Email to GenScript

SLC25A13 solute carrier family 25 (aspartate/glutamate carrier), member 13 [Homo sapiens (human)]

Gene Symbol SLC25A13
Entrez Gene ID 10165
Full Name solute carrier family 25 (aspartate/glutamate carrier), member 13
Synonyms ARALAR2, CITRIN, CTLN2
General protein information
Preferred Names
calcium-binding mitochondrial carrier protein Aralar2
Names
calcium-binding mitochondrial carrier protein Aralar2
mitochondrial aspartate glutamate carrier 2
solute carrier family 25, member 13 (citrin)
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

7

7q21.3

Summary This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2+) binding motifs in the N-terminal domain, and localizes to mitochondria. The protein catalyzes the exchange of aspartate for glutamate and a proton across the inner mitochondrial membrane, and is stimulated by calcium on the external side of the inner mitochondrial membrane. Mutations in this gene result in citrullinemia, type II. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]. lac of sum
Disorder MIM:

603859

Disorder Html: Citrullinemia, adult-onset type II, 603471 (3); Citrullinemia,





The following SLC25A13 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the SLC25A13 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu41332 XM_006715831 PREDICTED: Homo sapiens solute carrier family 25 (aspartate/glutamate carrier), member 13 (SLC25A13), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu63739 XM_011515727 PREDICTED: Homo sapiens solute carrier family 25 (aspartate/glutamate carrier), member 13 (SLC25A13), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319
OHu63740 XM_011515728 PREDICTED: Homo sapiens solute carrier family 25 (aspartate/glutamate carrier), member 13 (SLC25A13), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $319
OHu27423 NM_014251 Homo sapiens solute carrier family 25 (aspartate/glutamate carrier), member 13 (SLC25A13), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector in pcDNA3.1+/C-(K)DYK $379
OHu26637 NM_001160210 Homo sapiens solute carrier family 25 (aspartate/glutamate carrier), member 13 (SLC25A13), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 $379

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.


CloneID OHu41332
Accession Version XM_006715831.2
Sequence Information ORF Nucleotide Sequence (Length: 2061bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product calcium-binding mitochondrial carrier protein Aralar2 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_007933.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578813863. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
ATGCCAACAC ATGGCAAAGT AAAGGGGGAA GGAGATTTTC TGCTGCATGT GGCTTTAACC 
AAGAGAGCAG ATCCAGCTGA GCTTAGAACA ATATTTTTGA AGTATGCAAG CATTGAGAAA
AACGGTGAAT TTTTCATGTC CCCCAATGAC TTTGTCACTC GATACTTGAA CATTTTTGGA
GAAAGCCAGC CTAATCCAAA GACTGTGGAA CTTTTAAGTG GAGTGGTGGA TCAGACCAAA
GATGGATTAA TATCTTTTCA AGAATTTGTT GCCTTTGAAT CTGTCCTGTG TGCCCCTGAT
GCTTTGTTTA TGGTAGCCTT TCAGCTGTTT GACAAAGCTG GCAAAGGAGA AGTAACTTTT
GAGGATGTTA AGCAAGTTTT TGGACAGACC ACAATTCATC AACATATTCC ATTTAACTGG
GATTCAGAAT TTGTGCAACT ACATTTTGGA AAAGAAAGAA AAAGACACCT GACATATGCG
GAATTTACTC AGTTTTTATT GGAAATACAA CTGGAGCACG CAAAGCAAGC CTTTGTGCAA
CGGGACAATG CTAGGACTGG GAGAGTCACA GCCATCGACT TCCGAGACAT CATGGTCACC
ATCCGCCCCC ATGTCTTGAC TCCTTTTGTA GAAGAATGTC TAGTAGCTGC TGCTGGAGGT
ACCACATCCC ATCAAGTTAG TTTCTCCTAT TTTAATGGAT TTAATTCGCT CCTTAACAAC
ATGGAACTCA TTAGAAAGAT CTATAGCACT CTGGCTGGCA CCAGGAAAGA TGTTGAAGTG
ACTAAGGAGG AGTTTGTTCT GGCAGCTCAG AAATTTGGTC AGGTTACACC CATGGAAGTT
GACATCTTGT TTCAGTTAGC AGATTTATAT GAGCCAAGGG GACGTATGAC CTTAGCAGAC
ATTGAACGGA TTGCTCCTCT GGAAGAGGGA ACTCTGCCCT TTAACTTGGC TGAGGCCCAG
AGGCAGAAGG CCTCAGGTGA TTCAGCTCGA CCAGTTCTTC TACAAGTTGC AGAGTCGGCC
TACAGGTTTG GTCTGGGTTC TGTTGCTGGA GCTGTTGGAG CCACTGCTGT GTATCCTATC
GATCTTGTAA AAACTCGAAT GCAGAACCAA CGATCAACTG GCTCTTTTGT GGGAGAACTC
ATGTATAAAA ACAGCTTTGA CTGTTTTAAG AAAGTGCTAC GCTATGAAGG CTTCTTTGGA
CTGTATAGAG GTCTGTTGCC ACAGTTATTG GGAGTTGCCC CAGAGAAGGC CATAAAACTT
ACAGTGAACG ATTTTGTGAG GGATAAATTT ATGCACAAAG ATGGTTCGGT CCCACTTGCA
GCAGAAATTC TTGCTGGAGG CTGCGCTGGA GGCTCCCAGG TGATTTTCAC AAATCCTTTA
GAAATCGTCA AGATCCGTTT GCAAGTGGCA GGAGAAATCA CCACTGGTCC TCGAGTCAGT
GCTCTGTCTG TCGTGCGGGA CCTGGGGTTT TTTGGGATCT ACAAGGGTGC CAAAGCATGC
TTTCTGCGGG ACATTCCTTT CTCGGCCATC TACTTTCCGT GCTATGCTCA TGTGAAGGCT
TCCTTTGCAA ATGAAGATGG GCAGGTTAGC CCAGGAAGCC TGCTCTTAGC TGGTGCCATA
GCTGGTATGC CTGCAGCATC TTTAGTGACC CCTGCTGATG TTATCAAGAC GAGATTACAG
GTGGCTGCCC GGGCTGGCCA AACCACTTAC AGCGGAGTGA TAGACTGCTT TAGAAAGATA
CTGCGTGAAG AAGGACCAAA AGCTCTGTGG AAGGGAGCTG GTGCTCGTGT ATTTCGATCC
TCACCCCAGT TTGGTGTAAC TTTGCTGACT TACGAATTGC TACAGCGATG GTTCTACATT
GATTTTGGAG GAGTAAAACC CATGGGATCA GAGCCAGTTC CTAAATCCAG GATCAACCTG
CCTGCCCCGA ATCCTGATCA CGTTGGGGGC TACAAACTGG CAGTTGCTAC ATTTGCAGGG
ATTGAAAACA AATTTGGACT TTACCTACCT CTCTTCAAGC CATCAGTATC TACCTCAAAG
GCTATTGGTG GAGGCCCATA G
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_006715894.1
CDS38..2098
Misc Feature(1)125..313(+)
Misc Feature(2)143..301(+)
Misc Feature(3)155..313(+)
Misc Feature(4)1049..1840(+)
Misc Feature(5)1061..1339(+)
Misc Feature(6)1340..1603(+)
Misc Feature(7)1616..1891(+)
Translation
Position Chain Variation Link
99 99 a, g dbSNP:766641322
102 102 a, g dbSNP:755872035
104 104 a, g dbSNP:762899051
110 110 c, g dbSNP:773343761
111 111 c, t dbSNP:768418425
112 112 a, c dbSNP:181241302
115 115 a, c, t dbSNP:142466552
119 119 a, c dbSNP:771894421
130 130 a, g dbSNP:745497684
139 139 a, g dbSNP:778488962
140 140 c, t dbSNP:772019460
143 143 a, g dbSNP:759288496
150 150 g, t dbSNP:774203119
154 154 a, g dbSNP:770435848
155 155 a, g dbSNP:749030455
160 160 c, t dbSNP:777148254
163 163 c, t dbSNP:78430478
172 172 c, t dbSNP:754849153
173 173 a, g dbSNP:534452813
175 175 g, t dbSNP:781747984
180 180 c, g dbSNP:755544504
184 184 a, t dbSNP:751912314
197 197 c, t dbSNP:780525233
213 213 g, t dbSNP:368174754
216 216 a, g dbSNP:750698657
224 224 a, c dbSNP:142803277
228 228 c, g, t dbSNP:753950441
229 229 c, t dbSNP:767377944
231 231 a, c dbSNP:759484573
242 242 a, g dbSNP:774007506
245 245 a, g dbSNP:543029000
246 246 a, g dbSNP:762486181
251 251 c, t dbSNP:772971102
254 254 a, g dbSNP:111822068
255 255 a, g dbSNP:577901657
263 263 a, g dbSNP:747592860
273 273 c, g dbSNP:148573021
275 275 a, g dbSNP:567369040
281 281 c, g dbSNP:769271204
305 305 a, g, t dbSNP:754907957
318 318 a, c dbSNP:11558673
320 320 g, t dbSNP:751559996
325 325 a, g dbSNP:369071668
329 329 a, g dbSNP:543960516
332 332 a, c, t dbSNP:764922613
339 339 c, t dbSNP:761613642
350 350 a, g dbSNP:144837288
353 353 a, g dbSNP:768319437
354 354 a, c, t dbSNP:202010157
372 372 a, g dbSNP:747451386
376 376 c, t dbSNP:565008080
388 388 a, g dbSNP:772488794
400 400 a, g dbSNP:200987267
402 402 a, g dbSNP:766809778
408 408 a, g dbSNP:763505667
419 419 a, g dbSNP:370370192
425 425 a, g dbSNP:180944633
439 439 a, c dbSNP:149862016
459 459 a, c dbSNP:776667392
475 475 a, c dbSNP:768953296
478 478 a, g dbSNP:188486690
481 481 c, t dbSNP:775726518
491 491 a, g dbSNP:1131697
495 495 a, g dbSNP:148329449
498 498 a, t dbSNP:534989975
502 502 a, g dbSNP:755913787
503 503 c, t dbSNP:748000430
508 508 g, t dbSNP:140121008
516 516 c, t dbSNP:766541414
517 517 a, g dbSNP:760730497
524 524 a, g dbSNP:146131228
525 525 c, t dbSNP:751052385
546 546 a, g dbSNP:185718615
553 553 a, g dbSNP:762752651
557 557 a, g dbSNP:554663995
558 558 a, c dbSNP:757853711
572 572 a, g dbSNP:749978956
575 575 c, t dbSNP:779220022
577 577 a, g dbSNP:757796108
578 578 a, c, t dbSNP:111674765
579 579 a, g, t dbSNP:373362761
581 581 c, g dbSNP:767877590
586 586 c, t dbSNP:759498200
595 595 c, t dbSNP:774496891
598 598 c, g dbSNP:769565327
604 604 c, g, t dbSNP:776288888
605 605 a, g dbSNP:768500587
613 613 c, t dbSNP:370372951
614 614 a, g dbSNP:779617287
620 620 c, t dbSNP:80338716
621 621 a, g dbSNP:142427515
628 628 c, t dbSNP:181615775
641 641 c, t dbSNP:199744651
642 642 a, g dbSNP:376257669
644 644 a, c dbSNP:778267843
646 646 a, c, g dbSNP:753114158
650 650 a, g dbSNP:369939105
667 667 a, g dbSNP:759822371
678 678 -, gtct dbSNP:762941850
679 679 a, g dbSNP:751566503
688 688 c, t dbSNP:748759601
705 705 c, t dbSNP:137944390
717 717 a, g dbSNP:756716537
722 722 a, t dbSNP:748471758
725 725 c, t dbSNP:781721358
730 730 a, t dbSNP:755154931
735 735 g, t dbSNP:751869317
736 736 a, c dbSNP:200838637
744 744 a, c, t dbSNP:80338719
745 745 a, g dbSNP:78247004
748 748 c, g dbSNP:760655625
753 753 a, g dbSNP:775234166
756 756 -, a dbSNP:776937362
758 758 a, g dbSNP:767411822
763 763 a, c, t dbSNP:773995033
764 764 a, c dbSNP:10255762
778 778 c, g dbSNP:770492749
780 780 a, g dbSNP:748764269
783 783 a, g dbSNP:772867693
790 790 a, g dbSNP:545794488
793 793 c, t dbSNP:577055233
802 802 c, g dbSNP:749488819
803 803 a, g dbSNP:748735749
812 812 a, g dbSNP:781400809
821 821 a, g dbSNP:755315210
823 823 a, g dbSNP:747341156
826 826 a, g dbSNP:141152495
832 832 -, tgtt dbSNP:777405773
838 838 a, g dbSNP:772252278
845 845 c, g dbSNP:746155190
847 847 c, g dbSNP:778949203
849 849 a, g dbSNP:201756776
859 859 c, g dbSNP:187852403
860 860 a, g dbSNP:531991442
871 871 a, g dbSNP:781140919
876 876 c, t dbSNP:754890303
879 879 a, g dbSNP:751343245
880 880 c, t dbSNP:766122989
893 893 c, t dbSNP:200220428
899 899 a, g dbSNP:750041862
918 918 a, g dbSNP:544756381
920 920 c, t dbSNP:774717064
921 921 -, gtat dbSNP:80338720
921 921 a, g dbSNP:771117913
922 922 -, tatg dbSNP:569808959
932 932 a, c, g dbSNP:148206472
939 939 c, t dbSNP:143181462
944 944 c, t dbSNP:142308242
945 945 a, g dbSNP:375472754
947 947 a, c dbSNP:748268201
951 951 c, t dbSNP:780101587
952 952 c, t dbSNP:138094550
953 953 c, g, t dbSNP:778893487
958 958 a, g dbSNP:372848335
961 961 a, g dbSNP:753493066
966 966 a, g dbSNP:763820287
1000 1000 g, t dbSNP:755512817
1001 1001 c, t dbSNP:752281398
1008 1008 c, t dbSNP:755469215
1012 1012 a, g dbSNP:752114544
1016 1016 a, g dbSNP:766917149
1025 1025 c, g dbSNP:763191789
1026 1026 c, g, t dbSNP:771449632
1030 1030 a, g dbSNP:765358773
1036 1036 c, t dbSNP:113850932
1039 1039 a, g dbSNP:762137400
1048 1048 a, g dbSNP:776848302
1050 1050 -, ag dbSNP:764401478
1051 1051 g, t dbSNP:768915439
1054 1054 a, g dbSNP:760851084
1060 1060 a, c, t dbSNP:534585904
1068 1068 g, t dbSNP:770931172
1069 1069 g, t dbSNP:748986342
1070 1070 a, c, g dbSNP:769297213
1076 1076 a, t dbSNP:747861059
1078 1078 c, t dbSNP:780663014
1091 1091 a, g dbSNP:769683303
1099 1099 c, t dbSNP:747945892
1115 1115 a, g dbSNP:780785774
1117 1117 c, t dbSNP:768322999
1121 1121 a, c dbSNP:746502556
1132 1132 c, t dbSNP:779657849
1133 1133 c, t dbSNP:758827458
1134 1134 a, g, t dbSNP:398122839
1148 1148 c, t dbSNP:80338721
1153 1153 a, t dbSNP:202177210
1154 1154 a, g dbSNP:576650917
1158 1158 g, t dbSNP:35996658
1178 1178 a, g dbSNP:142386709
1180 1180 a, g dbSNP:767699888
1206 1206 a, t dbSNP:200427603
1214 1214 c, t dbSNP:762784067
1222 1222 c, t dbSNP:540364299
1226 1226 a, c, g dbSNP:761550839
1227 1227 g, t dbSNP:776461118
1231 1231 -, t dbSNP:59507540
1239 1239 a, t dbSNP:574856683
1240 1240 g, t dbSNP:377724262
1242 1242 a, g dbSNP:774850623
1243 1243 g, t dbSNP:762925301
1256 1256 c, t dbSNP:760401530
1264 1264 a, g, t dbSNP:2301629
1267 1267 a, g dbSNP:373876605
1276 1276 c, t dbSNP:774051691
1289 1289 a, g dbSNP:369195484
1300 1300 a, c dbSNP:150021522
1301 1301 a, g dbSNP:768922690
1306 1306 c, t dbSNP:747257110
1307 1307 a, g dbSNP:780268583
1313 1313 a, g dbSNP:758406317
1330 1330 a, g dbSNP:750535328
1332 1332 a, c dbSNP:140440047
1336 1336 a, g dbSNP:777639882
1337 1337 a, g, t dbSNP:553863381
1345 1345 a, g dbSNP:376416252
1352 1352 c, t dbSNP:759211846
1353 1353 c, t dbSNP:751195180
1364 1364 a, g dbSNP:766130485
1380 1380 a, g dbSNP:151256859
1390 1390 c, t dbSNP:373629670
1392 1392 c, t dbSNP:781202495
1393 1393 c, t dbSNP:754659147
1406 1406 a, c dbSNP:200237622
1410 1410 a, g dbSNP:766077420
1418 1418 g, t dbSNP:758167270
1423 1423 c, t dbSNP:267601652
1424 1424 a, g dbSNP:143877538
1429 1429 g, t dbSNP:764716490
1433 1433 c, t dbSNP:761402505
1434 1434 a, c, g dbSNP:764693182
1441 1441 a, g dbSNP:576739220
1444 1444 a, g dbSNP:115266882
1450 1450 a, g dbSNP:772250175
1458 1458 a, c dbSNP:746153244
1461 1461 c, g dbSNP:774476574
1462 1462 g, t dbSNP:770856997
1463 1463 g, t dbSNP:372216502
1469 1469 c, t dbSNP:540149539
1470 1470 g, t dbSNP:754985592
1476 1476 -, g dbSNP:747368721
1478 1478 a, g dbSNP:746775592
1483 1483 c, g dbSNP:780063972
1485 1485 c, g, t dbSNP:749990010
1486 1486 -, tgtc dbSNP:773624358
1486 1486 c, t dbSNP:764951987
1489 1489 c, t dbSNP:201598915
1490 1490 a, g dbSNP:554809009
1493 1493 c, t dbSNP:753411740
1494 1494 a, g dbSNP:764488086
1495 1495 a, g dbSNP:761211929
1504 1504 a, g, t dbSNP:146111714
1508 1508 c, t dbSNP:759905821
1515 1515 c, t dbSNP:774369510
1521 1521 a, g dbSNP:367988218
1522 1522 a, g dbSNP:771211154
1535 1535 c, t dbSNP:766485284
1544 1544 c, t dbSNP:763272772
1545 1545 a, g, t dbSNP:769939259
1553 1553 c, g dbSNP:761992118
1556 1556 -, ttct dbSNP:756182703
1561 1561 a, g dbSNP:775532487
1567 1567 c, g dbSNP:772157920
1573 1573 c, t dbSNP:745628778
1574 1574 c, g dbSNP:186863471
1575 1575 c, t dbSNP:139149160
1576 1576 a, g dbSNP:144494809
1581 1581 a, g dbSNP:777414201
1589 1589 a, g, t dbSNP:11558671
1605 1605 c, t dbSNP:752235032
1606 1606 a, t dbSNP:781625058
1608 1608 a, g dbSNP:369962634
1609 1609 g, t dbSNP:751836823
1614 1614 a, t dbSNP:766827198
1617 1617 g, t dbSNP:763244253
1618 1618 c, g dbSNP:750610043
1620 1620 a, c dbSNP:765591535
1636 1636 c, t dbSNP:771908277
1638 1638 c, t dbSNP:139455686
1655 1655 a, g dbSNP:772104865
1656 1656 g, t dbSNP:375405382
1662 1662 a, g dbSNP:80338724
1666 1666 c, g dbSNP:202144038
1675 1675 a, t dbSNP:776103327
1678 1678 c, t dbSNP:768148130
1680 1680 -, t dbSNP:750225643
1682 1682 g, t dbSNP:746535755
1683 1683 g, t dbSNP:780566134
1686 1686 a, c, t dbSNP:746205031
1688 1688 c, t dbSNP:75622628
1696 1696 c, t dbSNP:757541654
1701 1701 c, t dbSNP:754054414
1702 1702 c, g dbSNP:544174452
1705 1705 a, g dbSNP:756177534
1707 1707 c, g, t dbSNP:548769905
1708 1708 a, g dbSNP:143706021
1723 1723 -, tgc dbSNP:781077173
1724 1724 a, g dbSNP:367948961
1726 1726 a, c dbSNP:765072433
1727 1727 c, t dbSNP:761602352
1728 1728 a, c, g dbSNP:201283753
1729 1729 a, g dbSNP:760210666
1730 1730 -, gagattacaggtggctgcccggg dbSNP:80338725
1730 1730 c, g dbSNP:774907889
1733 1733 a, g dbSNP:772632837
1735 1735 c, t dbSNP:199735534
1736 1736 c, g dbSNP:779579089
1740 1740 c, t dbSNP:771352563
1741 1741 c, t dbSNP:79886797
1743 1743 c, t dbSNP:777999410
1747 1747 c, g dbSNP:201168119
1750 1750 c, t dbSNP:150082469
1751 1751 a, g dbSNP:142801864
1754 1754 a, g dbSNP:758317710
1764 1764 c, g dbSNP:750300786
1765 1765 c, t dbSNP:765192701
1776 1776 c, t dbSNP:200236841
1781 1781 c, t dbSNP:753626243
1782 1782 a, g dbSNP:187260240
1792 1792 a, g dbSNP:760315798
1795 1795 a, g dbSNP:775054829
1809 1809 a, g dbSNP:771652951
1815 1815 c, g dbSNP:759119965
1819 1819 c, t dbSNP:774955681
1822 1822 c, t dbSNP:774049761
1823 1823 c, t dbSNP:370997026
1824 1824 a, g dbSNP:367770143
1833 1833 a, g dbSNP:121908532
1840 1840 a, t dbSNP:769993871
1841 1841 c, t dbSNP:748548237
1847 1847 c, t dbSNP:776787438
1851 1851 a, g dbSNP:373632138
1857 1857 c, t dbSNP:747060193
1866 1866 c, t dbSNP:780179331
1867 1867 a, t dbSNP:757177279
1869 1869 -, a dbSNP:80338726
1870 1870 a, c, t dbSNP:765919667
1871 1871 a, g, t dbSNP:80338727
1879 1879 a, g dbSNP:755823140
1883 1883 c, t dbSNP:80338729
1884 1884 a, g dbSNP:548194276
1893 1893 a, g dbSNP:754713031
1898 1898 c, g dbSNP:751109329
1915 1915 a, g dbSNP:751199034
1920 1920 c, t dbSNP:779855647
1922 1922 a, g dbSNP:757805685
1924 1924 a, c dbSNP:760572056
1939 1939 c, t dbSNP:201931382
1946 1946 a, g dbSNP:200001052
1953 1953 a, t dbSNP:765632410
1954 1954 c, t dbSNP:35539807
1965 1965 c, t dbSNP:573420716
1966 1966 a, g dbSNP:764388459
1973 1973 g, t dbSNP:761035791
1979 1979 a, g, t dbSNP:151330313
1980 1980 c, g, t dbSNP:148962110
1987 1987 c, t dbSNP:769610597
2006 2006 a, g dbSNP:748153245
2012 2012 a, g dbSNP:781292740
2013 2013 c, t dbSNP:768497028
2015 2015 c, g dbSNP:757317844
2031 2031 c, t dbSNP:779551695
2040 2040 a, c dbSNP:758111197
2045 2045 a, c dbSNP:749897928
2056 2056 a, g dbSNP:778545092
2060 2060 a, t dbSNP:756776797
2064 2064 c, t dbSNP:754280216
2078 2078 g, t dbSNP:764619502
2082 2082 c, t dbSNP:760982579
2091 2091 g, t dbSNP:753105901
2092 2092 c, g dbSNP:767600441
2096 2096 a, t dbSNP:759865234
2099 2099 a, g dbSNP:774277675
2100 2100 a, g dbSNP:770984153
2102 2102 a, g dbSNP:763129811
2110 2110 c, g dbSNP:776668360
2123 2123 g, t dbSNP:369129587
2124 2124 c, t dbSNP:746771215
2137 2137 a, g dbSNP:779968341
2138 2138 c, t dbSNP:542828845
2139 2139 c, g, t dbSNP:778438712
2145 2145 a, g dbSNP:201342924
2150 2150 -, taaagaa dbSNP:773526278
2153 2153 g, t dbSNP:748822378
2155 2155 c, t dbSNP:778227631
2156 2156 -, c dbSNP:772510276
2162 2162 a, g dbSNP:554694466
2163 2163 g, t dbSNP:752996116
2166 2166 c, t dbSNP:767980169
2170 2170 a, g dbSNP:755310327
2182 2182 c, t dbSNP:751738128
2189 2189 a, c dbSNP:766538572
2190 2190 c, t dbSNP:763076851
2191 2191 a, g, t dbSNP:537886271
2193 2193 c, t dbSNP:568872413
2194 2194 a, c dbSNP:558547802
2198 2198 a, t dbSNP:771836656
2221 2221 c, t dbSNP:1044257
2231 2231 a, g dbSNP:745685828
2238 2238 a, g dbSNP:774009051
2253 2253 a, g dbSNP:770621452
2264 2264 a, c dbSNP:538940266
2272 2272 c, g dbSNP:566627365
2273 2273 a, g dbSNP:144877897
2289 2289 c, t dbSNP:529835831
2317 2317 a, g dbSNP:762859440
2350 2350 a, g dbSNP:140968602
2371 2371 g, t dbSNP:771843737
2377 2377 g, t dbSNP:550661000
2399 2399 -, g dbSNP:34219676
2407 2407 c, g dbSNP:373207040
2408 2408 c, t dbSNP:530869704
2476 2476 c, t dbSNP:781554158
2478 2478 a, g dbSNP:377554502
2495 2495 g, t dbSNP:192117485
2524 2524 c, t dbSNP:187381119
2554 2554 a, g dbSNP:766684721
2576 2576 a, c dbSNP:758761551
2579 2579 c, t dbSNP:182837763
2597 2597 a, c dbSNP:765351576
2601 2601 c, t dbSNP:559778122
2665 2665 a, t dbSNP:761805247
2668 2668 a, g dbSNP:147716687
2685 2685 c, t dbSNP:574148664
2689 2689 a, g dbSNP:376925315
2701 2701 a, t dbSNP:767379676
2702 2702 a, g dbSNP:544333452
2718 2718 -, g dbSNP:761315073
2720 2720 c, t dbSNP:575375923
2777 2777 -, atgtag dbSNP:532132551
2819 2819 c, t dbSNP:558607926
2825 2825 a, g dbSNP:759111517
2827 2827 a, g dbSNP:373153995
2831 2831 a, c dbSNP:538235683
2848 2848 c, t dbSNP:770563944
2878 2878 g, t dbSNP:368958557
2890 2890 c, t dbSNP:574119069
2901 2901 a, g dbSNP:769226693
2918 2918 a, g dbSNP:190889565
2922 2922 c, t dbSNP:747643423
2949 2949 c, t dbSNP:536495851
2960 2960 a, g dbSNP:567130517
2979 2979 g, t dbSNP:769090840
2981 2981 c, t dbSNP:747397637
2990 2990 -, g dbSNP:564859105
2998 2998 c, t dbSNP:780624692
3007 3007 c, g dbSNP:550323481
3020 3020 a, t dbSNP:750607799
3027 3027 c, t dbSNP:774373729
3043 3043 -, ccac dbSNP:760416565
3058 3058 c, t dbSNP:185634028

