Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

PQBP1 polyglutamine binding protein 1 [Homo sapiens (human)]

Gene Symbol PQBP1
Entrez Gene ID 10084
Full Name polyglutamine binding protein 1
Synonyms MRX2, MRX55, MRXS3, MRXS8, NPW38, RENS1, SHS
General protein information
Preferred Names
polyglutamine-binding protein 1
polyglutamine-binding protein 1
polyglutamine tract-binding protein 1
nuclear protein containing WW domain 38 kD
38 kDa nuclear protein containing a WW domain
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. lac of sum
Disorder MIM:


Disorder Html: Renpenning syndrome, 309500 (3); Golabi-Ito-Hall syndrome (3)
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu02070 XM_011543884 PREDICTED: Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK In stock -1 Starting from $99.00
OHu09339 XM_005272571 PREDICTED: Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu06312 XM_005272572 PREDICTED: Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu02070 NM_005710 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu02070 NM_001032381 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu02070 NM_001032382 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 3, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu02070 NM_001032383 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 4, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu02070 NM_001032384 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 5, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu06312 NM_144495 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 7, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu09339 NM_001167989 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 8, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu04106 NM_001167990 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 9, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu09316 NM_001167992 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 10, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu02070D
Sequence Information ORF Nucleotide Sequence (Length: 798bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_079573.5) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)391..486(+)
Position Chain Variation Link
91 91 g, t dbSNP:41312118
295 295 a, g dbSNP:202071384
446 446 a, g dbSNP:121917899
516 516 a, g dbSNP:398124212
586 586 -, aggggccatgacaagtcggac dbSNP:606231198
628 628 a, c, g dbSNP:28372358
645 645 a, t dbSNP:28489209
711 711 -, agag dbSNP:606231194
712 712 -, ag dbSNP:606231193
713 713 -, ag dbSNP:606231195
799 799 -, gagctggctccctatcccaagag dbSNP:606231197
891 891 -, c dbSNP:606231196

Target ORF information:

RefSeq Version XM_011543884
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu09339D
Sequence Information ORF Nucleotide Sequence (Length: 795bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_079573.5) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578838005. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)323..418(+)
Position Chain Variation Link
227 227 a, g dbSNP:202071384
378 378 a, g dbSNP:121917899
448 448 a, g dbSNP:398124212
518 518 -, aggggccatgacaagtcggac dbSNP:606231198
560 560 a, c, g dbSNP:28372358
577 577 a, t dbSNP:28489209
643 643 -, agag dbSNP:606231194
644 644 -, ag dbSNP:606231193
645 645 -, ag dbSNP:606231195
731 731 -, gagctggctccctatcccaagag dbSNP:606231197
820 820 -, c dbSNP:606231196

Target ORF information:

RefSeq Version XM_005272571
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu06312D
Sequence Information ORF Nucleotide Sequence (Length: 513bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_079573.5) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578838006. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)256..351(+)
Misc Feature(2)301..336(+)
Position Chain Variation Link
154 154 a, g dbSNP:202071384
305 305 a, g dbSNP:121917899
375 375 a, g dbSNP:398124212
465 465 -, c dbSNP:606231196

Target ORF information:

