Home » Species Summary » Homo sapiens » NR2E3 cDNA ORF clone
Email to GenScript

NR2E3 cDNA ORF clone, Homo sapiens (human)

Gene Symbol NR2E3
Entrez Gene ID 10002
Full Name nuclear receptor subfamily 2, group E, member 3
Synonyms ESCS, PNR, RNR, RP37, rd7
General protein information
Preferred Names
photoreceptor-specific nuclear receptor
photoreceptor-specific nuclear receptor
retina-specific nuclear receptor
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This protein is part of a large family of nuclear receptor transcription factors involved in signaling pathways. Nuclear receptors have been shown to regulate pathways involved in embryonic development, as well as in maintenance of proper cell function in adults. Members of this family are characterized by discrete domains that function in DNA and ligand binding. This gene encodes a retinal nuclear receptor that is a ligand-dependent transcription factor. Defects in this gene are a cause of enhanced S cone syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Enhanced S-cone syndrome, 268100 (3); Retinitis pigmentosa-37,

mRNA and Protein(s)

mRNA Protein Name
XM_011521146 XP_011519448 photoreceptor-specific nuclear receptor isoform X1
NM_014249 NP_055064 photoreceptor-specific nuclear receptor isoform b
NM_016346 NP_057430 photoreceptor-specific nuclear receptor isoform a

R-HSA-74160 Gene Expression
R-HSA-212436 Generic Transcription Pathway
R-HSA-383280 Nuclear Receptor transcription pathway

Homo sapiens (human) NR2E3 NP_055064.1
Pan troglodytes (chimpanzee) NR2E3 XP_001175025.1
Macaca mulatta (Rhesus monkey) NR2E3 XP_001089693.1
Bos taurus (cattle) NR2E3 NP_001161372.1
Mus musculus (house mouse) Nr2e3 NP_038736.1
Rattus norvegicus (Norway rat) LOC100365683 XP_003750575.2
Gallus gallus (chicken) NR2E3 NP_989925.1
Danio rerio (zebrafish) nr2e3 NP_001007369.1
Drosophila melanogaster (fruit fly) Hr51 NP_611032.2
Xenopus (Silurana) tropicalis (western clawed frog) nr2e3 NP_001090633.1


ID Name Evidence
GO:0005634 nucleus IEA
GO:0005654 nucleoplasm TAS


ID Name Evidence
GO:0003700 sequence-specific DNA binding transcription factor activity IEA
GO:0003707 steroid hormone receptor activity IEA
GO:0004879 ligand-dependent nuclear receptor activity TAS
GO:0005496 steroid binding IEA
GO:0008270 zinc ion binding IEA
GO:0043565 sequence-specific DNA binding IEA
GO:0046872 metal ion binding IEA