Target ORF information:

RefSeq Version XM_006715831
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens solute carrier family 25 (aspartate/glutamate carrier), member 13 (SLC25A13), transcript variant X1, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_006715831

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
ATGCCAACAC ATGGCAAAGT AAAGGGGGAA GGAGATTTTC TGCTGCATGT GGCTTTAACC 
AAGAGAGCAG ATCCAGCTGA GCTTAGAACA ATATTTTTGA AGTATGCAAG CATTGAGAAA
AACGGTGAAT TTTTCATGTC CCCCAATGAC TTTGTCACTC GATACTTGAA CATTTTTGGA
GAAAGCCAGC CTAATCCAAA GACTGTGGAA CTTTTAAGTG GAGTGGTGGA TCAGACCAAA
GATGGATTAA TATCTTTTCA AGAATTTGTT GCCTTTGAAT CTGTCCTGTG TGCCCCTGAT
GCTTTGTTTA TGGTAGCCTT TCAGCTGTTT GACAAAGCTG GCAAAGGAGA AGTAACTTTT
GAGGATGTTA AGCAAGTTTT TGGACAGACC ACAATTCATC AACATATTCC ATTTAACTGG
GATTCAGAAT TTGTGCAACT ACATTTTGGA AAAGAAAGAA AAAGACACCT GACATATGCG
GAATTTACTC AGTTTTTATT GGAAATACAA CTGGAGCACG CAAAGCAAGC CTTTGTGCAA
CGGGACAATG CTAGGACTGG GAGAGTCACA GCCATCGACT TCCGAGACAT CATGGTCACC
ATCCGCCCCC ATGTCTTGAC TCCTTTTGTA GAAGAATGTC TAGTAGCTGC TGCTGGAGGT
ACCACATCCC ATCAAGTTAG TTTCTCCTAT TTTAATGGAT TTAATTCGCT CCTTAACAAC
ATGGAACTCA TTAGAAAGAT CTATAGCACT CTGGCTGGCA CCAGGAAAGA TGTTGAAGTG
ACTAAGGAGG AGTTTGTTCT GGCAGCTCAG AAATTTGGTC AGGTTACACC CATGGAAGTT
GACATCTTGT TTCAGTTAGC AGATTTATAT GAGCCAAGGG GACGTATGAC CTTAGCAGAC
ATTGAACGGA TTGCTCCTCT GGAAGAGGGA ACTCTGCCCT TTAACTTGGC TGAGGCCCAG
AGGCAGAAGG CCTCAGGTGA TTCAGCTCGA CCAGTTCTTC TACAAGTTGC AGAGTCGGCC
TACAGGTTTG GTCTGGGTTC TGTTGCTGGA GCTGTTGGAG CCACTGCTGT GTATCCTATC
GATCTTGTAA AAACTCGAAT GCAGAACCAA CGATCAACTG GCTCTTTTGT GGGAGAACTC
ATGTATAAAA ACAGCTTTGA CTGTTTTAAG AAAGTGCTAC GCTATGAAGG CTTCTTTGGA
CTGTATAGAG GTCTGTTGCC ACAGTTATTG GGAGTTGCCC CAGAGAAGGC CATAAAACTT
ACAGTGAACG ATTTTGTGAG GGATAAATTT ATGCACAAAG ATGGTTCGGT CCCACTTGCA
GCAGAAATTC TTGCTGGAGG CTGCGCTGGA GGCTCCCAGG TGATTTTCAC AAATCCTTTA
GAAATCGTCA AGATCCGTTT GCAAGTGGCA GGAGAAATCA CCACTGGTCC TCGAGTCAGT
GCTCTGTCTG TCGTGCGGGA CCTGGGGTTT TTTGGGATCT ACAAGGGTGC CAAAGCATGC
TTTCTGCGGG ACATTCCTTT CTCGGCCATC TACTTTCCGT GCTATGCTCA TGTGAAGGCT
TCCTTTGCAA ATGAAGATGG GCAGGTTAGC CCAGGAAGCC TGCTCTTAGC TGGTGCCATA
GCTGGTATGC CTGCAGCATC TTTAGTGACC CCTGCTGATG TTATCAAGAC GAGATTACAG
GTGGCTGCCC GGGCTGGCCA AACCACTTAC AGCGGAGTGA TAGACTGCTT TAGAAAGATA
CTGCGTGAAG AAGGACCAAA AGCTCTGTGG AAGGGAGCTG GTGCTCGTGT ATTTCGATCC
TCACCCCAGT TTGGTGTAAC TTTGCTGACT TACGAATTGC TACAGCGATG GTTCTACATT
GATTTTGGAG GAGTAAAACC CATGGGATCA GAGCCAGTTC CTAAATCCAG GATCAACCTG
CCTGCCCCGA ATCCTGATCA CGTTGGGGGC TACAAACTGG CAGTTGCTAC ATTTGCAGGG
ATTGAAAACA AATTTGGACT TTACCTACCT CTCTTCAAGC CATCAGTATC TACCTCAAAG
GCTATTGGTG GAGGCCCATA G