RefSeq Version XM_005272572
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu02070D
Sequence Information ORF Nucleotide Sequence (Length: 798bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AJ005893.1 and BC012358.1. This sequence is a reference standard in the RefSeqGene project. On Aug 31, 2005 this sequence version replaced gi:5031956. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Variants 1, 2, 3, 4, and 5 all encode the same protein (isoform 1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AJ005893.1, BI223085.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)234..236(+)
Misc Feature(2)393..488(+)
Misc Feature(3)534..1049(+)
Misc Feature(4)534..536(+)
Misc Feature(5)564..668(+)
Misc Feature(6)669..686(+)
Misc Feature(7)702..743(+)
Misc Feature(8)987..1019(+)
Misc Feature(9)993..995(+)
Exon (1)1..321
Gene Synonym:
Exon (2)322..433
Gene Synonym:
Exon (3)434..546
Gene Synonym:
Exon (4)547..831
Gene Synonym:
Exon (5)832..895
Gene Synonym:
Exon (6)896..1111
Gene Synonym:
Position Chain Variation Link
297 297 a, g dbSNP:202071384
448 448 a, g dbSNP:121917899
518 518 a, g dbSNP:398124212
588 588 -, aggggccatgacaagtcggac dbSNP:606231198
630 630 a, c, g dbSNP:28372358
647 647 a, t dbSNP:28489209
713 713 -, agag dbSNP:606231194
714 714 -, ag dbSNP:606231193
715 715 -, ag dbSNP:606231195
801 801 -, gagctggctccctatcccaagag dbSNP:606231197
893 893 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_005710
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu02070D
Sequence Information ORF Nucleotide Sequence (Length: 798bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CN292761.1 and BC012358.1. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, and 5 all encode the same protein (isoform 1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC012358.1, BQ069132.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)14..16(+)
Misc Feature(2)260..355(+)
Misc Feature(3)401..916(+)
Misc Feature(4)401..403(+)
Misc Feature(5)431..535(+)
Misc Feature(6)536..553(+)
Misc Feature(7)569..610(+)
Misc Feature(8)854..886(+)
Misc Feature(9)860..862(+)
Exon (1)1..103
Gene Synonym:
Exon (2)104..188
Gene Synonym:
Exon (3)189..300
Gene Synonym:
Exon (4)301..413
Gene Synonym:
Exon (5)414..698
Gene Synonym:
Exon (6)699..762
Gene Synonym:
Exon (7)763..978
Gene Synonym:
Position Chain Variation Link
164 164 a, g dbSNP:202071384
315 315 a, g dbSNP:121917899
385 385 a, g dbSNP:398124212
455 455 -, aggggccatgacaagtcggac dbSNP:606231198
497 497 a, c, g dbSNP:28372358
514 514 a, t dbSNP:28489209
580 580 -, agag dbSNP:606231194
581 581 -, ag dbSNP:606231193
582 582 -, ag dbSNP:606231195
668 668 -, gagctggctccctatcccaagag dbSNP:606231197
760 760 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_001032381
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu02070D
Sequence Information ORF Nucleotide Sequence (Length: 798bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CN292761.1, AB016533.1 and BC012358.1. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, and 5 all encode the same protein (isoform 1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AJ242829.1, AB016533.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)139..141(+)
Misc Feature(2)328..423(+)
Misc Feature(3)469..984(+)
Misc Feature(4)469..471(+)
Misc Feature(5)499..603(+)
Misc Feature(6)604..621(+)
Misc Feature(7)637..678(+)
Misc Feature(8)922..954(+)
Misc Feature(9)928..930(+)
Exon (1)1..171
Gene Synonym:
Exon (2)172..256
Gene Synonym:
Exon (3)257..368
Gene Synonym:
Exon (4)369..481
Gene Synonym:
Exon (5)482..766
Gene Synonym:
Exon (6)767..830
Gene Synonym:
Exon (7)831..1046
Gene Synonym:
Position Chain Variation Link
232 232 a, g dbSNP:202071384
383 383 a, g dbSNP:121917899
453 453 a, g dbSNP:398124212
523 523 -, aggggccatgacaagtcggac dbSNP:606231198
565 565 a, c, g dbSNP:28372358
582 582 a, t dbSNP:28489209
648 648 -, agag dbSNP:606231194
649 649 -, ag dbSNP:606231193
650 650 -, ag dbSNP:606231195
736 736 -, gagctggctccctatcccaagag dbSNP:606231197
828 828 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_001032382
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu02070D
Sequence Information ORF Nucleotide Sequence (Length: 798bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CN292761.1, BX362311.2 and BC012358.1. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, and 5 all encode the same protein (isoform 1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BQ933443.1, BQ690561.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)54..56(+)
Misc Feature(2)339..434(+)
Misc Feature(3)480..995(+)
Misc Feature(4)480..482(+)
Misc Feature(5)510..614(+)
Misc Feature(6)615..632(+)
Misc Feature(7)648..689(+)
Misc Feature(8)933..965(+)
Misc Feature(9)939..941(+)
Exon (1)1..182
Gene Synonym:
Exon (2)183..267
Gene Synonym:
Exon (3)268..379
Gene Synonym:
Exon (4)380..492
Gene Synonym:
Exon (5)493..777
Gene Synonym:
Exon (6)778..841
Gene Synonym:
Exon (7)842..1057
Gene Synonym:
Position Chain Variation Link
243 243 a, g dbSNP:202071384
394 394 a, g dbSNP:121917899
464 464 a, g dbSNP:398124212
534 534 -, aggggccatgacaagtcggac dbSNP:606231198
576 576 a, c, g dbSNP:28372358
593 593 a, t dbSNP:28489209
659 659 -, agag dbSNP:606231194
660 660 -, ag dbSNP:606231193
661 661 -, ag dbSNP:606231195
747 747 -, gagctggctccctatcccaagag dbSNP:606231197
839 839 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_001032383
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu02070D
Sequence Information ORF Nucleotide Sequence (Length: 798bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AJ005893.1, BE396796.1 and BC012358.1. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, and 5 all encode the same protein (isoform 1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: BC012358.1, AJ005893.1 [ECO:0000331] RNAseq introns :: single sample supports all introns SAMEA1968540, SAMEA1968832 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)248..343(+)
Misc Feature(2)389..904(+)
Misc Feature(3)389..391(+)
Misc Feature(4)419..523(+)
Misc Feature(5)524..541(+)