ID Name Evidence
GO:0006355 regulation of transcription, DNA-dependent IEA
GO:0006366 transcription from RNA polymerase II promoter TAS
GO:0007165 signal transduction TAS
GO:0007601 visual perception IEA
GO:0007602 phototransduction TAS
GO:0010467 gene expression TAS
GO:0034339 regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor TAS
GO:0050896 response to stimulus IEA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following NR2E3 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the NR2E3 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu63589 XM_011521146 PREDICTED: Homo sapiens nuclear receptor subfamily 2, group E, member 3 (NR2E3), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $199.00
NM_014249 Homo sapiens nuclear receptor subfamily 2, group E, member 3 (NR2E3), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_016346 Homo sapiens nuclear receptor subfamily 2, group E, member 3 (NR2E3), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu63589
Accession Version XM_011521146.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 969bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product photoreceptor-specific nuclear receptor isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010194.18) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)155..280(+)
Misc Feature(2)464..1081(+)
Misc Feature(3)545..790(+)
Misc Feature(4)575..652(+)
Position Chain Variation Link
9 9 g, t dbSNP:749528847
10 10 c, t dbSNP:368095184
11 11 a, g dbSNP:370679503
13 13 a, g dbSNP:555860015
19 19 c, t dbSNP:768104512
21 21 c, t dbSNP:202098481
22 22 a, c, g dbSNP:759064828
23 23 c, t dbSNP:368627488
25 25 a, c, t dbSNP:752219772
32 32 c, t dbSNP:763706390
33 33 agtgtgcctccagtgcctcgctcca, gc dbSNP:730882149
33 33 a, c, g dbSNP:372156526
34 34 c, t dbSNP:781059369
36 36 c, t dbSNP:745820285
40 40 c, t dbSNP:376753500
41 41 a, g dbSNP:544807110
53 53 a, g dbSNP:749383991
55 55 c, t dbSNP:768900024
56 56 a, g dbSNP:121912631
60 60 a, g dbSNP:563014885
61 61 a, g dbSNP:748482039
64 64 c, t dbSNP:772583552
65 65 c, t dbSNP:773794490
67 67 c, t dbSNP:761264112
73 73 c, t dbSNP:771404428
75 75 a, g dbSNP:775046346
85 85 c, t dbSNP:367603365
86 86 a, g dbSNP:770937516
90 90 a, g dbSNP:769900190
92 92 a, g dbSNP:763764130
94 94 c, t dbSNP:751236605
95 95 a, g dbSNP:200102936
112 112 c, t dbSNP:767304567
113 113 a, g dbSNP:750284532
116 116 c, t dbSNP:104894492
117 117 a, g dbSNP:104894493
117 117 -, g dbSNP:772903026
119 119 c, t dbSNP:779903522
120 120 a, g dbSNP:186714117
127 127 c, g dbSNP:755040583
145 145 a, g dbSNP:374027410
154 154 g, t dbSNP:558123422
155 155 a, g dbSNP:746366181
157 157 a, g dbSNP:566850779
163 163 c, t dbSNP:773837062
164 164 a, g dbSNP:747703813
179 179 c, t dbSNP:775720634
194 194 g, t dbSNP:534220505
195 195 a, c dbSNP:772881093
196 196 c, t dbSNP:760466119
201 201 a, g dbSNP:766096417
213 213 a, g, t dbSNP:555544052
222 222 c, t dbSNP:759381786
223 223 a, c, g, t dbSNP:900546
231 231 a, g dbSNP:538009962
238 238 c, t dbSNP:374499278
241 241 c, t dbSNP:572488420
242 242 c, g dbSNP:776270511
250 250 c, t dbSNP:759418091
251 251 a, g dbSNP:146403122
254 254 c, t dbSNP:527236086
255 255 a, g dbSNP:376678128
262 262 a, g dbSNP:561598022
263 263 c, t dbSNP:786205493
264 264 a, g dbSNP:528986571
273 273 c, t dbSNP:760989182
281 281 c, t dbSNP:751730121
298 298 g, t dbSNP:550461615
300 300 c, t dbSNP:767828150
303 303 a, g dbSNP:367838359
309 309 a, g dbSNP:1805020
314 314 c, t dbSNP:756501491
318 318 c, t dbSNP:776742417
334 334 c, t dbSNP:533192044
337 337 c, t dbSNP:757833321
339 339 c, t dbSNP:777140312
340 340 a, g dbSNP:746581775
345 345 c, g, t dbSNP:371853056
353 353 c, t dbSNP:376858072
357 357 a, g dbSNP:776515170
362 362 c, t dbSNP:369486706
365 365 a, g dbSNP:769726361
371 371 -, a dbSNP:759339012
378 378 c, t dbSNP:1805021
379 379 a, g dbSNP:534156309
395 395 c, t dbSNP:1805022
397 397 c, g dbSNP:774271438
401 401 a, c dbSNP:750727064
414 414 a, c, g dbSNP:567617489
415 415 c, t dbSNP:750680330
419 419 a, c dbSNP:760968362
423 423 a, t dbSNP:766730044
436 436 -, ctg dbSNP:762887025
436 436 c, g dbSNP:754265589
440 440 a, g dbSNP:755461027
461 461 a, g dbSNP:779518180
466 466 c, t dbSNP:767049846
485 485 a, g dbSNP:201347199
492 492 -, c dbSNP:35568744
493 493 c, t dbSNP:755807403
527 527 c, t dbSNP:76502381
530 530 c, t dbSNP:371694743
531 531 c, g, t dbSNP:749050219
532 532 c, t dbSNP:778657206
535 535 c, t dbSNP:375133059
536 536 a, g dbSNP:368098126
542 542 a, g dbSNP:773264230
545 545 a, g dbSNP:766767604
552 552 a, g dbSNP:747137740
553 553 c, t dbSNP:771105535
554 554 a, g dbSNP:371945959
556 556 c, g dbSNP:759765652
561 561 c, t dbSNP:765642230
562 562 a, c, g dbSNP:530684859
566 566 c, t dbSNP:573593965
567 567 a, g dbSNP:544290323
570 570 c, t dbSNP:755715184
578 578 a, g dbSNP:766079363
583 583 c, t dbSNP:376605943
584 584 a, g dbSNP:1805023
589 589 a, g dbSNP:369817803
597 597 a, c dbSNP:754663006
600 600 a, c dbSNP:778760106
612 612 -, tc dbSNP:750740765
619 619 c, t dbSNP:747947987
622 622 g, t dbSNP:751129402
629 629 c, g dbSNP:777725578
630 630 a, g dbSNP:747043962
631 631 c, g dbSNP:375470824
642 642 a, t dbSNP:758153191
646 646 c, g dbSNP:777633560
