• THAT   AND

Sequence in raw or FASTA format:


Blast Method:


Homo sapiens solute carrier organic anion transporter family, member 1B3 (SLCO1B3), mRNA.

RefSeq Accession Definition Services Price Order
NM_019844 Homo sapiens solute carrier organic anion transporter family, member 1B3 (SLCO1B3), mRNA. ORF Sequence $611.61
Peptide Services
Antibody Services
Protein Services

RefSeq Version NM_019844.3, 375065831
Length 3014 bp
Structure linear
Update Date 15-APR-2013
Organism Homo sapiens (human)
Definition Homo sapiens solute carrier organic anion transporter family, member 1B3 (SLCO1B3), mRNA.
Product solute carrier organic anion transporter family member 1B3

Summary: This gene encodes a liver-specific member of the organic anion transporter family. The encoded protein is a transmembrane receptor that mediates the sodium-independent uptake of endogenous and xenobiotic compounds and plays a critical role in bile acid and bilirubin transport. Mutations in this gene are a cause of Rotor type hyperbilirubinemia. [provided by RefSeq, Feb 2012].

Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

RefSeq NP_062818.1
CDS 242..2350
Misc Feature(1)209..211
Misc Feature(2)320..2107
Misc Feature(3)320..2107
Misc Feature(4)326..385
Misc Feature(5)332..>604
Misc Feature(6)443..505
Misc Feature(7)524..598
Misc Feature(8)746..832
Misc Feature(9)890..952
Misc Feature(10)1007..1081
Misc Feature(11)1235..1300
Misc Feature(12)1361..1432
Misc Feature(13)1445..1516
Misc Feature(14)1604..1765
Misc Feature(15)1853..1921
Misc Feature(16)1949..2026
Misc Feature(17)2129..2182
Exon (1)1..61
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (2)62..176
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (3)177..325
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (4)326..467
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (5)468..600
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (6)601..722
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (7)723..869
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (8)870..968
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (9)969..1211
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (10)1212..1376
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (11)1377..1572
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (12)1573..1738
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (13)1739..1923
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (14)1924..1988
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (15)1989..2106
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Exon (16)2107..3014
Gene Synonym:HBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Order your protein of interest with our Guaranteed or It's Free Service now! For details, please click here.
Position Chain Variation Link
1+a, gdbSNP:59312184
152+c, tdbSNP:7305323
180+a, gdbSNP:189089836
210+, adbSNP:200104106
214..238+atattcacttggtatctgtagttta, tagdbSNP:71581943
214..235+, atattcacttggtatctgtagtdbSNP:201656982
214+, atattcacttggtatctgdbSNP:4149157
235..238+, tttadbSNP:4149158
237+a, tdbSNP:201503539