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu63739
Accession Version XM_011515727.1
Sequence Information ORF Nucleotide Sequence (Length: 1371bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product calcium-binding mitochondrial carrier protein Aralar2 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_007933.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
ATGCCAACAC ATGGCAAAGT AAAGGGGGAA GGAGATTTTC TGCTGCATGT GGCTTTAACC 
AAGAGAGCAG ATCCAGCTGA GCTTAGAACA ATATTTTTGA AGTATGCAAG CATTGAGAAA
AACGGTGAAT TTTTCATGTC CCCCAATGAC TTTGTCACTC GATACTTGAA CATTTTTGGA
GAAAGCCAGC CTAATCCAAA GACTGTGGAA CTTTTAAGTG GAGTGGTGGA TCAGACCAAA
GATGGATTAA TATCTTTTCA AGAATTTGTT GCCTTTGAAT CTGTCCTGTG TGCCCCTGAT
GCTTTGTTTA TGGTAGCCTT TCAGCTGTTT GACAAAGCTG GCAAAGGAGA AGTAACTTTT
GAGGATGTTA AGCAAGTTTT TGGACAGACC ACAATTCATC AACATATTCC ATTTAACTGG
GATTCAGAAT TTGTGCAACT ACATTTTGGA AAAGAAAGAA AAAGACACCT GACATATGCG
GAATTTACTC AGTTTTTATT GGAAATACAA CTGGAGCACG CAAAGCAAGC CTTTGTGCAA
CGGGACAATG CTAGGACTGG GAGAGTCACA GCCATCGACT TCCGAGACAT CATGGTCACC
ATCCGCCCCC ATGTCTTGAC TCCTTTTGTA GAAGAATGTC TAGTAGCTGC TGCTGGAGGT
ACCACATCCC ATCAAGTTAG TTTCTCCTAT TTTAATGGAT TTAATTCGCT CCTTAACAAC
ATGGAACTCA TTAGAAAGAT CTATAGCACT CTGGCTGGCA CCAGGAAAGA TGTTGAAGTG
ACTAAGGAGG AGTTTGTTCT GGCAGCTCAG AAATTTGGTC AGGTTACACC CATGGAAGTT
GACATCTTGT TTCAGTTAGC AGATTTATAT GAGCCAAGGG GACGTATGAC CTTAGCAGAC
ATTGAACGGA TTGCTCCTCT GGAAGAGGGA ACTCTGCCCT TTAACTTGGC TGAGGCCCAG
AGGCAGAAGG CCTCAGGTGA TTCAGCTCGA CCAGTTCTTC TACAAGTTGC AGAGTCGGCC
TACAGGTTTG GTCTGGGTTC TGTTGCTGGA GCTGTTGGAG CCACTGCTGT GTATCCTATC
GATCTTGTAA AAACTCGAAT GCAGAACCAA CGATCAACTG GCTCTTTTGT GGGAGAACTC
ATGTATAAAA ACAGCTTTGA CTGTTTTAAG AAAGTGCTAC GCTATGAAGG CTTCTTTGGA
CTGTATAGAG GTCTGTTGCC ACAGTTATTG GGAGTTGCCC CAGAGAAGGC CATAAAACTT
ACAGTGAACG ATTTTGTGAG GGATAAATTT ATGCACAAAG ATGGTTCGGT CCCACTTGCA
GCAGAAATTC TTGCTGGAGG CTGCATCCTG CACAAGGGCA GAGTCTACTA G
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_011514029.1
CDS52..1422
Misc Feature(1)139..327(+)
Misc Feature(2)157..315(+)
Misc Feature(3)169..327(+)
Misc Feature(4)1075..1353(+)
Translation
Position Chain Variation Link
8 8 c, g dbSNP:558475337
113 113 a, g dbSNP:766641322
116 116 a, g dbSNP:755872035
118 118 a, g dbSNP:762899051
124 124 c, g dbSNP:773343761
125 125 c, t dbSNP:768418425
126 126 a, c dbSNP:181241302
129 129 a, c, t dbSNP:142466552
133 133 a, c dbSNP:771894421
144 144 a, g dbSNP:745497684
153 153 a, g dbSNP:778488962
154 154 c, t dbSNP:772019460
157 157 a, g dbSNP:759288496
164 164 g, t dbSNP:774203119
168 168 a, g dbSNP:770435848
169 169 a, g dbSNP:749030455
174 174 c, t dbSNP:777148254
177 177 c, t dbSNP:78430478
186 186 c, t dbSNP:754849153
187 187 a, g dbSNP:534452813
189 189 g, t dbSNP:781747984
194 194 c, g dbSNP:755544504
198 198 a, t dbSNP:751912314
211 211 c, t dbSNP:780525233
227 227 g, t dbSNP:368174754
230 230 a, g dbSNP:750698657
238 238 a, c dbSNP:142803277
242 242 c, g, t dbSNP:753950441
243 243 c, t dbSNP:767377944
245 245 a, c dbSNP:759484573
256 256 a, g dbSNP:774007506
259 259 a, g dbSNP:543029000
260 260 a, g dbSNP:762486181
265 265 c, t dbSNP:772971102
268 268 a, g dbSNP:111822068
269 269 a, g dbSNP:577901657
277 277 a, g dbSNP:747592860
287 287 c, g dbSNP:148573021
289 289 a, g dbSNP:567369040
295 295 c, g dbSNP:769271204
319 319 a, g, t dbSNP:754907957
332 332 a, c dbSNP:11558673
334 334 g, t dbSNP:751559996
339 339 a, g dbSNP:369071668
343 343 a, g dbSNP:543960516
346 346 a, c, t dbSNP:764922613
353 353 c, t dbSNP:761613642
364 364 a, g dbSNP:144837288
367 367 a, g dbSNP:768319437
368 368 a, c, t dbSNP:202010157
386 386 a, g dbSNP:747451386
390 390 c, t dbSNP:565008080
402 402 a, g dbSNP:772488794
414 414 a, g dbSNP:200987267
416 416 a, g dbSNP:766809778
422 422 a, g dbSNP:763505667
433 433 a, g dbSNP:370370192
439 439 a, g dbSNP:180944633
453 453 a, c dbSNP:149862016
473 473 a, c dbSNP:776667392
489 489 a, c dbSNP:768953296
492 492 a, g dbSNP:188486690
495 495 c, t dbSNP:775726518
505 505 a, g dbSNP:1131697
509 509 a, g dbSNP:148329449
512 512 a, t dbSNP:534989975
516 516 a, g dbSNP:755913787
517 517 c, t dbSNP:748000430
522 522 g, t dbSNP:140121008
530 530 c, t dbSNP:766541414
531 531 a, g dbSNP:760730497
538 538 a, g dbSNP:146131228
539 539 c, t dbSNP:751052385
560 560 a, g dbSNP:185718615
567 567 a, g dbSNP:762752651
571 571 a, g dbSNP:554663995
572 572 a, c dbSNP:757853711
586 586 a, g dbSNP:749978956
589 589 c, t dbSNP:779220022
591 591 a, g dbSNP:757796108
592 592 a, c, t dbSNP:111674765
593 593 a, g, t dbSNP:373362761
595 595 c, g dbSNP:767877590
600 600 c, t dbSNP:759498200
609 609 c, t dbSNP:774496891
612 612 c, g dbSNP:769565327
618 618 c, g, t dbSNP:776288888
619 619 a, g dbSNP:768500587
627 627 c, t dbSNP:370372951
628 628 a, g dbSNP:779617287
634 634 c, t dbSNP:80338716
635 635 a, g dbSNP:142427515
642 642 c, t dbSNP:181615775
655 655 c, t dbSNP:199744651
656 656 a, g dbSNP:376257669
658 658 a, c dbSNP:778267843
660 660 a, c, g dbSNP:753114158
664 664 a, g dbSNP:369939105
681 681 a, g dbSNP:759822371
692 692 -, gtct dbSNP:762941850
693 693 a, g dbSNP:751566503
702 702 c, t dbSNP:748759601
719 719 c, t dbSNP:137944390
731 731 a, g dbSNP:756716537
736 736 a, t dbSNP:748471758
739 739 c, t dbSNP:781721358
744 744 a, t dbSNP:755154931
749 749 g, t dbSNP:751869317
750 750 a, c dbSNP:200838637
758 758 a, c, t dbSNP:80338719
759 759 a, g dbSNP:78247004
762 762 c, g dbSNP:760655625
767 767 a, g dbSNP:775234166
770 770 -, a dbSNP:776937362
772 772 a, g dbSNP:767411822
777 777 a, c, t dbSNP:773995033
778 778 a, c dbSNP:10255762
792 792 c, g dbSNP:770492749
794 794 a, g dbSNP:748764269
797 797 a, g dbSNP:772867693
804 804 a, g dbSNP:545794488
807 807 c, t dbSNP:577055233
816 816 c, g dbSNP:749488819
817 817 a, g dbSNP:748735749
826 826 a, g dbSNP:781400809
835 835 a, g dbSNP:755315210
837 837 a, g dbSNP:747341156
840 840 a, g dbSNP:141152495
846 846 -, tgtt dbSNP:777405773
852 852 a, g dbSNP:772252278
859 859 c, g dbSNP:746155190
861 861 c, g dbSNP:778949203
863 863 a, g dbSNP:201756776
873 873 c, g dbSNP:187852403
874 874 a, g dbSNP:531991442
885 885 a, g dbSNP:781140919
890 890 c, t dbSNP:754890303
893 893 a, g dbSNP:751343245
894 894 c, t dbSNP:766122989
907 907 c, t dbSNP:200220428
913 913 a, g dbSNP:750041862
932 932 a, g dbSNP:544756381
934 934 c, t dbSNP:774717064
935 935 -, gtat dbSNP:80338720
935 935 a, g dbSNP:771117913
936 936 -, tatg dbSNP:569808959
946 946 a, c, g dbSNP:148206472
953 953 c, t dbSNP:143181462
958 958 c, t dbSNP:142308242
959 959 a, g dbSNP:375472754
961 961 a, c dbSNP:748268201
965 965 c, t dbSNP:780101587
966 966 c, t dbSNP:138094550
967 967 c, g, t dbSNP:778893487
972 972 a, g dbSNP:372848335
975 975 a, g dbSNP:753493066
980 980 a, g dbSNP:763820287
1014 1014 g, t dbSNP:755512817
1015 1015 c, t dbSNP:752281398
1022 1022 c, t dbSNP:755469215
1026 1026 a, g dbSNP:752114544
1030 1030 a, g dbSNP:766917149
1039 1039 c, g dbSNP:763191789
1040 1040 c, g, t dbSNP:771449632
1044 1044 a, g dbSNP:765358773
1050 1050 c, t dbSNP:113850932
1053 1053 a, g dbSNP:762137400
1062 1062 a, g dbSNP:776848302
1064 1064 -, ag dbSNP:764401478
1065 1065 g, t dbSNP:768915439
1068 1068 a, g dbSNP:760851084
1074 1074 a, c, t dbSNP:534585904
1082 1082 g, t dbSNP:770931172
1083 1083 g, t dbSNP:748986342
1084 1084 a, c, g dbSNP:769297213
1090 1090 a, t dbSNP:747861059
1092 1092 c, t dbSNP:780663014
1105 1105 a, g dbSNP:769683303
1113 1113 c, t dbSNP:747945892
1129 1129 a, g dbSNP:780785774
1131 1131 c, t dbSNP:768322999
1135 1135 a, c dbSNP:746502556
1146 1146 c, t dbSNP:779657849
1147 1147 c, t dbSNP:758827458
1148 1148 a, g, t dbSNP:398122839
1162 1162 c, t dbSNP:80338721
1167 1167 a, t dbSNP:202177210
1168 1168 a, g dbSNP:576650917
1172 1172 g, t dbSNP:35996658
1192 1192 a, g dbSNP:142386709
1194 1194 a, g dbSNP:767699888
1220 1220 a, t dbSNP:200427603
1228 1228 c, t dbSNP:762784067
1236 1236 c, t dbSNP:540364299
1240 1240 a, c, g dbSNP:761550839
1241 1241 g, t dbSNP:776461118
1245 1245 -, t dbSNP:59507540
1253 1253 a, t dbSNP:574856683
1254 1254 g, t dbSNP:377724262
1256 1256 a, g dbSNP:774850623
1257 1257 g, t dbSNP:762925301
1270 1270 c, t dbSNP:760401530
1278 1278 a, g, t dbSNP:2301629
1281 1281 a, g dbSNP:373876605
1290 1290 c, t dbSNP:774051691
1303 1303 a, g dbSNP:369195484
1314 1314 a, c dbSNP:150021522
1315 1315 a, g dbSNP:768922690
1320 1320 c, t dbSNP:747257110
1321 1321 a, g dbSNP:780268583
1327 1327 a, g dbSNP:758406317
1344 1344 a, g dbSNP:750535328
1346 1346 a, c dbSNP:140440047
1350 1350 a, g dbSNP:777639882
1351 1351 a, g, t dbSNP:553863381
1359 1359 a, g dbSNP:376416252
1366 1366 c, t dbSNP:759211846
1367 1367 c, t dbSNP:751195180
1378 1378 a, g dbSNP:766130485
1394 1394 a, g dbSNP:151256859
1412 1412 c, g dbSNP:551507765
1424 1424 a, g dbSNP:541042115
1467 1467 a, t dbSNP:555253153
1479 1479 c, t dbSNP:373629670
1481 1481 c, t dbSNP:781202495
1482 1482 c, t dbSNP:754659147
1495 1495 a, c dbSNP:200237622
1499 1499 a, g dbSNP:766077420
1507 1507 g, t dbSNP:758167270
1512 1512 c, t dbSNP:267601652
1513 1513 a, g dbSNP:143877538
1518 1518 g, t dbSNP:764716490
1522 1522 c, t dbSNP:761402505
1523 1523 a, c, g dbSNP:764693182
1530 1530 a, g dbSNP:576739220
1533 1533 a, g dbSNP:115266882
1539 1539 a, g dbSNP:772250175
1547 1547 a, c dbSNP:746153244
1550 1550 c, g dbSNP:774476574

Target ORF information:

RefSeq Version XM_011515727
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens solute carrier family 25 (aspartate/glutamate carrier), member 13 (SLC25A13), transcript variant X2, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_011515727

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
ATGCCAACAC ATGGCAAAGT AAAGGGGGAA GGAGATTTTC TGCTGCATGT GGCTTTAACC 
AAGAGAGCAG ATCCAGCTGA GCTTAGAACA ATATTTTTGA AGTATGCAAG CATTGAGAAA
AACGGTGAAT TTTTCATGTC CCCCAATGAC TTTGTCACTC GATACTTGAA CATTTTTGGA
GAAAGCCAGC CTAATCCAAA GACTGTGGAA CTTTTAAGTG GAGTGGTGGA TCAGACCAAA
GATGGATTAA TATCTTTTCA AGAATTTGTT GCCTTTGAAT CTGTCCTGTG TGCCCCTGAT
GCTTTGTTTA TGGTAGCCTT TCAGCTGTTT GACAAAGCTG GCAAAGGAGA AGTAACTTTT
GAGGATGTTA AGCAAGTTTT TGGACAGACC ACAATTCATC AACATATTCC ATTTAACTGG
GATTCAGAAT TTGTGCAACT ACATTTTGGA AAAGAAAGAA AAAGACACCT GACATATGCG
GAATTTACTC AGTTTTTATT GGAAATACAA CTGGAGCACG CAAAGCAAGC CTTTGTGCAA
CGGGACAATG CTAGGACTGG GAGAGTCACA GCCATCGACT TCCGAGACAT CATGGTCACC
ATCCGCCCCC ATGTCTTGAC TCCTTTTGTA GAAGAATGTC TAGTAGCTGC TGCTGGAGGT
ACCACATCCC ATCAAGTTAG TTTCTCCTAT TTTAATGGAT TTAATTCGCT CCTTAACAAC
ATGGAACTCA TTAGAAAGAT CTATAGCACT CTGGCTGGCA CCAGGAAAGA TGTTGAAGTG
ACTAAGGAGG AGTTTGTTCT GGCAGCTCAG AAATTTGGTC AGGTTACACC CATGGAAGTT
GACATCTTGT TTCAGTTAGC AGATTTATAT GAGCCAAGGG GACGTATGAC CTTAGCAGAC
ATTGAACGGA TTGCTCCTCT GGAAGAGGGA ACTCTGCCCT TTAACTTGGC TGAGGCCCAG
AGGCAGAAGG CCTCAGGTGA TTCAGCTCGA CCAGTTCTTC TACAAGTTGC AGAGTCGGCC
TACAGGTTTG GTCTGGGTTC TGTTGCTGGA GCTGTTGGAG CCACTGCTGT GTATCCTATC
GATCTTGTAA AAACTCGAAT GCAGAACCAA CGATCAACTG GCTCTTTTGT GGGAGAACTC
ATGTATAAAA ACAGCTTTGA CTGTTTTAAG AAAGTGCTAC GCTATGAAGG CTTCTTTGGA
CTGTATAGAG GTCTGTTGCC ACAGTTATTG GGAGTTGCCC CAGAGAAGGC CATAAAACTT
ACAGTGAACG ATTTTGTGAG GGATAAATTT ATGCACAAAG ATGGTTCGGT CCCACTTGCA
GCAGAAATTC TTGCTGGAGG CTGCATCCTG CACAAGGGCA GAGTCTACTA G