657 657 a, c, t dbSNP:377257254
660 660 a, g dbSNP:370823298
679 679 c, t dbSNP:781235826
681 681 a, g dbSNP:201106600
687 687 c, t dbSNP:770027574
691 691 a, g dbSNP:780172380
696 696 a, c dbSNP:749027717
703 703 c, t dbSNP:377743925
728 728 a, c dbSNP:769154628
729 729 c, t dbSNP:774931088
733 733 c, t dbSNP:555211505
734 734 a, g dbSNP:370215891
736 736 a, g dbSNP:776180877
748 748 c, t dbSNP:566024312
749 749 a, g dbSNP:764901119
750 750 a, g, t dbSNP:752309343
751 751 c, t dbSNP:763876921
754 754 a, t dbSNP:537802684
762 762 a, g dbSNP:374975658
764 764 c, t dbSNP:368030775
765 765 a, g dbSNP:750478440
771 771 c, t dbSNP:756167856
772 772 a, g, t dbSNP:1805024
773 773 c, t dbSNP:769066649
783 783 c, t dbSNP:779402522
789 789 c, t dbSNP:374016332
790 790 a, g dbSNP:184906734
792 792 a, g dbSNP:375364175
794 794 a, g dbSNP:1805025
795 795 c, t dbSNP:759031159
801 801 a, c dbSNP:769195060
809 809 a, c dbSNP:375975199
810 810 c, t dbSNP:762584880
812 812 c, t dbSNP:553938466
815 815 c, t dbSNP:774102273
816 816 a, g dbSNP:761628767
821 821 c, t dbSNP:767442358
822 822 a, g dbSNP:28937873
825 825 c, g dbSNP:373235046
827 827 c, t dbSNP:756150875
831 831 c, t dbSNP:751114266
832 832 a, g dbSNP:375304296
838 838 c, t dbSNP:754029880
841 841 -, c dbSNP:398027866
842 842 a, c dbSNP:201606159
843 843 c, t dbSNP:755224888
844 844 a, g dbSNP:779314442
847 847 a, g dbSNP:748480349
855 855 a, g dbSNP:774385340
856 856 c, t dbSNP:148900690
865 865 c, t dbSNP:778279460
872 872 c, t dbSNP:747469901
880 880 a, g dbSNP:771529925
882 882 a, c dbSNP:774840614
883 883 a, g dbSNP:748836988
888 888 c, t dbSNP:554638593
889 889 a, g dbSNP:772856819
890 890 c, t dbSNP:371402963
891 891 a, g dbSNP:374483122
892 892 a, g dbSNP:776731139
893 893 c, g dbSNP:759629930
895 895 a, c dbSNP:142621527
897 897 c, t dbSNP:752883545
911 911 c, t dbSNP:763064894
913 913 c, t dbSNP:200402349
914 914 a, g dbSNP:757270261
915 915 c, t dbSNP:757665544
921 921 c, g dbSNP:781623501
938 938 c, g dbSNP:750931603
939 939 a, g dbSNP:756678889
942 942 c, t dbSNP:778378592
945 945 c, t dbSNP:747738378
947 947 c, t dbSNP:771592754
952 952 c, g dbSNP:777512062
958 958 c, g dbSNP:746731934
961 961 c, g dbSNP:570291117
972 972 a, c, g dbSNP:537337423
975 975 c, g dbSNP:759534224
985 985 c, g, t dbSNP:35004053
986 986 a, g dbSNP:150971548
1015 1015 c, t dbSNP:756939370
1017 1017 a, c, t dbSNP:527428190
1018 1018 a, g dbSNP:755989819
1027 1027 g, t dbSNP:779792987
1031 1031 a, g dbSNP:367585968
1032 1032 g, t dbSNP:768530931
1036 1036 g, t dbSNP:774464533
1037 1037 a, g dbSNP:748264418
1038 1038 c, t dbSNP:561915025
1039 1039 a, g dbSNP:371462976
1042 1042 a, g dbSNP:376046141
1044 1044 c, g dbSNP:766769900
1058 1058 -, tt dbSNP:574936510
1062 1062 a, c, t dbSNP:776925513
1065 1065 a, g dbSNP:765705755
1069 1069 g, t dbSNP:751040956
1074 1074 c, t dbSNP:529102778
1076 1076 a, g dbSNP:767225225
1083 1083 c, t dbSNP:750109070
1085 1085 a, c, t dbSNP:199564404
1088 1088 a, g dbSNP:369323987
1095 1095 a, t dbSNP:749083390
1106 1106 a, g dbSNP:754909545
1118 1118 a, t dbSNP:778743035
1122 1122 a, g dbSNP:374121651
1123 1123 a, g dbSNP:377154860
1125 1125 a, g dbSNP:777903865
1131 1131 a, g dbSNP:747225676
1140 1140 a, g dbSNP:771110090
1147 1147 c, t dbSNP:777024600
1156 1156 g, t dbSNP:369611634
1164 1164 a, t dbSNP:770287030
1165 1165 a, g dbSNP:776158082
1186 1186 c, g dbSNP:569188784
1212 1212 c, t dbSNP:182387227
1213 1213 a, g dbSNP:551802347
1214 1214 c, t dbSNP:184461716
1218 1218 c, t dbSNP:534297520
1219 1219 a, g dbSNP:189389563
1231 1231 a, c dbSNP:574163561
1244 1244 c, g dbSNP:538066285
1271 1271 c, g dbSNP:181328142
1320 1320 g, t dbSNP:779157022
1348 1348 -, a dbSNP:34114830
1354 1354 a, g dbSNP:185349250
1385 1385 a, g dbSNP:373683259
1410 1410 a, g dbSNP:535792196
1417 1417 c, t dbSNP:557723570
1466 1466 a, c dbSNP:772747252
1479 1479 c, t dbSNP:775994353
1484 1484 -, aat dbSNP:199704918
1484 1484 a, g dbSNP:747437942
1488 1488 -, ata dbSNP:71131709
1502 1502 a, g dbSNP:28451480
1515 1515 g, t dbSNP:572794732
1517 1517 a, g dbSNP:540299575
1526 1526 c, g dbSNP:561662627
1539 1539 a, g dbSNP:147491172
1541 1541 a, g dbSNP:190504253
1646 1646 c, t dbSNP:562724532
1664 1664 a, c dbSNP:533274932
1668 1668 -, a dbSNP:369467965
1669 1669 a, t dbSNP:376195026
1682 1682 -, aaaa dbSNP:531918877
1685 1685 -, a dbSNP:571931356
1688 1688 a, c dbSNP:76637957
1689 1689 a, c dbSNP:76978830
1690 1690 a, c dbSNP:71395043
1733 1733 a, g dbSNP:761407101
1772 1772 c, g dbSNP:80009488
1794 1794 c, t dbSNP:778780345
1795 1795 a, g, t dbSNP:549423789
1832 1832 a, g dbSNP:758391299
1847 1847 c, t dbSNP:567677253
1848 1848 a, t dbSNP:764750618
1859 1859 a, g dbSNP:772754229
1860 1860 a, g dbSNP:538004965
1867 1867 a, g dbSNP:546787165
1873 1873 c, t dbSNP:139974850
1950 1950 a, t dbSNP:571545345
1951 1951 a, g dbSNP:766367798
1967 1967 c, t dbSNP:779805368
1968 1968 a, g dbSNP:28397143
1979 1979 -, g dbSNP:749263580
2011 2011 a, t dbSNP:181384043
2012 2012 a, g dbSNP:74724002
2020 2020 a, g dbSNP:748276613
2021 2021 c, g dbSNP:2742321
2022 2022 c, t dbSNP:767220096
2040 2040 -, tttc dbSNP:770796419
2054 2054 g, t dbSNP:555411900
2085 2085 a, g dbSNP:573782033
2088 2088 a, g dbSNP:757470150

