• THAT   AND

Sequence in raw or FASTA format:


Blast Method:


Homo sapiens ret proto-oncogene (RET), transcript variant 2, mRNA.

Clone ID Definition Vector Stock Status Price *Turnaround time Order
OHu27214 Homo sapiens ret proto-oncogene (RET), transcript variant 2, mRNA. pcDNA3.1+-DYK On-demand TBD 25
OHu27214C Homo sapiens ret proto-oncogene (RET), transcript variant 2, mRNA. Customized vector On-demand TBD 25

*Business Day

Mutation services

Sequence Information ORF Nucleotide Sequence
Protein sequence
Vector pcDNA3.1+-DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+-DYK N terminal DYKDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
RefSeq Version NM_020975.4, 126273511
Length 3345 bp
Update Date 25-MAY-2014
Organism Homo sapiens (human)
Definition Homo sapiens ret proto-oncogene (RET), transcript variant 2, mRNA.
Product proto-oncogene tyrosine-protein kinase receptor Ret isoform a precursor

Summary: This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008].

Transcript Variant: This variant (2) represents the longer transcript and encodes the longer isoform (a). This isoform is also known as Ret51.

RefSeq NP_066124.1
CDS 191..3535
Misc Feature(1)149..151
Misc Feature(2)707..991
Misc Feature(3)order(722..727,878..880,884..886,980..982,986..991)
Misc Feature(4)1949..1954
Misc Feature(5)2096..2161
Misc Feature(6)2249..2251
Misc Feature(7)2276..2278
Misc Feature(8)2309..2314
Misc Feature(9)2324..2329
Misc Feature(10)2357..3226
Misc Feature(11)2360..3205
Misc Feature(12)order(2378..2392,2402..2404,2456..2458,2462..2464,
Misc Feature(13)order(2378..2389,2402..2404,2456..2458,2462..2464,
Misc Feature(14)2603..2611
Misc Feature(15)2606..2608
Misc Feature(16)2606..2608
Misc Feature(17)2615..2617
Misc Feature(18)2615..2617
Misc Feature(19)2666..2668
Misc Feature(20)order(2810..2812,2822..2824,2918..2932,2957..2959,
Misc Feature(21)2861..2938
Misc Feature(22)2888..2890
Misc Feature(23)2888..2890
Misc Feature(24)2903..2905
Misc Feature(25)2903..2905
Misc Feature(26)3131..3133
Misc Feature(27)3131..3133
Misc Feature(28)3233..3235
Misc Feature(29)3233..3235
Misc Feature(30)3239..3244
Misc Feature(31)3275..3277
Misc Feature(32)3374..3376
Misc Feature(33)3374..3376
Misc Feature(34)3458..3460
Misc Feature(35)3458..3460
Misc Feature(36)3476..3478
Misc Feature(37)3476..3478
Exon (1)1..263
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (2)264..527
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (3)528..815
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (4)816..1057
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (5)1058..1253
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (6)1254..1453
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (7)1454..1712
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (8)1713..1838
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (9)1839..1949
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (10)1950..2069
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (11)2070..2326