238+a, gdbSNP:201943559
252+a, gdbSNP:61612406
267+a, cdbSNP:200793002
310+c, tdbSNP:149944473
340+c, tdbSNP:144143469
349+c, gdbSNP:79042365
368+c, tdbSNP:11045565
395+a, gdbSNP:57325543
403+a, gdbSNP:117554616
422+a, tdbSNP:190960788
431+a, tdbSNP:151295214
454+a, gdbSNP:200473248
516+a, gdbSNP:144099822
558+a, cdbSNP:150007972
575+g, tdbSNP:4149117
576+a, cdbSNP:145334570
634+a, gdbSNP:200835380
645+c, tdbSNP:150039066
675+a, gdbSNP:146623116
680+a, gdbSNP:57585902
693+a, gdbSNP:77922474
725+g, tdbSNP:140353351
782+c, tdbSNP:143565471
783+a, gdbSNP:180875376
822+c, tdbSNP:148029725
825+a, cdbSNP:199849487
827+a, gdbSNP:147555114
828+c, tdbSNP:141703938
834+a, gdbSNP:150113358
844+a, gdbSNP:138661039
886+a, gdbSNP:142673817
917+c, gdbSNP:115227445
940+a, gdbSNP:7311358
977+a, gdbSNP:149427388
1000+a, tdbSNP:61736830
1008+c, gdbSNP:60140950
1113+a, cdbSNP:200068079
1114+a, cdbSNP:142873062
1190+a, gdbSNP:146565174
1213+a, tdbSNP:199532359
1214+a, tdbSNP:143558916
1229+a, gdbSNP:146780296
1240+c, tdbSNP:140410796
1269+, tdbSNP:149063204
1309+c, tdbSNP:150373728
1315+c, tdbSNP:145036538
1333+a, gdbSNP:149072672
1360+c, tdbSNP:200150730
1377+a, gdbSNP:202070259
1391+a, cdbSNP:145877520
1395+c, tdbSNP:138702607
1396+a, gdbSNP:142709481
1482+c, tdbSNP:146940490
1493+c, tdbSNP:137901490
1499+g, tdbSNP:201866779
1513+a, gdbSNP:4149143
1532+a, gdbSNP:141602442
1549+c, tdbSNP:147428265
1550+a, gdbSNP:61673910
1554+c, tdbSNP:189943255
1588+a, gdbSNP:79382866
1607+c, tdbSNP:61736817
1614+a, gdbSNP:140093214
1702+a, gdbSNP:199802324
1798+a, gdbSNP:2053098
1805+g, tdbSNP:72559743
1826+a, tdbSNP:148507021
1829+c, tdbSNP:188500840
1834+a, gdbSNP:142694767
1851+a, gdbSNP:150998576
1855+c, tdbSNP:77851390
1876..1877+, tdbSNP:78627909
1889+a, gdbSNP:144378120
1912+a, gdbSNP:201358042
1920+c, tdbSNP:12299012
1953+c, gdbSNP:76963574
2013+g, tdbSNP:146957020
2015+g, tdbSNP:143362002
2050+c, gdbSNP:137912239
2074+c, tdbSNP:3764006
2096+a, gdbSNP:202234562
2098+a, tdbSNP:143827641
2102+c, tdbSNP:77265855
2116+a, cdbSNP:200412791
2184+a, gdbSNP:200774414
2217+c, tdbSNP:200539697
2218+a, gdbSNP:60571683
2323..2324+, cdbSNP:72559744
2331+a, gdbSNP:143038862
2468+a, gdbSNP:112861267
2493+a, gdbSNP:188100388
2495+g, tdbSNP:112931172
2668+a, cdbSNP:145346893
2689+c, gdbSNP:191491660
2697..2698+, tdbSNP:3834935
2698..2699+, adbSNP:4149169
2898+a, tdbSNP:117703648
2922+a, gdbSNP:147670653
2977+a, gdbSNP:79132805
2992+a, gdbSNP:77957556
Gene SymbolSLCO1B3
Gene SynonymHBLRR; LST-2; LST-3TM13; LST3; OATP-8; OATP1B3; OATP8; SLC21A8
Locus Map12p12
All Transcripts
RefSeq Accession Definition Sequence Price Select
NM_019844 Homo sapiens solute carrier organic anion transporter family, member 1B3 (SLCO1B3), mRNA. Full Length $1054.90
ORF Sequence $611.61
Title Visualization of hepatic uptake transporter function in healthy subjects by using gadoxetic acid-enhanced MR imaging .
Author Nassif,A., Jia,J., Keiser,M., Oswald,S., Modess,C., Nagel,S., Weitschies,W., Hosten,N., Siegmund,W. and Kuhn,J.P.
Journal Radiology 264 (3), 741-750 (2012)
