Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND


KLLN killin, p53-regulated DNA replication inhibitor [Homo sapiens (human)]

Gene Symbol KLLN
Entrez Gene ID 100144748
Full Name killin, p53-regulated DNA replication inhibitor
Synonyms CWS4, KILLIN
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

10

10q23

Summary The protein encoded by this intronless gene is found in the nucleus, where it can inhibit DNA synthesis and promote S phase arrest coupled to apoptosis. The expression of this DNA binding protein is upregulated by transcription factor p53. [provided by RefSeq, Dec 2012]. lac of sum
Disorder MIM:

612105

Disorder Html:
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu18226 NM_001126049 Homo sapiens killin, p53-regulated DNA replication inhibitor (KLLN), mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.



CloneID OHu18226D
Sequence Information ORF Nucleotide Sequence (Length: 537bp)
Protein sequence
SNP
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 03-MAY-2014
Organism Homo sapiens (human)
Product killin
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from EU552092.1. This sequence is a reference standard in the RefSeqGene project. Summary: The protein encoded by this intronless gene is found in the nucleus, where it can inhibit DNA synthesis and promote S phase arrest coupled to apoptosis. The expression of this DNA binding protein is upregulated by transcription factor p53. [provided by RefSeq, Dec 2012]. ##Evidence-Data-START## Transcript exon combination :: EU552092.1 [ECO:0000332] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
ATGGATCGCC CGGGGCCAGG CTCCGCGCGC CCCGGCCGGA CCGTGCACGT TTGGGGTTAC 
CGGGTTGAGT GGAAAGTACG GAACGGTAGG AAGCTGCAGC CCAGCGAGTG GGCGGGGCGA
GGAGACCTAG GAGGGTTCAA AAGGAGGTGG AAGGATACAC GGGCCACAGT CGGAACTACT
TTCCGAAGGA GGTCACGTGT GTCCCTAGTT GGGGAACTTT CCAAATTCCC ACTCCCCAGT
GATAGCTCCG GAGGCAAGTC GTCTTCTTCC TTTGCTCGGG GTGCTCTTGC CTGGTGCAGG
CAGCGGAACC CCAACCCTTC CTGCGCCGCG GCGGAAACAG GGGCTCGGAC CAGCCTCCCG
AAGGAGCGCT GTCGGGGCTG GCGCTTGGGG AACTGGTTAC ACAAGCACCC ACATCCAAAC
ACGTGCCCCC GCCTCCCCGC CTGCTGGCTG CCGCCGATTC TTACAGAACG CGGGGAGAGA
GTCCCCAAAC TGGTGCCACT CCTCGCCTGC TACCCTAAGA GCAAGCCAAA GGACTGA
The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
RefSeqNP_001119521.1
CDS951..1487
Misc Feature(1)936..938(+)
Exon (1)1..4277
Gene:KLLN
Gene Synonym:
Translation
Position Chain Variation Link
13 13 a, t dbSNP:786204921
25 25 a, g dbSNP:587781501
28 28 c, g, t dbSNP:144620057
29 29 c, g dbSNP:727502789
31 31 -, gcagagcggtagctctgggtgcgagc dbSNP:786204887
32 32 -, cagagcggtagctctgggtgcgagcg dbSNP:786203072
39 39 a, c, g dbSNP:564216039
45 45 c, g dbSNP:587782079
48 48 a, c, g dbSNP:587782230
49 49 a, g dbSNP:587781871
52 52 c, g dbSNP:587782204
53 53 a, g dbSNP:538728843
55 55 g, t dbSNP:530598021
64 64 a, c dbSNP:786204920
65 65 c, t dbSNP:786204919
102 102 c, t dbSNP:587782801
103 103 -, a dbSNP:786204886
106 106 c, t dbSNP:587782068
109 109 -, gg dbSNP:786203981
111 111 a, g dbSNP:563841270
114 114 g, t dbSNP:112758888
123 123 c, t dbSNP:786203674
139 139 a, g, t dbSNP:587779981
141 141 c, g dbSNP:587781548
145 145 a, c dbSNP:587782761
148 148 a, t dbSNP:587782616
153 153 -, ttgctgcggctt dbSNP:786204885
154 154 -, tgctgcggcttt dbSNP:587781340
154 154 -, tgc dbSNP:587782867
157 157 -, tgcggcttttgc dbSNP:747418191
159 159 c, t dbSNP:587779982
167 167 g, t dbSNP:201263396
177 177 a, g dbSNP:786204918
179 179 a, g dbSNP:587779983
183 183 a, c dbSNP:587782881
185 185 a, g dbSNP:786203383
211 211 c, t dbSNP:587779985
212 212 c, t dbSNP:727502790
215 215 -, a dbSNP:786204897
225 225 c, t dbSNP:587781465
256 256 c, g dbSNP:587782034
259 259 g, t dbSNP:542360599
280 280 a, g dbSNP:70937047
287 287 c, t dbSNP:786204917
307 307 a, t dbSNP:769351955