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (12)2327..2474
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (13)2475..2582
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (14)2583..2797
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (15)2798..2920
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (16)2921..2991
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (17)2992..3129
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (18)3130..3229
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (19)3230..3377
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Exon (20)3378..5617
Gene Synonym:CDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Order your protein of interest with our Guaranteed or It's Free Service now! For details, please click here.
Position Chain Variation Link
7+a, gdbSNP:112715174
123+c, tdbSNP:3128725
269+c, tdbSNP:377160777
271+a, gdbSNP:369519655
285+c, tdbSNP:76764689
286+a, gdbSNP:139821724
308+c, tdbSNP:373420806
325+a, gdbSNP:1800858
356+a, cdbSNP:145633958
365+a, gdbSNP:376565365
367+a, cdbSNP:370622218
381+c, tdbSNP:77596424
390+a, gdbSNP:192489011
391+a, cdbSNP:200328158
394+g, tdbSNP:148874112
414+c, tdbSNP:142641173
415+a, gdbSNP:151267865
complement(421)-t, gdbSNP:3123654
452+a, gdbSNP:141679950
494+a, gdbSNP:201244749
498+a, gdbSNP:375390467
531+a, gdbSNP:76397662
532+c, tdbSNP:143083395
541+c, tdbSNP:267602487
565+a, cdbSNP:1800859
581+c, tdbSNP:375576038
588+a, gdbSNP:138265837
595+c, tdbSNP:142345108
596+g, tdbSNP:79014735
642+a, gdbSNP:150261092
658+c, tdbSNP:141290380
677+a, cdbSNP:371153966
678+a, gdbSNP:149403911
695+a, gdbSNP:374514956
699+c, tdbSNP:200547906
708+c, tdbSNP:368431125
728+c, tdbSNP:76449634
729+a, gdbSNP:370736139
738+a, gdbSNP:144801580
772+a, gdbSNP:368116579
782+a, cdbSNP:76736111
787+c, tdbSNP:55810667
844+a, gdbSNP:137928436
868+c, tdbSNP:142421698
882+a, gdbSNP:79661516
908+c, gdbSNP:375120544
916+a, gdbSNP:377193354
917+a, tdbSNP:112448213
921+c, tdbSNP:145970248
930+a, c, tdbSNP:61843232
975+c, tdbSNP:139790943
1014+g, tdbSNP:143209223
1015+c, tdbSNP:150797149
1016+a, gdbSNP:139213499
1023+a, cdbSNP:35118262
1024+c, tdbSNP:41306550
1058..1059+, gdbSNP:36008607
1064+a, gdbSNP:34682185
1128+a, gdbSNP:77702891
1141+g, tdbSNP:375812189
1147+a, cdbSNP:149926238
1151+a, gdbSNP:377767388
1179+a, gdbSNP:80236571
1183+a, gdbSNP:377200874
1198+c, gdbSNP:144981275
1203+c, tdbSNP:377767433
1207+a, gdbSNP:369810881
1208+g, tdbSNP:367737920
1230+c, tdbSNP:200641186
1237+a, gdbSNP:373208682
1240+c, tdbSNP:142188675
1253+a, gdbSNP:145402131
1285+a, gdbSNP:201992974
1293+a, gdbSNP:199529397
1309+a, gdbSNP:113931414
1314+a, tdbSNP:142338976
1332+g, tdbSNP:139813765
1347+c, tdbSNP:115272158
1348+a, gdbSNP:373540097
1369+a, cdbSNP:78098482
1372+c, tdbSNP:376465385
1379+a, gdbSNP:183729115
1387+a, gdbSNP:148371113
1391+a, tdbSNP:140638866
1440+a, gdbSNP:201030628
1443+c, gdbSNP:371731991
1465+c, gdbSNP:200458714
1480+c, gdbSNP:202053997
1485..1486+ca, tgdbSNP:386743165
1486+a, gdbSNP:1800860
1526+c, gdbSNP:115423919
