
ABCC9 cDNA ORF clone, Homo sapiens (human)

Gene Symbol ABCC9
Entrez Gene ID 10060
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 9
Synonyms ABC37, ATFB12, CANTU, CMD1O, SUR2
General protein information
Preferred Names
ATP-binding cassette sub-family C member 9
ATP-binding cassette sub-family C member 9
sulfonylurea receptor 2
ATP-binding cassette transporter sub-family C member 9
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein is thought to form ATP-sensitive potassium channels in cardiac, skeletal, and vascular and non-vascular smooth muscle. Protein structure suggests a role as the drug-binding channel-modulating subunit of the extra-pancreatic ATP-sensitive potassium channels. Mutations in this gene are associated with cardiomyopathy dilated type 1O. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2011]. lac of sum
Disorder MIM:


Disorder Html: Cardiomyopathy, dilated, 1O, 608569 (3)

mRNA and Protein(s)

mRNA Protein Name
NM_005691 NP_005682 ATP-binding cassette sub-family C member 9 isoform SUR2A
NM_020297 NP_064693 ATP-binding cassette sub-family C member 9 isoform SUR2B
XM_005253284 XP_005253341 ATP-binding cassette sub-family C member 9 isoform X1
XM_005253286 XP_005253343 ATP-binding cassette sub-family C member 9 isoform X1
XM_005253287 XP_005253344 ATP-binding cassette sub-family C member 9 isoform X2
XM_005253288 XP_005253345 ATP-binding cassette sub-family C member 9 isoform X1
XM_005253289 XP_005253346 ATP-binding cassette sub-family C member 9 isoform X3
XM_005253290 XP_005253347 ATP-binding cassette sub-family C member 9 isoform X5
XM_006719025 XP_006719088 ATP-binding cassette sub-family C member 9 isoform X4
XM_011520545 XP_011518847 ATP-binding cassette sub-family C member 9 isoform X1

hsa02010 ABC transporters
R-HSA-112316 Neuronal System
R-HSA-1296071 Potassium Channels
R-HSA-1296025 ATP sensitive Potassium channels
R-HSA-1296065 Inwardly rectifying K+ channels
R-HSA-382551 Transmembrane transport of small molecules
R-HSA-382556 ABC-family proteins mediated transport

Homo sapiens (human) ABCC9 NP_005682.2
Pan troglodytes (chimpanzee) ABCC9 XP_001149414.1
Macaca mulatta (Rhesus monkey) ABCC9 XP_001098888.1
Canis lupus familiaris (dog) ABCC9 XP_852746.1
Bos taurus (cattle) ABCC9 XP_005207020.1
Mus musculus (house mouse) Abcc9 NP_035641.1
Rattus norvegicus (Norway rat) Abcc9 NP_037172.2
Gallus gallus (chicken) ABCC9 XP_004938045.1
Danio rerio (zebrafish) abcc9 NP_001025325.1
Drosophila melanogaster (fruit fly) Sur NP_477472.2
Xenopus (Silurana) tropicalis (western clawed frog) abcc9 XP_004920363.1


ID Name Evidence
GO:0008282 ATP-sensitive potassium channel complex ISS
GO:0016020 membrane IEA
GO:0016021 integral to membrane IEA


ID Name Evidence
GO:0000166 nucleotide binding IEA
GO:0004872 receptor activity IEA
GO:0005215 transporter activity TAS
GO:0005524 ATP binding IEA
GO:0008281 sulfonylurea receptor activity ISS
GO:0015459 potassium channel regulator activity ISS
GO:0016887 ATPase activity IEA
GO:0042626 ATPase activity, coupled to transmembrane movement of substances IEA


ID Name Evidence
GO:0006813 potassium ion transport IEA
GO:0010107 potassium ion import ISS
GO:0051607 defense response to virus IMP
GO:0055085 transmembrane transport IEA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following ABCC9 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the ABCC9 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu23543 NM_005691 Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 9 (ABCC9), transcript variant SUR2A, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu23823 NM_020297 Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 9 (ABCC9), transcript variant SUR2B, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu23823 XM_005253284 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 9 (ABCC9), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu23823 XM_005253286 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 9 (ABCC9), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu23543 XM_005253287 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 9 (ABCC9), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu23823 XM_005253288 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 9 (ABCC9), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu46040 XM_005253289 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 9 (ABCC9), transcript variant X6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu46042 XM_005253290 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 9 (ABCC9), transcript variant X8, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu46041 XM_006719025 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 9 (ABCC9), transcript variant X7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu23823 XM_011520545 PREDICTED: Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 9 (ABCC9), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee that the protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu23543
Accession Version NM_005691.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 4650bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product ATP-binding cassette sub-family C member 9 isoform SUR2A
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK056519.1, AC008250.23, KF459680.1, CA389699.1 and AK092535.1. On Jan 17, 2014 this sequence version replaced gi:110832834. Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein is thought to form ATP-sensitive potassium channels in cardiac, skeletal, and vascular and non-vascular smooth muscle. Protein structure suggests a role as the drug-binding channel-modulating subunit of the extra-pancreatic ATP-sensitive potassium channels. Mutations in this gene are associated with cardiomyopathy dilated type 1O. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2011]. Transcript Variant: This variant (SUR2A) uses an alternate 3' coding exon (exon 38A), compared to variant SUR2B, which uses exon 38B. The encoded isoform (SUR2A) has an alternate 38-amino acid C-terminus, but is the same length as isoform SUR2B. There are no full-length transcripts representing this variant in human; it is supported by partial transcript alignments, by full-length transcript alignments from the homologous mouse and rat genes, and by RT-PCR analysis in PMID:11054556. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##RefSeq-Attributes-START## inferred exon combination :: PMID: 11054556 ##RefSeq-Attributes-END## ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)12..14(+)
Misc Feature(2)111..173(+)
Misc Feature(3)237..299(+)
Misc Feature(4)324..386(+)
Misc Feature(5)417..479(+)
Misc Feature(6)522..584(+)
Misc Feature(7)681..4622(+)
Misc Feature(8)924..986(+)
Misc Feature(9)1071..1133(+)
Misc Feature(10)1113..1775(+)
Misc Feature(11)1290..1352(+)
Misc Feature(12)1386..1448(+)
Misc Feature(13)1614..1676(+)
Misc Feature(14)1734..1796(+)
Misc Feature(15)2034..2687(+)
Misc Feature(16)2133..2156(+)
Misc Feature(17)2142..2633(+)
Misc Feature(18)2280..2291(+)
Misc Feature(19)2454..2483(+)
Misc Feature(20)2514..2531(+)
Misc Feature(21)2538..2549(+)
Misc Feature(22)2619..2639(+)
Misc Feature(23)2991..3053(+)
Misc Feature(24)3000..3818(+)
Misc Feature(25)3123..3185(+)
Misc Feature(26)3402..3464(+)
Misc Feature(27)3756..3818(+)
Misc Feature(28)3948..4667(+)
Misc Feature(29)4056..4079(+)
Misc Feature(30)4065..4535(+)
Misc Feature(31)4191..4202(+)
Misc Feature(32)4365..4394(+)
Misc Feature(33)4425..4442(+)
Misc Feature(34)4449..4460(+)
Misc Feature(35)4521..4541(+)
Exon (1)1..162
Gene Synonym:
Exon (2)163..304
Gene Synonym:
Exon (3)305..426
Gene Synonym:
Exon (4)427..593
Gene Synonym:
Exon (5)594..836
Gene Synonym:
Exon (6)837..1031
Gene Synonym:
Exon (7)1032..1184
Gene Synonym:
Exon (8)1185..1340
Gene Synonym:
Exon (9)1341..1475
Gene Synonym:
Exon (10)1476..1638
Gene Synonym:
Exon (11)1639..1679
Gene Synonym:
Exon (12)1680..1822
Gene Synonym:
Exon (13)1823..1931
Gene Synonym:
Exon (14)1932..2039
Gene Synonym:
Exon (15)2040..2112
Gene Synonym:
Exon (16)2113..2218
Gene Synonym:
Exon (17)2219..2257
Gene Synonym:
Exon (18)2258..2359
Gene Synonym:
Exon (19)2360..2444
Gene Synonym:
Exon (20)2445..2525
Gene Synonym:
Exon (21)2526..2663
Gene Synonym:
Exon (22)2664..2789
Gene Synonym:
Exon (23)2790..2886
Gene Synonym:
Exon (24)2887..3116
Gene Synonym:
Exon (25)3117..3265
Gene Synonym:
Exon (26)3266..3335
Gene Synonym:
Exon (27)3336..3493
Gene Synonym:
Exon (28)3494..3586
Gene Synonym:
Exon (29)3587..3689
Gene Synonym:
Exon (30)3690..3791
Gene Synonym:
Exon (31)3792..3912
Gene Synonym:
Exon (32)3913..4043
Gene Synonym:
Exon (33)4044..4122
Gene Synonym:
Exon (34)4123..4231
Gene Synonym:
Exon (35)4232..4335
