Email to GenScript

PQBP1 polyglutamine binding protein 1 [Homo sapiens (human)]

Gene Symbol PQBP1
Entrez Gene ID 10084
Full Name polyglutamine binding protein 1
Synonyms MRX2, MRX55, MRXS3, MRXS8, NPW38, RENS1, SHS
General protein information
Preferred Names
polyglutamine-binding protein 1
polyglutamine-binding protein 1
polyglutamine tract-binding protein 1
nuclear protein containing WW domain 38 kD
38 kDa nuclear protein containing a WW domain
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. lac of sum
Disorder MIM:


Disorder Html: Renpenning syndrome, 309500 (3); Golabi-Ito-Hall syndrome (3)

The following PQBP1 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the PQBP1 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu02070 XM_011543884 PREDICTED: Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu09339 XM_005272571 PREDICTED: Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $199
OHu06312 XM_005272572 PREDICTED: Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99
OHu02070 NM_005710 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu02070 NM_001032381 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu02070 NM_001032382 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu02070 NM_001032383 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu02070 NM_001032384 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu06312 NM_144495 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99
OHu09339 NM_001167989 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 8, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $269
OHu04106 NM_001167990 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 9, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $269
OHu09316 NM_001167992 Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 10, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu02070
Accession Version XM_011543884.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 798bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu02070D_COA.pdf (pdf)
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_079573.5) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)391..486(+)
Position Chain Variation Link
91 91 g, t dbSNP:41312118
295 295 a, g dbSNP:202071384
446 446 a, g dbSNP:121917899
516 516 a, g dbSNP:398124212
586 586 -, aggggccatgacaagtcggac dbSNP:606231198
628 628 a, c, g dbSNP:28372358
645 645 a, t dbSNP:28489209
711 711 -, agag dbSNP:606231194
712 712 -, ag dbSNP:606231193
713 713 -, ag dbSNP:606231195
799 799 -, gagctggctccctatcccaagag dbSNP:606231197
891 891 -, c dbSNP:606231196

Target ORF information:

RefSeq Version XM_011543884
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu09339
Accession Version XM_005272571.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 795bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_079573.5) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578838005. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)323..418(+)
Position Chain Variation Link
227 227 a, g dbSNP:202071384
378 378 a, g dbSNP:121917899
448 448 a, g dbSNP:398124212
518 518 -, aggggccatgacaagtcggac dbSNP:606231198
560 560 a, c, g dbSNP:28372358
577 577 a, t dbSNP:28489209
643 643 -, agag dbSNP:606231194
644 644 -, ag dbSNP:606231193
645 645 -, ag dbSNP:606231195
731 731 -, gagctggctccctatcccaagag dbSNP:606231197
820 820 -, c dbSNP:606231196

Target ORF information:

RefSeq Version XM_005272571
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu06312
Accession Version XM_005272572.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 513bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_079573.5) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578838006. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)256..351(+)
Misc Feature(2)301..336(+)
Position Chain Variation Link
154 154 a, g dbSNP:202071384
305 305 a, g dbSNP:121917899
375 375 a, g dbSNP:398124212
465 465 -, c dbSNP:606231196

Target ORF information:

