×

CYP2E1 CRISPR guide RNA, cytochrome P450, family 2, subfamily E, polypeptide 1 CRISPR guide RNA[human]

gRNA/crRNA for genome editing with WT SpCas9 vector or cas9 protein

The following gRNA sequences were designed by Feng Zhang’s laboratory at the Broad institute* to uniquely target the CYP2E1 gene within the human genome. These gRNA sequences are for use with WT SpCas9, or as crRNA for use with WT SpCas9 protein, to introduce a DSB for genome editing. These sgRNA sequences were validated in Sanjana N.E., Shalem O., Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014 Aug;11(8):783-4.

gRNA or crRNA
(name)
gRNA target sequence Vector Availability* Price Select
CYP2E1 CRISPR Guide RNA or crRNA 1 GATGTCGGCTATGACGTTGC Customized On-demand $199.00
pLentiCRISPR v2 $99.00
crRNA On-demand From $195.00
CYP2E1 CRISPR Guide RNA or crRNA 2 GCCGGTGTTCACGCTGTACG Customized On-demand $199.00
pLentiCRISPR v2 $99.00
crRNA On-demand From $195.00
CYP2E1 CRISPR Guide RNA or crRNA 3 CTGACCACCCTCCGGAACTA Customized On-demand $199.00
pLentiCRISPR v2 $99.00
crRNA On-demand From $195.00
CYP2E1 CRISPR Guide RNA or crRNA 4 AAGGACGAGTTCTCGGGCAG Customized On-demand $199.00
crRNA On-demand From $195.00
CYP2E1 CRISPR Guide RNA or crRNA 5 GGGTGGTCAGGGAAAACCGC Customized On-demand $199.00
crRNA On-demand From $195.00
CYP2E1 CRISPR Guide RNA or crRNA 6 CCTTCTCCATTTCCACGAGC Customized On-demand $199.00
crRNA On-demand From $195.00

*GenScript provides in-stock gRNA clones for select genes; however, they must still undergo amplification and QC processing. These clones will be delivered within 6 business days.


Description of CYP2E1 CRISPR guide RNA

Search for other guide RNAs

The CYP2E1 CRISPR guide RNA sequences shown above were designed by the laboratory of Feng Zhang at the Broad Institute* in order to efficiently target the CYP2E1 gene with minimal risk of off-target Cas9 binding elsewhere in the genome. For complete details on the criteria and process for guide RNA design and selection, please see: Sanjana N.E., Shalem O., Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014 Aug;11(8):783-4. doi: 10.1038/nmeth.3047. Read the Full Text

Based on our experience using our design tool to create knock-out cell lines, a single gRNA construct is typically sufficient to knock-out your gene of interest, but to increase your chance of success, we recommend ordering at least two gRNA constructs per gene that you want to target. We recommend that you double-check the gRNA sequences against your target gene sequence of interest before ordering, especially if you are trying to target only one specific splice variant or a specific exon.

When you order gRNA clones from GenScript, we deliver a sequence-verified plasmid containing all elements required for gRNA expression and genome binding: the U6 promoter, spacer (target) sequence, gRNA scaffold, and terminator. You may select from vectors that include selection markers. We guarantee sequence accuracy for gRNA clones we deliver; however, given the complexity of creating genomically edited cell lines, we cannot guarantee the outcome of experiments using our gRNA constructs. If you prefer to receive sequence-validated KO or KI cell lines created using CRISPR technology, please refer to our GenCRISPR™ mammalian cell line service.

Price & Turnaround time of CYP2E1 CRISPR guide RNA

  • $199.00/clone includes:
    • gRNA design services: Select from gRNAs above, which were designed by the Feng Zhang lab at the Broad Institute to target human and mouse genes with high specificity. Alternatively, our expert scientists will design guide RNA sequences according to your needs, for any species or genome editing strategy, when you use our online request form. We strongly recommend ordering at least 2 or more gRNAs for each target sequence.
    • gRNA synthesis and cloning into any vector of your choice, including free all-in-one vectors. The cost for gRNA constructs is $199.00/clone no matter which vector you select. Genscript offers several options for lentiviral or nonviral delivery, all suitable for use in any mammalian system. See our gRNA vector guide for details. If you prefer a different vector, simply mail an aliquot to us and we will perform subcloning at no additional cost.
  • GenCRISPR™ gRNA constructs are custom-synthesized and cloned into your choice of vector within 10 business days.
  • Our Ph.D.–level gene service representatives can answer any questions you have and help tailor our services to your needs. When you request a quote, we will contact you within 24 hours.

gRNA for transcription activation with SAM

The following gRNA sequences were designed by Feng Zhang’s laboratory at the Broad institute* to uniquely and robustly activate transcription of the endogenous CYP2E1 gene within the human genome when used with the the CRISPR/Cas9 Synergistic Activation Mediators (SAM) complex. These gRNA specifically target the first 200 bp upstream of the transcription start site (TSS). These validated sgRNA sequences were published in Konermann S et al. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature, 2015 Jan 29;517(7536):583-8.