Gene Synonym:
Exon (36)4336..4469
Gene Synonym:
Exon (37)4470..4532
Gene Synonym:
Exon (38)4533..4670
Gene Synonym:
Position Chain Variation Link
4 4 a, g dbSNP:538242067
7 7 -, ccatata dbSNP:746420722
10 10 c, t dbSNP:72559432
12 12 c, t dbSNP:370067847
18 18 a, g dbSNP:775391004
21 21 -, a dbSNP:774663798
26 26 c, t dbSNP:765382139
38 38 c, t dbSNP:759586176
46 46 a, g dbSNP:776881654
55 55 c, t dbSNP:766371743
57 57 c, t dbSNP:771346551
67 67 a, g dbSNP:727502877
68 68 c, t dbSNP:199631710
69 69 a, g dbSNP:772070154
78 78 c, t dbSNP:375713309
95 95 c, t dbSNP:201972673
96 96 a, g dbSNP:754476885
97 97 c, t dbSNP:748812668
108 108 a, g dbSNP:779664751
116 116 c, t dbSNP:727505034
122 122 a, c, t dbSNP:778139798
132 132 c, t dbSNP:375739359
150 150 a, g dbSNP:750233555
179 179 c, t dbSNP:779463030
186 186 a, g dbSNP:749597050
189 189 c, t dbSNP:727502876
192 192 -, a dbSNP:756155004
194 194 c, t dbSNP:753906607
198 198 c, t dbSNP:387907230
220 220 c, t dbSNP:766600615
221 221 a, g dbSNP:769322587
223 223 a, g dbSNP:760934600
235 235 a, g dbSNP:369409311
247 247 c, g dbSNP:745330137
251 251 c, t dbSNP:767694387
269 269 c, t dbSNP:761653519
276 276 c, g dbSNP:774026262
286 286 a, g dbSNP:199508243
304 304 c, t dbSNP:376432144
306 306 c, t dbSNP:373792254
307 307 a, g dbSNP:202103893
309 309 c, t dbSNP:727502875
310 310 a, g dbSNP:778951072
311 311 a, g dbSNP:759034996
325 325 c, t dbSNP:374659816
344 344 c, t dbSNP:770552940
345 345 a, g dbSNP:374849789
349 349 a, t dbSNP:774731983
350 350 a, g dbSNP:267603425
356 356 c, t dbSNP:769123978
357 357 a, g dbSNP:200723629
363 363 a, g dbSNP:780689866
374 374 a, g dbSNP:189582135
375 375 a, g dbSNP:745873108
391 391 a, g dbSNP:781160274
392 392 c, t dbSNP:377384557
401 401 a, g dbSNP:377696872
411 411 c, t dbSNP:751708268
415 415 a, g dbSNP:727505161
421 421 a, t dbSNP:764416164
422 422 c, t dbSNP:758185120
431 431 a, g, t dbSNP:368753369
440 440 c, t dbSNP:397517189
449 449 a, g dbSNP:759985677
457 457 a, t dbSNP:149325742
477 477 a, g dbSNP:771527727
487 487 a, g dbSNP:754918275
500 500 a, g dbSNP:747004107
503 503 c, t dbSNP:777836104
517 517 a, g dbSNP:772244404
531 531 a, g dbSNP:748393474
532 532 c, g dbSNP:779159910
538 538 c, t dbSNP:529337366
539 539 g, t dbSNP:567173040
585 585 c, t dbSNP:779793300
587 587 a, t dbSNP:756079711
595 595 a, g dbSNP:727504612
596 596 a, t dbSNP:779927466
599 599 c, t dbSNP:755954331
600 600 a, g dbSNP:745776787
629 629 a, g dbSNP:139669232
632 632 g, t dbSNP:375789756
640 640 a, g dbSNP:182537028
650 650 c, t dbSNP:751172494
684 684 c, t dbSNP:763596073
689 689 g, t dbSNP:17846788
703 703 a, c dbSNP:200336305
710 710 -, tgg dbSNP:779955645
733 733 c, t dbSNP:746018912
748 748 c, t dbSNP:754113599
754 754 c, t dbSNP:766792143
763 763 c, t dbSNP:760997956
784 784 c, t dbSNP:150627958
809 809 c, t dbSNP:58386780
810 810 c, t dbSNP:761820569
814 814 a, g dbSNP:774415124
818 818 c, t dbSNP:138356189
829 829 a, c dbSNP:145774770
840 840 a, g dbSNP:776572382
846 846 a, g dbSNP:201783967
861 861 c, t dbSNP:746967404
862 862 a, g dbSNP:753456211
863 863 g, t dbSNP:547213635
866 866 g, t dbSNP:747683989
872 872 a, t dbSNP:113562970
873 873 a, g, t dbSNP:370662364
882 882 g, t dbSNP:781555751
887 887 a, g dbSNP:757665666
889 889 a, t dbSNP:752072949
902 902 a, g dbSNP:764574133
904 904 a, g dbSNP:763074253
905 905 a, g dbSNP:368276490
914 914 a, g dbSNP:765489183
920 920 c, t dbSNP:759869766
927 927 c, t dbSNP:776519364
928 928 c, t dbSNP:200207117
931 931 a, g dbSNP:770829231
938 938 a, g dbSNP:142115849
944 944 c, t dbSNP:139127928
947 947 a, g dbSNP:548380877
948 948 c, t dbSNP:747640613
957 957 a, g dbSNP:778313829
968 968 -, tt dbSNP:771232310
977 977 c, t dbSNP:768245158
979 979 a, g dbSNP:200272254
989 989 a, g dbSNP:748914473
990 990 c, t dbSNP:779720018
1010 1010 c, t dbSNP:757612560
1018 1018 a, t dbSNP:531754904
1028 1028 c, t dbSNP:778283866
1033 1033 c, t dbSNP:756300282
1043 1043 c, g dbSNP:369597360
1046 1046 c, t dbSNP:750197446
1055 1055 a, g dbSNP:72559752
1070 1070 c, t dbSNP:143373045
1071 1071 g, t dbSNP:375758521
1076 1076 c, t dbSNP:149408382
1083 1083 g, t dbSNP:145455570
1102 1102 c, g dbSNP:762383594
1132 1132 c, g dbSNP:774995037
1139 1139 c, g dbSNP:769439725
1142 1142 c, t dbSNP:745536995
1147 1147 c, t dbSNP:372244832
1149 1149 a, g dbSNP:567016348
1150 1150 c, t dbSNP:368908490
1162 1162 a, t dbSNP:397517181
1167 1167 c, t dbSNP:755542764
1170 1170 c, t dbSNP:749318820
1171 1171 a, g dbSNP:374574602
1195 1195 a, g, t dbSNP:370918215
1217 1217 a, t dbSNP:769232379
1219 1219 a, c dbSNP:749786076
1220 1220 a, g dbSNP:150096625
1232 1232 c, t dbSNP:376726505
1233 1233 a, g dbSNP:142038412
1271 1271 c, t dbSNP:746029351
1272 1272 a, g dbSNP:781206225
1273 1273 c, t dbSNP:147580701
1293 1293 -, at dbSNP:753555698
1294 1294 c, t dbSNP:751307815
1298 1298 g, t dbSNP:777576366
1315 1315 a, c dbSNP:758229885
1316 1316 c, t dbSNP:10770865
1326 1326 a, g dbSNP:765275705
1332 1332 a, c dbSNP:758962407
1340 1340 c, g dbSNP:753391218
1342 1342 a, t dbSNP:765941070
1343 1343 c, g dbSNP:755739683
1349 1349 a, g dbSNP:151197166
1352 1352 c, t dbSNP:369830406
1361 1361 a, g dbSNP:763346044
1378 1378 c, g dbSNP:397517183
1384 1384 c, g dbSNP:775938318
1394 1394 c, t dbSNP:200819464
1401 1401 c, g dbSNP:374535641
1416 1416 c, t dbSNP:555340137
1418 1418 c, t dbSNP:368698007
1420 1420 c, t dbSNP:770976719
1421 1421 a, g dbSNP:142219855
1436 1436 c, t dbSNP:777308898
1445 1445 a, g dbSNP:772284924
1453 1453 c, t dbSNP:387907211
1471 1471 c, t dbSNP:747837398
1493 1493 a, g dbSNP:777181850
1505 1505 a, g dbSNP:751828406
1549 1549 a, g dbSNP:766936591
1554 1554 c, t dbSNP:368128251
1565 1565 c, t dbSNP:760680023
1574 1574 a, g dbSNP:773290634
1577 1577 a, g dbSNP:143346402
1598 1598 a, g dbSNP:748429545
1607 1607 c, g dbSNP:570095510
1622 1622 a, g dbSNP:768487549
1623 1623 c, t dbSNP:397517184
1629 1629 a, t dbSNP:780072385
1658 1658 a, c, t dbSNP:370463895
1678 1678 -, c dbSNP:766870789
1691 1691 c, t dbSNP:746467455
1696 1696 c, t dbSNP:772619542
1697 1697 a, g dbSNP:76458291
1709 1709 a, g dbSNP:747765299
1751 1751 c, g dbSNP:778581244
1763 1763 a, g dbSNP:777049470
1790 1790 a, g dbSNP:746239063
1793 1793 a, g dbSNP:781684241
1823 1823 c, t dbSNP:773930785
1837 1837 a, c, g dbSNP:149229372
1848 1848 -, tt dbSNP:776934642
1868 1868 c, t dbSNP:61001398
1869 1869 a, g dbSNP:757681761
1879 1879 a, g dbSNP:139539832
1883 1883 c, t dbSNP:577810106
1894 1894 c, t dbSNP:75460545
1895 1895 a, g dbSNP:727502873
1899 1899 c, g dbSNP:367770980
1907 1907 g, t dbSNP:150036969
1922 1922 c, t dbSNP:753627514
1929 1929 a, g dbSNP:113542001
1934 1934 a, g dbSNP:565125768
1941 1941 a, g dbSNP:755145193
1946 1946 a, g dbSNP:552092424
1947 1947 a, c dbSNP:138890128
1958 1958 a, g dbSNP:755853969
1959 1959 c, g, t dbSNP:767396331
1962 1962 a, c, g dbSNP:368279608
1963 1963 a, g dbSNP:763573197
1968 1968 c, t dbSNP:762583015
1975 1975 g, t dbSNP:775002315
1992 1992 c, t dbSNP:769493004
1998 1998 c, t dbSNP:760889253
1999 1999 a, g dbSNP:150255709
2001 2001 c, t dbSNP:199499109
2002 2002 a, g dbSNP:397517185
2006 2006 a, g dbSNP:779609498
2007 2007 c, t dbSNP:200349671
2008 2008 a, g dbSNP:141999048
2012 2012 c, t dbSNP:780071007
2013 2013 a, g dbSNP:200891785
2020 2020 a, c, t dbSNP:397517186
2021 2021 a, g dbSNP:549032386
2022 2022 a, g dbSNP:757093666
2024 2024 a, g dbSNP:751485829
2025 2025 a, c, g dbSNP:762304330
2050 2050 g, t dbSNP:777631521
2060 2060 a, c dbSNP:758381330
2065 2065 a, g dbSNP:752106985
2070 2070 a, g dbSNP:148174226
2086 2086 c, t dbSNP:200288646
2087 2087 a, c dbSNP:754495447
2090 2090 c, t dbSNP:753524629
2092 2092 c, t dbSNP:766197122
2101 2101 a, g dbSNP:267603424
2106 2106 c, t dbSNP:183603557
2110 2110 c, g dbSNP:764471784
2117 2117 a, g dbSNP:546978327
2121 2121 -, c dbSNP:371525457
2122 2122 a, c dbSNP:763289280
2124 2124 -, a dbSNP:772110955
2132 2132 c, g dbSNP:756409292
2141 2141 a, t dbSNP:765667189
2169 2169 a, g dbSNP:397517187
2174 2174 c, t dbSNP:74067815
2175 2175 c, t dbSNP:141925577
2177 2177 c, t dbSNP:201848437
2178 2178 a, g dbSNP:542184069
2191 2191 c, t dbSNP:773355490
2210 2210 a, c dbSNP:771887289
2211 2211 c, g, t dbSNP:367621959
2217 2217 a, g dbSNP:369604693
2220 2220 a, g dbSNP:61688134
2232 2232 a, g dbSNP:202054255
2234 2234 a, g dbSNP:749218661
2235 2235 c, g dbSNP:201223488
2242 2242 c, t dbSNP:146944210
2252 2252 c, t dbSNP:769428584
2257 2257 a, g dbSNP:745375583
2262 2262 a, g dbSNP:777459907
2265 2265 a, t dbSNP:755331988
2271 2271 a, t dbSNP:375322301
2282 2282 c, t dbSNP:145561881
2288 2288 g, t dbSNP:780477165
2291 2291 a, g dbSNP:756598798
2295 2295 c, t dbSNP:538520169
2310 2310 a, g dbSNP:750474414