1543+g, tdbSNP:201568301
1544+a, cdbSNP:151148041
1552+a, gdbSNP:35717926
1553+a, gdbSNP:145966037
1561+a, tdbSNP:376464605
1564+c, tdbSNP:190750926
1589+c, gdbSNP:200334340
1614+a, gdbSNP:138624658
1655+a, gdbSNP:9282834
1657+a, cdbSNP:372648203
1672+a, gdbSNP:200088863
1683+c, tdbSNP:375677628
1691+c, gdbSNP:199572076
1719+c, tdbSNP:201745826
1721+a, gdbSNP:201553718
1728+c, gdbSNP:149238501
1734..1735+ct, gcdbSNP:377767389
1781+c, tdbSNP:377767390
1783..1784+, gaggagtgtdbSNP:377767434
1786+c, tdbSNP:144460361
1787+a, g, tdbSNP:75873440
1803+c, gdbSNP:148406803
1832+a, gdbSNP:374461212
1851+a, gdbSNP:200047805
1858+c, gdbSNP:141771814
1871+a, cdbSNP:201972250
1889+a, gdbSNP:147219360
1891+c, tdbSNP:201209972
1892+a, gdbSNP:140464432
1900+a, cdbSNP:144015580
1927+c, gdbSNP:144455821
1989+a, gdbSNP:377767393
1997+a, cdbSNP:377767394
2006+c, tdbSNP:199921511
2007+a, gdbSNP:377767395
2015+a, c, g, tdbSNP:77558292
2016+a, c, g, tdbSNP:77939446
2017+c, gdbSNP:377767396
2021+a, c, g, tdbSNP:377767391
2022..2023+at, ct, gc, ttdbSNP:377767398
2022+a, c, g, tdbSNP:377767397
2023+c, gdbSNP:80069458
2024..2050+, ttccctgaggaggagaagtgcttctgcdbSNP:121913313
2036..2038+, gagdbSNP:377767399
2042+a, c, g, tdbSNP:76262710
2043+a, c, g, tdbSNP:79781594
2044+c, gdbSNP:377767400
2047+c, tdbSNP:377767401
2048+a, c, g, tdbSNP:77316810
2049+a, c, g, tdbSNP:77503355
2050+c, gdbSNP:79890926
2056+c, gdbSNP:201979255
2057+a, gdbSNP:377767402
2068+a, gdbSNP:147692872
2078+c, tdbSNP:377767404
2079+a, c, g, tdbSNP:377767405
2081..2083+, gacdbSNP:377767435
2081+a, g, tdbSNP:377767406
2082+a, c, g, tdbSNP:121913308
2083..2088+, cgagctdbSNP:121913307
2083+a, c, tdbSNP:55846256
2084..2089+, gagctgdbSNP:121913312
2084+a, gdbSNP:377767407
2085..2108+agctgtgccgcacggtgatcgcag, tgcggcdbSNP:121913310
2085..2087+, agcdbSNP:121913311
2086..2090+cgtgc, gctgtdbSNP:377767408
2086..2087+cg, gcdbSNP:267607009
2086+c, gdbSNP:387906531
2087+c, gdbSNP:267607010
2090+a, c, g, tdbSNP:75076352
2091..2092+gc, tgdbSNP:377767409
2091+a, c, g, tdbSNP:75996173
2092+c, gdbSNP:77709286
2093..2094+, acgagctgtgccdbSNP:377767436
2093+c, gdbSNP:377767410
2096+a, gacctgtgccgccdbSNP:377767438
2098..2099+, tgccgcacgdbSNP:377767437
2104+c, tdbSNP:375041479
2109+c, gdbSNP:78935588
2110+c, tdbSNP:149768519
2111+g, tdbSNP:377767411
2131+c, tdbSNP:75225191
2132+a, gdbSNP:77711105
2136+c, tdbSNP:148935214
2137+a, gdbSNP:377767412
2185+c, gdbSNP:377767413
2186+a, gdbSNP:143795581
2187+a, tdbSNP:377767439
2188+g, tdbSNP:146646971
2188+g, ttctdbSNP:377767440
2207+a, gdbSNP:3026759
2227+c, tdbSNP:55862116
2228+a, gdbSNP:184498773
2240+c, tdbSNP:141347316
2242+a, gdbSNP:145122337
2260+c, tdbSNP:201550433
2261+a, gdbSNP:1799939
2270+c, tdbSNP:193922700
2271+a, gdbSNP:141185224
2278+a, gdbSNP:150329150
2288+a, tdbSNP:377767441
2306+a, gdbSNP:137855422
2318+a, gdbSNP:3026760
2329+a, gdbSNP:149460492
2335+, adbSNP:66858251
2372+a, gdbSNP:147216744
2380+a, gdbSNP:377616279
2427..2428+, gdbSNP:35938496
2436+c, gdbSNP:34288963
2451+c, tdbSNP:181856591