310 310 c, t dbSNP:786204913
313 313 a, g dbSNP:748032117
327 327 a, g dbSNP:781249764
372 372 a, g dbSNP:768316248
373 373 a, g dbSNP:559790304
382 382 c, g dbSNP:541399654
386 386 c, t dbSNP:779859190
409 409 -, t dbSNP:765962681
414 414 c, t dbSNP:758574837
419 419 c, t dbSNP:577656288
426 426 c, t dbSNP:558961422
438 438 a, g dbSNP:750643407
459 459 -, ct dbSNP:556751243
488 488 a, g dbSNP:373561203
510 510 c, t dbSNP:571126356
521 521 a, g dbSNP:140692322
545 545 a, t dbSNP:150923050
548 548 c, t dbSNP:115389083
550 550 c, g dbSNP:571266361
560 560 g, t dbSNP:535179783
564 564 c, t dbSNP:567774730
572 572 a, g dbSNP:754275030
617 617 a, c dbSNP:552591230
628 628 c, t dbSNP:183905591
656 656 a, g dbSNP:114717956
669 669 a, g dbSNP:552173268
713 713 g, t dbSNP:530801550
724 724 c, g dbSNP:569775070
739 739 g, t dbSNP:548360693
741 741 -, ccaaagggc dbSNP:140280016
768 768 a, g dbSNP:772961242
798 798 c, t dbSNP:530229073
814 814 g, t dbSNP:559881023
817 817 c, t dbSNP:771482091
837 837 a, g dbSNP:541462983
852 852 c, t dbSNP:532384445
860 860 c, t dbSNP:192286047
887 887 c, t dbSNP:543780235
888 888 a, c dbSNP:576629071
904 904 a, g dbSNP:775530644
922 922 a, c dbSNP:554752233
923 923 a, c dbSNP:759386918
925 925 -, c dbSNP:780317820
927 927 a, c, t dbSNP:542803093
934 934 c, t dbSNP:143510676
938 938 a, c dbSNP:773356312
942 942 c, t dbSNP:769797542
944 944 c, g, t dbSNP:367958117
948 948 a, c dbSNP:376068536
961 961 c, t dbSNP:755383474
979 979 -, gc dbSNP:769874341
983 983 c, g dbSNP:747363285
989 989 g, t dbSNP:778493831
991 991 a, c dbSNP:534352505
999 999 a, g dbSNP:201100551
1007 1007 c, t dbSNP:763692760
1011 1011 c, t dbSNP:755641571
1023 1023 a, g dbSNP:752734295
1025 1025 a, g dbSNP:767531763
1026 1026 a, g dbSNP:753061420
1065 1065 a, g dbSNP:374921871
1080 1080 c, g dbSNP:186106725
1083 1083 a, g dbSNP:763239852
1092 1092 -, a dbSNP:746388484
1095 1095 a, c dbSNP:762629002
1104 1104 a, g dbSNP:536951646
1122 1122 a, g dbSNP:773263886
1132 1132 a, g, t dbSNP:569894367
1133 1133 c, t dbSNP:748203285
1134 1134 c, g dbSNP:548448478
1136 1136 a, g dbSNP:769143123
1141 1141 a, g dbSNP:529890302
1147 1147 g, t dbSNP:780478359
1155 1155 c, t dbSNP:758652283
1171 1171 a, c, g dbSNP:773066595
1179 1179 c, t dbSNP:571336068
1182 1182 c, t dbSNP:566209860
1196 1196 c, t dbSNP:547925835
1200 1200 c, g dbSNP:3758479
1203 1203 c, g dbSNP:752251651
1210 1210 c, t dbSNP:372344241
1213 1213 c, g, t dbSNP:369376419
1214 1214 g, t dbSNP:376123304
1217 1217 a, t dbSNP:543758335
1239 1239 g, t dbSNP:531951589
1244 1244 -, ggt dbSNP:781685752
1245 1245 g, t dbSNP:561243952
1247 1247 c, g, t dbSNP:542841708
1248 1248 a, t dbSNP:572290539
1250 1250 -, gcag dbSNP:757570578
1250 1250 -, g dbSNP:576385179
1261 1261 c, g dbSNP:148838695
1265 1265 -, ccct dbSNP:751991164
1265 1265 c, t dbSNP:751388587
1276 1276 c, t dbSNP:766226070
1277 1277 c, g dbSNP:537792531
1282 1282 c, t dbSNP:768719505
1289 1289 -, ag dbSNP:749052307
1307 1307 c, t dbSNP:540792809
1326 1326 a, g dbSNP:765413745
1332 1332 c, g dbSNP:201652303
1342 1342 a, g dbSNP:147932146
1343 1343 c, g dbSNP:768662566
1361 1361 a, g dbSNP:761277836
1389 1389 g, t dbSNP:775814292
1392 1392 -, ccccgcct dbSNP:754674831
1395 1395 a, t dbSNP:144811392
1411 1411 c, t dbSNP:188648297
1413 1413 -, a dbSNP:779014614
1422 1422 c, g, t dbSNP:554884852
1426 1426 a, g dbSNP:769557842
1438 1438 a, t dbSNP:536515096
1469 1469 a, g dbSNP:185550921
1471 1471 c, g dbSNP:747746080
1472 1472 a, c dbSNP:780855741
1507 1507 a, g dbSNP:754403847
1531 1531 c, t dbSNP:751537271
1540 1540 c, t dbSNP:181069579
1541 1541 g, t dbSNP:776404259
1545 1545 -, g dbSNP:779972240
1574 1574 a, g dbSNP:755976514
1591 1591 g, t dbSNP:538764371
1604 1604 -, g dbSNP:35361056