2311 2311 c, t dbSNP:767475566
2313 2313 a, g dbSNP:757419477
2320 2320 a, g dbSNP:751831174
2324 2324 a, g dbSNP:764419953
2332 2332 c, t dbSNP:180739851
2335 2335 c, t dbSNP:775448788
2351 2351 c, t dbSNP:765227350
2363 2363 c, t dbSNP:758726580
2377 2377 a, g dbSNP:753010015
2384 2384 c, t dbSNP:764916922
2388 2388 c, t dbSNP:759432313
2389 2389 c, t dbSNP:555127853
2395 2395 c, t dbSNP:753713460
2405 2405 c, t dbSNP:766344568
2412 2412 a, c dbSNP:760116129
2429 2429 a, t dbSNP:772727573
2437 2437 a, g dbSNP:771669791
2438 2438 a, t dbSNP:761421687
2462 2462 a, g dbSNP:747498785
2463 2463 a, g, t dbSNP:267603423
2468 2468 a, g dbSNP:772272069
2475 2475 a, g dbSNP:748239152
2480 2480 c, t dbSNP:778941231
2481 2481 a, t dbSNP:755251666
2485 2485 c, t dbSNP:748996561
2490 2490 a, c dbSNP:779866340
2491 2491 a, g dbSNP:755951253
2495 2495 a, g, t dbSNP:587780845
2507 2507 c, t dbSNP:756699664
2515 2515 c, t dbSNP:542818695
2519 2519 a, c dbSNP:751103892
2520 2520 c, t dbSNP:367776754
2523 2523 -, ttg dbSNP:776927430
2526 2526 a, g dbSNP:764983816
2531 2531 c, t dbSNP:761059899
2543 2543 c, t dbSNP:144537241
2574 2574 c, t dbSNP:193922683
2591 2591 a, g dbSNP:762350069
2600 2600 a, g dbSNP:774768881
2602 2602 a, c dbSNP:776565800
2606 2606 c, g dbSNP:768765531
2608 2608 a, g dbSNP:111943197
2619 2619 a, g dbSNP:376754153
2627 2627 a, g dbSNP:762524104
2633 2633 c, t dbSNP:373909378
2636 2636 a, g dbSNP:745622324
2642 2642 a, g dbSNP:780938779
2650 2650 c, t dbSNP:140872303
2651 2651 a, g dbSNP:139408145
2652 2652 c, t dbSNP:777640505
2658 2658 g, t dbSNP:757855454
2661 2661 c, t dbSNP:752158447
2668 2668 c, t dbSNP:751892751
2679 2679 c, g dbSNP:764622641
2681 2681 c, t dbSNP:545923015
2686 2686 a, g dbSNP:144158922
2721 2721 a, c dbSNP:372063844
2726 2726 -, a dbSNP:761025138
2729 2729 c, t dbSNP:765291115
2742 2742 a, g dbSNP:759682679
2757 2757 c, t dbSNP:61926077
2766 2766 c, t dbSNP:533032970
2777 2777 a, c dbSNP:771069339
2783 2783 a, g dbSNP:760466255
2788 2788 -, a dbSNP:775677708
2790 2790 a, g dbSNP:760772830
2799 2799 g, t dbSNP:773531870
2802 2802 a, g dbSNP:767203577
2804 2804 c, g dbSNP:139472403
2812 2812 c, t dbSNP:763933429
2833 2833 a, g dbSNP:201838439
2835 2835 c, t dbSNP:373890183
2836 2836 a, g dbSNP:748770166
2840 2840 a, c dbSNP:370592605
2846 2846 c, t dbSNP:141025897
2850 2850 a, g dbSNP:745497913
2867 2867 a, g dbSNP:780969045
2876 2876 c, t dbSNP:758697683
2877 2877 a, g dbSNP:143685061
2882 2882 c, g, t dbSNP:2291550
2894 2894 a, g dbSNP:113544922
2906 2906 c, t dbSNP:780676951
2910 2910 a, g dbSNP:756078959
2914 2914 a, g dbSNP:750529516
2935 2935 a, g dbSNP:781525973
2947 2947 a, t dbSNP:149319186
2952 2952 a, c dbSNP:376874273
2955 2955 c, t dbSNP:763968252
2958 2958 a, g dbSNP:762876194
2961 2961 a, g dbSNP:752514128
2962 2962 a, c dbSNP:765236712
2970 2970 c, t dbSNP:78979794
2971 2971 a, g dbSNP:148752791
3003 3003 a, g dbSNP:374500043
3006 3006 c, t dbSNP:760294059
3027 3027 c, t dbSNP:138700703
3037 3037 -, c dbSNP:777605277
3050 3050 c, t dbSNP:76102634
3061 3061 g, t dbSNP:74839837
3078 3078 c, t dbSNP:387907229
3080 3080 a, g dbSNP:769003781
3081 3081 a, g dbSNP:749668601
3082 3082 a, t dbSNP:201076495
3090 3090 a, g dbSNP:376701259
3093 3093 a, g dbSNP:372020861
3096 3096 a, g dbSNP:369389402
3100 3100 c, t dbSNP:781401356
3115 3115 a, c dbSNP:757471451
3130 3130 c, t dbSNP:754783744
3148 3148 a, g dbSNP:387907210
3149 3149 c, t dbSNP:753767796
3167 3167 c, t dbSNP:766308200
3179 3179 a, g dbSNP:755562764
3197 3197 c, g dbSNP:749956738
3208 3208 c, t dbSNP:767036098
3212 3212 a, t dbSNP:374811560
3221 3221 c, t dbSNP:761506474
3240 3240 a, g dbSNP:773935879
3241 3241 a, g dbSNP:765629988
3257 3257 a, g dbSNP:554189538
3258 3258 c, t dbSNP:190886443
3284 3284 c, t dbSNP:745801825
3287 3287 a, g dbSNP:780998911
3293 3293 c, g dbSNP:144325590
3295 3295 a, g, t dbSNP:182158174
3299 3299 c, t dbSNP:758097449
3303 3303 c, t dbSNP:752450127
3308 3308 c, t dbSNP:377372612
3319 3319 c, g, t dbSNP:201358406
3324 3324 a, g dbSNP:750872710
3329 3329 c, t dbSNP:767919730
3335 3335 c, g dbSNP:761902896
3341 3341 c, t dbSNP:35404804
3344 3344 c, t dbSNP:752156685
3351 3351 c, t dbSNP:764155671
3359 3359 g, t dbSNP:138280089
3366 3366 c, t dbSNP:387907228
3367 3367 a, g dbSNP:387907227
3377 3377 a, g dbSNP:2287626
3384 3384 c, t dbSNP:765467874
3416 3416 c, t dbSNP:759338528
3425 3425 c, t dbSNP:776262076
3429 3429 a, g dbSNP:147895473
3452 3452 c, t dbSNP:746911808
3455 3455 a, c dbSNP:373381644
3480 3480 c, t dbSNP:387907208
3481 3481 a, c, g dbSNP:387907209
3486 3486 a, g dbSNP:747672720
3488 3488 c, t dbSNP:201572736
3499 3499 g, t dbSNP:780799175
3527 3527 c, t dbSNP:752807533
3534 3534 c, t dbSNP:112192000
3540 3540 c, t dbSNP:786205475
3548 3548 a, g dbSNP:765343947
3554 3554 a, c dbSNP:759659676
3559 3559 -, aag dbSNP:747901960
3577 3577 a, g dbSNP:776973456
3592 3592 a, g dbSNP:758873590
3603 3603 a, g dbSNP:753254985
3609 3609 c, t dbSNP:778849288
3610 3610 a, g dbSNP:755156050
3614 3614 a, g dbSNP:199900459
3622 3622 g, t dbSNP:766633076
3626 3626 a, g dbSNP:143316915
3635 3635 c, t dbSNP:17846779
3636 3636 a, t dbSNP:750272556
3641 3641 c, t dbSNP:767458242
3659 3659 a, g dbSNP:761818286
3665 3665 c, t dbSNP:188944145
3670 3670 a, c, g dbSNP:12298510
3671 3671 a, g dbSNP:762538247
3673 3673 a, g dbSNP:774958948
3682 3682 c, t dbSNP:769519614
3688 3688 c, t dbSNP:137907278
3689 3689 a, g dbSNP:146942382
3693 3693 -, t dbSNP:769609857
3694 3694 a, g dbSNP:200876028
3696 3696 c, t dbSNP:749797034
3704 3704 g, t dbSNP:780157680
3710 3710 a, t dbSNP:756318114
3725 3725 c, t dbSNP:576867217
3726 3726 a, g dbSNP:781568971
3727 3727 c, t dbSNP:757069575
3748 3748 c, t dbSNP:751402564
3749 3749 a, c, g dbSNP:140182559
3788 3788 c, t dbSNP:150303433
3790 3790 c, t dbSNP:533543882
3791 3791 a, g dbSNP:759055406
3817 3817 c, t dbSNP:765911298
3851 3851 a, t dbSNP:760351484
3883 3883 c, t dbSNP:772795759
3899 3899 c, t dbSNP:764514204
3907 3907 c, t dbSNP:763230369
3913 3913 a, t dbSNP:750024025
3920 3920 c, t dbSNP:767089303
3924 3924 g, t dbSNP:763337024
3930 3930 a, g dbSNP:59492152
3933 3933 c, t dbSNP:753081604
3934 3934 a, g dbSNP:765744015
3943 3943 a, g dbSNP:143091422
3953 3953 a, g dbSNP:371193643
3960 3960 a, g dbSNP:149077049
3962 3962 a, c dbSNP:777342713
3963 3963 c, t dbSNP:770973803
3966 3966 c, g dbSNP:760679890
3968 3968 c, t dbSNP:368875701
3969 3969 c, g dbSNP:773431560
3975 3975 a, g dbSNP:200499616
3976 3976 g, t dbSNP:748445967
3977 3977 c, t dbSNP:778660636
3979 3979 a, g dbSNP:59663759
3981 3981 c, t dbSNP:768500484
4013 4013 c, t dbSNP:377704379
4014 4014 a, c, g dbSNP:200350065
4029 4029 a, g dbSNP:755593674
4049 4049 c, t dbSNP:557601519
4064 4064 c, t dbSNP:756856961
4082 4082 a, g dbSNP:145005748
4106 4106 a, g dbSNP:777578143
4112 4112 c, t dbSNP:755341471
4113 4113 a, g dbSNP:778634668
4115 4115 a, g dbSNP:766810801
4118 4118 g, t dbSNP:756560119
4121 4121 c, t dbSNP:376991991
4131 4131 a, g dbSNP:747856125
4146 4146 a, g dbSNP:780271535
4164 4164 c, t dbSNP:756571598
4166 4166 a, g dbSNP:374672511
4167 4167 c, t dbSNP:768084482
4170 4170 a, g dbSNP:757279479
4176 4176 c, t dbSNP:751670196
4177 4177 a, g dbSNP:730880035
4178 4178 g, t dbSNP:764206812
4187 4187 a, g, t dbSNP:565927065
4188 4188 c, t dbSNP:764871989
4190 4190 a, c dbSNP:759385607
4197 4197 c, t dbSNP:776379902
4216 4216 -, t dbSNP:730880370
4225 4225 c, g dbSNP:369587958
4251 4251 c, t dbSNP:17846782
4275 4275 c, t dbSNP:369608273
4294 4294 c, g dbSNP:780812024
4309 4309 c, t dbSNP:144125604
4339 4339 c, t dbSNP:767586816
4340 4340 a, g dbSNP:377289768
4342 4342 c, t dbSNP:140448278
4345 4345 c, t dbSNP:763562261
4364 4364 c, t dbSNP:146782703
4372 4372 c, t dbSNP:397517190
4373 4373 c, t dbSNP:771226136
4374 4374 c, g dbSNP:747395248
4375 4375 -, ga dbSNP:766413117
4385 4385 a, g dbSNP:727504785
4409 4409 c, t dbSNP:530506599
4412 4412 c, g dbSNP:371653292
4457 4457 c, t dbSNP:368079660
4460 4460 c, t dbSNP:755085104
4482 4482 a, c dbSNP:76584880
4490 4490 a, g dbSNP:727505001
4491 4491 a, g dbSNP:757007049
4509 4509 c, g dbSNP:751455786
4514 4514 a, g dbSNP:763871855
4532 4532 a, t dbSNP:777591544
4536 4536 c, t dbSNP:397517191
4537 4537 a, g dbSNP:777661095
4540 4540 a, t dbSNP:143619038
4547 4547 c, t dbSNP:758307506
4555 4555 a, g dbSNP:752684723
4557 4557 a, g dbSNP:72559751
4564 4564 g, t dbSNP:754492531
4567 4567 c, t dbSNP:753477110
4575 4575 a, t dbSNP:765973007
4589 4589 -, aaa dbSNP:771500892
4590 4590 a, t dbSNP:139703258
4591 4591 -, ta dbSNP:778425119
4591 4591 a, c, t dbSNP:150631550
4592 4592 -, t, ta dbSNP:761784169
4600 4600 a, g dbSNP:751840926
4611 4611 c, t dbSNP:142875103
4620 4620 c, t dbSNP:763540906