Target ORF information:

RefSeq Version XM_011521146
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens nuclear receptor subfamily 2, group E, member 3 (NR2E3), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu20514
Accession Version NM_014249.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1233bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product photoreceptor-specific nuclear receptor isoform b
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL711747.1, AF121129.1, BU732726.1 and AW080977.1. This sequence is a reference standard in the RefSeqGene project. On Jul 26, 2013 this sequence version replaced gi:30581147. Summary: This protein is part of a large family of nuclear receptor transcription factors involved in signaling pathways. Nuclear receptors have been shown to regulate pathways involved in embryonic development, as well as in maintenance of proper cell function in adults. Members of this family are characterized by discrete domains that function in DNA and ligand binding. This gene encodes a retinal nuclear receptor that is a ligand-dependent transcription factor. Defects in this gene are a cause of enhanced S cone syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (b) contains a longer C-terminus compared to isoform a. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF121129.1, AB307710.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1968189, SAMEA1968968 [ECO:0000350] ##Evidence-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)191..193(+)
Misc Feature(2)311..586(+)
Misc Feature(3)335..505(+)
Misc Feature(4)365..550(+)
Misc Feature(5)770..1387(+)
Misc Feature(6)851..1096(+)
Misc Feature(7)881..958(+)
Misc Feature(8)1193..1195(+)
Exon (1)1..314
Gene Synonym:
Exon (2)315..441
Gene Synonym:
Exon (3)442..545
Gene Synonym:
Exon (4)546..767
Gene Synonym:
Exon (5)768..943
Gene Synonym:
Exon (6)944..1190
Gene Synonym:
Exon (7)1191..1296
Gene Synonym:
Exon (8)1297..2004
Gene Synonym:
Position Chain Variation Link
1 1 c, t dbSNP:752816807
15 15 c, t dbSNP:144605823
43 43 a, g dbSNP:562339667
58 58 a, g, t dbSNP:138513681
97 97 -, ag dbSNP:768224072
126 126 c, g dbSNP:776297781
128 128 c, g dbSNP:551298973
148 148 c, t dbSNP:369166086
158 158 c, g dbSNP:768497132
162 162 c, t dbSNP:778844467
167 167 c, t dbSNP:569548291
168 168 a, g dbSNP:370524688
169 169 a, c dbSNP:771878880
181 181 a, g dbSNP:369493844
185 185 a, g dbSNP:551839789
187 187 c, t dbSNP:771015928
188 188 c, g, t dbSNP:776771148
195 195 c, t dbSNP:765504086
205 205 c, t dbSNP:570230953
222 222 g, t dbSNP:374232020
229 229 c, t dbSNP:764469729
241 241 a, g dbSNP:752130237
244 244 c, t dbSNP:755521253
246 246 c, t dbSNP:534483995
247 247 a, g dbSNP:753463414
248 248 c, t dbSNP:754661615
249 249 c, t dbSNP:778754527
250 250 g, t dbSNP:552754753
263 263 c, g dbSNP:771928643
265 265 c, t dbSNP:777517743
272 272 a, c dbSNP:373237215
277 277 a, g dbSNP:770924023
284 284 c, g dbSNP:371396941
290 290 g, t dbSNP:377300789
295 295 a, c dbSNP:759662513
314 314 a, g dbSNP:769974850
315 315 g, t dbSNP:749528847
316 316 c, t dbSNP:368095184
317 317 a, g dbSNP:370679503
319 319 a, g dbSNP:555860015
325 325 c, t dbSNP:768104512
327 327 c, t dbSNP:202098481
328 328 a, c, g dbSNP:759064828
329 329 c, t dbSNP:368627488
331 331 a, c, t dbSNP:752219772
338 338 c, t dbSNP:763706390
339 339 agtgtgcctccagtgcctcgctcca, gc dbSNP:730882149
339 339 a, c, g dbSNP:372156526
340 340 c, t dbSNP:781059369
342 342 c, t dbSNP:745820285
346 346 c, t dbSNP:376753500
347 347 a, g dbSNP:544807110
359 359 a, g dbSNP:749383991
361 361 c, t dbSNP:768900024
362 362 a, g dbSNP:121912631
366 366 a, g dbSNP:563014885
367 367 a, g dbSNP:748482039
370 370 c, t dbSNP:772583552
371 371 c, t dbSNP:773794490
373 373 c, t dbSNP:761264112
379 379 c, t dbSNP:771404428
381 381 a, g dbSNP:775046346