Title Association study of genetic polymorphisms of drug transporters, SLCO1B1, SLCO1B3 and ABCC2, in African-Americans, Hispanics and Caucasians and olmesartan exposure .
Author Endo,S., Fukahori,A., Tokuhiro,S., Shinagawa,A., Walker,J., Yoshihara,K., Ishizuka,H., Ieiri,I. and Sugiyama,Y.
Journal J. Hum. Genet. 57 (8), 531-544 (2012)
Title UGT1A1, SLCO1B1, and SLCO1B3 polymorphisms vs. neonatal hyperbilirubinemia: is there an association? .
Author Alencastro de Azevedo,L., Reverbel da Silveira,T., Carvalho,C.G., Martins de Castro,S., Giugliani,R. and Matte,U.
Journal Pediatr. Res. 72 (2), 169-173 (2012)
Title Interaction of three regiospecific amino acid residues is required for OATP1B1 gain of OATP1B3 substrate specificity .
Author DeGorter,M.K., Ho,R.H., Leake,B.F., Tirona,R.G. and Kim,R.B.
Journal Mol. Pharm. 9 (4), 986-995 (2012)
Title Complete OATP1B1 and OATP1B3 deficiency causes human Rotor syndrome by interrupting conjugated bilirubin reuptake into the liver .
Author van de Steeg,E., Stranecky,V., Hartmannova,H., Noskova,L., Hrebicek,M., Wagenaar,E., van Esch,A., de Waart,D.R., Oude Elferink,R.P., Kenworthy,K.E., Sticova,E., al-Edreesi,M., Knisely,A.S., Kmoch,S., Jirsa,M. and Schinkel,A.H.
Journal J. Clin. Invest. 122 (2), 519-528 (2012)
Title Human organic anion transporting polypeptide 8 promoter is transactivated by the farnesoid X receptor/bile acid receptor .
Author Jung,D., Podvinec,M., Meyer,U.A., Mangelsdorf,D.J., Fried,M., Meier,P.J. and Kullak-Ublick,G.A.
Journal Gastroenterology 122 (7), 1954-1966 (2002)
Title Hepatic uptake of cholecystokinin octapeptide by organic anion-transporting polypeptides OATP4 and OATP8 of rat and human liver .
Author Ismair,M.G., Stieger,B., Cattori,V., Hagenbuch,B., Fried,M., Meier,P.J. and Kullak-Ublick,G.A.
Journal Gastroenterology 121 (5), 1185-1190 (2001)
Title LST-2, a human liver-specific organic anion transporter, determines methotrexate sensitivity in gastrointestinal cancers .
Author Abe,T., Unno,M., Onogawa,T., Tokui,T., Kondo,T.N., Nakagomi,R., Adachi,H., Fujiwara,K., Okabe,M., Suzuki,T., Nunoki,K., Sato,E., Kakyo,M., Nishio,T., Sugita,J., Asano,N., Tanemoto,M., Seki,M., Date,F., Ono,K., Kondo,Y., Shiiba,K., Suzuki,M., Ohtani,H., Shimosegawa,T., Iinuma,K., Nagura,H., Ito,S. and Matsuno,S.
Journal Gastroenterology 120 (7), 1689-1699 (2001)
Title Organic anion-transporting polypeptide B (OATP-B) and its functional comparison with three other OATPs of human liver .
Author Kullak-Ublick,G.A., Ismair,M.G., Stieger,B., Landmann,L., Huber,R., Pizzagalli,F., Fattinger,K., Meier,P.J. and Hagenbuch,B.
Journal Gastroenterology 120 (2), 525-533 (2001)
Title Localization and genomic organization of a new hepatocellular organic anion transporting polypeptide .
Author Konig,J., Cui,Y., Nies,A.T. and Keppler,D.
Journal J. Biol. Chem. 275 (30), 23161-23168 (2000)

Our customer service representatives are available 24 hours a day, Monday through Friday; please contact us anytime for assistance.

Secured Online Quotation
Email: gene@genscript.com
Phone: 1-877-436-7274 (Toll-Free) 1-732-885-9188
Fax: 1-732-210-0262 1-732-885-5878