4622 4622 c, t dbSNP:776207326
4623 4623 a, g, t dbSNP:542730918
4624 4624 a, c dbSNP:572721907
4625 4625 c, t dbSNP:771026513
4630 4630 a, g dbSNP:148547035
4633 4633 a, g dbSNP:372859669
4646 4646 c, t dbSNP:771917219
4647 4647 a, c dbSNP:748008984
4649 4649 g, t dbSNP:184056531
4651 4651 c, t dbSNP:754437551
4654 4654 c, t dbSNP:748782303
4656 4656 a, t dbSNP:536847089
4660 4660 c, t dbSNP:387906805
4666 4666 a, g dbSNP:779655875

Target ORF information:

RefSeq Version NM_005691
Organism Homo sapiens (human)
Definition Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 9 (ABCC9), transcript variant SUR2A, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu23823
Accession Version NM_020297.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 4650bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product ATP-binding cassette sub-family C member 9 isoform SUR2B
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK056519.1, AC008250.23, KF459680.1, CA389699.1 and AK092535.1. On Jan 17, 2014 this sequence version replaced gi:110832836. Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein is thought to form ATP-sensitive potassium channels in cardiac, skeletal, and vascular and non-vascular smooth muscle. Protein structure suggests a role as the drug-binding channel-modulating subunit of the extra-pancreatic ATP-sensitive potassium channels. Mutations in this gene are associated with cardiomyopathy dilated type 1O. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2011]. Transcript Variant: This variant (SUR2B) uses an alternate 3' coding exon (exon 38B), compared to variant SUR2A, which uses exon 38A. The encoded isoform (SUR2B) has an alternate 38-amino acid C-terminus, but is the same length as isoform SUR2A. There are no full-length transcripts representing this variant in human; it is supported by partial transcript alignments, by full-length transcript alignments from the homologous mouse and rat genes, and by RT-PCR analysis in PMID:11054556. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##RefSeq-Attributes-START## inferred exon combination :: PMID: 11054556 ##RefSeq-Attributes-END## ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)12..14(+)
Misc Feature(2)111..173(+)
Misc Feature(3)237..299(+)
Misc Feature(4)324..386(+)
Misc Feature(5)417..479(+)
Misc Feature(6)522..584(+)
Misc Feature(7)681..4628(+)
Misc Feature(8)924..986(+)
Misc Feature(9)1071..1133(+)
Misc Feature(10)1113..1775(+)
Misc Feature(11)1290..1352(+)
Misc Feature(12)1386..1448(+)
Misc Feature(13)1614..1676(+)
Misc Feature(14)1734..1796(+)
Misc Feature(15)2034..2687(+)
Misc Feature(16)2133..2156(+)
Misc Feature(17)2142..2633(+)
Misc Feature(18)2280..2291(+)
Misc Feature(19)2454..2483(+)
Misc Feature(20)2514..2531(+)
Misc Feature(21)2538..2549(+)
Misc Feature(22)2619..2639(+)
Misc Feature(23)2991..3053(+)
Misc Feature(24)3000..3818(+)
Misc Feature(25)3123..3185(+)
Misc Feature(26)3402..3464(+)
Misc Feature(27)3756..3818(+)
Misc Feature(28)3948..4667(+)
Misc Feature(29)4056..4079(+)
Misc Feature(30)4065..4535(+)
Misc Feature(31)4191..4202(+)
Misc Feature(32)4365..4394(+)
Misc Feature(33)4425..4442(+)
Misc Feature(34)4449..4460(+)
Misc Feature(35)4521..4541(+)
Exon (1)1..162
Gene Synonym:
Exon (2)163..304
Gene Synonym:
Exon (3)305..426
Gene Synonym:
Exon (4)427..593
Gene Synonym:
Exon (5)594..836
Gene Synonym:
Exon (6)837..1031
Gene Synonym:
Exon (7)1032..1184
Gene Synonym:
Exon (8)1185..1340
Gene Synonym:
Exon (9)1341..1475
Gene Synonym:
Exon (10)1476..1638
Gene Synonym:
Exon (11)1639..1679
Gene Synonym:
Exon (12)1680..1822
Gene Synonym:
Exon (13)1823..1931
Gene Synonym:
Exon (14)1932..2039
Gene Synonym:
Exon (15)2040..2112
Gene Synonym:
Exon (16)2113..2218
Gene Synonym:
Exon (17)2219..2257
Gene Synonym:
Exon (18)2258..2359
Gene Synonym:
Exon (19)2360..2444
Gene Synonym:
Exon (20)2445..2525
Gene Synonym:
Exon (21)2526..2663
Gene Synonym:
Exon (22)2664..2789
Gene Synonym:
Exon (23)2790..2886
Gene Synonym:
Exon (24)2887..3116
Gene Synonym:
Exon (25)3117..3265
Gene Synonym:
Exon (26)3266..3335
Gene Synonym:
Exon (27)3336..3493
Gene Synonym:
Exon (28)3494..3586
Gene Synonym:
Exon (29)3587..3689
Gene Synonym:
Exon (30)3690..3791
Gene Synonym:
Exon (31)3792..3912
Gene Synonym:
Exon (32)3913..4043
Gene Synonym:
Exon (33)4044..4122
Gene Synonym:
Exon (34)4123..4231
Gene Synonym:
Exon (35)4232..4335
Gene Synonym:
Exon (36)4336..4469
Gene Synonym:
Exon (37)4470..4532
Gene Synonym:
Exon (38)4533..8325
Gene Synonym:
Position Chain Variation Link
4 4 a, g dbSNP:538242067
7 7 -, ccatata dbSNP:746420722
10 10 c, t dbSNP:72559432
12 12 c, t dbSNP:370067847
18 18 a, g dbSNP:775391004
21 21 -, a dbSNP:774663798
26 26 c, t dbSNP:765382139
38 38 c, t dbSNP:759586176
46 46 a, g dbSNP:776881654
55 55 c, t dbSNP:766371743
57 57 c, t dbSNP:771346551
67 67 a, g dbSNP:727502877
68 68 c, t dbSNP:199631710
69 69 a, g dbSNP:772070154
78 78 c, t dbSNP:375713309
95 95 c, t dbSNP:201972673
96 96 a, g dbSNP:754476885
97 97 c, t dbSNP:748812668
108 108 a, g dbSNP:779664751
116 116 c, t dbSNP:727505034
122 122 a, c, t dbSNP:778139798
132 132 c, t dbSNP:375739359
150 150 a, g dbSNP:750233555
179 179 c, t dbSNP:779463030
186 186 a, g dbSNP:749597050
189 189 c, t dbSNP:727502876
192 192 -, a dbSNP:756155004
194 194 c, t dbSNP:753906607
198 198 c, t dbSNP:387907230
220 220 c, t dbSNP:766600615
221 221 a, g dbSNP:769322587
223 223 a, g dbSNP:760934600
235 235 a, g dbSNP:369409311
247 247 c, g dbSNP:745330137
251 251 c, t dbSNP:767694387
269 269 c, t dbSNP:761653519
276 276 c, g dbSNP:774026262
286 286 a, g dbSNP:199508243
304 304 c, t dbSNP:376432144
306 306 c, t dbSNP:373792254
307 307 a, g dbSNP:202103893
309 309 c, t dbSNP:727502875
310 310 a, g dbSNP:778951072
311 311 a, g dbSNP:759034996
325 325 c, t dbSNP:374659816
344 344 c, t dbSNP:770552940
345 345 a, g dbSNP:374849789
349 349 a, t dbSNP:774731983
350 350 a, g dbSNP:267603425
356 356 c, t dbSNP:769123978
357 357 a, g dbSNP:200723629
363 363 a, g dbSNP:780689866
374 374 a, g dbSNP:189582135
375 375 a, g dbSNP:745873108
391 391 a, g dbSNP:781160274
392 392 c, t dbSNP:377384557
401 401 a, g dbSNP:377696872
411 411 c, t dbSNP:751708268
415 415 a, g dbSNP:727505161
421 421 a, t dbSNP:764416164
422 422 c, t dbSNP:758185120
431 431 a, g, t dbSNP:368753369
440 440 c, t dbSNP:397517189
449 449 a, g dbSNP:759985677
457 457 a, t dbSNP:149325742
477 477 a, g dbSNP:771527727
487 487 a, g dbSNP:754918275
500 500 a, g dbSNP:747004107
503 503 c, t dbSNP:777836104
517 517 a, g dbSNP:772244404
531 531 a, g dbSNP:748393474
532 532 c, g dbSNP:779159910
538 538 c, t dbSNP:529337366
539 539 g, t dbSNP:567173040
585 585 c, t dbSNP:779793300
587 587 a, t dbSNP:756079711
595 595 a, g dbSNP:727504612
596 596 a, t dbSNP:779927466
599 599 c, t dbSNP:755954331
600 600 a, g dbSNP:745776787
629 629 a, g dbSNP:139669232
632 632 g, t dbSNP:375789756
640 640 a, g dbSNP:182537028
650 650 c, t dbSNP:751172494
684 684 c, t dbSNP:763596073
689 689 g, t dbSNP:17846788
703 703 a, c dbSNP:200336305
710 710 -, tgg dbSNP:779955645
733 733 c, t dbSNP:746018912
748 748 c, t dbSNP:754113599
754 754 c, t dbSNP:766792143
763 763 c, t dbSNP:760997956
784 784 c, t dbSNP:150627958
809 809 c, t dbSNP:58386780
810 810 c, t dbSNP:761820569
814 814 a, g dbSNP:774415124
818 818 c, t dbSNP:138356189
829 829 a, c dbSNP:145774770
840 840 a, g dbSNP:776572382
846 846 a, g dbSNP:201783967
861 861 c, t dbSNP:746967404
862 862 a, g dbSNP:753456211
863 863 g, t dbSNP:547213635
866 866 g, t dbSNP:747683989
872 872 a, t dbSNP:113562970
873 873 a, g, t dbSNP:370662364
882 882 g, t dbSNP:781555751
887 887 a, g dbSNP:757665666
889 889 a, t dbSNP:752072949
902 902 a, g dbSNP:764574133
904 904 a, g dbSNP:763074253
905 905 a, g dbSNP:368276490
914 914 a, g dbSNP:765489183
920 920 c, t dbSNP:759869766
927 927 c, t dbSNP:776519364
928 928 c, t dbSNP:200207117
931 931 a, g dbSNP:770829231
938 938 a, g dbSNP:142115849
944 944 c, t dbSNP:139127928
947 947 a, g dbSNP:548380877
948 948 c, t dbSNP:747640613
957 957 a, g dbSNP:778313829
968 968 -, tt dbSNP:771232310
977 977 c, t dbSNP:768245158
979 979 a, g dbSNP:200272254
989 989 a, g dbSNP:748914473
990 990 c, t dbSNP:779720018
1010 1010 c, t dbSNP:757612560
1018 1018 a, t dbSNP:531754904
1028 1028 c, t dbSNP:778283866
1033 1033 c, t dbSNP:756300282
1043 1043 c, g dbSNP:369597360
1046 1046 c, t dbSNP:750197446
1055 1055 a, g dbSNP:72559752
1070 1070 c, t dbSNP:143373045
1071 1071 g, t dbSNP:375758521
1076 1076 c, t dbSNP:149408382
1083 1083 g, t dbSNP:145455570
1102 1102 c, g dbSNP:762383594
1132 1132 c, g dbSNP:774995037
1139 1139 c, g dbSNP:769439725
1142 1142 c, t dbSNP:745536995
1147 1147 c, t dbSNP:372244832
1149 1149 a, g dbSNP:567016348