Misc Feature(6)557..598(+)
Misc Feature(7)842..874(+)
Misc Feature(8)848..850(+)
Exon (1)1..91
Gene Synonym:
Exon (2)92..176
Gene Synonym:
Exon (3)177..288
Gene Synonym:
Exon (4)289..401
Gene Synonym:
Exon (5)402..686
Gene Synonym:
Exon (6)687..750
Gene Synonym:
Exon (7)751..966
Gene Synonym:
Position Chain Variation Link
152 152 a, g dbSNP:202071384
303 303 a, g dbSNP:121917899
373 373 a, g dbSNP:398124212
443 443 -, aggggccatgacaagtcggac dbSNP:606231198
485 485 a, c, g dbSNP:28372358
502 502 a, t dbSNP:28489209
568 568 -, agag dbSNP:606231194
569 569 -, ag dbSNP:606231193
570 570 -, ag dbSNP:606231195
656 656 -, gagctggctccctatcccaagag dbSNP:606231197
748 748 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_001032384
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 5, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu06312D
Sequence Information ORF Nucleotide Sequence (Length: 513bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CN292761.1, AJ973593.1 and BC012358.1. On Nov 21, 2009 this sequence version replaced gi:41281714. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (7) contains a different 5' UTR and lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. The resulting protein (isoform 3) is shorter when it is compared to isoform 1. Variant 7 is also known as variant PQBP-1d. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: BF529979.1, AJ973593.1 [ECO:0000331] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)139..141(+)
Misc Feature(2)334..429(+)
Misc Feature(3)379..414(+)
Exon (1)1..171
Gene Synonym:
Exon (2)172..256
Gene Synonym:
Exon (3)257..368
Gene Synonym:
Exon (4)369..481
Gene Synonym:
Exon (5)482..545
Gene Synonym:
Exon (6)546..761
Gene Synonym:
Position Chain Variation Link
232 232 a, g dbSNP:202071384
383 383 a, g dbSNP:121917899
453 453 a, g dbSNP:398124212
543 543 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_144495
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 7, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu09339D
Sequence Information ORF Nucleotide Sequence (Length: 795bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 4
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CN292761.1, BI818141.1, AJ973606.1, BE385548.1, AJ973597.1 and CD365745.1. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (8) differs in the 5' UTR and uses a different splice site in the 3' coding region, compared to variant 1. The resulting protein (isoform 4) is shorter by 1 aa when it is compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BI818141.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)14..16(+)
Misc Feature(2)260..355(+)
Misc Feature(3)401..403(+)
Misc Feature(4)431..535(+)
Misc Feature(5)536..553(+)
Misc Feature(6)569..610(+)
Misc Feature(7)851..883(+)
Misc Feature(8)857..859(+)
Exon (1)1..103
Gene Synonym:
Exon (2)104..188
Gene Synonym:
Exon (3)189..300
Gene Synonym:
Exon (4)301..413
Gene Synonym:
Exon (5)414..698
Gene Synonym:
Exon (6)699..759
Gene Synonym:
Exon (7)760..977
Gene Synonym:
Position Chain Variation Link
164 164 a, g dbSNP:202071384
315 315 a, g dbSNP:121917899
385 385 a, g dbSNP:398124212
455 455 -, aggggccatgacaagtcggac dbSNP:606231198
497 497 a, c, g dbSNP:28372358
514 514 a, t dbSNP:28489209
580 580 -, agag dbSNP:606231194
581 581 -, ag dbSNP:606231193
582 582 -, ag dbSNP:606231195
668 668 -, gagctggctccctatcccaagag dbSNP:606231197
757 757 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_001167989
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 8, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu04106D
Sequence Information ORF Nucleotide Sequence (Length: 774bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 5
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CD051018.1 and BC012358.1. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (9) differs in the 5' UTR and uses a different splice site in the coding region, compared to variant 1. The resulting protein (isoform 5) is shorter when it is compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: CD051018.1, CD050623.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2144335, SAMEA2145245 [ECO:0000348] ##Evidence-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Exon (1)1..85
Gene Synonym:
Exon (2)86..170
Gene Synonym:
Exon (3)171..258
Gene Synonym:
Exon (4)259..371
Gene Synonym:
Exon (5)372..656
Gene Synonym:
Exon (6)657..720
Gene Synonym:
Exon (7)721..936
Gene Synonym:
Position Chain Variation Link
146 146 a, g dbSNP:202071384
273 273 a, g dbSNP:121917899
343 343 a, g dbSNP:398124212
413 413 -, aggggccatgacaagtcggac dbSNP:606231198
455 455 a, c, g dbSNP:28372358
472 472 a, t dbSNP:28489209
538 538 -, agag dbSNP:606231194
539 539 -, ag dbSNP:606231193
540 540 -, ag dbSNP:606231195
626 626 -, gagctggctccctatcccaagag dbSNP:606231197
718 718 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_001167990
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 9, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu09316D
Sequence Information ORF Nucleotide Sequence (Length: 498bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 6
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CN292761.1, AJ973605.1 and BC012358.1. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (10) lacks a 5' UTR and uses different splice sites in the coding region, compared to variant 1. The resulting protein (isoform 6) is shorter when it is compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AJ973605.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Exon (1)1..85
Gene Synonym:
Exon (2)86..197
Gene Synonym:
Exon (3)198..219
Gene Synonym:
Exon (4)220..295
Gene Synonym:
Exon (5)296..359
Gene Synonym:
Exon (6)360..575
Gene Synonym:
Position Chain Variation Link
61 61 a, g dbSNP:202071384
212 212 a, g dbSNP:121917899
265 265 -, gagctggctccctatcccaagag dbSNP:606231197
357 357 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_001167992
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 10, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.