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu63740
Accession Version XM_011515728.1
Sequence Information ORF Nucleotide Sequence (Length: 1176bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product calcium-binding mitochondrial carrier protein Aralar2 isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_007933.16) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
ATGACCTTAG CAGACATTGA ACGGATTGCT CCTCTGGAAG AGGGAACTCT GCCCTTTAAC 
TTGGCTGAGG CCCAGAGGCA GAAGGCCTCA GGTGATTCAG CTCGACCAGT TCTTCTACAA
GTTGCAGAGT CGGCCTACAG GTTTGGTCTG GGTTCTGTTG CTGGAGCTGT TGGAGCCACT
GCTGTGTATC CTATCGATCT TGTAAAAACT CGAATGCAGA ACCAACGATC AACTGGCTCT
TTTGTGGGAG AACTCATGTA TAAAAACAGC TTTGACTGTT TTAAGAAAGT GCTACGCTAT
GAAGGCTTCT TTGGACTGTA TAGAGGTCTG TTGCCACAGT TATTGGGAGT TGCCCCAGAG
AAGGCCATAA AACTTACAGT GAACGATTTT GTGAGGGATA AATTTATGCA CAAAGATGGT
TCGGTCCCAC TTGCAGCAGA AATTCTTGCT GGAGGCTGCG CTGGAGGCTC CCAGGTGATT
TTCACAAATC CTTTAGAAAT CGTCAAGATC CGTTTGCAAG TGGCAGGAGA AATCACCACT
GGTCCTCGAG TCAGTGCTCT GTCTGTCGTG CGGGACCTGG GGTTTTTTGG GATCTACAAG
GGTGCCAAAG CATGCTTTCT GCGGGACATT CCTTTCTCGG CCATCTACTT TCCGTGCTAT
GCTCATGTGA AGGCTTCCTT TGCAAATGAA GATGGGCAGG TTAGCCCAGG AAGCCTGCTC
TTAGCTGGTG CCATAGCTGG TATGCCTGCA GCATCTTTAG TGACCCCTGC TGATGTTATC
AAGACGAGAT TACAGGTGGC TGCCCGGGCT GGCCAAACCA CTTACAGCGG AGTGATAGAC
TGCTTTAGAA AGATACTGCG TGAAGAAGGA CCAAAAGCTC TGTGGAAGGG AGCTGGTGCT
CGTGTATTTC GATCCTCACC CCAGTTTGGT GTAACTTTGC TGACTTACGA ATTGCTACAG
CGATGGTTCT ACATTGATTT TGGAGGAGTA AAACCCATGG GATCAGAGCC AGTTCCTAAA
TCCAGGATCA ACCTGCCTGC CCCGAATCCT GATCACGTTG GGGGCTACAA ACTGGCAGTT
GCTACATTTG CAGGGATTGA AAACAAATTT GGACTTTACC TACCTCTCTT CAAGCCATCA
GTATCTACCT CAAAGGCTAT TGGTGGAGGC CCATAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_011514030.1
CDS95..1270
Misc Feature(1)221..1012(+)
Misc Feature(2)233..511(+)
Misc Feature(3)512..775(+)
Misc Feature(4)788..1063(+)
Translation
Position Chain Variation Link
1 1 g, t dbSNP:751869317
2 2 a, c dbSNP:200838637
10 10 a, c, t dbSNP:80338719
11 11 a, g dbSNP:78247004
14 14 c, g dbSNP:760655625
19 19 a, g dbSNP:775234166
22 22 -, a dbSNP:776937362
24 24 a, g dbSNP:767411822
29 29 a, c, t dbSNP:773995033
30 30 a, c dbSNP:10255762
44 44 c, g dbSNP:770492749
46 46 a, g dbSNP:748764269
49 49 a, g dbSNP:772867693
56 56 a, g dbSNP:545794488
59 59 c, t dbSNP:577055233
68 68 c, g dbSNP:749488819
69 69 a, g dbSNP:748735749
78 78 a, g dbSNP:781400809
87 87 a, g dbSNP:755315210
89 89 a, g dbSNP:747341156
92 92 c, t dbSNP:774717064
93 93 -, gtat dbSNP:80338720
93 93 a, g dbSNP:771117913
94 94 -, tatg dbSNP:569808959
104 104 a, c, g dbSNP:148206472
111 111 c, t dbSNP:143181462
116 116 c, t dbSNP:142308242
117 117 a, g dbSNP:375472754
119 119 a, c dbSNP:748268201
123 123 c, t dbSNP:780101587
124 124 c, t dbSNP:138094550
125 125 c, g, t dbSNP:778893487
130 130 a, g dbSNP:372848335
133 133 a, g dbSNP:753493066
138 138 a, g dbSNP:763820287
172 172 g, t dbSNP:755512817
173 173 c, t dbSNP:752281398
180 180 c, t dbSNP:755469215
184 184 a, g dbSNP:752114544
188 188 a, g dbSNP:766917149
197 197 c, g dbSNP:763191789
198 198 c, g, t dbSNP:771449632
202 202 a, g dbSNP:765358773
208 208 c, t dbSNP:113850932
211 211 a, g dbSNP:762137400
220 220 a, g dbSNP:776848302
222 222 -, ag dbSNP:764401478
223 223 g, t dbSNP:768915439
226 226 a, g dbSNP:760851084
232 232 a, c, t dbSNP:534585904
240 240 g, t dbSNP:770931172
241 241 g, t dbSNP:748986342
242 242 a, c, g dbSNP:769297213
248 248 a, t dbSNP:747861059
250 250 c, t dbSNP:780663014
263 263 a, g dbSNP:769683303
271 271 c, t dbSNP:747945892
287 287 a, g dbSNP:780785774
289 289 c, t dbSNP:768322999
293 293 a, c dbSNP:746502556
304 304 c, t dbSNP:779657849
305 305 c, t dbSNP:758827458
306 306 a, g, t dbSNP:398122839
320 320 c, t dbSNP:80338721
325 325 a, t dbSNP:202177210
326 326 a, g dbSNP:576650917
330 330 g, t dbSNP:35996658
350 350 a, g dbSNP:142386709
352 352 a, g dbSNP:767699888
378 378 a, t dbSNP:200427603
386 386 c, t dbSNP:762784067
394 394 c, t dbSNP:540364299
398 398 a, c, g dbSNP:761550839
399 399 g, t dbSNP:776461118
403 403 -, t dbSNP:59507540
411 411 a, t dbSNP:574856683
412 412 g, t dbSNP:377724262
414 414 a, g dbSNP:774850623
415 415 g, t dbSNP:762925301
428 428 c, t dbSNP:760401530
436 436 a, g, t dbSNP:2301629
439 439 a, g dbSNP:373876605
448 448 c, t dbSNP:774051691
461 461 a, g dbSNP:369195484
472 472 a, c dbSNP:150021522
473 473 a, g dbSNP:768922690
478 478 c, t dbSNP:747257110
479 479 a, g dbSNP:780268583
485 485 a, g dbSNP:758406317
502 502 a, g dbSNP:750535328
504 504 a, c dbSNP:140440047
508 508 a, g dbSNP:777639882
509 509 a, g, t dbSNP:553863381
517 517 a, g dbSNP:376416252
524 524 c, t dbSNP:759211846
525 525 c, t dbSNP:751195180
536 536 a, g dbSNP:766130485
552 552 a, g dbSNP:151256859
562 562 c, t dbSNP:373629670
564 564 c, t dbSNP:781202495
565 565 c, t dbSNP:754659147
578 578 a, c dbSNP:200237622
582 582 a, g dbSNP:766077420
590 590 g, t dbSNP:758167270
595 595 c, t dbSNP:267601652
596 596 a, g dbSNP:143877538
601 601 g, t dbSNP:764716490
605 605 c, t dbSNP:761402505
606 606 a, c, g dbSNP:764693182
613 613 a, g dbSNP:576739220
616 616 a, g dbSNP:115266882
622 622 a, g dbSNP:772250175
630 630 a, c dbSNP:746153244
633 633 c, g dbSNP:774476574
634 634 g, t dbSNP:770856997
635 635 g, t dbSNP:372216502
641 641 c, t dbSNP:540149539
642 642 g, t dbSNP:754985592
648 648 -, g dbSNP:747368721
650 650 a, g dbSNP:746775592
655 655 c, g dbSNP:780063972
657 657 c, g, t dbSNP:749990010
658 658 -, tgtc dbSNP:773624358
658 658 c, t dbSNP:764951987
661 661 c, t dbSNP:201598915
662 662 a, g dbSNP:554809009
665 665 c, t dbSNP:753411740
666 666 a, g dbSNP:764488086
667 667 a, g dbSNP:761211929
676 676 a, g, t dbSNP:146111714
680 680 c, t dbSNP:759905821
687 687 c, t dbSNP:774369510
693 693 a, g dbSNP:367988218
694 694 a, g dbSNP:771211154
707 707 c, t dbSNP:766485284
716 716 c, t dbSNP:763272772
717 717 a, g, t dbSNP:769939259
725 725 c, g dbSNP:761992118
728 728 -, ttct dbSNP:756182703
733 733 a, g dbSNP:775532487
739 739 c, g dbSNP:772157920
745 745 c, t dbSNP:745628778
746 746 c, g dbSNP:186863471
747 747 c, t dbSNP:139149160
748 748 a, g dbSNP:144494809
753 753 a, g dbSNP:777414201
761 761 a, g, t dbSNP:11558671
777 777 c, t dbSNP:752235032
778 778 a, t dbSNP:781625058
780 780 a, g dbSNP:369962634
781 781 g, t dbSNP:751836823
786 786 a, t dbSNP:766827198
789 789 g, t dbSNP:763244253
790 790 c, g dbSNP:750610043
792 792 a, c dbSNP:765591535
808 808 c, t dbSNP:771908277
810 810 c, t dbSNP:139455686
827 827 a, g dbSNP:772104865
828 828 g, t dbSNP:375405382
834 834 a, g dbSNP:80338724
838 838 c, g dbSNP:202144038
847 847 a, t dbSNP:776103327
850 850 c, t dbSNP:768148130
852 852 -, t dbSNP:750225643
854 854 g, t dbSNP:746535755
855 855 g, t dbSNP:780566134
858 858 a, c, t dbSNP:746205031
860 860 c, t dbSNP:75622628
868 868 c, t dbSNP:757541654
873 873 c, t dbSNP:754054414
874 874 c, g dbSNP:544174452
877 877 a, g dbSNP:756177534
879 879 c, g, t dbSNP:548769905
880 880 a, g dbSNP:143706021
895 895 -, tgc dbSNP:781077173
896 896 a, g dbSNP:367948961
898 898 a, c dbSNP:765072433
899 899 c, t dbSNP:761602352
900 900 a, c, g dbSNP:201283753
901 901 a, g dbSNP:760210666
902 902 -, gagattacaggtggctgcccggg dbSNP:80338725
902 902 c, g dbSNP:774907889
905 905 a, g dbSNP:772632837
907 907 c, t dbSNP:199735534
908 908 c, g dbSNP:779579089
912 912 c, t dbSNP:771352563
913 913 c, t dbSNP:79886797
915 915 c, t dbSNP:777999410
919 919 c, g dbSNP:201168119
922 922 c, t dbSNP:150082469
923 923 a, g dbSNP:142801864
926 926 a, g dbSNP:758317710
936 936 c, g dbSNP:750300786
937 937 c, t dbSNP:765192701
948 948 c, t dbSNP:200236841
953 953 c, t dbSNP:753626243
954 954 a, g dbSNP:187260240
964 964 a, g dbSNP:760315798
967 967 a, g dbSNP:775054829
981 981 a, g dbSNP:771652951
987 987 c, g dbSNP:759119965
991 991 c, t dbSNP:774955681
994 994 c, t dbSNP:774049761
995 995 c, t dbSNP:370997026
996 996 a, g dbSNP:367770143
1005 1005 a, g dbSNP:121908532
1012 1012 a, t dbSNP:769993871
1013 1013 c, t dbSNP:748548237
1019 1019 c, t dbSNP:776787438
1023 1023 a, g dbSNP:373632138
1029 1029 c, t dbSNP:747060193
1038 1038 c, t dbSNP:780179331
1039 1039 a, t dbSNP:757177279
1041 1041 -, a dbSNP:80338726
1042 1042 a, c, t dbSNP:765919667
1043 1043 a, g, t dbSNP:80338727
1051 1051 a, g dbSNP:755823140
1055 1055 c, t dbSNP:80338729
1056 1056 a, g dbSNP:548194276
1065 1065 a, g dbSNP:754713031
1070 1070 c, g dbSNP:751109329
1087 1087 a, g dbSNP:751199034
1092 1092 c, t dbSNP:779855647
1094 1094 a, g dbSNP:757805685
1096 1096 a, c dbSNP:760572056
1111 1111 c, t dbSNP:201931382
1118 1118 a, g dbSNP:200001052
1125 1125 a, t dbSNP:765632410
1126 1126 c, t dbSNP:35539807
1137 1137 c, t dbSNP:573420716
1138 1138 a, g dbSNP:764388459
1145 1145 g, t dbSNP:761035791
1151 1151 a, g, t dbSNP:151330313
1152 1152 c, g, t dbSNP:148962110
1159 1159 c, t dbSNP:769610597
1178 1178 a, g dbSNP:748153245
1184 1184 a, g dbSNP:781292740
1185 1185 c, t dbSNP:768497028
1187 1187 c, g dbSNP:757317844
1203 1203 c, t dbSNP:779551695
1212 1212 a, c dbSNP:758111197
1217 1217 a, c dbSNP:749897928
1228 1228 a, g dbSNP:778545092
1232 1232 a, t dbSNP:756776797
1236 1236 c, t dbSNP:754280216
1250 1250 g, t dbSNP:764619502
1254 1254 c, t dbSNP:760982579
1263 1263 g, t dbSNP:753105901
1264 1264 c, g dbSNP:767600441
1268 1268 a, t dbSNP:759865234
1271 1271 a, g dbSNP:774277675
1272 1272 a, g dbSNP:770984153
1274 1274 a, g dbSNP:763129811
1282 1282 c, g dbSNP:776668360
1295 1295 g, t dbSNP:369129587
1296 1296 c, t dbSNP:746771215
1309 1309 a, g dbSNP:779968341
1310 1310 c, t dbSNP:542828845
1311 1311 c, g, t dbSNP:778438712
1317 1317 a, g dbSNP:201342924
1322 1322 -, taaagaa dbSNP:773526278
1325 1325 g, t dbSNP:748822378
1327 1327 c, t dbSNP:778227631
1328 1328 -, c dbSNP:772510276
1334 1334 a, g dbSNP:554694466
1335 1335 g, t dbSNP:752996116
1338 1338 c, t dbSNP:767980169
1342 1342 a, g dbSNP:755310327
1354 1354 c, t dbSNP:751738128
1361 1361 a, c dbSNP:766538572
1362 1362 c, t dbSNP:763076851
1363 1363 a, g, t dbSNP:537886271
1365 1365 c, t dbSNP:568872413
1366 1366 a, c dbSNP:558547802
1370 1370 a, t dbSNP:771836656
1393 1393 c, t dbSNP:1044257
1403 1403 a, g dbSNP:745685828
1410 1410 a, g dbSNP:774009051
1425 1425 a, g dbSNP:770621452
1436 1436 a, c dbSNP:538940266
1444 1444 c, g dbSNP:566627365
1445 1445 a, g dbSNP:144877897
1461 1461 c, t dbSNP:529835831
1489 1489 a, g dbSNP:762859440
1522 1522 a, g dbSNP:140968602
1543 1543 g, t dbSNP:771843737
1549 1549 g, t dbSNP:550661000
1571 1571 -, g dbSNP:34219676
1579 1579 c, g dbSNP:373207040
1580 1580 c, t dbSNP:530869704
1648 1648 c, t dbSNP:781554158
1650 1650 a, g dbSNP:377554502
1667 1667 g, t dbSNP:192117485
1696 1696 c, t dbSNP:187381119
1726 1726 a, g dbSNP:766684721
1748 1748 a, c dbSNP:758761551
1751 1751 c, t dbSNP:182837763
1769 1769 a, c dbSNP:765351576
1773 1773 c, t dbSNP:559778122
1837 1837 a, t dbSNP:761805247
1840 1840 a, g dbSNP:147716687
1857 1857 c, t dbSNP:574148664
1861 1861 a, g dbSNP:376925315
1873 1873 a, t dbSNP:767379676
1874 1874 a, g dbSNP:544333452
1890 1890 -, g dbSNP:761315073
1892 1892 c, t dbSNP:575375923
1949 1949 -, atgtag dbSNP:532132551
1991 1991 c, t dbSNP:558607926
1997 1997 a, g dbSNP:759111517
1999 1999 a, g dbSNP:373153995
2003 2003 a, c dbSNP:538235683
2020 2020 c, t dbSNP:770563944
2050 2050 g, t dbSNP:368958557
2062 2062 c, t dbSNP:574119069
2073 2073 a, g dbSNP:769226693
2090 2090 a, g dbSNP:190889565
2094 2094 c, t dbSNP:747643423
2121 2121 c, t dbSNP:536495851
2132 2132 a, g dbSNP:567130517
2151 2151 g, t dbSNP:769090840
2153 2153 c, t dbSNP:747397637
2162 2162 -, g dbSNP:564859105
2170 2170 c, t dbSNP:780624692
2179 2179 c, g dbSNP:550323481
2192 2192 a, t dbSNP:750607799
2199 2199 c, t dbSNP:774373729
2215 2215 -, ccac dbSNP:760416565
2230 2230 c, t dbSNP:185634028