1150 1150 c, t dbSNP:368908490
1162 1162 a, t dbSNP:397517181
1167 1167 c, t dbSNP:755542764
1170 1170 c, t dbSNP:749318820
1171 1171 a, g dbSNP:374574602
1195 1195 a, g, t dbSNP:370918215
1217 1217 a, t dbSNP:769232379
1219 1219 a, c dbSNP:749786076
1220 1220 a, g dbSNP:150096625
1232 1232 c, t dbSNP:376726505
1233 1233 a, g dbSNP:142038412
1271 1271 c, t dbSNP:746029351
1272 1272 a, g dbSNP:781206225
1273 1273 c, t dbSNP:147580701
1293 1293 -, at dbSNP:753555698
1294 1294 c, t dbSNP:751307815
1298 1298 g, t dbSNP:777576366
1315 1315 a, c dbSNP:758229885
1316 1316 c, t dbSNP:10770865
1326 1326 a, g dbSNP:765275705
1332 1332 a, c dbSNP:758962407
1340 1340 c, g dbSNP:753391218
1342 1342 a, t dbSNP:765941070
1343 1343 c, g dbSNP:755739683
1349 1349 a, g dbSNP:151197166
1352 1352 c, t dbSNP:369830406
1361 1361 a, g dbSNP:763346044
1378 1378 c, g dbSNP:397517183
1384 1384 c, g dbSNP:775938318
1394 1394 c, t dbSNP:200819464
1401 1401 c, g dbSNP:374535641
1416 1416 c, t dbSNP:555340137
1418 1418 c, t dbSNP:368698007
1420 1420 c, t dbSNP:770976719
1421 1421 a, g dbSNP:142219855
1436 1436 c, t dbSNP:777308898
1445 1445 a, g dbSNP:772284924
1453 1453 c, t dbSNP:387907211
1471 1471 c, t dbSNP:747837398
1493 1493 a, g dbSNP:777181850
1505 1505 a, g dbSNP:751828406
1549 1549 a, g dbSNP:766936591
1554 1554 c, t dbSNP:368128251
1565 1565 c, t dbSNP:760680023
1574 1574 a, g dbSNP:773290634
1577 1577 a, g dbSNP:143346402
1598 1598 a, g dbSNP:748429545
1607 1607 c, g dbSNP:570095510
1622 1622 a, g dbSNP:768487549
1623 1623 c, t dbSNP:397517184
1629 1629 a, t dbSNP:780072385
1658 1658 a, c, t dbSNP:370463895
1678 1678 -, c dbSNP:766870789
1691 1691 c, t dbSNP:746467455
1696 1696 c, t dbSNP:772619542
1697 1697 a, g dbSNP:76458291
1709 1709 a, g dbSNP:747765299
1751 1751 c, g dbSNP:778581244
1763 1763 a, g dbSNP:777049470
1790 1790 a, g dbSNP:746239063
1793 1793 a, g dbSNP:781684241
1823 1823 c, t dbSNP:773930785
1837 1837 a, c, g dbSNP:149229372
1848 1848 -, tt dbSNP:776934642
1868 1868 c, t dbSNP:61001398
1869 1869 a, g dbSNP:757681761
1879 1879 a, g dbSNP:139539832
1883 1883 c, t dbSNP:577810106
1894 1894 c, t dbSNP:75460545
1895 1895 a, g dbSNP:727502873
1899 1899 c, g dbSNP:367770980
1907 1907 g, t dbSNP:150036969
1922 1922 c, t dbSNP:753627514
1929 1929 a, g dbSNP:113542001
1934 1934 a, g dbSNP:565125768
1941 1941 a, g dbSNP:755145193
1946 1946 a, g dbSNP:552092424
1947 1947 a, c dbSNP:138890128
1958 1958 a, g dbSNP:755853969
1959 1959 c, g, t dbSNP:767396331
1962 1962 a, c, g dbSNP:368279608
1963 1963 a, g dbSNP:763573197
1968 1968 c, t dbSNP:762583015
1975 1975 g, t dbSNP:775002315
1992 1992 c, t dbSNP:769493004
1998 1998 c, t dbSNP:760889253
1999 1999 a, g dbSNP:150255709
2001 2001 c, t dbSNP:199499109
2002 2002 a, g dbSNP:397517185
2006 2006 a, g dbSNP:779609498
2007 2007 c, t dbSNP:200349671
2008 2008 a, g dbSNP:141999048
2012 2012 c, t dbSNP:780071007
2013 2013 a, g dbSNP:200891785
2020 2020 a, c, t dbSNP:397517186
2021 2021 a, g dbSNP:549032386
2022 2022 a, g dbSNP:757093666
2024 2024 a, g dbSNP:751485829
2025 2025 a, c, g dbSNP:762304330
2050 2050 g, t dbSNP:777631521
2060 2060 a, c dbSNP:758381330
2065 2065 a, g dbSNP:752106985
2070 2070 a, g dbSNP:148174226
2086 2086 c, t dbSNP:200288646
2087 2087 a, c dbSNP:754495447
2090 2090 c, t dbSNP:753524629
2092 2092 c, t dbSNP:766197122
2101 2101 a, g dbSNP:267603424
2106 2106 c, t dbSNP:183603557
2110 2110 c, g dbSNP:764471784
2117 2117 a, g dbSNP:546978327
2121 2121 -, c dbSNP:371525457
2122 2122 a, c dbSNP:763289280
2124 2124 -, a dbSNP:772110955
2132 2132 c, g dbSNP:756409292
2141 2141 a, t dbSNP:765667189
2169 2169 a, g dbSNP:397517187
2174 2174 c, t dbSNP:74067815
2175 2175 c, t dbSNP:141925577
2177 2177 c, t dbSNP:201848437
2178 2178 a, g dbSNP:542184069
2191 2191 c, t dbSNP:773355490
2210 2210 a, c dbSNP:771887289
2211 2211 c, g, t dbSNP:367621959
2217 2217 a, g dbSNP:369604693
2220 2220 a, g dbSNP:61688134
2232 2232 a, g dbSNP:202054255
2234 2234 a, g dbSNP:749218661
2235 2235 c, g dbSNP:201223488
2242 2242 c, t dbSNP:146944210
2252 2252 c, t dbSNP:769428584
2257 2257 a, g dbSNP:745375583
2262 2262 a, g dbSNP:777459907
2265 2265 a, t dbSNP:755331988
2271 2271 a, t dbSNP:375322301
2282 2282 c, t dbSNP:145561881
2288 2288 g, t dbSNP:780477165
2291 2291 a, g dbSNP:756598798
2295 2295 c, t dbSNP:538520169
2310 2310 a, g dbSNP:750474414
2311 2311 c, t dbSNP:767475566
2313 2313 a, g dbSNP:757419477
2320 2320 a, g dbSNP:751831174
2324 2324 a, g dbSNP:764419953
2332 2332 c, t dbSNP:180739851
2335 2335 c, t dbSNP:775448788
2351 2351 c, t dbSNP:765227350
2363 2363 c, t dbSNP:758726580
2377 2377 a, g dbSNP:753010015
2384 2384 c, t dbSNP:764916922
2388 2388 c, t dbSNP:759432313
2389 2389 c, t dbSNP:555127853
2395 2395 c, t dbSNP:753713460
2405 2405 c, t dbSNP:766344568
2412 2412 a, c dbSNP:760116129
2429 2429 a, t dbSNP:772727573
2437 2437 a, g dbSNP:771669791
2438 2438 a, t dbSNP:761421687
2462 2462 a, g dbSNP:747498785
2463 2463 a, g, t dbSNP:267603423
2468 2468 a, g dbSNP:772272069
2475 2475 a, g dbSNP:748239152
2480 2480 c, t dbSNP:778941231
2481 2481 a, t dbSNP:755251666
2485 2485 c, t dbSNP:748996561
2490 2490 a, c dbSNP:779866340
2491 2491 a, g dbSNP:755951253
2495 2495 a, g, t dbSNP:587780845
2507 2507 c, t dbSNP:756699664
2515 2515 c, t dbSNP:542818695
2519 2519 a, c dbSNP:751103892
2520 2520 c, t dbSNP:367776754
2523 2523 -, ttg dbSNP:776927430
2526 2526 a, g dbSNP:764983816
2531 2531 c, t dbSNP:761059899
2543 2543 c, t dbSNP:144537241
2574 2574 c, t dbSNP:193922683
2591 2591 a, g dbSNP:762350069
2600 2600 a, g dbSNP:774768881
2602 2602 a, c dbSNP:776565800
2606 2606 c, g dbSNP:768765531
2608 2608 a, g dbSNP:111943197
2619 2619 a, g dbSNP:376754153
2627 2627 a, g dbSNP:762524104
2633 2633 c, t dbSNP:373909378
2636 2636 a, g dbSNP:745622324
2642 2642 a, g dbSNP:780938779
2650 2650 c, t dbSNP:140872303
2651 2651 a, g dbSNP:139408145
2652 2652 c, t dbSNP:777640505
2658 2658 g, t dbSNP:757855454
2661 2661 c, t dbSNP:752158447
2668 2668 c, t dbSNP:751892751
2679 2679 c, g dbSNP:764622641
2681 2681 c, t dbSNP:545923015
2686 2686 a, g dbSNP:144158922
2721 2721 a, c dbSNP:372063844
2726 2726 -, a dbSNP:761025138
2729 2729 c, t dbSNP:765291115
2742 2742 a, g dbSNP:759682679
2757 2757 c, t dbSNP:61926077
2766 2766 c, t dbSNP:533032970
2777 2777 a, c dbSNP:771069339
2783 2783 a, g dbSNP:760466255
2788 2788 -, a dbSNP:775677708
2790 2790 a, g dbSNP:760772830
2799 2799 g, t dbSNP:773531870
2802 2802 a, g dbSNP:767203577
2804 2804 c, g dbSNP:139472403
2812 2812 c, t dbSNP:763933429
2833 2833 a, g dbSNP:201838439
2835 2835 c, t dbSNP:373890183
2836 2836 a, g dbSNP:748770166
2840 2840 a, c dbSNP:370592605
2846 2846 c, t dbSNP:141025897
2850 2850 a, g dbSNP:745497913
2867 2867 a, g dbSNP:780969045
2876 2876 c, t dbSNP:758697683
2877 2877 a, g dbSNP:143685061
2882 2882 c, g, t dbSNP:2291550
2894 2894 a, g dbSNP:113544922
2906 2906 c, t dbSNP:780676951
2910 2910 a, g dbSNP:756078959
2914 2914 a, g dbSNP:750529516
2935 2935 a, g dbSNP:781525973
2947 2947 a, t dbSNP:149319186
2952 2952 a, c dbSNP:376874273
2955 2955 c, t dbSNP:763968252
2958 2958 a, g dbSNP:762876194
2961 2961 a, g dbSNP:752514128
2962 2962 a, c dbSNP:765236712
2970 2970 c, t dbSNP:78979794
2971 2971 a, g dbSNP:148752791
3003 3003 a, g dbSNP:374500043
3006 3006 c, t dbSNP:760294059
3027 3027 c, t dbSNP:138700703
3037 3037 -, c dbSNP:777605277
3050 3050 c, t dbSNP:76102634
3061 3061 g, t dbSNP:74839837
3078 3078 c, t dbSNP:387907229
3080 3080 a, g dbSNP:769003781
3081 3081 a, g dbSNP:749668601
3082 3082 a, t dbSNP:201076495
3090 3090 a, g dbSNP:376701259
3093 3093 a, g dbSNP:372020861
3096 3096 a, g dbSNP:369389402
3100 3100 c, t dbSNP:781401356
3115 3115 a, c dbSNP:757471451
3130 3130 c, t dbSNP:754783744
3148 3148 a, g dbSNP:387907210
3149 3149 c, t dbSNP:753767796
3167 3167 c, t dbSNP:766308200
3179 3179 a, g dbSNP:755562764
3197 3197 c, g dbSNP:749956738
3208 3208 c, t dbSNP:767036098
3212 3212 a, t dbSNP:374811560
3221 3221 c, t dbSNP:761506474
3240 3240 a, g dbSNP:773935879
3241 3241 a, g dbSNP:765629988
3257 3257 a, g dbSNP:554189538
3258 3258 c, t dbSNP:190886443
3284 3284 c, t dbSNP:745801825
3287 3287 a, g dbSNP:780998911
3293 3293 c, g dbSNP:144325590
3295 3295 a, g, t dbSNP:182158174
3299 3299 c, t dbSNP:758097449
3303 3303 c, t dbSNP:752450127
3308 3308 c, t dbSNP:377372612
3319 3319 c, g, t dbSNP:201358406
3324 3324 a, g dbSNP:750872710
3329 3329 c, t dbSNP:767919730
3335 3335 c, g dbSNP:761902896
3341 3341 c, t dbSNP:35404804
3344 3344 c, t dbSNP:752156685
3351 3351 c, t dbSNP:764155671
3359 3359 g, t dbSNP:138280089
3366 3366 c, t dbSNP:387907228
3367 3367 a, g dbSNP:387907227
3377 3377 a, g dbSNP:2287626