391 391 c, t dbSNP:367603365
392 392 a, g dbSNP:770937516
396 396 a, g dbSNP:769900190
398 398 a, g dbSNP:763764130
400 400 c, t dbSNP:751236605
401 401 a, g dbSNP:200102936
418 418 c, t dbSNP:767304567
419 419 a, g dbSNP:750284532
422 422 c, t dbSNP:104894492
423 423 a, g dbSNP:104894493
423 423 -, g dbSNP:772903026
425 425 c, t dbSNP:779903522
426 426 a, g dbSNP:186714117
433 433 c, g dbSNP:755040583
451 451 a, g dbSNP:374027410
460 460 g, t dbSNP:558123422
461 461 a, g dbSNP:746366181
463 463 a, g dbSNP:566850779
469 469 c, t dbSNP:773837062
470 470 a, g dbSNP:747703813
485 485 c, t dbSNP:775720634
500 500 g, t dbSNP:534220505
501 501 a, c dbSNP:772881093
502 502 c, t dbSNP:760466119
507 507 a, g dbSNP:766096417
519 519 a, g, t dbSNP:555544052
528 528 c, t dbSNP:759381786
529 529 a, c, g, t dbSNP:900546
537 537 a, g dbSNP:538009962
544 544 c, t dbSNP:374499278
547 547 c, t dbSNP:572488420
548 548 c, g dbSNP:776270511
556 556 c, t dbSNP:759418091
557 557 a, g dbSNP:146403122
560 560 c, t dbSNP:527236086
561 561 a, g dbSNP:376678128
568 568 a, g dbSNP:561598022
569 569 c, t dbSNP:786205493
570 570 a, g dbSNP:528986571
579 579 c, t dbSNP:760989182
587 587 c, t dbSNP:751730121
604 604 g, t dbSNP:550461615
606 606 c, t dbSNP:767828150
609 609 a, g dbSNP:367838359
615 615 a, g dbSNP:1805020
620 620 c, t dbSNP:756501491
624 624 c, t dbSNP:776742417
640 640 c, t dbSNP:533192044
643 643 c, t dbSNP:757833321
645 645 c, t dbSNP:777140312
646 646 a, g dbSNP:746581775
651 651 c, g, t dbSNP:371853056
659 659 c, t dbSNP:376858072
663 663 a, g dbSNP:776515170
668 668 c, t dbSNP:369486706
671 671 a, g dbSNP:769726361
677 677 -, a dbSNP:759339012
684 684 c, t dbSNP:1805021
685 685 a, g dbSNP:534156309
701 701 c, t dbSNP:1805022
703 703 c, g dbSNP:774271438
707 707 a, c dbSNP:750727064
720 720 a, c, g dbSNP:567617489
721 721 c, t dbSNP:750680330
725 725 a, c dbSNP:760968362
729 729 a, t dbSNP:766730044
742 742 -, ctg dbSNP:762887025
742 742 c, g dbSNP:754265589
746 746 a, g dbSNP:755461027
767 767 a, g dbSNP:779518180
772 772 c, t dbSNP:767049846
791 791 a, g dbSNP:201347199
798 798 -, c dbSNP:35568744
799 799 c, t dbSNP:755807403
833 833 c, t dbSNP:76502381
836 836 c, t dbSNP:371694743
837 837 c, g, t dbSNP:749050219
838 838 c, t dbSNP:778657206
841 841 c, t dbSNP:375133059
842 842 a, g dbSNP:368098126
848 848 a, g dbSNP:773264230
851 851 a, g dbSNP:766767604
858 858 a, g dbSNP:747137740
859 859 c, t dbSNP:771105535
860 860 a, g dbSNP:371945959
862 862 c, g dbSNP:759765652
867 867 c, t dbSNP:765642230
868 868 a, c, g dbSNP:530684859
872 872 c, t dbSNP:573593965
873 873 a, g dbSNP:544290323
876 876 c, t dbSNP:755715184
884 884 a, g dbSNP:766079363
889 889 c, t dbSNP:376605943
890 890 a, g dbSNP:1805023
895 895 a, g dbSNP:369817803
903 903 a, c dbSNP:754663006
906 906 a, c dbSNP:778760106
918 918 -, tc dbSNP:750740765
925 925 c, t dbSNP:747947987
928 928 g, t dbSNP:751129402
935 935 c, g dbSNP:777725578
936 936 a, g dbSNP:747043962
937 937 c, g dbSNP:375470824
948 948 a, t dbSNP:758153191
952 952 c, g dbSNP:777633560
963 963 a, c, t dbSNP:377257254
966 966 a, g dbSNP:370823298
985 985 c, t dbSNP:781235826
987 987 a, g dbSNP:201106600
993 993 c, t dbSNP:770027574
997 997 a, g dbSNP:780172380
1002 1002 a, c dbSNP:749027717
1009 1009 c, t dbSNP:377743925
1034 1034 a, c dbSNP:769154628
1035 1035 c, t dbSNP:774931088
1039 1039 c, t dbSNP:555211505
1040 1040 a, g dbSNP:370215891
1042 1042 a, g dbSNP:776180877
1054 1054 c, t dbSNP:566024312
1055 1055 a, g dbSNP:764901119
1056 1056 a, g, t dbSNP:752309343
1057 1057 c, t dbSNP:763876921
1060 1060 a, t dbSNP:537802684
1068 1068 a, g dbSNP:374975658
1070 1070 c, t dbSNP:368030775
1071 1071 a, g dbSNP:750478440
1077 1077 c, t dbSNP:756167856
1078 1078 a, g, t dbSNP:1805024
1079 1079 c, t dbSNP:769066649
1089 1089 c, t dbSNP:779402522