Target ORF information:

RefSeq Version XM_011515728
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens solute carrier family 25 (aspartate/glutamate carrier), member 13 (SLC25A13), transcript variant X3, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_011515728

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
ATGACCTTAG CAGACATTGA ACGGATTGCT CCTCTGGAAG AGGGAACTCT GCCCTTTAAC 
TTGGCTGAGG CCCAGAGGCA GAAGGCCTCA GGTGATTCAG CTCGACCAGT TCTTCTACAA
GTTGCAGAGT CGGCCTACAG GTTTGGTCTG GGTTCTGTTG CTGGAGCTGT TGGAGCCACT
GCTGTGTATC CTATCGATCT TGTAAAAACT CGAATGCAGA ACCAACGATC AACTGGCTCT
TTTGTGGGAG AACTCATGTA TAAAAACAGC TTTGACTGTT TTAAGAAAGT GCTACGCTAT
GAAGGCTTCT TTGGACTGTA TAGAGGTCTG TTGCCACAGT TATTGGGAGT TGCCCCAGAG
AAGGCCATAA AACTTACAGT GAACGATTTT GTGAGGGATA AATTTATGCA CAAAGATGGT
TCGGTCCCAC TTGCAGCAGA AATTCTTGCT GGAGGCTGCG CTGGAGGCTC CCAGGTGATT
TTCACAAATC CTTTAGAAAT CGTCAAGATC CGTTTGCAAG TGGCAGGAGA AATCACCACT
GGTCCTCGAG TCAGTGCTCT GTCTGTCGTG CGGGACCTGG GGTTTTTTGG GATCTACAAG
GGTGCCAAAG CATGCTTTCT GCGGGACATT CCTTTCTCGG CCATCTACTT TCCGTGCTAT
GCTCATGTGA AGGCTTCCTT TGCAAATGAA GATGGGCAGG TTAGCCCAGG AAGCCTGCTC
TTAGCTGGTG CCATAGCTGG TATGCCTGCA GCATCTTTAG TGACCCCTGC TGATGTTATC
AAGACGAGAT TACAGGTGGC TGCCCGGGCT GGCCAAACCA CTTACAGCGG AGTGATAGAC
TGCTTTAGAA AGATACTGCG TGAAGAAGGA CCAAAAGCTC TGTGGAAGGG AGCTGGTGCT
CGTGTATTTC GATCCTCACC CCAGTTTGGT GTAACTTTGC TGACTTACGA ATTGCTACAG
CGATGGTTCT ACATTGATTT TGGAGGAGTA AAACCCATGG GATCAGAGCC AGTTCCTAAA
TCCAGGATCA ACCTGCCTGC CCCGAATCCT GATCACGTTG GGGGCTACAA ACTGGCAGTT
GCTACATTTG CAGGGATTGA AAACAAATTT GGACTTTACC TACCTCTCTT CAAGCCATCA
GTATCTACCT CAAAGGCTAT TGGTGGAGGC CCATAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu27423
Accession Version NM_014251.2
Sequence Information ORF Nucleotide Sequence (Length: 2028bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product calcium-binding mitochondrial carrier protein Aralar2 isoform 2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA118296.1, AC004458.1 and BC006566.2. This sequence is a reference standard in the RefSeqGene project. On Apr 2, 2008 this sequence version replaced gi:7657580. Summary: This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2+) binding motifs in the N-terminal domain, and localizes to mitochondria. The protein catalyzes the exchange of aspartate for glutamate and a proton across the inner mitochondrial membrane, and is stimulated by calcium on the external side of the inner mitochondrial membrane. Mutations in this gene result in citrullinemia, type II. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]. Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1. The resulting isoform (2) lacks one-aa, compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## ##Evidence-Data-START## Transcript exon combination :: AF118838.1, AK000766.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
ATGGCGGCCG CCAAGGTGGC TTTAACCAAG AGAGCAGATC CAGCTGAGCT TAGAACAATA 
TTTTTGAAGT ATGCAAGCAT TGAGAAAAAC GGTGAATTTT TCATGTCCCC CAATGACTTT
GTCACTCGAT ACTTGAACAT TTTTGGAGAA AGCCAGCCTA ATCCAAAGAC TGTGGAACTT
TTAAGTGGAG TGGTGGATCA GACCAAAGAT GGATTAATAT CTTTTCAAGA ATTTGTTGCC
TTTGAATCTG TCCTGTGTGC CCCTGATGCT TTGTTTATGG TAGCCTTTCA GCTGTTTGAC
AAAGCTGGCA AAGGAGAAGT AACTTTTGAG GATGTTAAGC AAGTTTTTGG ACAGACCACA
ATTCATCAAC ATATTCCATT TAACTGGGAT TCAGAATTTG TGCAACTACA TTTTGGAAAA
GAAAGAAAAA GACACCTGAC ATATGCGGAA TTTACTCAGT TTTTATTGGA AATACAACTG
GAGCACGCAA AGCAAGCCTT TGTGCAACGG GACAATGCTA GGACTGGGAG AGTCACAGCC
ATCGACTTCC GAGACATCAT GGTCACCATC CGCCCCCATG TCTTGACTCC TTTTGTAGAA
GAATGTCTAG TAGCTGCTGC TGGAGGTACC ACATCCCATC AAGTTAGTTT CTCCTATTTT
AATGGATTTA ATTCGCTCCT TAACAACATG GAACTCATTA GAAAGATCTA TAGCACTCTG
GCTGGCACCA GGAAAGATGT TGAAGTGACT AAGGAGGAGT TTGTTCTGGC AGCTCAGAAA
TTTGGTCAGG TTACACCCAT GGAAGTTGAC ATCTTGTTTC AGTTAGCAGA TTTATATGAG
CCAAGGGGAC GTATGACCTT AGCAGACATT GAACGGATTG CTCCTCTGGA AGAGGGAACT
CTGCCCTTTA ACTTGGCTGA GGCCCAGAGG CAGAAGGCCT CAGGTGATTC AGCTCGACCA
GTTCTTCTAC AAGTTGCAGA GTCGGCCTAC AGGTTTGGTC TGGGTTCTGT TGCTGGAGCT
GTTGGAGCCA CTGCTGTGTA TCCTATCGAT CTTGTAAAAA CTCGAATGCA GAACCAACGA
TCAACTGGCT CTTTTGTGGG AGAACTCATG TATAAAAACA GCTTTGACTG TTTTAAGAAA
GTGCTACGCT ATGAAGGCTT CTTTGGACTG TATAGAGGTC TGTTGCCACA GTTATTGGGA
GTTGCCCCAG AGAAGGCCAT AAAACTTACA GTGAACGATT TTGTGAGGGA TAAATTTATG
CACAAAGATG GTTCGGTCCC ACTTGCAGCA GAAATTCTTG CTGGAGGCTG CGCTGGAGGC
TCCCAGGTGA TTTTCACAAA TCCTTTAGAA ATCGTCAAGA TCCGTTTGCA AGTGGCAGGA
GAAATCACCA CTGGTCCTCG AGTCAGTGCT CTGTCTGTCG TGCGGGACCT GGGGTTTTTT
GGGATCTACA AGGGTGCCAA AGCATGCTTT CTGCGGGACA TTCCTTTCTC GGCCATCTAC
TTTCCGTGCT ATGCTCATGT GAAGGCTTCC TTTGCAAATG AAGATGGGCA GGTTAGCCCA
GGAAGCCTGC TCTTAGCTGG TGCCATAGCT GGTATGCCTG CAGCATCTTT AGTGACCCCT
GCTGATGTTA TCAAGACGAG ATTACAGGTG GCTGCCCGGG CTGGCCAAAC CACTTACAGC
GGAGTGATAG ACTGCTTTAG AAAGATACTG CGTGAAGAAG GACCAAAAGC TCTGTGGAAG
GGAGCTGGTG CTCGTGTATT TCGATCCTCA CCCCAGTTTG GTGTAACTTT GCTGACTTAC
GAATTGCTAC AGCGATGGTT CTACATTGAT TTTGGAGGAG TAAAACCCAT GGGATCAGAG
CCAGTTCCTA AATCCAGGAT CAACCTGCCT GCCCCGAATC CTGATCACGT TGGGGGCTAC
AAACTGGCAG TTGCTACATT TGCAGGGATT GAAAACAAAT TTGGACTTTA CCTACCTCTC
TTCAAGCCAT CAGTATCTAC CTCAAAGGCT ATTGGTGGAG GCCCATAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqNP_055066.1
CDS192..2219
Misc Feature(1)120..122(+)
Misc Feature(2)195..197(+)
Misc Feature(3)246..434(+)
Misc Feature(4)264..422(+)
Misc Feature(5)276..434(+)
Misc Feature(6)1167..1445(+)
Misc Feature(7)1170..1961(+)
Misc Feature(8)1182..1460(+)
Misc Feature(9)1185..1238(+)
Misc Feature(10)1368..1427(+)
Misc Feature(11)1461..1724(+)
Misc Feature(12)1467..1721(+)
Misc Feature(13)1497..1538(+)
Misc Feature(14)1644..1703(+)
Misc Feature(15)1737..2012(+)
Misc Feature(16)1743..2009(+)
Misc Feature(17)1761..1814(+)
Misc Feature(18)1932..1991(+)
Exon (1)1..206
Gene:SLC25A13
Gene Synonym:
Exon (2)207..260
Gene:SLC25A13
Gene Synonym:
Exon (3)261..403
Gene:SLC25A13
Gene Synonym:
Exon (4)404..519
Gene:SLC25A13
Gene Synonym:
Exon (5)520..659
Gene:SLC25A13
Gene Synonym:
Exon (6)660..806
Gene:SLC25A13
Gene Synonym:
Exon (7)807..945
Gene:SLC25A13
Gene Synonym:
Exon (8)946..1039
Gene:SLC25A13
Gene Synonym:
Exon (9)1040..1124
Gene:SLC25A13
Gene Synonym:
Exon (10)1125..1209
Gene:SLC25A13
Gene Synonym:
Exon (11)1210..1368
Gene:SLC25A13
Gene Synonym:
Exon (12)1369..1421
Gene:SLC25A13
Gene Synonym:
Exon (13)1422..1502
Gene:SLC25A13
Gene Synonym:
Exon (14)1503..1643
Gene:SLC25A13
Gene Synonym:
Exon (15)1644..1782
Gene:SLC25A13
Gene Synonym:
Exon (16)1783..1941
Gene:SLC25A13
Gene Synonym:
Exon (17)1942..2032
Gene:SLC25A13
Gene Synonym:
Exon (18)2033..3190
Gene:SLC25A13
Gene Synonym:
Translation
Position Chain Variation Link
2 2 a, g dbSNP:772446911
7 7 c, t dbSNP:527876175
22 22 g, t dbSNP:559222210
32 32 c, t dbSNP:542691034
71 71 c, t dbSNP:528908830
77 77 g, t dbSNP:543933601
81 81 c, t dbSNP:368317804
83 83 c, t dbSNP:769799830
89 89 a, c dbSNP:748096375
98 98 -, ccgccgccgccg dbSNP:774534380
104 104 -, ccgccg dbSNP:768880901
105 105 c, t dbSNP:781006007
106 106 -, ccg dbSNP:759638459
107 107 -, ccg dbSNP:761627390
109 109 -, ccg dbSNP:539085481
115 115 a, g dbSNP:754775788
120 120 a, t dbSNP:746839249
122 122 a, g dbSNP:779638076
123 123 c, g dbSNP:758050100
125 125 c, t dbSNP:543406259
127 127 c, t dbSNP:749877264
131 131 a, g dbSNP:17848731
134 134 a, c dbSNP:757777612
141 141 a, g dbSNP:754344364
146 146 c, t dbSNP:578004174
150 150 c, g dbSNP:564323455
158 158 -, cagt dbSNP:770401744
169 169 a, g dbSNP:577012400
172 172 a, g dbSNP:776029355
176 176 a, g dbSNP:767785289
192 192 a, t dbSNP:758522194
193 193 c, t dbSNP:541276426
197 197 g, t dbSNP:774562949
200 200 c, t dbSNP:771172427
206 206 a, g dbSNP:80338715
220 220 a, g dbSNP:766641322
223 223 a, g dbSNP:755872035
225 225 a, g dbSNP:762899051
231 231 c, g dbSNP:773343761
232 232 c, t dbSNP:768418425
233 233 a, c dbSNP:181241302
236 236 a, c, t dbSNP:142466552
240 240 a, c dbSNP:771894421
251 251 a, g dbSNP:745497684
260 260 a, g dbSNP:778488962
261 261 c, t dbSNP:772019460
264 264 a, g dbSNP:759288496
271 271 g, t dbSNP:774203119
275 275 a, g dbSNP:770435848
276 276 a, g dbSNP:749030455
281 281 c, t dbSNP:777148254
284 284 c, t dbSNP:78430478
293 293 c, t dbSNP:754849153
294 294 a, g dbSNP:534452813
296 296 g, t dbSNP:781747984
301 301 c, g dbSNP:755544504
305 305 a, t dbSNP:751912314
318 318 c, t dbSNP:780525233
334 334 g, t dbSNP:368174754
337 337 a, g dbSNP:750698657
345 345 a, c dbSNP:142803277
349 349 c, g, t dbSNP:753950441
350 350 c, t dbSNP:767377944
352 352 a, c dbSNP:759484573
363 363 a, g dbSNP:774007506
366 366 a, g dbSNP:543029000
367 367 a, g dbSNP:762486181
372 372 c, t dbSNP:772971102
375 375 a, g dbSNP:111822068
376 376 a, g dbSNP:577901657
384 384 a, g dbSNP:747592860
394 394 c, g dbSNP:148573021
396 396 a, g dbSNP:567369040
402 402 c, g dbSNP:769271204
426 426 a, g, t dbSNP:754907957
439 439 a, c dbSNP:11558673
441 441 g, t dbSNP:751559996
446 446 a, g dbSNP:369071668
450 450 a, g dbSNP:543960516
453 453 a, c, t dbSNP:764922613
460 460 c, t dbSNP:761613642
471 471 a, g dbSNP:144837288
474 474 a, g dbSNP:768319437
475 475 a, c, t dbSNP:202010157
493 493 a, g dbSNP:747451386
497 497 c, t dbSNP:565008080
509 509 a, g dbSNP:772488794
521 521 a, g dbSNP:200987267
523 523 a, g dbSNP:766809778
529 529 a, g dbSNP:763505667
540 540 a, g dbSNP:370370192
546 546 a, g dbSNP:180944633
560 560 a, c dbSNP:149862016
580 580 a, c dbSNP:776667392
596 596 a, c dbSNP:768953296
599 599 a, g dbSNP:188486690
602 602 c, t dbSNP:775726518
612 612 a, g dbSNP:1131697
616 616 a, g dbSNP:148329449
619 619 a, t dbSNP:534989975
623 623 a, g dbSNP:755913787
624 624 c, t dbSNP:748000430
629 629 g, t dbSNP:140121008
637 637 c, t dbSNP:766541414
638 638 a, g dbSNP:760730497
645 645 a, g dbSNP:146131228
646 646 c, t dbSNP:751052385
667 667 a, g dbSNP:185718615
674 674 a, g dbSNP:762752651
678 678 a, g dbSNP:554663995
679 679 a, c dbSNP:757853711
693 693 a, g dbSNP:749978956
696 696 c, t dbSNP:779220022
698 698 a, g dbSNP:757796108
699 699 a, c, t dbSNP:111674765
700 700 a, g, t dbSNP:373362761
702 702 c, g dbSNP:767877590
707 707 c, t dbSNP:759498200
716 716 c, t dbSNP:774496891
719 719 c, g dbSNP:769565327
725 725 c, g, t dbSNP:776288888
726 726 a, g dbSNP:768500587
734 734 c, t dbSNP:370372951
735 735 a, g dbSNP:779617287
741 741 c, t dbSNP:80338716
742 742 a, g dbSNP:142427515
749 749 c, t dbSNP:181615775
762 762 c, t dbSNP:199744651
763 763 a, g dbSNP:376257669
765 765 a, c dbSNP:778267843
767 767 a, c, g dbSNP:753114158
771 771 a, g dbSNP:369939105
788 788 a, g dbSNP:759822371
799 799 -, gtct dbSNP:762941850
800 800 a, g dbSNP:751566503
809 809 c, t dbSNP:748759601
826 826 c, t dbSNP:137944390
838 838 a, g dbSNP:756716537
843 843 a, t dbSNP:748471758
846 846 c, t dbSNP:781721358
851 851 a, t dbSNP:755154931
856 856 g, t dbSNP:751869317