3384 3384 c, t dbSNP:765467874
3416 3416 c, t dbSNP:759338528
3425 3425 c, t dbSNP:776262076
3429 3429 a, g dbSNP:147895473
3452 3452 c, t dbSNP:746911808
3455 3455 a, c dbSNP:373381644
3480 3480 c, t dbSNP:387907208
3481 3481 a, c, g dbSNP:387907209
3486 3486 a, g dbSNP:747672720
3488 3488 c, t dbSNP:201572736
3499 3499 g, t dbSNP:780799175
3527 3527 c, t dbSNP:752807533
3534 3534 c, t dbSNP:112192000
3540 3540 c, t dbSNP:786205475
3548 3548 a, g dbSNP:765343947
3554 3554 a, c dbSNP:759659676
3559 3559 -, aag dbSNP:747901960
3577 3577 a, g dbSNP:776973456
3592 3592 a, g dbSNP:758873590
3603 3603 a, g dbSNP:753254985
3609 3609 c, t dbSNP:778849288
3610 3610 a, g dbSNP:755156050
3614 3614 a, g dbSNP:199900459
3622 3622 g, t dbSNP:766633076
3626 3626 a, g dbSNP:143316915
3635 3635 c, t dbSNP:17846779
3636 3636 a, t dbSNP:750272556
3641 3641 c, t dbSNP:767458242
3659 3659 a, g dbSNP:761818286
3665 3665 c, t dbSNP:188944145
3670 3670 a, c, g dbSNP:12298510
3671 3671 a, g dbSNP:762538247
3673 3673 a, g dbSNP:774958948
3682 3682 c, t dbSNP:769519614
3688 3688 c, t dbSNP:137907278
3689 3689 a, g dbSNP:146942382
3693 3693 -, t dbSNP:769609857
3694 3694 a, g dbSNP:200876028
3696 3696 c, t dbSNP:749797034
3704 3704 g, t dbSNP:780157680
3710 3710 a, t dbSNP:756318114
3725 3725 c, t dbSNP:576867217
3726 3726 a, g dbSNP:781568971
3727 3727 c, t dbSNP:757069575
3748 3748 c, t dbSNP:751402564
3749 3749 a, c, g dbSNP:140182559
3788 3788 c, t dbSNP:150303433
3790 3790 c, t dbSNP:533543882
3791 3791 a, g dbSNP:759055406
3817 3817 c, t dbSNP:765911298
3851 3851 a, t dbSNP:760351484
3883 3883 c, t dbSNP:772795759
3899 3899 c, t dbSNP:764514204
3907 3907 c, t dbSNP:763230369
3913 3913 a, t dbSNP:750024025
3920 3920 c, t dbSNP:767089303
3924 3924 g, t dbSNP:763337024
3930 3930 a, g dbSNP:59492152
3933 3933 c, t dbSNP:753081604
3934 3934 a, g dbSNP:765744015
3943 3943 a, g dbSNP:143091422
3953 3953 a, g dbSNP:371193643
3960 3960 a, g dbSNP:149077049
3962 3962 a, c dbSNP:777342713
3963 3963 c, t dbSNP:770973803
3966 3966 c, g dbSNP:760679890
3968 3968 c, t dbSNP:368875701
3969 3969 c, g dbSNP:773431560
3975 3975 a, g dbSNP:200499616
3976 3976 g, t dbSNP:748445967
3977 3977 c, t dbSNP:778660636
3979 3979 a, g dbSNP:59663759
3981 3981 c, t dbSNP:768500484
4013 4013 c, t dbSNP:377704379
4014 4014 a, c, g dbSNP:200350065
4029 4029 a, g dbSNP:755593674
4049 4049 c, t dbSNP:557601519
4064 4064 c, t dbSNP:756856961
4082 4082 a, g dbSNP:145005748
4106 4106 a, g dbSNP:777578143
4112 4112 c, t dbSNP:755341471
4113 4113 a, g dbSNP:778634668
4115 4115 a, g dbSNP:766810801
4118 4118 g, t dbSNP:756560119
4121 4121 c, t dbSNP:376991991
4131 4131 a, g dbSNP:747856125
4146 4146 a, g dbSNP:780271535
4164 4164 c, t dbSNP:756571598
4166 4166 a, g dbSNP:374672511
4167 4167 c, t dbSNP:768084482
4170 4170 a, g dbSNP:757279479
4176 4176 c, t dbSNP:751670196
4177 4177 a, g dbSNP:730880035
4178 4178 g, t dbSNP:764206812
4187 4187 a, g, t dbSNP:565927065
4188 4188 c, t dbSNP:764871989
4190 4190 a, c dbSNP:759385607
4197 4197 c, t dbSNP:776379902
4216 4216 -, t dbSNP:730880370
4225 4225 c, g dbSNP:369587958
4251 4251 c, t dbSNP:17846782
4275 4275 c, t dbSNP:369608273
4294 4294 c, g dbSNP:780812024
4309 4309 c, t dbSNP:144125604
4339 4339 c, t dbSNP:767586816
4340 4340 a, g dbSNP:377289768
4342 4342 c, t dbSNP:140448278
4345 4345 c, t dbSNP:763562261
4364 4364 c, t dbSNP:146782703
4372 4372 c, t dbSNP:397517190
4373 4373 c, t dbSNP:771226136
4374 4374 c, g dbSNP:747395248
4375 4375 -, ga dbSNP:766413117
4385 4385 a, g dbSNP:727504785
4409 4409 c, t dbSNP:530506599
4412 4412 c, g dbSNP:371653292
4457 4457 c, t dbSNP:368079660
4460 4460 c, t dbSNP:755085104
4482 4482 a, c dbSNP:76584880
4490 4490 a, g dbSNP:727505001
4491 4491 a, g dbSNP:757007049
4509 4509 c, g dbSNP:751455786
4514 4514 a, g dbSNP:763871855
4532 4532 a, t dbSNP:777591544
4539 4539 a, g dbSNP:747962000
4547 4547 c, t dbSNP:774236898
4555 4555 c, t dbSNP:554811993
4556 4556 a, g dbSNP:186493048
4557 4557 a, g dbSNP:121909304
4589 4589 c, t dbSNP:727504538
4591 4591 g, t dbSNP:755718495
4600 4600 a, c dbSNP:78275359
4606 4606 c, t dbSNP:568984710
4614 4614 a, g dbSNP:781012885
4615 4615 c, g dbSNP:373396917
4629 4629 a, g dbSNP:149722127
4636 4636 a, g dbSNP:753079722
4640 4640 a, g dbSNP:765745602
4644 4644 c, g dbSNP:147521845
4653 4653 a, g dbSNP:755422776
4656 4656 a, c, t dbSNP:766300688
4657 4657 a, g, t dbSNP:773377070
4658 4658 a, c, t dbSNP:143310355
4677 4677 a, g dbSNP:180770035
4688 4688 -, ataca dbSNP:753102079
4689 4689 c, t dbSNP:114906131
4692 4692 a, g dbSNP:376736105
4693 4693 c, t dbSNP:767798962
4696 4696 a, g dbSNP:762798124
4698 4698 c, t dbSNP:775503041
4714 4714 a, g dbSNP:769135819
4718 4718 a, c dbSNP:370423028
4727 4727 c, t dbSNP:772458579
4730 4730 a, g dbSNP:768172354
4759 4759 a, t dbSNP:566226557
4773 4773 a, c dbSNP:188290333
4817 4817 a, g dbSNP:529676218
4822 4822 a, g dbSNP:560738082
4833 4833 c, t dbSNP:772916231
4853 4853 a, c dbSNP:762319597
4880 4880 c, t dbSNP:146747782
4961 4961 -, cct dbSNP:759257927
4966 4966 c, g dbSNP:769057774
4987 4987 c, t dbSNP:143461880
4995 4995 c, t dbSNP:565439540
5019 5019 -, c dbSNP:34599737
5026 5026 c, t dbSNP:529983576
5071 5071 a, g dbSNP:545611317
5072 5072 c, g dbSNP:573526157
5080 5080 c, t dbSNP:139937898
5096 5096 g, t dbSNP:553485421
5146 5146 c, t dbSNP:73253073
5189 5189 c, g dbSNP:1283784
5191 5191 a, g dbSNP:779707625
5242 5242 -, acttat dbSNP:776330173
5247 5247 g, t dbSNP:377734952
5270 5270 c, t dbSNP:769400461
5306 5306 c, t dbSNP:111647146
5313 5313 a, g dbSNP:538101784
5341 5341 g, t dbSNP:141707120
5413 5413 a, c dbSNP:558468396
5439 5439 a, t dbSNP:538424676
5446 5446 a, g dbSNP:148416760
5520 5520 a, t dbSNP:757201191
5521 5521 c, g dbSNP:184578911
5528 5528 c, t dbSNP:377351174
5537 5537 a, g dbSNP:567207145
5552 5552 g, t dbSNP:374294612
5608 5608 c, g dbSNP:144446899
5635 5635 a, t dbSNP:530571057
5650 5650 c, t dbSNP:556786098
5708 5708 a, c dbSNP:777470921
5710 5710 a, c dbSNP:533809571
5711 5711 a, t dbSNP:829063
5716 5716 a, g dbSNP:545746533
5740 5740 a, g dbSNP:752490822
5741 5741 a, t dbSNP:149235644
5747 5747 c, t dbSNP:560007812
5753 5753 a, g dbSNP:543059003
5781 5781 a, g dbSNP:755412780
5881 5881 g, t dbSNP:574057853
5884 5884 a, t dbSNP:557468594
5887 5887 c, t dbSNP:192888616
5888 5888 a, g dbSNP:113307208
5930 5930 a, g dbSNP:139370710
5935 5935 -, t dbSNP:201459464
5987 5987 a, t dbSNP:111349057
6042 6042 c, t dbSNP:572654650
6113 6113 c, t dbSNP:552770923
6127 6127 c, t dbSNP:536310131
6131 6131 c, t dbSNP:568030925
6137 6137 c, t dbSNP:567232093
6161 6161 a, g dbSNP:144076013
6171 6171 g, t dbSNP:369206463
6199 6199 -, c dbSNP:201058622
6199 6199 c, t dbSNP:374848925
6269 6269 g, t dbSNP:571301597
6319 6319 a, c dbSNP:562434394
6441 6441 c, t dbSNP:552060160
6442 6442 -, c dbSNP:368512533
6454 6454 -, t dbSNP:542776471
6454 6454 -, t dbSNP:536748638
6466 6466 a, t dbSNP:79202780
6484 6484 a, c dbSNP:749749700
6487 6487 a, g dbSNP:547742628
6520 6520 c, t dbSNP:138502719
6521 6521 a, g dbSNP:853287
6648 6648 c, t dbSNP:559954690
6653 6653 a, g dbSNP:549296581
6683 6683 a, c dbSNP:529521421
6699 6699 a, g dbSNP:563629259
6704 6704 g, t dbSNP:12817966
6705 6705 g, t dbSNP:12817799
6720 6720 c, t dbSNP:12817793
6726 6726 a, t dbSNP:12817648
6742 6742 a, g dbSNP:12819187
6817 6817 c, g dbSNP:543937055
6843 6843 c, t dbSNP:577575158
6944 6944 -, atttatagtcatttgggtatatacccagtaatgggatggctgggtcaa atggtatttctagttctagatccctgaggaatcgccacactgacttccacaatggtta aactaaagagcttctgcacagcaaaagaaactacca dbSNP:72488364
7017 7017 a, g dbSNP:564143229
7083 7083 c, t dbSNP:185196180
7102 7102 a, c dbSNP:113290058
7110 7110 a, c dbSNP:1283785
7131 7131 a, c dbSNP:553265702
7156 7156 a, g dbSNP:536035901
7197 7197 -, aaac dbSNP:542427716
7210 7210 c, t dbSNP:369176373
7260 7260 cc, tt dbSNP:386761109
7388 7388 a, c dbSNP:556769480
7397 7397 c, t dbSNP:369061303
7471 7471 a, g dbSNP:16924306
7529 7529 a, g dbSNP:531213423
7534 7534 a, g dbSNP:551414448
7540 7540 c, g dbSNP:562553615
7541 7541 c, t dbSNP:117295320
7581 7581 c, t dbSNP:192230600
7582 7582 c, t dbSNP:529456721
7595 7595 a, c dbSNP:76760708
7677 7677 a, t dbSNP:549960647
7681 7681 g, t dbSNP:375761017
7719 7719 a, g dbSNP:187601904
7758 7758 a, t dbSNP:543641134
7777 7777 a, c dbSNP:564104583
7822 7822 a, g dbSNP:541010005
7866 7866 a, g dbSNP:760914059
7883 7883 a, g dbSNP:572134351
7905 7905 a, g dbSNP:750479448
7922 7922 a, t dbSNP:767618165
7933 7933 a, g dbSNP:113907773
7947 7947 a, g dbSNP:558235598
7950 7950 a, g dbSNP:11835091
7972 7972 c, g dbSNP:573711742
7984 7984 a, c dbSNP:116542036
8015 8015 a, g dbSNP:543511314
8053 8053 c, t dbSNP:11832676