SAM gRNA name SAM gRNA sequence Target RefSeq Price Select
CYP2E1 SAM guide RNA 1 AGCCAGTGACCTGGTGAGGA NM_000773 $199.00
CYP2E1 SAM guide RNA 2 GGAATCAGCCTTTGAAACGA NM_000773 $199.00
CYP2E1 SAM guide RNA 3 GGTTTATTATTAGCTGCTGT NM_000773 $199.00

Description of CYP2E1 SAM guide RNA

The CYP2E1 SAM guide RNA sequences shown above will robustly activate transcription of the endogenous CYP2E1 gene within the human genome when delivered in conjunction with all required components of the SAM complex. When you order CYP2E1 SAM gRNA constructs from GenScript, we deliver sequence-verified plasmid DNA containing your selected SAM gRNA sequences cloned into the lenti sgRNA(MS2)_zeo vector. You may choose to order at the same time the two other SAM plasmids: lenti dCas9-VP64_Blast and lenti MS2-P65-HSF1_Hygro.

For complete details on the criteria and process for SAM guide RNA design and validation, please see: Konermann et al. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature, doi:10.1038/nature14136.

Price & Turnaround time of CYP2E1 SAM guide RNA

  • $199.00 for each SAM gRNA sequence synthesized and cloned into the lenti sgRNA(MS2)_zeo vector
  • $50.00 each for lenti dCas9-VP64_Blast and lenti MS2-P65-HSF1_Hygro, which can be ordered at the same time.
  • Total price for the three-plasmid system: $299.00; additional gRNA are $199.00 each
  • 10-day turnaround time

Our Ph.D.–level gene service representatives can answer any questions you have and help tailor our services to your needs. When you request a quote, we will contact you within 24 hours.



Search for gRNA for use with WT SpCas9 for genome editing:

Species: 
Gene: 

Search for gRNA for use with SAM for transcription activation:

Species:  
Gene: 


Related Services of CYP2E1 CRISPR guide RNA


Related gene information of CYP2E1 CRISPR guide RNA

Gene SymbolCYP2E1
Entre Gene ID1571
Full Namecytochrome P450, family 2, subfamily E, polypeptide 1
SynonymsCPE1, CYP2E, P450-J, P450C2E
Gene Typeprotein-coding
OrganismHomo sapiens (human)
Genome

10

10q26.3

SummaryThis gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is induced by ethanol, the diabetic state, and starvation. The enzyme metabolizes both endogenous substrates, such as ethanol, acetone, and acetal, as well as exogenous substrates including benzene, carbon tetrachloride, ethylene glycol, and nitrosamines which are premutagens found in cigarette smoke. Due to its many substrates, this enzyme may be involved in such varied processes as gluconeogenesis, hepatic cirrhosis, diabetes, and cancer. [provided by RefSeq, Jul 2008]. lac of sum


Related Services of CYP2E1 CRISPR guide RNA

mRNA Protein Product Price Select
NM_000773 NP_000764 cytochrome P450 2E1 precursor starting from $99.00

Learn more about the CRISPR gRNA constucts.

Legal Statement of GenCRISPR Services and Products (Updated on July 28, 2015):

  1. GenCRISPR™ services and products are covered under US 8,697,359, US 8,771,945, US 8,795,965, US 8,865,406, US 8,871,445, US 8,889,356, US 8,889,418, US 8,895,308, US 8,906,616 and foreign equivalents and licensed from Broad Institute, Inc. Cambridge, Massachusetts.
  2. The products and the reagents generated from these services shall be used as tools for research purposes, and shall exclude (a) any human or clinical use, including, without limitation, any administration into humans or any diagnostic or prognostic use, (b) any human germline modification, including modifying the DNA of human embryos or human reproductive cells, (c) any in vivo veterinary or livestock use, or (d) the manufacture, distribution, importation, exportation, transportation, sale, offer for sale, marketing, promotion or other exploitation or use of, or as, a testing service, therapeutic or diagnostic for humans or animals.
  3. The purchase of the GenCRISPR Services and Products coveys to the purchaser the limited, non-transferable right to use the products purchased and the reagents generated from GenCRISPR services and any related material solely for Research Purposes only, not for any Commercial Purposes.

Our customer service representatives are available 24 hours a day, Monday through Friday; please contact us anytime for assistance.

 
*
*
*
*