1095 1095 c, t dbSNP:374016332
1096 1096 a, g dbSNP:184906734
1098 1098 a, g dbSNP:375364175
1100 1100 a, g dbSNP:1805025
1101 1101 c, t dbSNP:759031159
1107 1107 a, c dbSNP:769195060
1115 1115 a, c dbSNP:375975199
1116 1116 c, t dbSNP:762584880
1118 1118 c, t dbSNP:553938466
1121 1121 c, t dbSNP:774102273
1122 1122 a, g dbSNP:761628767
1127 1127 c, t dbSNP:767442358
1128 1128 a, g dbSNP:28937873
1131 1131 c, g dbSNP:373235046
1133 1133 c, t dbSNP:756150875
1137 1137 c, t dbSNP:751114266
1138 1138 a, g dbSNP:375304296
1144 1144 c, t dbSNP:754029880
1147 1147 -, c dbSNP:398027866
1148 1148 a, c dbSNP:201606159
1149 1149 c, t dbSNP:755224888
1150 1150 a, g dbSNP:779314442
1153 1153 a, g dbSNP:748480349
1161 1161 a, g dbSNP:774385340
1162 1162 c, t dbSNP:148900690
1171 1171 c, t dbSNP:778279460
1178 1178 c, t dbSNP:747469901
1186 1186 a, g dbSNP:771529925
1188 1188 a, c dbSNP:774840614
1189 1189 a, g dbSNP:748836988
1194 1194 c, t dbSNP:554638593
1195 1195 a, g dbSNP:772856819
1196 1196 c, t dbSNP:371402963
1197 1197 a, g dbSNP:374483122
1198 1198 a, g dbSNP:776731139
1199 1199 c, g dbSNP:759629930
1201 1201 a, c dbSNP:142621527
1203 1203 c, t dbSNP:752883545
1217 1217 c, t dbSNP:763064894
1219 1219 c, t dbSNP:200402349
1220 1220 a, g dbSNP:757270261
1221 1221 c, t dbSNP:757665544
1227 1227 c, g dbSNP:781623501
1244 1244 c, g dbSNP:750931603
1245 1245 a, g dbSNP:756678889
1248 1248 c, t dbSNP:778378592
1251 1251 c, t dbSNP:747738378
1253 1253 c, t dbSNP:771592754
1258 1258 c, g dbSNP:777512062
1264 1264 c, g dbSNP:746731934
1267 1267 c, g dbSNP:570291117
1278 1278 a, c, g dbSNP:537337423
1281 1281 c, g dbSNP:759534224
1291 1291 c, g, t dbSNP:35004053
1292 1292 a, g dbSNP:150971548
1321 1321 c, t dbSNP:756939370
1323 1323 a, c, t dbSNP:527428190
1324 1324 a, g dbSNP:755989819
1333 1333 g, t dbSNP:779792987
1337 1337 a, g dbSNP:367585968
1338 1338 g, t dbSNP:768530931
1342 1342 g, t dbSNP:774464533
1343 1343 a, g dbSNP:748264418
1344 1344 c, t dbSNP:561915025
1345 1345 a, g dbSNP:371462976
1348 1348 a, g dbSNP:376046141
1350 1350 c, g dbSNP:766769900
1364 1364 -, tt dbSNP:574936510
1368 1368 a, c, t dbSNP:776925513
1371 1371 a, g dbSNP:765705755
1375 1375 g, t dbSNP:751040956
1380 1380 c, t dbSNP:529102778
1382 1382 a, g dbSNP:767225225
1389 1389 c, t dbSNP:750109070
1391 1391 a, c, t dbSNP:199564404
1394 1394 a, g dbSNP:369323987
1401 1401 a, t dbSNP:749083390
1412 1412 a, g dbSNP:754909545
1424 1424 a, t dbSNP:778743035
1428 1428 a, g dbSNP:374121651
1429 1429 a, g dbSNP:377154860
1431 1431 a, g dbSNP:777903865
1437 1437 a, g dbSNP:747225676
1446 1446 a, g dbSNP:771110090
1453 1453 c, t dbSNP:777024600
1462 1462 g, t dbSNP:369611634
1470 1470 a, t dbSNP:770287030
1471 1471 a, g dbSNP:776158082
1492 1492 c, g dbSNP:569188784
1518 1518 c, t dbSNP:182387227
1519 1519 a, g dbSNP:551802347
1520 1520 c, t dbSNP:184461716
1524 1524 c, t dbSNP:534297520
1525 1525 a, g dbSNP:189389563
1537 1537 a, c dbSNP:574163561
1550 1550 c, g dbSNP:538066285
1577 1577 c, g dbSNP:181328142
1626 1626 g, t dbSNP:779157022
1654 1654 -, a dbSNP:34114830
1660 1660 a, g dbSNP:185349250
1691 1691 a, g dbSNP:373683259
1716 1716 a, g dbSNP:535792196
1723 1723 c, t dbSNP:557723570
1772 1772 a, c dbSNP:772747252
1785 1785 c, t dbSNP:775994353
1790 1790 -, aat dbSNP:199704918
1790 1790 a, g dbSNP:747437942
1794 1794 -, ata dbSNP:71131709
1808 1808 a, g dbSNP:28451480
1821 1821 g, t dbSNP:572794732
1823 1823 a, g dbSNP:540299575
1832 1832 c, g dbSNP:561662627
1845 1845 a, g dbSNP:147491172
1847 1847 a, g dbSNP:190504253
1952 1952 c, t dbSNP:562724532
1970 1970 a, c dbSNP:533274932
1974 1974 -, a dbSNP:369467965
1975 1975 a, t dbSNP:376195026
1988 1988 -, aaaa dbSNP:531918877
1991 1991 -, a dbSNP:571931356
1994 1994 a, c dbSNP:76637957
1995 1995 a, c dbSNP:76978830
1996 1996 a, c dbSNP:71395043