1733 1733 -, t dbSNP:747190523
1743 1743 a, g dbSNP:141066244
1749 1749 c, t dbSNP:768601757
1769 1769 a, g dbSNP:746974442
1776 1776 c, g dbSNP:549954376
1788 1788 a, c dbSNP:531710639
1799 1799 a, g dbSNP:147739023
1839 1839 a, g dbSNP:565600813
1911 1911 a, g dbSNP:549283354
1950 1950 a, c dbSNP:190019605
2009 2009 a, t dbSNP:771917238
2033 2033 a, g dbSNP:746073034
2037 2037 c, g dbSNP:779241478
2039 2039 c, t dbSNP:546594521
2055 2055 a, g dbSNP:527952325
2058 2058 g, t dbSNP:185094431
2070 2070 c, t dbSNP:560318248
2111 2111 g, t dbSNP:545544697
2116 2116 c, t dbSNP:757250596
2134 2134 a, g dbSNP:7901097
2173 2173 c, t dbSNP:564991821
2206 2206 -, t dbSNP:752592502
2224 2224 c, t dbSNP:543082103
2311 2311 a, c dbSNP:370905351
2312 2312 a, t dbSNP:576119843
2313 2313 c, g dbSNP:554575355
2315 2315 a, g dbSNP:193149038
2327 2327 a, g dbSNP:777746796
2337 2337 a, c dbSNP:758349626
2376 2376 a, c dbSNP:190576098
2432 2432 a, t dbSNP:367801804
2445 2445 a, g dbSNP:552946896
2467 2467 a, g dbSNP:149992281
2484 2484 a, g dbSNP:756622635
2594 2594 c, t dbSNP:571678582
2609 2609 c, g dbSNP:183894316
2612 2612 c, t dbSNP:191518084
2655 2655 c, t dbSNP:56389051
2702 2702 g, t dbSNP:567345489
2783 2783 c, t dbSNP:530010360
2788 2788 c, g dbSNP:548921567
2792 2792 c, t dbSNP:527990207
2812 2812 c, t dbSNP:186662792
2820 2820 g, t dbSNP:565799299
2843 2843 g, t dbSNP:533552717
2859 2859 c, t dbSNP:750010648
2890 2890 a, g dbSNP:116928332
2907 2907 c, t dbSNP:543524504
2929 2929 a, g dbSNP:184216900
2931 2931 a, g dbSNP:560875179
2978 2978 a, c dbSNP:561450801
2980 2980 a, g dbSNP:542634874
2985 2985 a, g dbSNP:1903860
2995 2995 a, c dbSNP:554012658
3018 3018 c, t dbSNP:544909412
3021 3021 c, t dbSNP:80005718
3029 3029 a, g dbSNP:531162210
3041 3041 a, g dbSNP:556057845
3064 3064 c, t dbSNP:191630598
3169 3169 a, g dbSNP:567383999
3199 3199 -, aagtt dbSNP:559242940
3199 3199 a, g dbSNP:139261693
3206 3206 g, t dbSNP:776163150
3240 3240 c, t dbSNP:188576792
3288 3288 -, ctaaa dbSNP:767495314
3342 3342 g, t dbSNP:183638448
3362 3362 a, c dbSNP:552063520
3364 3364 a, c dbSNP:760596593
3398 3398 c, t dbSNP:369197917
3402 3402 c, t dbSNP:567129170
3403 3403 -, c dbSNP:772642013
3403 3403 c, t dbSNP:113730541
3420 3420 -, ttttttttttt dbSNP:763209997
3422 3422 -, t, tt dbSNP:5786795
3428 3428 a, g dbSNP:569434957
3439 3439 a, g dbSNP:550852908
3464 3464 a, g dbSNP:192064705
3488 3488 a, g dbSNP:188956302
3490 3490 a, g dbSNP:755493639
3494 3494 a, g dbSNP:771826993
3499 3499 a, g dbSNP:542671953
3502 3502 a, c dbSNP:527262178
3522 3522 a, g dbSNP:559860708
3554 3554 c, t dbSNP:545310935
3571 3571 c, g dbSNP:573588280
3587 3587 a, g dbSNP:150816814
3614 3614 c, g dbSNP:556335233
3639 3639 c, t dbSNP:373364249
3644 3644 c, t dbSNP:374986491
3645 3645 a, g dbSNP:548514172
3650 3650 c, t dbSNP:141469860
3652 3652 -, c dbSNP:543307510
3682 3682 a, c dbSNP:78839565
3683 3683 a, g dbSNP:140073260
3684 3684 c, t dbSNP:533991936
3688 3688 c, t dbSNP:566878155
3689 3689 a, g dbSNP:749476311
3700 3700 a, g dbSNP:60373064
3716 3716 a, g dbSNP:530195013
3744 3744 a, g dbSNP:183136843
3746 3746 g, t dbSNP:748659967
3768 3768 a, g dbSNP:781774241
3821 3821 -, c dbSNP:371100979
3835 3835 c, t dbSNP:189765659
3836 3836 a, g dbSNP:184914771
3845 3845 a, g dbSNP:536035434
3846 3846 g, t dbSNP:181205569
3905 3905 g, t dbSNP:75742574
3959 3959 c, t dbSNP:751899970
3970 3970 c, g dbSNP:77542800
4011 4011 c, g dbSNP:560896889
4031 4031 c, t dbSNP:560097889
4045 4045 a, g dbSNP:551051140
4061 4061 a, g dbSNP:533300514
4073 4073 a, t dbSNP:557052599
4113 4113 -, gttt dbSNP:373583523
4130 4130 c, t dbSNP:562639933
4143 4143 a, c dbSNP:536723454
4156 4156 a, g dbSNP:753496923
4167 4167 a, c dbSNP:544033033
4265 4265 a, t dbSNP:76631158

