkar N, Kim D and Lee W.
Journal Biochem. Pharmacol. 86 (6), 816-823 (2013)
Title Effects of Rifampin, a potent inducer of drug-metabolizing enzymes and an inhibitor of OATP1B1/3 transport, on the single dose pharmacokinetics of anacetrapib .
Author Anderson MS, Cote J, Liu Y, Stypinski D, Auger P, Hohnstein A, Rasmussen S, Johnson-Levonas AO and Gutstein DE.
Journal J Clin Pharmacol 53 (7), 746-752 (2013)
Title Prognostic value of organic anion transporting polypeptide 1B3 and copper transporter 1 expression in endometrial cancer patients treated with paclitaxel and carboplatin .
Author Ogane N, Yasuda M, Kameda Y, Yokose T, Kato H, Itoh A, Nishino S, Hashimoto Y and Kamoshida S.
Journal Biomed. Res. 34 (3), 143-151 (2013)
Title Complete OATP1B1 and OATP1B3 deficiency causes human Rotor syndrome by interrupting conjugated bilirubin reuptake into the liver .
Author van de Steeg E, Stranecky V, Hartmannova H, Noskova L, Hrebicek M, Wagenaar E, van Esch A, de Waart DR, Oude Elferink RP, Kenworthy KE, Sticova E, al-Edreesi M, Knisely AS, Kmoch S, Jirsa M and Schinkel AH.
Journal J. Clin. Invest. 122 (2), 519-528 (2012)
Title Hepatic uptake of cholecystokinin octapeptide by organic anion-transporting polypeptides OATP4 and OATP8 of rat and human liver .
Author Ismair MG, Stieger B, Cattori V, Hagenbuch B, Fried M, Meier PJ and Kullak-Ublick GA.
Journal Gastroenterology 121 (5), 1185-1190 (2001)
Title LST-2, a human liver-specific organic anion transporter, determines methotrexate sensitivity in gastrointestinal cancers .
Author Abe T, Unno M, Onogawa T, Tokui T, Kondo TN, Nakagomi R, Adachi H, Fujiwara K, Okabe M, Suzuki T, Nunoki K, Sato E, Kakyo M, Nishio T, Sugita J, Asano N, Tanemoto M, Seki M, Date F, Ono K, Kondo Y, Shiiba K, Suzuki M, Ohtani H, Shimosegawa T, Iinuma K, Nagura H, Ito S and Matsuno S.
Journal Gastroenterology 120 (7), 1689-1699 (2001)
Title Organic anion-transporting polypeptide B (OATP-B) and its functional comparison with three other OATPs of human liver .
Author Kullak-Ublick GA, Ismair MG, Stieger B, Landmann L, Huber R, Pizzagalli F, Fattinger K, Meier PJ and Hagenbuch B.
Journal Gastroenterology 120 (2), 525-533 (2001)
Title Localization and genomic organization of a new hepatocellular organic anion transporting polypeptide .
Author Konig J, Cui Y, Nies AT and Keppler D.
Journal J. Biol. Chem. 275 (30), 23161-23168 (2000)
Title Rotor Syndrome .
Author Jirsa,M., Knisely,A.S., Schinkel,A. and Kmoch,S.
Journal (in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)

Our customer service representatives are available 24 hours a day, Monday through Friday; please contact us anytime for assistance.