Target ORF information:

RefSeq Version NM_014249
Organism Homo sapiens (human)
Definition Homo sapiens nuclear receptor subfamily 2, group E, member 3 (NR2E3), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu21890
Accession Version NM_016346.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1104bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product photoreceptor-specific nuclear receptor isoform a
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC104938.7, AF148128.1 and KF495720.1. On Jul 26, 2013 this sequence version replaced gi:30581148. Summary: This protein is part of a large family of nuclear receptor transcription factors involved in signaling pathways. Nuclear receptors have been shown to regulate pathways involved in embryonic development, as well as in maintenance of proper cell function in adults. Members of this family are characterized by discrete domains that function in DNA and ligand binding. This gene encodes a retinal nuclear receptor that is a ligand-dependent transcription factor. Defects in this gene are a cause of enhanced S cone syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (1) represents the longer transcript and encodes isoform a. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF148128.1, HQ692847.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1968189, SAMEA1968968 [ECO:0000350] ##Evidence-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)191..193(+)
Misc Feature(2)311..586(+)
Misc Feature(3)335..505(+)
Misc Feature(4)365..550(+)
Misc Feature(5)770..1297(+)
Misc Feature(6)851..1096(+)
Misc Feature(7)881..958(+)
Misc Feature(8)1193..1195(+)
Exon (1)1..314
Gene Synonym:
Exon (2)315..441
Gene Synonym:
Exon (3)442..545
Gene Synonym:
Exon (4)546..767
Gene Synonym:
Exon (5)768..943
Gene Synonym:
Exon (6)944..1190
Gene Synonym:
Exon (7)1191..2108
Gene Synonym:
Position Chain Variation Link
1 1 c, t dbSNP:752816807
15 15 c, t dbSNP:144605823
43 43 a, g dbSNP:562339667
58 58 a, g, t dbSNP:138513681
97 97 -, ag dbSNP:768224072
126 126 c, g dbSNP:776297781
128 128 c, g dbSNP:551298973
148 148 c, t dbSNP:369166086
158 158 c, g dbSNP:768497132
162 162 c, t dbSNP:778844467
167 167 c, t dbSNP:569548291
168 168 a, g dbSNP:370524688
169 169 a, c dbSNP:771878880
181 181 a, g dbSNP:369493844
185 185 a, g dbSNP:551839789
187 187 c, t dbSNP:771015928
188 188 c, g, t dbSNP:776771148
195 195 c, t dbSNP:765504086
205 205 c, t dbSNP:570230953
222 222 g, t dbSNP:374232020
229 229 c, t dbSNP:764469729
241 241 a, g dbSNP:752130237
244 244 c, t dbSNP:755521253
246 246 c, t dbSNP:534483995
247 247 a, g dbSNP:753463414
248 248 c, t dbSNP:754661615
249 249 c, t dbSNP:778754527
250 250 g, t dbSNP:552754753
263 263 c, g dbSNP:771928643
265 265 c, t dbSNP:777517743
272 272 a, c dbSNP:373237215
277 277 a, g dbSNP:770924023
284 284 c, g dbSNP:371396941
290 290 g, t dbSNP:377300789
295 295 a, c dbSNP:759662513
314 314 a, g dbSNP:769974850
315 315 g, t dbSNP:749528847
316 316 c, t dbSNP:368095184
317 317 a, g dbSNP:370679503
319 319 a, g dbSNP:555860015
325 325 c, t dbSNP:768104512
327 327 c, t dbSNP:202098481
328 328 a, c, g dbSNP:759064828
329 329 c, t dbSNP:368627488
331 331 a, c, t dbSNP:752219772
338 338 c, t dbSNP:763706390
339 339 agtgtgcctccagtgcctcgctcca, gc dbSNP:730882149
339 339 a, c, g dbSNP:372156526
340 340 c, t dbSNP:781059369
342 342 c, t dbSNP:745820285
346 346 c, t dbSNP:376753500
347 347 a, g dbSNP:544807110
359 359 a, g dbSNP:749383991
361 361 c, t dbSNP:768900024
362 362 a, g dbSNP:121912631
366 366 a, g dbSNP:563014885
367 367 a, g dbSNP:748482039
370 370 c, t dbSNP:772583552
371 371 c, t dbSNP:773794490
373 373 c, t dbSNP:761264112
379 379 c, t dbSNP:771404428
381 381 a, g dbSNP:775046346
391 391 c, t dbSNP:367603365
392 392 a, g dbSNP:770937516
396 396 a, g dbSNP:769900190
398 398 a, g dbSNP:763764130
400 400 c, t dbSNP:751236605
401 401 a, g dbSNP:200102936
418 418 c, t dbSNP:767304567
419 419 a, g dbSNP:750284532
422 422 c, t dbSNP:104894492
423 423 a, g dbSNP:104894493
423 423 -, g dbSNP:772903026
425 425 c, t dbSNP:779903522
426 426 a, g dbSNP:186714117
433 433 c, g dbSNP:755040583
451 451 a, g dbSNP:374027410
460 460 g, t dbSNP:558123422
461 461 a, g dbSNP:746366181
463 463 a, g dbSNP:566850779
469 469 c, t dbSNP:773837062
470 470 a, g dbSNP:747703813
485 485 c, t dbSNP:775720634
500 500 g, t dbSNP:534220505
501 501 a, c dbSNP:772881093
502 502 c, t dbSNP:760466119
507 507 a, g dbSNP:766096417
519 519 a, g, t dbSNP:555544052
528 528 c, t dbSNP:759381786
529 529 a, c, g, t dbSNP:900546
537 537 a, g dbSNP:538009962
544 544 c, t dbSNP:374499278
547 547 c, t dbSNP:572488420
548 548 c, g dbSNP:776270511
556 556 c, t dbSNP:759418091
557 557 a, g dbSNP:146403122
560 560 c, t dbSNP:527236086
561 561 a, g dbSNP:376678128
568 568 a, g dbSNP:561598022
569 569 c, t dbSNP:786205493
570 570 a, g dbSNP:528986571
579 579 c, t dbSNP:760989182
587 587 c, t dbSNP:751730121
604 604 g, t dbSNP:550461615
606 606 c, t dbSNP:767828150
609 609 a, g dbSNP:367838359
615 615 a, g dbSNP:1805020
620 620 c, t dbSNP:756501491
624 624 c, t dbSNP:776742417
640 640 c, t dbSNP:533192044
643 643 c, t dbSNP:757833321
645 645 c, t dbSNP:777140312
646 646 a, g dbSNP:746581775
651 651 c, g, t dbSNP:371853056
659 659 c, t dbSNP:376858072
663 663 a, g dbSNP:776515170
668 668 c, t dbSNP:369486706
671 671 a, g dbSNP:769726361
677 677 -, a dbSNP:759339012
684 684 c, t dbSNP:1805021
685 685 a, g dbSNP:534156309
701 701 c, t dbSNP:1805022