RefSeq Version XM_005272572
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu02070
Accession Version NM_005710.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 798bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu02070D_COA.pdf (pdf)
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AJ005893.1 and BC012358.1. This sequence is a reference standard in the RefSeqGene project. On Aug 31, 2005 this sequence version replaced gi:5031956. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Variants 1, 2, 3, 4, and 5 all encode the same protein (isoform 1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AJ005893.1, BI223085.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)234..236(+)
Misc Feature(2)393..488(+)
Misc Feature(3)534..1049(+)
Misc Feature(4)534..536(+)
Misc Feature(5)564..668(+)
Misc Feature(6)669..686(+)
Misc Feature(7)702..743(+)
Misc Feature(8)987..1019(+)
Misc Feature(9)993..995(+)
Exon (1)1..321
Gene Synonym:
Exon (2)322..433
Gene Synonym:
Exon (3)434..546
Gene Synonym:
Exon (4)547..831
Gene Synonym:
Exon (5)832..895
Gene Synonym:
Exon (6)896..1111
Gene Synonym:
Position Chain Variation Link
297 297 a, g dbSNP:202071384
448 448 a, g dbSNP:121917899
518 518 a, g dbSNP:398124212
588 588 -, aggggccatgacaagtcggac dbSNP:606231198
630 630 a, c, g dbSNP:28372358
647 647 a, t dbSNP:28489209
713 713 -, agag dbSNP:606231194
714 714 -, ag dbSNP:606231193
715 715 -, ag dbSNP:606231195
801 801 -, gagctggctccctatcccaagag dbSNP:606231197
893 893 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_005710
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu02070
Accession Version NM_001032381.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 798bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu02070D_COA.pdf (pdf)
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CN292761.1 and BC012358.1. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, and 5 all encode the same protein (isoform 1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC012358.1, BQ069132.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)14..16(+)
Misc Feature(2)260..355(+)
Misc Feature(3)401..916(+)
Misc Feature(4)401..403(+)
Misc Feature(5)431..535(+)
Misc Feature(6)536..553(+)
Misc Feature(7)569..610(+)
Misc Feature(8)854..886(+)
Misc Feature(9)860..862(+)
Exon (1)1..103
Gene Synonym:
Exon (2)104..188
Gene Synonym:
Exon (3)189..300
Gene Synonym:
Exon (4)301..413
Gene Synonym:
Exon (5)414..698
Gene Synonym:
Exon (6)699..762
Gene Synonym:
Exon (7)763..978
Gene Synonym:
Position Chain Variation Link
164 164 a, g dbSNP:202071384
315 315 a, g dbSNP:121917899
385 385 a, g dbSNP:398124212
455 455 -, aggggccatgacaagtcggac dbSNP:606231198
497 497 a, c, g dbSNP:28372358
514 514 a, t dbSNP:28489209
580 580 -, agag dbSNP:606231194
581 581 -, ag dbSNP:606231193
582 582 -, ag dbSNP:606231195
668 668 -, gagctggctccctatcccaagag dbSNP:606231197
760 760 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_001032381
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu02070
Accession Version NM_001032382.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 798bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu02070D_COA.pdf (pdf)
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CN292761.1, AB016533.1 and BC012358.1. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, and 5 all encode the same protein (isoform 1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AJ242829.1, AB016533.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)139..141(+)
Misc Feature(2)328..423(+)
Misc Feature(3)469..984(+)
Misc Feature(4)469..471(+)
Misc Feature(5)499..603(+)
Misc Feature(6)604..621(+)
Misc Feature(7)637..678(+)
Misc Feature(8)922..954(+)
Misc Feature(9)928..930(+)
Exon (1)1..171
Gene Synonym:
Exon (2)172..256
Gene Synonym:
Exon (3)257..368
Gene Synonym:
Exon (4)369..481
Gene Synonym:
Exon (5)482..766
Gene Synonym:
Exon (6)767..830
Gene Synonym:
Exon (7)831..1046
Gene Synonym:
Position Chain Variation Link
232 232 a, g dbSNP:202071384
383 383 a, g dbSNP:121917899
453 453 a, g dbSNP:398124212
523 523 -, aggggccatgacaagtcggac dbSNP:606231198
565 565 a, c, g dbSNP:28372358
582 582 a, t dbSNP:28489209
648 648 -, agag dbSNP:606231194
649 649 -, ag dbSNP:606231193
650 650 -, ag dbSNP:606231195
736 736 -, gagctggctccctatcccaagag dbSNP:606231197