8054 8054 a, g, t dbSNP:557916578
8070 8070 c, t dbSNP:750524732
8083 8083 c, t dbSNP:143249920
8096 8096 c, t dbSNP:183248049
8110 8110 a, t dbSNP:763342592
8114 8114 c, t dbSNP:767755085
8123 8123 c, t dbSNP:555743723
8153 8153 -, gcctat dbSNP:200165311
8158 8158 a, t dbSNP:775765922
8211 8211 c, t dbSNP:78132170
8215 8215 c, t dbSNP:113837759
8234 8234 g, t dbSNP:570121349
8242 8242 a, c dbSNP:535871170
8262 8262 a, t dbSNP:550364029
8279 8279 a, t dbSNP:769453825

Target ORF information:

RefSeq Version NM_020297
Organism Homo sapiens (human)
Definition Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 9 (ABCC9), transcript variant SUR2B, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu23823
Accession Version XM_005253284.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 4650bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product ATP-binding cassette sub-family C member 9 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_009714.18) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 3, 2014 this sequence version replaced gi:530398961. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)1461..5408(+)
Misc Feature(2)1893..2555(+)
Misc Feature(3)2814..3467(+)
Misc Feature(4)2913..2936(+)
Misc Feature(5)2922..3413(+)
Misc Feature(6)3060..3071(+)
Misc Feature(7)3234..3263(+)
Misc Feature(8)3294..3311(+)
Misc Feature(9)3318..3329(+)
Misc Feature(10)3399..3419(+)
Misc Feature(11)3780..4598(+)
Misc Feature(12)4728..5447(+)
Misc Feature(13)4836..4859(+)
Misc Feature(14)4845..5315(+)
Misc Feature(15)4971..4982(+)
Misc Feature(16)5145..5174(+)
Misc Feature(17)5205..5222(+)
Misc Feature(18)5229..5240(+)
Misc Feature(19)5301..5321(+)
Position Chain Variation Link
42 42 c, t dbSNP:761447060
45 45 a, c dbSNP:370837883
48 48 a, g dbSNP:558443727
88 88 c, t dbSNP:538958629
89 89 a, g dbSNP:773996407
98 98 c, t dbSNP:71530931
110 110 c, t dbSNP:578174630
112 112 -, t dbSNP:752782487
135 135 a, g dbSNP:775452709
156 156 a, g, t dbSNP:377665031
202 202 c, t dbSNP:535855280
207 207 -, a dbSNP:760634218
276 276 a, g dbSNP:566889968
298 298 a, g dbSNP:564607245
304 304 c, g dbSNP:778112034
320 320 a, t dbSNP:78945871
324 324 a, g dbSNP:530501911
479 479 c, g dbSNP:565510961
507 507 a, g dbSNP:758542310
525 525 c, t dbSNP:369545931
527 527 c, t dbSNP:376798610
537 537 a, c dbSNP:373413846
542 542 c, t dbSNP:551676395
551 551 a, g dbSNP:528830362
576 576 a, g dbSNP:541125722
597 597 a, c dbSNP:560089127
613 613 a, t dbSNP:190918271
644 644 a, c, g dbSNP:574095874
675 675 a, t dbSNP:778905864
695 695 c, t dbSNP:755497608
714 714 c, t dbSNP:371630785
740 740 c, t dbSNP:754302636
744 744 c, g dbSNP:758078002
779 779 a, g dbSNP:766765272
784 784 a, g dbSNP:538242067
787 787 -, ccatata dbSNP:746420722
790 790 c, t dbSNP:72559432
792 792 c, t dbSNP:370067847
798 798 a, g dbSNP:775391004
801 801 -, a dbSNP:774663798
806 806 c, t dbSNP:765382139
818 818 c, t dbSNP:759586176
826 826 a, g dbSNP:776881654
835 835 c, t dbSNP:766371743
837 837 c, t dbSNP:771346551
847 847 a, g dbSNP:727502877
848 848 c, t dbSNP:199631710
849 849 a, g dbSNP:772070154
858 858 c, t dbSNP:375713309
875 875 c, t dbSNP:201972673
876 876 a, g dbSNP:754476885
877 877 c, t dbSNP:748812668
888 888 a, g dbSNP:779664751
896 896 c, t dbSNP:727505034
902 902 a, c, t dbSNP:778139798
912 912 c, t dbSNP:375739359
930 930 a, g dbSNP:750233555
959 959 c, t dbSNP:779463030
966 966 a, g dbSNP:749597050
969 969 c, t dbSNP:727502876
972 972 -, a dbSNP:756155004
974 974 c, t dbSNP:753906607
978 978 c, t dbSNP:387907230
1000 1000 c, t dbSNP:766600615
1001 1001 a, g dbSNP:769322587
1003 1003 a, g dbSNP:760934600
1015 1015 a, g dbSNP:369409311
1027 1027 c, g dbSNP:745330137
1031 1031 c, t dbSNP:767694387
1049 1049 c, t dbSNP:761653519
1056 1056 c, g dbSNP:774026262
1066 1066 a, g dbSNP:199508243
1084 1084 c, t dbSNP:376432144
1086 1086 c, t dbSNP:373792254
1087 1087 a, g dbSNP:202103893
1089 1089 c, t dbSNP:727502875
1090 1090 a, g dbSNP:778951072
1091 1091 a, g dbSNP:759034996
1105 1105 c, t dbSNP:374659816
1124 1124 c, t dbSNP:770552940
1125 1125 a, g dbSNP:374849789
1129 1129 a, t dbSNP:774731983
1130 1130 a, g dbSNP:267603425
1136 1136 c, t dbSNP:769123978
1137 1137 a, g dbSNP:200723629
1143 1143 a, g dbSNP:780689866
1154 1154 a, g dbSNP:189582135
1155 1155 a, g dbSNP:745873108
1171 1171 a, g dbSNP:781160274
1172 1172 c, t dbSNP:377384557
1181 1181 a, g dbSNP:377696872
1191 1191 c, t dbSNP:751708268
1195 1195 a, g dbSNP:727505161
1201 1201 a, t dbSNP:764416164
1202 1202 c, t dbSNP:758185120
1211 1211 a, g, t dbSNP:368753369
1220 1220 c, t dbSNP:397517189
1229 1229 a, g dbSNP:759985677
1237 1237 a, t dbSNP:149325742
1257 1257 a, g dbSNP:771527727
1267 1267 a, g dbSNP:754918275
1280 1280 a, g dbSNP:747004107
1283 1283 c, t dbSNP:777836104
1297 1297 a, g dbSNP:772244404
1311 1311 a, g dbSNP:748393474
1312 1312 c, g dbSNP:779159910
1318 1318 c, t dbSNP:529337366
1319 1319 g, t dbSNP:567173040
1365 1365 c, t dbSNP:779793300
1367 1367 a, t dbSNP:756079711
1375 1375 a, g dbSNP:727504612
1376 1376 a, t dbSNP:779927466
1379 1379 c, t dbSNP:755954331
1380 1380 a, g dbSNP:745776787
1409 1409 a, g dbSNP:139669232
1412 1412 g, t dbSNP:375789756
1420 1420 a, g dbSNP:182537028
1430 1430 c, t dbSNP:751172494
1464 1464 c, t dbSNP:763596073
1469 1469 g, t dbSNP:17846788
1483 1483 a, c dbSNP:200336305
1490 1490 -, tgg dbSNP:779955645
1513 1513 c, t dbSNP:746018912
1528 1528 c, t dbSNP:754113599
1534 1534 c, t dbSNP:766792143
1543 1543 c, t dbSNP:760997956
1564 1564 c, t dbSNP:150627958
1589 1589 c, t dbSNP:58386780
1590 1590 c, t dbSNP:761820569
1594 1594 a, g dbSNP:774415124
1598 1598 c, t dbSNP:138356189
1609 1609 a, c dbSNP:145774770
1620 1620 a, g dbSNP:776572382
1626 1626 a, g dbSNP:201783967
1641 1641 c, t dbSNP:746967404
1642 1642 a, g dbSNP:753456211
1643 1643 g, t dbSNP:547213635
1646 1646 g, t dbSNP:747683989
1652 1652 a, t dbSNP:113562970
1653 1653 a, g, t dbSNP:370662364
1662 1662 g, t dbSNP:781555751
1667 1667 a, g dbSNP:757665666
1669 1669 a, t dbSNP:752072949
1682 1682 a, g dbSNP:764574133
1684 1684 a, g dbSNP:763074253
1685 1685 a, g dbSNP:368276490
1694 1694 a, g dbSNP:765489183
1700 1700 c, t dbSNP:759869766
1707 1707 c, t dbSNP:776519364
1708 1708 c, t dbSNP:200207117
1711 1711 a, g dbSNP:770829231
1718 1718 a, g dbSNP:142115849
1724 1724 c, t dbSNP:139127928
1727 1727 a, g dbSNP:548380877
1728 1728 c, t dbSNP:747640613
1737 1737 a, g dbSNP:778313829
1748 1748 -, tt dbSNP:771232310
1757 1757 c, t dbSNP:768245158
1759 1759 a, g dbSNP:200272254
1769 1769 a, g dbSNP:748914473
1770 1770 c, t dbSNP:779720018
1790 1790 c, t dbSNP:757612560
1798 1798 a, t dbSNP:531754904
1808 1808 c, t dbSNP:778283866
1813 1813 c, t dbSNP:756300282
1823 1823 c, g dbSNP:369597360
1826 1826 c, t dbSNP:750197446
1835 1835 a, g dbSNP:72559752
1850 1850 c, t dbSNP:143373045
1851 1851 g, t dbSNP:375758521
1856 1856 c, t dbSNP:149408382
1863 1863 g, t dbSNP:145455570
1882 1882 c, g dbSNP:762383594
1912 1912 c, g dbSNP:774995037
1919 1919 c, g dbSNP:769439725
1922 1922 c, t dbSNP:745536995
1927 1927 c, t dbSNP:372244832
1929 1929 a, g dbSNP:567016348
1930 1930 c, t dbSNP:368908490
1942 1942 a, t dbSNP:397517181
1947 1947 c, t dbSNP:755542764
1950 1950 c, t dbSNP:749318820
1951 1951 a, g dbSNP:374574602
1975 1975 a, g, t dbSNP:370918215
1997 1997 a, t dbSNP:769232379
1999 1999 a, c dbSNP:749786076
2000 2000 a, g dbSNP:150096625
2012 2012 c, t dbSNP:376726505
2013 2013 a, g dbSNP:142038412
2051 2051 c, t dbSNP:746029351
2052 2052 a, g dbSNP:781206225
2053 2053 c, t dbSNP:147580701
2073 2073 -, at dbSNP:753555698
2074 2074 c, t dbSNP:751307815
2078 2078 g, t dbSNP:777576366
2095 2095 a, c dbSNP:758229885
2096 2096 c, t dbSNP:10770865
2106 2106 a, g dbSNP:765275705
2112 2112 a, c dbSNP:758962407
2120 2120 c, g dbSNP:753391218
2122 2122 a, t dbSNP:765941070
2123 2123 c, g dbSNP:755739683
2129 2129 a, g dbSNP:151197166
2132 2132 c, t dbSNP:369830406
2141 2141 a, g dbSNP:763346044
2158 2158 c, g dbSNP:397517183
2164 2164 c, g dbSNP:775938318
2174 2174 c, t dbSNP:200819464
2181 2181 c, g dbSNP:374535641
2196 2196 c, t dbSNP:555340137
2198 2198 c, t dbSNP:368698007
2200 2200 c, t dbSNP:770976719
2201 2201 a, g dbSNP:142219855
2216 2216 c, t dbSNP:777308898
2225 2225 a, g dbSNP:772284924
2233 2233 c, t dbSNP:387907211
2251 2251 c, t dbSNP:747837398
2273 2273 a, g dbSNP:777181850
2285 2285 a, g dbSNP:751828406
2329 2329 a, g dbSNP:766936591
2334 2334 c, t dbSNP:368128251
2345 2345 c, t dbSNP:760680023
2354 2354 a, g dbSNP:773290634
2357 2357 a, g dbSNP:143346402
2378 2378 a, g dbSNP:748429545
2387 2387 c, g dbSNP:570095510
2402 2402 a, g dbSNP:768487549
2403 2403 c, t dbSNP:397517184
2409 2409 a, t dbSNP:780072385
2438 2438 a, c, t dbSNP:370463895