2458+c, tdbSNP:370791179
2478+a, tdbSNP:199882293
2483+c, tdbSNP:75075748
2488+a, gdbSNP:140658743
2494+a, c, g, tdbSNP:78014899
2495+c, tdbSNP:142793711
complement(2497)-t, c, adbSNP:1800861
2499+a, gdbSNP:377767414
2520+a, gdbSNP:377767415
2522+a, gdbSNP:75686697
2532+a, gdbSNP:377767416
2559+g, tdbSNP:149148794
2560+c, g, tdbSNP:75030001
2561+a, tdbSNP:377767417
2562+a, tdbSNP:77724903
2600+a, c, g, tdbSNP:79658334
2603+a, gdbSNP:377767418
2607+a, gdbSNP:377767419
2638+a, cdbSNP:368500000
2639+c, tdbSNP:142318626
2642+a, gdbSNP:377767420
2646+g, tdbSNP:377767421
2647+c, tdbSNP:375322585
2657+a, gdbSNP:138847998
2658+a, gdbSNP:142779213
2667+a, cdbSNP:34617196
2675+a, gdbSNP:113005278
2678+a, gdbSNP:200127630
2687+c, tdbSNP:377767422
2691+a, cdbSNP:147433153
2698+c, tdbSNP:1800862
2712+c, g, tdbSNP:149891333
2713+a, g, tdbSNP:56195026
2719+g, tdbSNP:377767423
2720+c, tdbSNP:377767424
2721+a, g, tdbSNP:55947360
2725+c, tdbSNP:377767425
2728+c, tdbSNP:201816539
2733+a, c, tdbSNP:201101792
2746+c, gdbSNP:377767426
2773+a, gdbSNP:146628741
2788+c, tdbSNP:202029768
2791+g, tdbSNP:141459368
2801+a, gdbSNP:145170911
2831+c, gdbSNP:377767427
2836..2838+agc, tttdbSNP:121913306
2837..2838+gc, ttdbSNP:377767429
2837+a, gdbSNP:377767428
2843+a, gdbSNP:201487882
2846+c, tdbSNP:146838520
2847+a, gdbSNP:373594744
2861+g, tdbSNP:75234356
2863+a, gdbSNP:201620214
2880+a, gdbSNP:76087194
2882..2893+, gatgtttatgaadbSNP:121913309
2901+c, g, tdbSNP:267607011
2902+c, gdbSNP:1800863
2906+a, gdbSNP:200627072
2909+a, gdbSNP:377767430
2910+a, tdbSNP:377767431
2925+a, c, g, tdbSNP:78347871
2932+a, gdbSNP:375963128
2942+a, gdbSNP:377767442
2943+c, tdbSNP:74799832
2955+a, cdbSNP:377767432
3075+a, gdbSNP:369804828
3088+c, tdbSNP:373693875
3104+a, gdbSNP:76534745
3121+c, gdbSNP:375414982
3133+c, tdbSNP:147318495
3134+c, tdbSNP:17158558
3135+a, gdbSNP:368550200
3172+a, cdbSNP:199718928
3178+a, gdbSNP:145798106
3187+a, gdbSNP:376487144
3196+c, tdbSNP:370970483
3216+c, tdbSNP:375213011
3221+a, gdbSNP:368345402
3247+a, gdbSNP:369579749
3249+c, gdbSNP:372191563
3258+c, tdbSNP:138912894
3280+c, tdbSNP:142859395
3281+a, gdbSNP:200989078
3283+c, tdbSNP:369116900
3302+a, gdbSNP:201740483
3303+c, tdbSNP:200021472
3306+c, tdbSNP:79853121
3313+a, gdbSNP:147437610
3328+a, cdbSNP:201576838
3329+c, tdbSNP:369152977
3331+c, tdbSNP:372673589
3339+a, gdbSNP:200956659
3346+c, tdbSNP:191769748
3355+a, gdbSNP:200289472
3356+c, tdbSNP:373423271
3369+a, gdbSNP:370756353
3374+c, tdbSNP:138010639
3381+c, tdbSNP:149513065
3382+a, gdbSNP:144730090
3386+c, gdbSNP:180700967
3433+c, tdbSNP:144192900
3526+c, tdbSNP:146049841
3564+a, cdbSNP:199639914
3630+c, tdbSNP:17028
complement(3865)-g, adbSNP:141460872
complement(3909)-t, gdbSNP:74985876
3923+a, gdbSNP:3026782
4015+a, gdbSNP:112831036
4026..4027+, gdbSNP:201945709
4111+a, gdbSNP:185408658
4135+a, tdbSNP:2742240
4263+a, tdbSNP:3026783
4312+c, tdbSNP:373663381
4379+c, tdbSNP:190116296
4553+c, tdbSNP:138493014
complement(4581)-g, cdbSNP:143948954
4651+c, tdbSNP:2435355
4804+c, tdbSNP:9971097