828 828 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_001032382
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu02070
Accession Version NM_001032383.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 798bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu02070D_COA.pdf (pdf)
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CN292761.1, BX362311.2 and BC012358.1. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, and 5 all encode the same protein (isoform 1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BQ933443.1, BQ690561.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)54..56(+)
Misc Feature(2)339..434(+)
Misc Feature(3)480..995(+)
Misc Feature(4)480..482(+)
Misc Feature(5)510..614(+)
Misc Feature(6)615..632(+)
Misc Feature(7)648..689(+)
Misc Feature(8)933..965(+)
Misc Feature(9)939..941(+)
Exon (1)1..182
Gene Synonym:
Exon (2)183..267
Gene Synonym:
Exon (3)268..379
Gene Synonym:
Exon (4)380..492
Gene Synonym:
Exon (5)493..777
Gene Synonym:
Exon (6)778..841
Gene Synonym:
Exon (7)842..1057
Gene Synonym:
Position Chain Variation Link
243 243 a, g dbSNP:202071384
394 394 a, g dbSNP:121917899
464 464 a, g dbSNP:398124212
534 534 -, aggggccatgacaagtcggac dbSNP:606231198
576 576 a, c, g dbSNP:28372358
593 593 a, t dbSNP:28489209
659 659 -, agag dbSNP:606231194
660 660 -, ag dbSNP:606231193
661 661 -, ag dbSNP:606231195
747 747 -, gagctggctccctatcccaagag dbSNP:606231197
839 839 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_001032383
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu02070
Accession Version NM_001032384.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 798bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu02070D_COA.pdf (pdf)
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AJ005893.1, BE396796.1 and BC012358.1. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, and 5 all encode the same protein (isoform 1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: BC012358.1, AJ005893.1 [ECO:0000331] RNAseq introns :: single sample supports all introns SAMEA1968540, SAMEA1968832 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)248..343(+)
Misc Feature(2)389..904(+)
Misc Feature(3)389..391(+)
Misc Feature(4)419..523(+)
Misc Feature(5)524..541(+)
Misc Feature(6)557..598(+)
Misc Feature(7)842..874(+)
Misc Feature(8)848..850(+)
Exon (1)1..91
Gene Synonym:
Exon (2)92..176
Gene Synonym:
Exon (3)177..288
Gene Synonym:
Exon (4)289..401
Gene Synonym:
Exon (5)402..686
Gene Synonym:
Exon (6)687..750
Gene Synonym:
Exon (7)751..966
Gene Synonym:
Position Chain Variation Link
152 152 a, g dbSNP:202071384
303 303 a, g dbSNP:121917899
373 373 a, g dbSNP:398124212
443 443 -, aggggccatgacaagtcggac dbSNP:606231198
485 485 a, c, g dbSNP:28372358
502 502 a, t dbSNP:28489209
568 568 -, agag dbSNP:606231194
569 569 -, ag dbSNP:606231193
570 570 -, ag dbSNP:606231195
656 656 -, gagctggctccctatcccaagag dbSNP:606231197
748 748 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_001032384
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 5, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu06312
Accession Version NM_144495.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 513bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CN292761.1, AJ973593.1 and BC012358.1. On Nov 21, 2009 this sequence version replaced gi:41281714. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (7) contains a different 5' UTR and lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. The resulting protein (isoform 3) is shorter when it is compared to isoform 1. Variant 7 is also known as variant PQBP-1d. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: BF529979.1, AJ973593.1 [ECO:0000331] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)139..141(+)
Misc Feature(2)334..429(+)
Misc Feature(3)379..414(+)
Exon (1)1..171
Gene Synonym:
Exon (2)172..256
Gene Synonym:
Exon (3)257..368
Gene Synonym:
Exon (4)369..481
Gene Synonym:
Exon (5)482..545
Gene Synonym:
Exon (6)546..761
Gene Synonym:
Position Chain Variation Link
232 232 a, g dbSNP:202071384
383 383 a, g dbSNP:121917899
453 453 a, g dbSNP:398124212
543 543 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_144495
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 7, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu09339