703 703 c, g dbSNP:774271438
707 707 a, c dbSNP:750727064
720 720 a, c, g dbSNP:567617489
721 721 c, t dbSNP:750680330
725 725 a, c dbSNP:760968362
729 729 a, t dbSNP:766730044
742 742 -, ctg dbSNP:762887025
742 742 c, g dbSNP:754265589
746 746 a, g dbSNP:755461027
767 767 a, g dbSNP:779518180
772 772 c, t dbSNP:767049846
791 791 a, g dbSNP:201347199
798 798 -, c dbSNP:35568744
799 799 c, t dbSNP:755807403
833 833 c, t dbSNP:76502381
836 836 c, t dbSNP:371694743
837 837 c, g, t dbSNP:749050219
838 838 c, t dbSNP:778657206
841 841 c, t dbSNP:375133059
842 842 a, g dbSNP:368098126
848 848 a, g dbSNP:773264230
851 851 a, g dbSNP:766767604
858 858 a, g dbSNP:747137740
859 859 c, t dbSNP:771105535
860 860 a, g dbSNP:371945959
862 862 c, g dbSNP:759765652
867 867 c, t dbSNP:765642230
868 868 a, c, g dbSNP:530684859
872 872 c, t dbSNP:573593965
873 873 a, g dbSNP:544290323
876 876 c, t dbSNP:755715184
884 884 a, g dbSNP:766079363
889 889 c, t dbSNP:376605943
890 890 a, g dbSNP:1805023
895 895 a, g dbSNP:369817803
903 903 a, c dbSNP:754663006
906 906 a, c dbSNP:778760106
918 918 -, tc dbSNP:750740765
925 925 c, t dbSNP:747947987
928 928 g, t dbSNP:751129402
935 935 c, g dbSNP:777725578
936 936 a, g dbSNP:747043962
937 937 c, g dbSNP:375470824
948 948 a, t dbSNP:758153191
952 952 c, g dbSNP:777633560
963 963 a, c, t dbSNP:377257254
966 966 a, g dbSNP:370823298
985 985 c, t dbSNP:781235826
987 987 a, g dbSNP:201106600
993 993 c, t dbSNP:770027574
997 997 a, g dbSNP:780172380
1002 1002 a, c dbSNP:749027717
1009 1009 c, t dbSNP:377743925
1034 1034 a, c dbSNP:769154628
1035 1035 c, t dbSNP:774931088
1039 1039 c, t dbSNP:555211505
1040 1040 a, g dbSNP:370215891
1042 1042 a, g dbSNP:776180877
1054 1054 c, t dbSNP:566024312
1055 1055 a, g dbSNP:764901119
1056 1056 a, g, t dbSNP:752309343
1057 1057 c, t dbSNP:763876921
1060 1060 a, t dbSNP:537802684
1068 1068 a, g dbSNP:374975658
1070 1070 c, t dbSNP:368030775
1071 1071 a, g dbSNP:750478440
1077 1077 c, t dbSNP:756167856
1078 1078 a, g, t dbSNP:1805024
1079 1079 c, t dbSNP:769066649
1089 1089 c, t dbSNP:779402522
1095 1095 c, t dbSNP:374016332
1096 1096 a, g dbSNP:184906734
1098 1098 a, g dbSNP:375364175
1100 1100 a, g dbSNP:1805025
1101 1101 c, t dbSNP:759031159
1107 1107 a, c dbSNP:769195060
1115 1115 a, c dbSNP:375975199
1116 1116 c, t dbSNP:762584880
1118 1118 c, t dbSNP:553938466
1121 1121 c, t dbSNP:774102273
1122 1122 a, g dbSNP:761628767
1127 1127 c, t dbSNP:767442358
1128 1128 a, g dbSNP:28937873
1131 1131 c, g dbSNP:373235046
1133 1133 c, t dbSNP:756150875
1137 1137 c, t dbSNP:751114266
1138 1138 a, g dbSNP:375304296
1144 1144 c, t dbSNP:754029880
1147 1147 -, c dbSNP:398027866
1148 1148 a, c dbSNP:201606159
1149 1149 c, t dbSNP:755224888
1150 1150 a, g dbSNP:779314442
1153 1153 a, g dbSNP:748480349
1161 1161 a, g dbSNP:774385340
1162 1162 c, t dbSNP:148900690
1171 1171 c, t dbSNP:778279460
1178 1178 c, t dbSNP:747469901
1186 1186 a, g dbSNP:771529925
1188 1188 a, c dbSNP:774840614
1189 1189 a, g dbSNP:748836988
1194 1194 c, t dbSNP:554638593
1195 1195 a, g dbSNP:772856819
1196 1196 c, t dbSNP:371402963
1197 1197 a, g dbSNP:374483122
1198 1198 a, g dbSNP:776731139
1199 1199 c, g dbSNP:759629930
1201 1201 a, c dbSNP:142621527
1203 1203 c, t dbSNP:752883545
1217 1217 c, t dbSNP:763064894
1219 1219 c, t dbSNP:200402349
1220 1220 a, g dbSNP:757270261
1221 1221 c, t dbSNP:757665544
1227 1227 c, g dbSNP:781623501
1244 1244 c, g dbSNP:750931603
1245 1245 a, g dbSNP:756678889
1248 1248 c, t dbSNP:778378592
1251 1251 c, t dbSNP:747738378
1253 1253 c, t dbSNP:771592754
1258 1258 c, g dbSNP:777512062
1264 1264 c, g dbSNP:746731934
1267 1267 c, g dbSNP:570291117
1278 1278 a, c, g dbSNP:537337423
1281 1281 c, g dbSNP:759534224
1291 1291 c, g, t dbSNP:35004053
1292 1292 a, g dbSNP:150971548
1306 1306 c, g dbSNP:368151968
1311 1311 c, t dbSNP:370703800
1312 1312 a, g dbSNP:762019934
1317 1317 -, c dbSNP:755402021
1319 1319 c, t dbSNP:374409457
1326 1326 c, g dbSNP:553866606
1333 1333 c, t dbSNP:756587271
1336 1336 c, t dbSNP:368632939
1344 1344 c, t dbSNP:752109014
1345 1345 g, t dbSNP:757947443
1350 1350 c, t dbSNP:777231953
1368 1368 a, c dbSNP:572065120
1370 1370 c, t dbSNP:764635783
1395 1395 a, g dbSNP:536398548
1406 1406 a, t dbSNP:745745813
1458 1458 a, g dbSNP:768854838
1473 1473 a, g dbSNP:768773245
1476 1476 a, g dbSNP:554475643
1512 1512 c, t dbSNP:576226582
1546 1546 a, g dbSNP:776773685
1572 1572 c, g dbSNP:575225730
1589 1589 -, c dbSNP:755962532
1663 1663 a, t dbSNP:781337187
1664 1664 a, c dbSNP:748377144
1701 1701 a, g dbSNP:188978131
1774 1774 a, g dbSNP:564863972
1793 1793 -, a dbSNP:750755677
1840 1840 c, t dbSNP:118090004
1857 1857 a, g dbSNP:12050537
1869 1869 c, t dbSNP:762105036
1880 1880 c, t dbSNP:184778076
1898 1898 c, g dbSNP:140787956
1913 1913 c, t dbSNP:773362065
1914 1914 a, g dbSNP:763343630
1959 1959 c, g dbSNP:188374522
1991 1991 c, t dbSNP:533650888
2012 2012 c, g dbSNP:113441626
2014 2014 c, t dbSNP:774572874
2018 2018 c, t dbSNP:144639026
2020 2020 -, g dbSNP:34014247
2045 2045 a, c dbSNP:571178572
2059 2059 a, c dbSNP:16956233
2061 2061 a, t dbSNP:180685840
2064 2064 c, t dbSNP:752358225
2065 2065 a, g dbSNP:760425922
2081 2081 c, t dbSNP:763490976
2091 2091 a, g dbSNP:565726176

Target ORF information:

RefSeq Version NM_016346
Organism Homo sapiens (human)
Definition Homo sapiens nuclear receptor subfamily 2, group E, member 3 (NR2E3), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