4809+c, gdbSNP:147336674
4821..4822+, gdbSNP:35856296
complement(4861)-t, cdbSNP:141016377
complement(4883)-g, adbSNP:149252070
4916+a, gdbSNP:115358030
4916+a, gdbSNP:386453483
4990+a, cdbSNP:3026784
5012+a, gdbSNP:148393331
5041+a, gdbSNP:2742241
5067+c, gdbSNP:181388347
5093+a, cdbSNP:142572876
5104+c, gdbSNP:186000190
5118+a, gdbSNP:192065891
5126+a, gdbSNP:76759170
complement(5134)-g, adbSNP:145954635
5179+c, gdbSNP:117119161
5189+a, gdbSNP:139925563
complement(5277)-g, adbSNP:143369221
5347+a, cdbSNP:183817000
complement(5405)-t, cdbSNP:146771196
5410..5411+, cdbSNP:35911434
5441+c, tdbSNP:188882445
5504+c, tdbSNP:3026785
5574+a, gdbSNP:191974370
Gene SymbolRET
Gene SynonymCDHF12; CDHR16; HSCR1; MEN2A; MEN2B; MTC1; PTC; RET-ELE1; RET51
Locus Map10q11.2
Title Genetic mosaicism of a frameshift mutation in the RET gene in a family with Hirschsprung disease .
Author Muller CM, Haase MG, Kemnitz I and Fitze G.
Journal Gene 541 (1), 51-54 (2014)
Title Oncogenic RET kinase domain mutations perturb the autophosphorylation trajectory by enhancing substrate presentation in trans .
Author Plaza-Menacho I, Barnouin K, Goodman K, Martinez-Torres RJ, Borg A, Murray-Rust J, Mouilleron S, Knowles P and McDonald NQ.
Journal Mol. Cell 53 (5), 738-751 (2014)
Title RET revisited: expanding the oncogenic portfolio .
Author Mulligan LM.
Journal Nat. Rev. Cancer 14 (3), 173-186 (2014)
Title Patient affected by neurofibromatosis type 1 and thyroid C-cell hyperplasia harboring pathogenic germ-line mutations in both NF1 and RET genes .
Author Ercolino T, Lai R, Giache V, Melchionda S, Carella M, Delitala A, Mannelli M and Fanciulli G.
Journal Gene 536 (2), 332-335 (2014)
Title Hirschsprung Disease Overview .
Author Parisi,M.A.
Journal (in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)
Title Multiple Endocrine Neoplasia Type 2 .
Author Moline,J. and Eng,C.
Journal (in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)
Title Identification and analysis of the ret proto-oncogene promoter region in neuroblastoma cell lines and medullary thyroid carcinomas from MEN2A patients .
Author Itoh F, Ishizaka Y, Tahira T, Yamamoto M, Miya A, Imai K, Yachi A, Takai S, Sugimura T and Nagao M.
Journal Oncogene 7 (6), 1201-1206 (1992)
Title Ret oncogene activation in human thyroid neoplasms is restricted to the papillary cancer subtype .
Author Santoro M, Carlomagno F, Hay ID, Herrmann MA, Grieco M, Melillo R, Pierotti MA, Bongarzone I, Della Porta G and Berger N.
Journal J. Clin. Invest. 89 (5), 1517-1522 (1992)
Title Localization of the 5' end of the MCF2 oncogene to human chromosome 15q15----q23 .
Author Galland F, Stefanova M, Lafage M and Birnbaum D.
Journal Cytogenet. Cell Genet. 60 (2), 114-116 (1992)
Title An STS in the human PTC oncogene located at 10q11.2 .
Author Jhiang SM, Chiu IM and Mazzaferri EL.
Journal Nucleic Acids Res. 19 (15), 4303 (1991)

Our customer service representatives are available 24 hours a day, Monday through Friday; please contact us anytime for assistance.