857 857 a, c dbSNP:200838637
865 865 a, c, t dbSNP:80338719
866 866 a, g dbSNP:78247004
869 869 c, g dbSNP:760655625
874 874 a, g dbSNP:775234166
877 877 -, a dbSNP:776937362
879 879 a, g dbSNP:767411822
884 884 a, c, t dbSNP:773995033
885 885 a, c dbSNP:10255762
899 899 c, g dbSNP:770492749
901 901 a, g dbSNP:748764269
904 904 a, g dbSNP:772867693
911 911 a, g dbSNP:545794488
914 914 c, t dbSNP:577055233
923 923 c, g dbSNP:749488819
924 924 a, g dbSNP:748735749
933 933 a, g dbSNP:781400809
942 942 a, g dbSNP:755315210
944 944 a, g dbSNP:747341156
947 947 a, g dbSNP:141152495
953 953 -, tgtt dbSNP:777405773
959 959 a, g dbSNP:772252278
966 966 c, g dbSNP:746155190
968 968 c, g dbSNP:778949203
970 970 a, g dbSNP:201756776
980 980 c, g dbSNP:187852403
981 981 a, g dbSNP:531991442
992 992 a, g dbSNP:781140919
997 997 c, t dbSNP:754890303
1000 1000 a, g dbSNP:751343245
1001 1001 c, t dbSNP:766122989
1014 1014 c, t dbSNP:200220428
1020 1020 a, g dbSNP:750041862
1039 1039 a, g dbSNP:544756381
1041 1041 c, t dbSNP:774717064
1042 1042 -, gtat dbSNP:80338720
1042 1042 a, g dbSNP:771117913
1043 1043 -, tatg dbSNP:569808959
1053 1053 a, c, g dbSNP:148206472
1060 1060 c, t dbSNP:143181462
1065 1065 c, t dbSNP:142308242
1066 1066 a, g dbSNP:375472754
1068 1068 a, c dbSNP:748268201
1072 1072 c, t dbSNP:780101587
1073 1073 c, t dbSNP:138094550
1074 1074 c, g, t dbSNP:778893487
1079 1079 a, g dbSNP:372848335
1082 1082 a, g dbSNP:753493066
1087 1087 a, g dbSNP:763820287
1121 1121 g, t dbSNP:755512817
1122 1122 c, t dbSNP:752281398
1129 1129 c, t dbSNP:755469215
1133 1133 a, g dbSNP:752114544
1137 1137 a, g dbSNP:766917149
1146 1146 c, g dbSNP:763191789
1147 1147 c, g, t dbSNP:771449632
1151 1151 a, g dbSNP:765358773
1157 1157 c, t dbSNP:113850932
1160 1160 a, g dbSNP:762137400
1169 1169 a, g dbSNP:776848302
1171 1171 -, ag dbSNP:764401478
1172 1172 g, t dbSNP:768915439
1175 1175 a, g dbSNP:760851084
1181 1181 a, c, t dbSNP:534585904
1189 1189 g, t dbSNP:770931172
1190 1190 g, t dbSNP:748986342
1191 1191 a, c, g dbSNP:769297213
1197 1197 a, t dbSNP:747861059
1199 1199 c, t dbSNP:780663014
1212 1212 a, g dbSNP:769683303
1220 1220 c, t dbSNP:747945892
1236 1236 a, g dbSNP:780785774
1238 1238 c, t dbSNP:768322999
1242 1242 a, c dbSNP:746502556
1253 1253 c, t dbSNP:779657849
1254 1254 c, t dbSNP:758827458
1255 1255 a, g, t dbSNP:398122839
1269 1269 c, t dbSNP:80338721
1274 1274 a, t dbSNP:202177210
1275 1275 a, g dbSNP:576650917
1279 1279 g, t dbSNP:35996658
1299 1299 a, g dbSNP:142386709
1301 1301 a, g dbSNP:767699888
1327 1327 a, t dbSNP:200427603
1335 1335 c, t dbSNP:762784067
1343 1343 c, t dbSNP:540364299
1347 1347 a, c, g dbSNP:761550839
1348 1348 g, t dbSNP:776461118
1352 1352 -, t dbSNP:59507540
1360 1360 a, t dbSNP:574856683
1361 1361 g, t dbSNP:377724262
1363 1363 a, g dbSNP:774850623
1364 1364 g, t dbSNP:762925301
1377 1377 c, t dbSNP:760401530
1385 1385 a, g, t dbSNP:2301629
1388 1388 a, g dbSNP:373876605
1397 1397 c, t dbSNP:774051691
1410 1410 a, g dbSNP:369195484
1421 1421 a, c dbSNP:150021522
1422 1422 a, g dbSNP:768922690
1427 1427 c, t dbSNP:747257110
1428 1428 a, g dbSNP:780268583
1434 1434 a, g dbSNP:758406317
1451 1451 a, g dbSNP:750535328
1453 1453 a, c dbSNP:140440047
1457 1457 a, g dbSNP:777639882
1458 1458 a, g, t dbSNP:553863381
1466 1466 a, g dbSNP:376416252
1473 1473 c, t dbSNP:759211846
1474 1474 c, t dbSNP:751195180
1485 1485 a, g dbSNP:766130485
1501 1501 a, g dbSNP:151256859
1511 1511 c, t dbSNP:373629670
1513 1513 c, t dbSNP:781202495
1514 1514 c, t dbSNP:754659147
1527 1527 a, c dbSNP:200237622
1531 1531 a, g dbSNP:766077420
1539 1539 g, t dbSNP:758167270
1544 1544 c, t dbSNP:267601652
1545 1545 a, g dbSNP:143877538
1550 1550 g, t dbSNP:764716490
1554 1554 c, t dbSNP:761402505
1555 1555 a, c, g dbSNP:764693182
1562 1562 a, g dbSNP:576739220
1565 1565 a, g dbSNP:115266882
1571 1571 a, g dbSNP:772250175
1579 1579 a, c dbSNP:746153244
1582 1582 c, g dbSNP:774476574
1583 1583 g, t dbSNP:770856997
1584 1584 g, t dbSNP:372216502
1590 1590 c, t dbSNP:540149539
1591 1591 g, t dbSNP:754985592
1597 1597 -, g dbSNP:747368721
1599 1599 a, g dbSNP:746775592
1604 1604 c, g dbSNP:780063972
1606 1606 c, g, t dbSNP:749990010
1607 1607 -, tgtc dbSNP:773624358
1607 1607 c, t dbSNP:764951987
1610 1610 c, t dbSNP:201598915
1611 1611 a, g dbSNP:554809009
1614 1614 c, t dbSNP:753411740
1615 1615 a, g dbSNP:764488086
1616 1616 a, g dbSNP:761211929
1625 1625 a, g, t dbSNP:146111714
1629 1629 c, t dbSNP:759905821
1636 1636 c, t dbSNP:774369510
1642 1642 a, g dbSNP:367988218
1643 1643 a, g dbSNP:771211154
1656 1656 c, t dbSNP:766485284
1665 1665 c, t dbSNP:763272772
1666 1666 a, g, t dbSNP:769939259
1674 1674 c, g dbSNP:761992118
1677 1677 -, ttct dbSNP:756182703
1682 1682 a, g dbSNP:775532487
1688 1688 c, g dbSNP:772157920
1694 1694 c, t dbSNP:745628778
1695 1695 c, g dbSNP:186863471
1696 1696 c, t dbSNP:139149160
1697 1697 a, g dbSNP:144494809
1702 1702 a, g dbSNP:777414201
1710 1710 a, g, t dbSNP:11558671
1726 1726 c, t dbSNP:752235032
1727 1727 a, t dbSNP:781625058
1729 1729 a, g dbSNP:369962634
1730 1730 g, t dbSNP:751836823
1735 1735 a, t dbSNP:766827198
1738 1738 g, t dbSNP:763244253
1739 1739 c, g dbSNP:750610043
1741 1741 a, c dbSNP:765591535
1757 1757 c, t dbSNP:771908277
1759 1759 c, t dbSNP:139455686
1776 1776 a, g dbSNP:772104865
1777 1777 g, t dbSNP:375405382
1783 1783 a, g dbSNP:80338724
1787 1787 c, g dbSNP:202144038
1796 1796 a, t dbSNP:776103327
1799 1799 c, t dbSNP:768148130
1801 1801 -, t dbSNP:750225643
1803 1803 g, t dbSNP:746535755
1804 1804 g, t dbSNP:780566134
1807 1807 a, c, t dbSNP:746205031
1809 1809 c, t dbSNP:75622628
1817 1817 c, t dbSNP:757541654
1822 1822 c, t dbSNP:754054414
1823 1823 c, g dbSNP:544174452
1826 1826 a, g dbSNP:756177534
1828 1828 c, g, t dbSNP:548769905
1829 1829 a, g dbSNP:143706021
1844 1844 -, tgc dbSNP:781077173
1845 1845 a, g dbSNP:367948961
1847 1847 a, c dbSNP:765072433
1848 1848 c, t dbSNP:761602352
1849 1849 a, c, g dbSNP:201283753
1850 1850 a, g dbSNP:760210666
1851 1851 -, gagattacaggtggctgcccggg dbSNP:80338725
1851 1851 c, g dbSNP:774907889
1854 1854 a, g dbSNP:772632837
1856 1856 c, t dbSNP:199735534
1857 1857 c, g dbSNP:779579089
1861 1861 c, t dbSNP:771352563
1862 1862 c, t dbSNP:79886797
1864 1864 c, t dbSNP:777999410
1868 1868 c, g dbSNP:201168119
1871 1871 c, t dbSNP:150082469
1872 1872 a, g dbSNP:142801864
1875 1875 a, g dbSNP:758317710
1885 1885 c, g dbSNP:750300786
1886 1886 c, t dbSNP:765192701
1897 1897 c, t dbSNP:200236841
1902 1902 c, t dbSNP:753626243
1903 1903 a, g dbSNP:187260240
1913 1913 a, g dbSNP:760315798
1916 1916 a, g dbSNP:775054829
1930 1930 a, g dbSNP:771652951
1936 1936 c, g dbSNP:759119965
1940 1940 c, t dbSNP:774955681
1943 1943 c, t dbSNP:774049761
1944 1944 c, t dbSNP:370997026
1945 1945 a, g dbSNP:367770143
1954 1954 a, g dbSNP:121908532
1961 1961 a, t dbSNP:769993871
1962 1962 c, t dbSNP:748548237
1968 1968 c, t dbSNP:776787438
1972 1972 a, g dbSNP:373632138
1978 1978 c, t dbSNP:747060193
1987 1987 c, t dbSNP:780179331
1988 1988 a, t dbSNP:757177279
1990 1990 -, a dbSNP:80338726
1991 1991 a, c, t dbSNP:765919667
1992 1992 a, g, t dbSNP:80338727
2000 2000 a, g dbSNP:755823140
2004 2004 c, t dbSNP:80338729
2005 2005 a, g dbSNP:548194276
2014 2014 a, g dbSNP:754713031
2019 2019 c, g dbSNP:751109329
2036 2036 a, g dbSNP:751199034
2041 2041 c, t dbSNP:779855647
2043 2043 a, g dbSNP:757805685
2045 2045 a, c dbSNP:760572056
2060 2060 c, t dbSNP:201931382
2067 2067 a, g dbSNP:200001052
2074 2074 a, t dbSNP:765632410
2075 2075 c, t dbSNP:35539807
2086 2086 c, t dbSNP:573420716
2087 2087 a, g dbSNP:764388459
2094 2094 g, t dbSNP:761035791
2100 2100 a, g, t dbSNP:151330313
2101 2101 c, g, t dbSNP:148962110
2108 2108 c, t dbSNP:769610597
2127 2127 a, g dbSNP:748153245
2133 2133 a, g dbSNP:781292740
2134 2134 c, t dbSNP:768497028
2136 2136 c, g dbSNP:757317844
2152 2152 c, t dbSNP:779551695
2161 2161 a, c dbSNP:758111197
2166 2166 a, c dbSNP:749897928
2177 2177 a, g dbSNP:778545092
2181 2181 a, t dbSNP:756776797
2185 2185 c, t dbSNP:754280216
2199 2199 g, t dbSNP:764619502
2203 2203 c, t dbSNP:760982579
2212 2212 g, t dbSNP:753105901
2213 2213 c, g dbSNP:767600441
2217 2217 a, t dbSNP:759865234
2220 2220 a, g dbSNP:774277675
2221 2221 a, g dbSNP:770984153
2223 2223 a, g dbSNP:763129811
2231 2231 c, g dbSNP:776668360
2244 2244 g, t dbSNP:369129587
2245 2245 c, t dbSNP:746771215
2258 2258 a, g dbSNP:779968341
2259 2259 c, t dbSNP:542828845
2260 2260 c, g, t dbSNP:778438712
2266 2266 a, g dbSNP:201342924
2271 2271 -, taaagaa dbSNP:773526278
2274 2274 g, t dbSNP:748822378
2276 2276 c, t dbSNP:778227631
2277 2277 -, c dbSNP:772510276
2283 2283 a, g dbSNP:554694466
2284 2284 g, t dbSNP:752996116
2287 2287 c, t dbSNP:767980169
2291 2291 a, g dbSNP:755310327
2303 2303 c, t dbSNP:751738128
2310 2310 a, c dbSNP:766538572
2311 2311 c, t dbSNP:763076851
2312 2312 a, g, t dbSNP:537886271
2314 2314 c, t dbSNP:568872413
2315 2315 a, c dbSNP:558547802
2319 2319 a, t dbSNP:771836656
2342 2342 c, t dbSNP:1044257
2352 2352 a, g dbSNP:745685828
2359 2359 a, g dbSNP:774009051
2374 2374 a, g dbSNP:770621452
2385 2385 a, c dbSNP:538940266
2393 2393 c, g dbSNP:566627365
2394 2394 a, g dbSNP:144877897
2410 2410 c, t dbSNP:529835831
2438 2438 a, g dbSNP:762859440
2471 2471 a, g dbSNP:140968602
2492 2492 g, t dbSNP:771843737
2498 2498 g, t dbSNP:550661000
2520 2520 -, g dbSNP:34219676
2528 2528 c, g dbSNP:373207040
2529 2529 c, t dbSNP:530869704
2597 2597 c, t dbSNP:781554158
2599 2599 a, g dbSNP:377554502
2616 2616 g, t dbSNP:192117485
2645 2645 c, t dbSNP:187381119
2675 2675 a, g dbSNP:766684721
2697 2697 a, c dbSNP:758761551
2700 2700 c, t dbSNP:182837763
2718 2718 a, c dbSNP:765351576
2722 2722 c, t dbSNP:559778122
2786 2786 a, t dbSNP:761805247
2789 2789 a, g dbSNP:147716687
2806 2806 c, t dbSNP:574148664
2810 2810 a, g dbSNP:376925315
2822 2822 a, t dbSNP:767379676
2823 2823 a, g dbSNP:544333452
2839 2839 -, g dbSNP:761315073
2841 2841 c, t dbSNP:575375923
2898 2898 -, atgtag dbSNP:532132551
2940 2940 c, t dbSNP:558607926
2946 2946 a, g dbSNP:759111517
2948 2948 a, g dbSNP:373153995
2952 2952 a, c dbSNP:538235683
2969 2969 c, t dbSNP:770563944
2999 2999 g, t dbSNP:368958557
3011 3011 c, t dbSNP:574119069
3022 3022 a, g dbSNP:769226693
3039 3039 a, g dbSNP:190889565
3043 3043 c, t dbSNP:747643423
3070 3070 c, t dbSNP:536495851
3081 3081 a, g dbSNP:567130517
3100 3100 g, t dbSNP:769090840
3102 3102 c, t dbSNP:747397637
3111 3111 -, g dbSNP:564859105
3119 3119 c, t dbSNP:780624692
3128 3128 c, g dbSNP:550323481
3141 3141 a, t dbSNP:750607799
3148 3148 c, t dbSNP:774373729
3164 3164 -, ccac dbSNP:760416565
3179 3179 c, t dbSNP:185634028