Accession Version NM_001167989.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 795bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 4
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CN292761.1, BI818141.1, AJ973606.1, BE385548.1, AJ973597.1 and CD365745.1. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (8) differs in the 5' UTR and uses a different splice site in the 3' coding region, compared to variant 1. The resulting protein (isoform 4) is shorter by 1 aa when it is compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BI818141.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)14..16(+)
Misc Feature(2)260..355(+)
Misc Feature(3)401..403(+)
Misc Feature(4)431..535(+)
Misc Feature(5)536..553(+)
Misc Feature(6)569..610(+)
Misc Feature(7)851..883(+)
Misc Feature(8)857..859(+)
Exon (1)1..103
Gene Synonym:
Exon (2)104..188
Gene Synonym:
Exon (3)189..300
Gene Synonym:
Exon (4)301..413
Gene Synonym:
Exon (5)414..698
Gene Synonym:
Exon (6)699..759
Gene Synonym:
Exon (7)760..977
Gene Synonym:
Position Chain Variation Link
164 164 a, g dbSNP:202071384
315 315 a, g dbSNP:121917899
385 385 a, g dbSNP:398124212
455 455 -, aggggccatgacaagtcggac dbSNP:606231198
497 497 a, c, g dbSNP:28372358
514 514 a, t dbSNP:28489209
580 580 -, agag dbSNP:606231194
581 581 -, ag dbSNP:606231193
582 582 -, ag dbSNP:606231195
668 668 -, gagctggctccctatcccaagag dbSNP:606231197
757 757 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_001167989
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 8, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu04106
Accession Version NM_001167990.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 774bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 5
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CD051018.1 and BC012358.1. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (9) differs in the 5' UTR and uses a different splice site in the coding region, compared to variant 1. The resulting protein (isoform 5) is shorter when it is compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: CD051018.1, CD050623.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2144335, SAMEA2145245 [ECO:0000348] ##Evidence-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Exon (1)1..85
Gene Synonym:
Exon (2)86..170
Gene Synonym:
Exon (3)171..258
Gene Synonym:
Exon (4)259..371
Gene Synonym:
Exon (5)372..656
Gene Synonym:
Exon (6)657..720
Gene Synonym:
Exon (7)721..936
Gene Synonym:
Position Chain Variation Link
146 146 a, g dbSNP:202071384
273 273 a, g dbSNP:121917899
343 343 a, g dbSNP:398124212
413 413 -, aggggccatgacaagtcggac dbSNP:606231198
455 455 a, c, g dbSNP:28372358
472 472 a, t dbSNP:28489209
538 538 -, agag dbSNP:606231194
539 539 -, ag dbSNP:606231193
540 540 -, ag dbSNP:606231195
626 626 -, gagctggctccctatcccaagag dbSNP:606231197
718 718 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_001167990
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 9, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu09316
Accession Version NM_001167992.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 498bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product polyglutamine-binding protein 1 isoform 6
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CN292761.1, AJ973605.1 and BC012358.1. Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked mental retardation. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene.[provided by RefSeq, Nov 2009]. Transcript Variant: This variant (10) lacks a 5' UTR and uses different splice sites in the coding region, compared to variant 1. The resulting protein (isoform 6) is shorter when it is compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AJ973605.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Exon (1)1..85
Gene Synonym:
Exon (2)86..197
Gene Synonym:
Exon (3)198..219
Gene Synonym:
Exon (4)220..295
Gene Synonym:
Exon (5)296..359
Gene Synonym:
Exon (6)360..575
Gene Synonym:
Position Chain Variation Link
61 61 a, g dbSNP:202071384
212 212 a, g dbSNP:121917899
265 265 -, gagctggctccctatcccaagag dbSNP:606231197
357 357 -, c dbSNP:606231196

Target ORF information:

RefSeq Version NM_001167992
Organism Homo sapiens (human)
Definition Homo sapiens polyglutamine binding protein 1 (PQBP1), transcript variant 10, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.