2458 2458 -, c dbSNP:766870789
2471 2471 c, t dbSNP:746467455
2476 2476 c, t dbSNP:772619542
2477 2477 a, g dbSNP:76458291
2489 2489 a, g dbSNP:747765299
2531 2531 c, g dbSNP:778581244
2543 2543 a, g dbSNP:777049470
2570 2570 a, g dbSNP:746239063
2573 2573 a, g dbSNP:781684241
2603 2603 c, t dbSNP:773930785
2617 2617 a, c, g dbSNP:149229372
2628 2628 -, tt dbSNP:776934642
2648 2648 c, t dbSNP:61001398
2649 2649 a, g dbSNP:757681761
2659 2659 a, g dbSNP:139539832
2663 2663 c, t dbSNP:577810106
2674 2674 c, t dbSNP:75460545
2675 2675 a, g dbSNP:727502873
2679 2679 c, g dbSNP:367770980
2687 2687 g, t dbSNP:150036969
2702 2702 c, t dbSNP:753627514
2709 2709 a, g dbSNP:113542001
2714 2714 a, g dbSNP:565125768
2721 2721 a, g dbSNP:755145193
2726 2726 a, g dbSNP:552092424
2727 2727 a, c dbSNP:138890128
2738 2738 a, g dbSNP:755853969
2739 2739 c, g, t dbSNP:767396331
2742 2742 a, c, g dbSNP:368279608
2743 2743 a, g dbSNP:763573197
2748 2748 c, t dbSNP:762583015
2755 2755 g, t dbSNP:775002315
2772 2772 c, t dbSNP:769493004
2778 2778 c, t dbSNP:760889253
2779 2779 a, g dbSNP:150255709
2781 2781 c, t dbSNP:199499109
2782 2782 a, g dbSNP:397517185
2786 2786 a, g dbSNP:779609498
2787 2787 c, t dbSNP:200349671
2788 2788 a, g dbSNP:141999048
2792 2792 c, t dbSNP:780071007
2793 2793 a, g dbSNP:200891785
2800 2800 a, c, t dbSNP:397517186
2801 2801 a, g dbSNP:549032386
2802 2802 a, g dbSNP:757093666
2804 2804 a, g dbSNP:751485829
2805 2805 a, c, g dbSNP:762304330
2830 2830 g, t dbSNP:777631521
2840 2840 a, c dbSNP:758381330
2845 2845 a, g dbSNP:752106985
2850 2850 a, g dbSNP:148174226
2866 2866 c, t dbSNP:200288646
2867 2867 a, c dbSNP:754495447
2870 2870 c, t dbSNP:753524629
2872 2872 c, t dbSNP:766197122
2881 2881 a, g dbSNP:267603424
2886 2886 c, t dbSNP:183603557
2890 2890 c, g dbSNP:764471784
2897 2897 a, g dbSNP:546978327
2901 2901 -, c dbSNP:371525457
2902 2902 a, c dbSNP:763289280
2904 2904 -, a dbSNP:772110955
2912 2912 c, g dbSNP:756409292
2921 2921 a, t dbSNP:765667189
2949 2949 a, g dbSNP:397517187
2954 2954 c, t dbSNP:74067815
2955 2955 c, t dbSNP:141925577
2957 2957 c, t dbSNP:201848437
2958 2958 a, g dbSNP:542184069
2971 2971 c, t dbSNP:773355490
2990 2990 a, c dbSNP:771887289
2991 2991 c, g, t dbSNP:367621959
2997 2997 a, g dbSNP:369604693
3000 3000 a, g dbSNP:61688134
3012 3012 a, g dbSNP:202054255
3014 3014 a, g dbSNP:749218661
3015 3015 c, g dbSNP:201223488
3022 3022 c, t dbSNP:146944210
3032 3032 c, t dbSNP:769428584
3037 3037 a, g dbSNP:745375583
3042 3042 a, g dbSNP:777459907
3045 3045 a, t dbSNP:755331988
3051 3051 a, t dbSNP:375322301
3062 3062 c, t dbSNP:145561881
3068 3068 g, t dbSNP:780477165
3071 3071 a, g dbSNP:756598798
3075 3075 c, t dbSNP:538520169
3090 3090 a, g dbSNP:750474414
3091 3091 c, t dbSNP:767475566
3093 3093 a, g dbSNP:757419477
3100 3100 a, g dbSNP:751831174
3104 3104 a, g dbSNP:764419953
3112 3112 c, t dbSNP:180739851
3115 3115 c, t dbSNP:775448788
3131 3131 c, t dbSNP:765227350
3143 3143 c, t dbSNP:758726580
3157 3157 a, g dbSNP:753010015
3164 3164 c, t dbSNP:764916922
3168 3168 c, t dbSNP:759432313
3169 3169 c, t dbSNP:555127853
3175 3175 c, t dbSNP:753713460
3185 3185 c, t dbSNP:766344568
3192 3192 a, c dbSNP:760116129
3209 3209 a, t dbSNP:772727573
3217 3217 a, g dbSNP:771669791
3218 3218 a, t dbSNP:761421687
3242 3242 a, g dbSNP:747498785
3243 3243 a, g, t dbSNP:267603423
3248 3248 a, g dbSNP:772272069
3255 3255 a, g dbSNP:748239152
3260 3260 c, t dbSNP:778941231
3261 3261 a, t dbSNP:755251666
3265 3265 c, t dbSNP:748996561
3270 3270 a, c dbSNP:779866340
3271 3271 a, g dbSNP:755951253
3275 3275 a, g, t dbSNP:587780845
3287 3287 c, t dbSNP:756699664
3295 3295 c, t dbSNP:542818695
3299 3299 a, c dbSNP:751103892
3300 3300 c, t dbSNP:367776754
3303 3303 -, ttg dbSNP:776927430
3306 3306 a, g dbSNP:764983816
3311 3311 c, t dbSNP:761059899
3323 3323 c, t dbSNP:144537241
3354 3354 c, t dbSNP:193922683
3371 3371 a, g dbSNP:762350069
3380 3380 a, g dbSNP:774768881
3382 3382 a, c dbSNP:776565800
3386 3386 c, g dbSNP:768765531
3388 3388 a, g dbSNP:111943197
3399 3399 a, g dbSNP:376754153
3407 3407 a, g dbSNP:762524104
3413 3413 c, t dbSNP:373909378
3416 3416 a, g dbSNP:745622324
3422 3422 a, g dbSNP:780938779
3430 3430 c, t dbSNP:140872303
3431 3431 a, g dbSNP:139408145
3432 3432 c, t dbSNP:777640505
3438 3438 g, t dbSNP:757855454
3441 3441 c, t dbSNP:752158447
3448 3448 c, t dbSNP:751892751
3459 3459 c, g dbSNP:764622641
3461 3461 c, t dbSNP:545923015
3466 3466 a, g dbSNP:144158922
3501 3501 a, c dbSNP:372063844
3506 3506 -, a dbSNP:761025138
3509 3509 c, t dbSNP:765291115
3522 3522 a, g dbSNP:759682679
3537 3537 c, t dbSNP:61926077
3546 3546 c, t dbSNP:533032970
3557 3557 a, c dbSNP:771069339
3563 3563 a, g dbSNP:760466255
3568 3568 -, a dbSNP:775677708
3570 3570 a, g dbSNP:760772830
3579 3579 g, t dbSNP:773531870
3582 3582 a, g dbSNP:767203577
3584 3584 c, g dbSNP:139472403
3592 3592 c, t dbSNP:763933429
3613 3613 a, g dbSNP:201838439
3615 3615 c, t dbSNP:373890183
3616 3616 a, g dbSNP:748770166
3620 3620 a, c dbSNP:370592605
3626 3626 c, t dbSNP:141025897
3630 3630 a, g dbSNP:745497913
3647 3647 a, g dbSNP:780969045
3656 3656 c, t dbSNP:758697683
3657 3657 a, g dbSNP:143685061
3662 3662 c, g, t dbSNP:2291550
3674 3674 a, g dbSNP:113544922
3686 3686 c, t dbSNP:780676951
3690 3690 a, g dbSNP:756078959
3694 3694 a, g dbSNP:750529516
3715 3715 a, g dbSNP:781525973
3727 3727 a, t dbSNP:149319186
3732 3732 a, c dbSNP:376874273
3735 3735 c, t dbSNP:763968252
3738 3738 a, g dbSNP:762876194
3741 3741 a, g dbSNP:752514128
3742 3742 a, c dbSNP:765236712
3750 3750 c, t dbSNP:78979794
3751 3751 a, g dbSNP:148752791
3783 3783 a, g dbSNP:374500043
3786 3786 c, t dbSNP:760294059
3807 3807 c, t dbSNP:138700703
3817 3817 -, c dbSNP:777605277
3830 3830 c, t dbSNP:76102634
3841 3841 g, t dbSNP:74839837
3858 3858 c, t dbSNP:387907229
3860 3860 a, g dbSNP:769003781
3861 3861 a, g dbSNP:749668601
3862 3862 a, t dbSNP:201076495
3870 3870 a, g dbSNP:376701259
3873 3873 a, g dbSNP:372020861
3876 3876 a, g dbSNP:369389402
3880 3880 c, t dbSNP:781401356
3895 3895 a, c dbSNP:757471451
3910 3910 c, t dbSNP:754783744
3928 3928 a, g dbSNP:387907210
3929 3929 c, t dbSNP:753767796
3947 3947 c, t dbSNP:766308200
3959 3959 a, g dbSNP:755562764
3977 3977 c, g dbSNP:749956738
3988 3988 c, t dbSNP:767036098
3992 3992 a, t dbSNP:374811560
4001 4001 c, t dbSNP:761506474
4020 4020 a, g dbSNP:773935879
4021 4021 a, g dbSNP:765629988
4037 4037 a, g dbSNP:554189538
4038 4038 c, t dbSNP:190886443
4064 4064 c, t dbSNP:745801825
4067 4067 a, g dbSNP:780998911
4073 4073 c, g dbSNP:144325590
4075 4075 a, g, t dbSNP:182158174
4079 4079 c, t dbSNP:758097449
4083 4083 c, t dbSNP:752450127
4088 4088 c, t dbSNP:377372612
4099 4099 c, g, t dbSNP:201358406
4104 4104 a, g dbSNP:750872710
4109 4109 c, t dbSNP:767919730
4115 4115 c, g dbSNP:761902896
4121 4121 c, t dbSNP:35404804
4124 4124 c, t dbSNP:752156685
4131 4131 c, t dbSNP:764155671
4139 4139 g, t dbSNP:138280089
4146 4146 c, t dbSNP:387907228
4147 4147 a, g dbSNP:387907227
4157 4157 a, g dbSNP:2287626
4164 4164 c, t dbSNP:765467874
4196 4196 c, t dbSNP:759338528
4205 4205 c, t dbSNP:776262076
4209 4209 a, g dbSNP:147895473
4232 4232 c, t dbSNP:746911808
4235 4235 a, c dbSNP:373381644
4260 4260 c, t dbSNP:387907208
4261 4261 a, c, g dbSNP:387907209
4266 4266 a, g dbSNP:747672720
4268 4268 c, t dbSNP:201572736
4279 4279 g, t dbSNP:780799175
4307 4307 c, t dbSNP:752807533
4314 4314 c, t dbSNP:112192000
4320 4320 c, t dbSNP:786205475
4328 4328 a, g dbSNP:765343947
4334 4334 a, c dbSNP:759659676
4339 4339 -, aag dbSNP:747901960
4357 4357 a, g dbSNP:776973456
4372 4372 a, g dbSNP:758873590
4383 4383 a, g dbSNP:753254985
4389 4389 c, t dbSNP:778849288
4390 4390 a, g dbSNP:755156050
4394 4394 a, g dbSNP:199900459
4402 4402 g, t dbSNP:766633076
4406 4406 a, g dbSNP:143316915
4415 4415 c, t dbSNP:17846779
4416 4416 a, t dbSNP:750272556
4421 4421 c, t dbSNP:767458242
4439 4439 a, g dbSNP:761818286
4445 4445 c, t dbSNP:188944145
4450 4450 a, c, g dbSNP:12298510
4451 4451 a, g dbSNP:762538247
4453 4453 a, g dbSNP:774958948
4462 4462 c, t dbSNP:769519614
4468 4468 c, t dbSNP:137907278
4469 4469 a, g dbSNP:146942382
4473 4473 -, t dbSNP:769609857
4474 4474 a, g dbSNP:200876028
4476 4476 c, t dbSNP:749797034
4484 4484 g, t dbSNP:780157680
4490 4490 a, t dbSNP:756318114
4505 4505 c, t dbSNP:576867217
4506 4506 a, g dbSNP:781568971
4507 4507 c, t dbSNP:757069575
4528 4528 c, t dbSNP:751402564
4529 4529 a, c, g dbSNP:140182559
4568 4568 c, t dbSNP:150303433
4570 4570 c, t dbSNP:533543882
4571 4571 a, g dbSNP:759055406
4597 4597 c, t dbSNP:765911298
4631 4631 a, t dbSNP:760351484
4663 4663 c, t dbSNP:772795759