Target ORF information:

RefSeq Version NM_014251
Organism Homo sapiens (human)
Definition Homo sapiens solute carrier family 25 (aspartate/glutamate carrier), member 13 (SLC25A13), transcript variant 2, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_014251

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
ATGGCGGCCG CCAAGGTGGC TTTAACCAAG AGAGCAGATC CAGCTGAGCT TAGAACAATA 
TTTTTGAAGT ATGCAAGCAT TGAGAAAAAC GGTGAATTTT TCATGTCCCC CAATGACTTT
GTCACTCGAT ACTTGAACAT TTTTGGAGAA AGCCAGCCTA ATCCAAAGAC TGTGGAACTT
TTAAGTGGAG TGGTGGATCA GACCAAAGAT GGATTAATAT CTTTTCAAGA ATTTGTTGCC
TTTGAATCTG TCCTGTGTGC CCCTGATGCT TTGTTTATGG TAGCCTTTCA GCTGTTTGAC
AAAGCTGGCA AAGGAGAAGT AACTTTTGAG GATGTTAAGC AAGTTTTTGG ACAGACCACA
ATTCATCAAC ATATTCCATT TAACTGGGAT TCAGAATTTG TGCAACTACA TTTTGGAAAA
GAAAGAAAAA GACACCTGAC ATATGCGGAA TTTACTCAGT TTTTATTGGA AATACAACTG
GAGCACGCAA AGCAAGCCTT TGTGCAACGG GACAATGCTA GGACTGGGAG AGTCACAGCC
ATCGACTTCC GAGACATCAT GGTCACCATC CGCCCCCATG TCTTGACTCC TTTTGTAGAA
GAATGTCTAG TAGCTGCTGC TGGAGGTACC ACATCCCATC AAGTTAGTTT CTCCTATTTT
AATGGATTTA ATTCGCTCCT TAACAACATG GAACTCATTA GAAAGATCTA TAGCACTCTG
GCTGGCACCA GGAAAGATGT TGAAGTGACT AAGGAGGAGT TTGTTCTGGC AGCTCAGAAA
TTTGGTCAGG TTACACCCAT GGAAGTTGAC ATCTTGTTTC AGTTAGCAGA TTTATATGAG
CCAAGGGGAC GTATGACCTT AGCAGACATT GAACGGATTG CTCCTCTGGA AGAGGGAACT
CTGCCCTTTA ACTTGGCTGA GGCCCAGAGG CAGAAGGCCT CAGGTGATTC AGCTCGACCA
GTTCTTCTAC AAGTTGCAGA GTCGGCCTAC AGGTTTGGTC TGGGTTCTGT TGCTGGAGCT
GTTGGAGCCA CTGCTGTGTA TCCTATCGAT CTTGTAAAAA CTCGAATGCA GAACCAACGA
TCAACTGGCT CTTTTGTGGG AGAACTCATG TATAAAAACA GCTTTGACTG TTTTAAGAAA
GTGCTACGCT ATGAAGGCTT CTTTGGACTG TATAGAGGTC TGTTGCCACA GTTATTGGGA
GTTGCCCCAG AGAAGGCCAT AAAACTTACA GTGAACGATT TTGTGAGGGA TAAATTTATG
CACAAAGATG GTTCGGTCCC ACTTGCAGCA GAAATTCTTG CTGGAGGCTG CGCTGGAGGC
TCCCAGGTGA TTTTCACAAA TCCTTTAGAA ATCGTCAAGA TCCGTTTGCA AGTGGCAGGA
GAAATCACCA CTGGTCCTCG AGTCAGTGCT CTGTCTGTCG TGCGGGACCT GGGGTTTTTT
GGGATCTACA AGGGTGCCAA AGCATGCTTT CTGCGGGACA TTCCTTTCTC GGCCATCTAC
TTTCCGTGCT ATGCTCATGT GAAGGCTTCC TTTGCAAATG AAGATGGGCA GGTTAGCCCA
GGAAGCCTGC TCTTAGCTGG TGCCATAGCT GGTATGCCTG CAGCATCTTT AGTGACCCCT
GCTGATGTTA TCAAGACGAG ATTACAGGTG GCTGCCCGGG CTGGCCAAAC CACTTACAGC
GGAGTGATAG ACTGCTTTAG AAAGATACTG CGTGAAGAAG GACCAAAAGC TCTGTGGAAG
GGAGCTGGTG CTCGTGTATT TCGATCCTCA CCCCAGTTTG GTGTAACTTT GCTGACTTAC
GAATTGCTAC AGCGATGGTT CTACATTGAT TTTGGAGGAG TAAAACCCAT GGGATCAGAG
CCAGTTCCTA AATCCAGGAT CAACCTGCCT GCCCCGAATC CTGATCACGT TGGGGGCTAC
AAACTGGCAG TTGCTACATT TGCAGGGATT GAAAACAAAT TTGGACTTTA CCTACCTCTC
TTCAAGCCAT CAGTATCTAC CTCAAAGGCT ATTGGTGGAG GCCCATAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu26637
Accession Version NM_001160210.1
Sequence Information ORF Nucleotide Sequence (Length: 2031bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product calcium-binding mitochondrial carrier protein Aralar2 isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA118296.1, DA696723.1 and AJ496569.1. Summary: This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2+) binding motifs in the N-terminal domain, and localizes to mitochondria. The protein catalyzes the exchange of aspartate for glutamate and a proton across the inner mitochondrial membrane, and is stimulated by calcium on the external side of the inner mitochondrial membrane. Mutations in this gene result in citrullinemia, type II. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]. Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (1). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## ##Evidence-Data-START## Transcript exon combination :: AJ496569.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
ATGGCGGCCG CCAAGGTGGC TTTAACCAAG AGAGCAGATC CAGCTGAGCT TAGAACAATA 
TTTTTGAAGT ATGCAAGCAT TGAGAAAAAC GGTGAATTTT TCATGTCCCC CAATGACTTT
GTCACTCGAT ACTTGAACAT TTTTGGAGAA AGCCAGCCTA ATCCAAAGAC TGTGGAACTT
TTAAGTGGAG TGGTGGATCA GACCAAAGAT GGATTAATAT CTTTTCAAGA ATTTGTTGCC
TTTGAATCTG TCCTGTGTGC CCCTGATGCT TTGTTTATGG TAGCCTTTCA GCTGTTTGAC
AAAGCTGGCA AAGGAGAAGT AACTTTTGAG GATGTTAAGC AAGTTTTTGG ACAGACCACA
ATTCATCAAC ATATTCCATT TAACTGGGAT TCAGAATTTG TGCAACTACA TTTTGGAAAA
GAAAGAAAAA GACACCTGAC ATATGCGGAA TTTACTCAGT TTTTATTGGA AATACAACTG
GAGCACGCAA AGCAAGCCTT TGTGCAACGG GACAATGCTA GGACTGGGAG AGTCACAGCC
ATCGACTTCC GAGACATCAT GGTCACCATC CGCCCCCATG TCTTGACTCC TTTTGTAGAA
GAATGTCTAG TAGCTGCTGC TGGAGGTACC ACATCCCATC AAGTTAGTTT CTCCTATTTT
AATGGATTTA ATTCGCTCCT TAACAACATG GAACTCATTA GAAAGATCTA TAGCACTCTG
GCTGGCACCA GGAAAGATGT TGAAGTGACT AAGGAGGAGT TTGTTCTGGC AGCTCAGAAA
TTTGGTCAGG TTACACCCAT GGAAGTTGAC ATCTTGTTTC AGTTAGCAGA TTTATATGAG
CCAAGGGGAC GTATGACCTT AGCAGACATT GAACGGATTG CTCCTCTGGA AGAGGGAACT
CTGCCCTTTA ACTTGGCTGA GGCCCAGAGG CAGCAGAAGG CCTCAGGTGA TTCAGCTCGA
CCAGTTCTTC TACAAGTTGC AGAGTCGGCC TACAGGTTTG GTCTGGGTTC TGTTGCTGGA
GCTGTTGGAG CCACTGCTGT GTATCCTATC GATCTTGTAA AAACTCGAAT GCAGAACCAA
CGATCAACTG GCTCTTTTGT GGGAGAACTC ATGTATAAAA ACAGCTTTGA CTGTTTTAAG
AAAGTGCTAC GCTATGAAGG CTTCTTTGGA CTGTATAGAG GTCTGTTGCC ACAGTTATTG
GGAGTTGCCC CAGAGAAGGC CATAAAACTT ACAGTGAACG ATTTTGTGAG GGATAAATTT
ATGCACAAAG ATGGTTCGGT CCCACTTGCA GCAGAAATTC TTGCTGGAGG CTGCGCTGGA
GGCTCCCAGG TGATTTTCAC AAATCCTTTA GAAATCGTCA AGATCCGTTT GCAAGTGGCA
GGAGAAATCA CCACTGGTCC TCGAGTCAGT GCTCTGTCTG TCGTGCGGGA CCTGGGGTTT
TTTGGGATCT ACAAGGGTGC CAAAGCATGC TTTCTGCGGG ACATTCCTTT CTCGGCCATC
TACTTTCCGT GCTATGCTCA TGTGAAGGCT TCCTTTGCAA ATGAAGATGG GCAGGTTAGC
CCAGGAAGCC TGCTCTTAGC TGGTGCCATA GCTGGTATGC CTGCAGCATC TTTAGTGACC
CCTGCTGATG TTATCAAGAC GAGATTACAG GTGGCTGCCC GGGCTGGCCA AACCACTTAC
AGCGGAGTGA TAGACTGCTT TAGAAAGATA CTGCGTGAAG AAGGACCAAA AGCTCTGTGG
AAGGGAGCTG GTGCTCGTGT ATTTCGATCC TCACCCCAGT TTGGTGTAAC TTTGCTGACT
TACGAATTGC TACAGCGATG GTTCTACATT GATTTTGGAG GAGTAAAACC CATGGGATCA
GAGCCAGTTC CTAAATCCAG GATCAACCTG CCTGCCCCGA ATCCTGATCA CGTTGGGGGC
TACAAACTGG CAGTTGCTAC ATTTGCAGGG ATTGAAAACA AATTTGGACT TTACCTACCT
CTCTTCAAGC CATCAGTATC TACCTCAAAG GCTATTGGTG GAGGCCCATA G
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqNP_001153682.1
CDS192..2222
Misc Feature(1)120..122(+)
Misc Feature(2)195..197(+)
Misc Feature(3)246..434(+)
Misc Feature(4)264..422(+)
Misc Feature(5)276..434(+)
Misc Feature(6)1170..1448(+)
Misc Feature(7)1173..1964(+)
Misc Feature(8)1185..1463(+)
Misc Feature(9)1188..1241(+)
Misc Feature(10)1371..1430(+)
Misc Feature(11)1464..1727(+)
Misc Feature(12)1470..1724(+)
Misc Feature(13)1500..1541(+)
Misc Feature(14)1647..1706(+)
Misc Feature(15)1740..2015(+)
Misc Feature(16)1746..2012(+)
Misc Feature(17)1764..1817(+)
Misc Feature(18)1935..1994(+)
Exon (1)1..206
Gene:SLC25A13
Gene Synonym:
Exon (2)207..260
Gene:SLC25A13
Gene Synonym:
Exon (3)261..403
Gene:SLC25A13
Gene Synonym:
Exon (4)404..519
Gene:SLC25A13
Gene Synonym:
Exon (5)520..659
Gene:SLC25A13
Gene Synonym:
Exon (6)660..806
Gene:SLC25A13
Gene Synonym:
Exon (7)807..945
Gene:SLC25A13
Gene Synonym:
Exon (8)946..1039
Gene:SLC25A13
Gene Synonym:
Exon (9)1040..1124
Gene:SLC25A13
Gene Synonym:
Exon (10)1125..1212
Gene:SLC25A13
Gene Synonym:
Exon (11)1213..1371
Gene:SLC25A13
Gene Synonym:
Exon (12)1372..1424
Gene:SLC25A13
Gene Synonym:
Exon (13)1425..1505
Gene:SLC25A13
Gene Synonym:
Exon (14)1506..1646
Gene:SLC25A13
Gene Synonym:
Exon (15)1647..1785
Gene:SLC25A13
Gene Synonym:
Exon (16)1786..1944
Gene:SLC25A13
Gene Synonym:
Exon (17)1945..2035
Gene:SLC25A13
Gene Synonym:
Exon (18)2036..3193
Gene:SLC25A13
Gene Synonym:
Translation
Position Chain Variation Link
2 2 a, g dbSNP:772446911
7 7 c, t dbSNP:527876175
22 22 g, t dbSNP:559222210
32 32 c, t dbSNP:542691034
71 71 c, t dbSNP:528908830
77 77 g, t dbSNP:543933601
81 81 c, t dbSNP:368317804
83 83 c, t dbSNP:769799830
89 89 a, c dbSNP:748096375
98 98 -, ccgccgccgccg dbSNP:774534380
104 104 -, ccgccg dbSNP:768880901
105 105 c, t dbSNP:781006007
106 106 -, ccg dbSNP:759638459
107 107 -, ccg dbSNP:761627390
109 109 -, ccg dbSNP:539085481
115 115 a, g dbSNP:754775788
120 120 a, t dbSNP:746839249
122 122 a, g dbSNP:779638076
123 123 c, g dbSNP:758050100
125 125 c, t dbSNP:543406259
127 127 c, t dbSNP:749877264
131 131 a, g dbSNP:17848731
134 134 a, c dbSNP:757777612
141 141 a, g dbSNP:754344364
146 146 c, t dbSNP:578004174
150 150 c, g dbSNP:564323455
158 158 -, cagt dbSNP:770401744
169 169 a, g dbSNP:577012400
172 172 a, g dbSNP:776029355
176 176 a, g dbSNP:767785289
192 192 a, t dbSNP:758522194
193 193 c, t dbSNP:541276426
197 197 g, t dbSNP:774562949
200 200 c, t dbSNP:771172427
206 206 a, g dbSNP:80338715
220 220 a, g dbSNP:766641322
223 223 a, g dbSNP:755872035
225 225 a, g dbSNP:762899051
231 231 c, g dbSNP:773343761
232 232 c, t dbSNP:768418425
233 233 a, c dbSNP:181241302
236 236 a, c, t dbSNP:142466552
240 240 a, c dbSNP:771894421
251 251 a, g dbSNP:745497684
260 260 a, g dbSNP:778488962
261 261 c, t dbSNP:772019460
264 264 a, g dbSNP:759288496
271 271 g, t dbSNP:774203119
275 275 a, g dbSNP:770435848
276 276 a, g dbSNP:749030455
281 281 c, t dbSNP:777148254
284 284 c, t dbSNP:78430478
293 293 c, t dbSNP:754849153
294 294 a, g dbSNP:534452813
296 296 g, t dbSNP:781747984
301 301 c, g dbSNP:755544504
305 305 a, t dbSNP:751912314
318 318 c, t dbSNP:780525233
334 334 g, t dbSNP:368174754
337 337 a, g dbSNP:750698657
345 345 a, c dbSNP:142803277
349 349 c, g, t dbSNP:753950441
350 350 c, t dbSNP:767377944
352 352 a, c dbSNP:759484573
363 363 a, g dbSNP:774007506
366 366 a, g dbSNP:543029000
367 367 a, g dbSNP:762486181
372 372 c, t dbSNP:772971102
375 375 a, g dbSNP:111822068
376 376 a, g dbSNP:577901657
384 384 a, g dbSNP:747592860
394 394 c, g dbSNP:148573021
396 396 a, g dbSNP:567369040
402 402 c, g dbSNP:769271204
426 426 a, g, t dbSNP:754907957
439 439 a, c dbSNP:11558673
441 441 g, t dbSNP:751559996
446 446 a, g dbSNP:369071668
450 450 a, g dbSNP:543960516
453 453 a, c, t dbSNP:764922613
460 460 c, t dbSNP:761613642
471 471 a, g dbSNP:144837288
474 474 a, g dbSNP:768319437
475 475 a, c, t dbSNP:202010157
493 493 a, g dbSNP:747451386
497 497 c, t dbSNP:565008080
509 509 a, g dbSNP:772488794
521 521 a, g dbSNP:200987267
523 523 a, g dbSNP:766809778
529 529 a, g dbSNP:763505667