Target ORF information:

RefSeq Version NM_001126049
Organism Homo sapiens (human)
Definition Homo sapiens killin, p53-regulated DNA replication inhibitor (KLLN), mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK
NM_001126049

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
ATGGATCGCC CGGGGCCAGG CTCCGCGCGC CCCGGCCGGA CCGTGCACGT TTGGGGTTAC 
CGGGTTGAGT GGAAAGTACG GAACGGTAGG AAGCTGCAGC CCAGCGAGTG GGCGGGGCGA
GGAGACCTAG GAGGGTTCAA AAGGAGGTGG AAGGATACAC GGGCCACAGT CGGAACTACT
TTCCGAAGGA GGTCACGTGT GTCCCTAGTT GGGGAACTTT CCAAATTCCC ACTCCCCAGT
GATAGCTCCG GAGGCAAGTC GTCTTCTTCC TTTGCTCGGG GTGCTCTTGC CTGGTGCAGG
CAGCGGAACC CCAACCCTTC CTGCGCCGCG GCGGAAACAG GGGCTCGGAC CAGCCTCCCG
AAGGAGCGCT GTCGGGGCTG GCGCTTGGGG AACTGGTTAC ACAAGCACCC ACATCCAAAC
ACGTGCCCCC GCCTCCCCGC CTGCTGGCTG CCGCCGATTC TTACAGAACG CGGGGAGAGA
GTCCCCAAAC TGGTGCCACT CCTCGCCTGC TACCCTAAGA GCAAGCCAAA GGACTGA

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.