540 540 a, g dbSNP:370370192
546 546 a, g dbSNP:180944633
560 560 a, c dbSNP:149862016
580 580 a, c dbSNP:776667392
596 596 a, c dbSNP:768953296
599 599 a, g dbSNP:188486690
602 602 c, t dbSNP:775726518
612 612 a, g dbSNP:1131697
616 616 a, g dbSNP:148329449
619 619 a, t dbSNP:534989975
623 623 a, g dbSNP:755913787
624 624 c, t dbSNP:748000430
629 629 g, t dbSNP:140121008
637 637 c, t dbSNP:766541414
638 638 a, g dbSNP:760730497
645 645 a, g dbSNP:146131228
646 646 c, t dbSNP:751052385
667 667 a, g dbSNP:185718615
674 674 a, g dbSNP:762752651
678 678 a, g dbSNP:554663995
679 679 a, c dbSNP:757853711
693 693 a, g dbSNP:749978956
696 696 c, t dbSNP:779220022
698 698 a, g dbSNP:757796108
699 699 a, c, t dbSNP:111674765
700 700 a, g, t dbSNP:373362761
702 702 c, g dbSNP:767877590
707 707 c, t dbSNP:759498200
716 716 c, t dbSNP:774496891
719 719 c, g dbSNP:769565327
725 725 c, g, t dbSNP:776288888
726 726 a, g dbSNP:768500587
734 734 c, t dbSNP:370372951
735 735 a, g dbSNP:779617287
741 741 c, t dbSNP:80338716
742 742 a, g dbSNP:142427515
749 749 c, t dbSNP:181615775
762 762 c, t dbSNP:199744651
763 763 a, g dbSNP:376257669
765 765 a, c dbSNP:778267843
767 767 a, c, g dbSNP:753114158
771 771 a, g dbSNP:369939105
788 788 a, g dbSNP:759822371
799 799 -, gtct dbSNP:762941850
800 800 a, g dbSNP:751566503
809 809 c, t dbSNP:748759601
826 826 c, t dbSNP:137944390
838 838 a, g dbSNP:756716537
843 843 a, t dbSNP:748471758
846 846 c, t dbSNP:781721358
851 851 a, t dbSNP:755154931
856 856 g, t dbSNP:751869317
857 857 a, c dbSNP:200838637
865 865 a, c, t dbSNP:80338719
866 866 a, g dbSNP:78247004
869 869 c, g dbSNP:760655625
874 874 a, g dbSNP:775234166
877 877 -, a dbSNP:776937362
879 879 a, g dbSNP:767411822
884 884 a, c, t dbSNP:773995033
885 885 a, c dbSNP:10255762
899 899 c, g dbSNP:770492749
901 901 a, g dbSNP:748764269
904 904 a, g dbSNP:772867693
911 911 a, g dbSNP:545794488
914 914 c, t dbSNP:577055233
923 923 c, g dbSNP:749488819
924 924 a, g dbSNP:748735749
933 933 a, g dbSNP:781400809
942 942 a, g dbSNP:755315210
944 944 a, g dbSNP:747341156
947 947 a, g dbSNP:141152495
953 953 -, tgtt dbSNP:777405773
959 959 a, g dbSNP:772252278
966 966 c, g dbSNP:746155190
968 968 c, g dbSNP:778949203
970 970 a, g dbSNP:201756776
980 980 c, g dbSNP:187852403
981 981 a, g dbSNP:531991442
992 992 a, g dbSNP:781140919
997 997 c, t dbSNP:754890303
1000 1000 a, g dbSNP:751343245
1001 1001 c, t dbSNP:766122989
1014 1014 c, t dbSNP:200220428
1020 1020 a, g dbSNP:750041862
1039 1039 a, g dbSNP:544756381
1041 1041 c, t dbSNP:774717064
1042 1042 -, gtat dbSNP:80338720
1042 1042 a, g dbSNP:771117913
1043 1043 -, tatg dbSNP:569808959
1053 1053 a, c, g dbSNP:148206472
1060 1060 c, t dbSNP:143181462
1065 1065 c, t dbSNP:142308242
1066 1066 a, g dbSNP:375472754
1068 1068 a, c dbSNP:748268201
1072 1072 c, t dbSNP:780101587
1073 1073 c, t dbSNP:138094550
1074 1074 c, g, t dbSNP:778893487
1079 1079 a, g dbSNP:372848335
1082 1082 a, g dbSNP:753493066
1087 1087 a, g dbSNP:763820287
1121 1121 g, t dbSNP:755512817
1122 1122 c, t dbSNP:752281398
1125 1125 c, t dbSNP:767051127
1132 1132 c, t dbSNP:755469215
1136 1136 a, g dbSNP:752114544
1140 1140 a, g dbSNP:766917149
1149 1149 c, g dbSNP:763191789
1150 1150 c, g, t dbSNP:771449632
1154 1154 a, g dbSNP:765358773
1160 1160 c, t dbSNP:113850932
1163 1163 a, g dbSNP:762137400
1172 1172 a, g dbSNP:776848302
1174 1174 -, ag dbSNP:764401478
1175 1175 g, t dbSNP:768915439
1178 1178 a, g dbSNP:760851084
1184 1184 a, c, t dbSNP:534585904
1192 1192 g, t dbSNP:770931172
1193 1193 g, t dbSNP:748986342
1194 1194 a, c, g dbSNP:769297213
1200 1200 a, t dbSNP:747861059
1202 1202 c, t dbSNP:780663014
1215 1215 a, g dbSNP:769683303
1223 1223 c, t dbSNP:747945892
1239 1239 a, g dbSNP:780785774
1241 1241 c, t dbSNP:768322999
1245 1245 a, c dbSNP:746502556
1256 1256 c, t dbSNP:779657849
1257 1257 c, t dbSNP:758827458
1258 1258 a, g, t dbSNP:398122839
1272 1272 c, t dbSNP:80338721
1277 1277 a, t dbSNP:202177210
1278 1278 a, g dbSNP:576650917
1282 1282 g, t dbSNP:35996658
1302 1302 a, g dbSNP:142386709
1304 1304 a, g dbSNP:767699888
1330 1330 a, t dbSNP:200427603
1338 1338 c, t dbSNP:762784067
1346 1346 c, t dbSNP:540364299
1350 1350 a, c, g dbSNP:761550839
1351 1351 g, t dbSNP:776461118
1355 1355 -, t dbSNP:59507540
1363 1363 a, t dbSNP:574856683
1364 1364 g, t dbSNP:377724262
1366 1366 a, g dbSNP:774850623
1367 1367 g, t dbSNP:762925301
1380 1380 c, t dbSNP:760401530
1388 1388 a, g, t dbSNP:2301629
1391 1391 a, g dbSNP:373876605
1400 1400 c, t dbSNP:774051691
1413 1413 a, g dbSNP:369195484
1424 1424 a, c dbSNP:150021522
1425 1425 a, g dbSNP:768922690
1430 1430 c, t dbSNP:747257110
1431 1431 a, g dbSNP:780268583
1437 1437 a, g dbSNP:758406317
1454 1454 a, g dbSNP:750535328
1456 1456 a, c dbSNP:140440047
1460 1460 a, g dbSNP:777639882
1461 1461 a, g, t dbSNP:553863381
1469 1469 a, g dbSNP:376416252
1476 1476 c, t dbSNP:759211846
1477 1477 c, t dbSNP:751195180
1488 1488 a, g dbSNP:766130485
1504 1504 a, g dbSNP:151256859
1514 1514 c, t dbSNP:373629670
1516 1516 c, t dbSNP:781202495
1517 1517 c, t dbSNP:754659147
1530 1530 a, c dbSNP:200237622
1534 1534 a, g dbSNP:766077420
1542 1542 g, t dbSNP:758167270
1547 1547 c, t dbSNP:267601652
1548 1548 a, g dbSNP:143877538
1553 1553 g, t dbSNP:764716490
1557 1557 c, t dbSNP:761402505
1558 1558 a, c, g dbSNP:764693182
1565 1565 a, g dbSNP:576739220
1568 1568 a, g dbSNP:115266882
1574 1574 a, g dbSNP:772250175
1582 1582 a, c dbSNP:746153244
1585 1585 c, g dbSNP:774476574
1586 1586 g, t dbSNP:770856997
1587 1587 g, t dbSNP:372216502
1593 1593 c, t dbSNP:540149539
1594 1594 g, t dbSNP:754985592
1600 1600 -, g dbSNP:747368721
1602 1602 a, g dbSNP:746775592
1607 1607 c, g dbSNP:780063972
1609 1609 c, g, t dbSNP:749990010
1610 1610 -, tgtc dbSNP:773624358
1610 1610 c, t dbSNP:764951987
1613 1613 c, t dbSNP:201598915
1614 1614 a, g dbSNP:554809009
1617 1617 c, t dbSNP:753411740
1618 1618 a, g dbSNP:764488086
1619 1619 a, g dbSNP:761211929
1628 1628 a, g, t dbSNP:146111714
1632 1632 c, t dbSNP:759905821
1639 1639 c, t dbSNP:774369510
1645 1645 a, g dbSNP:367988218
1646 1646 a, g dbSNP:771211154
1659 1659 c, t dbSNP:766485284
1668 1668 c, t dbSNP:763272772
1669 1669 a, g, t dbSNP:769939259
1677 1677 c, g dbSNP:761992118
1680 1680 -, ttct dbSNP:756182703
1685 1685 a, g dbSNP:775532487
1691 1691 c, g dbSNP:772157920
1697 1697 c, t dbSNP:745628778
1698 1698 c, g dbSNP:186863471
1699 1699 c, t dbSNP:139149160
1700 1700 a, g dbSNP:144494809
1705 1705 a, g dbSNP:777414201
1713 1713 a, g, t dbSNP:11558671
1729 1729 c, t dbSNP:752235032
1730 1730 a, t dbSNP:781625058
1732 1732 a, g dbSNP:369962634
1733 1733 g, t dbSNP:751836823
1738 1738 a, t dbSNP:766827198
1741 1741 g, t dbSNP:763244253
1742 1742 c, g dbSNP:750610043
1744 1744 a, c dbSNP:765591535
1760 1760 c, t dbSNP:771908277
1762 1762 c, t dbSNP:139455686
1779 1779 a, g dbSNP:772104865
1780 1780 g, t dbSNP:375405382
1786 1786 a, g dbSNP:80338724
1790 1790 c, g dbSNP:202144038
1799 1799 a, t dbSNP:776103327
1802 1802 c, t dbSNP:768148130
1804 1804 -, t dbSNP:750225643
1806 1806 g, t dbSNP:746535755
1807 1807 g, t dbSNP:780566134
1810 1810 a, c, t dbSNP:746205031
1812 1812 c, t dbSNP:75622628
1820 1820 c, t dbSNP:757541654
1825 1825 c, t dbSNP:754054414
1826 1826 c, g dbSNP:544174452
1829 1829 a, g dbSNP:756177534
1831 1831 c, g, t dbSNP:548769905
1832 1832 a, g dbSNP:143706021
1847 1847 -, tgc dbSNP:781077173
1848 1848 a, g dbSNP:367948961
1850 1850 a, c dbSNP:765072433
1851 1851 c, t dbSNP:761602352
1852 1852 a, c, g dbSNP:201283753
1853 1853 a, g dbSNP:760210666
1854 1854 -, gagattacaggtggctgcccggg dbSNP:80338725
1854 1854 c, g dbSNP:774907889
1857 1857 a, g dbSNP:772632837
1859 1859 c, t dbSNP:199735534
1860 1860 c, g dbSNP:779579089
1864 1864 c, t dbSNP:771352563
1865 1865 c, t dbSNP:79886797
1867 1867 c, t dbSNP:777999410
1871 1871 c, g dbSNP:201168119
1874 1874 c, t dbSNP:150082469
1875 1875 a, g dbSNP:142801864
1878 1878 a, g dbSNP:758317710
1888 1888 c, g dbSNP:750300786
1889 1889 c, t dbSNP:765192701
1900 1900 c, t dbSNP:200236841
1905 1905 c, t dbSNP:753626243
1906 1906 a, g dbSNP:187260240
1916 1916 a, g dbSNP:760315798
1919 1919 a, g dbSNP:775054829
1933 1933 a, g dbSNP:771652951
1939 1939 c, g dbSNP:759119965
1943 1943 c, t dbSNP:774955681
1946 1946 c, t dbSNP:774049761
1947 1947 c, t dbSNP:370997026
1948 1948 a, g dbSNP:367770143
1957 1957 a, g dbSNP:121908532
1964 1964 a, t dbSNP:769993871
1965 1965 c, t dbSNP:748548237
1971 1971 c, t dbSNP:776787438
1975 1975 a, g dbSNP:373632138
1981 1981 c, t dbSNP:747060193
1990 1990 c, t dbSNP:780179331
1991 1991 a, t dbSNP:757177279
1993 1993 -, a dbSNP:80338726
1994 1994 a, c, t dbSNP:765919667
1995 1995 a, g, t dbSNP:80338727
2003 2003 a, g dbSNP:755823140
2007 2007 c, t dbSNP:80338729
2008 2008 a, g dbSNP:548194276
2017 2017 a, g dbSNP:754713031
2022 2022 c, g dbSNP:751109329
2039 2039 a, g dbSNP:751199034
2044 2044 c, t dbSNP:779855647
2046 2046 a, g dbSNP:757805685
2048 2048 a, c dbSNP:760572056
2063 2063 c, t dbSNP:201931382
2070 2070 a, g dbSNP:200001052
2077 2077 a, t dbSNP:765632410
2078 2078 c, t dbSNP:35539807
2089 2089 c, t dbSNP:573420716
2090 2090 a, g dbSNP:764388459
2097 2097 g, t dbSNP:761035791
2103 2103 a, g, t dbSNP:151330313
2104 2104 c, g, t dbSNP:148962110
2111 2111 c, t dbSNP:769610597
2130 2130 a, g dbSNP:748153245
2136 2136 a, g dbSNP:781292740
2137 2137 c, t dbSNP:768497028
2139 2139 c, g dbSNP:757317844
2155 2155 c, t dbSNP:779551695
2164 2164 a, c dbSNP:758111197
2169 2169 a, c dbSNP:749897928
2180 2180 a, g dbSNP:778545092
2184 2184 a, t dbSNP:756776797
2188 2188 c, t dbSNP:754280216
2202 2202 g, t dbSNP:764619502
2206 2206 c, t dbSNP:760982579
2215 2215 g, t dbSNP:753105901
2216 2216 c, g dbSNP:767600441
2220 2220 a, t dbSNP:759865234
2223 2223 a, g dbSNP:774277675
2224 2224 a, g dbSNP:770984153
2226 2226 a, g dbSNP:763129811
2234 2234 c, g dbSNP:776668360
2247 2247 g, t dbSNP:369129587
2248 2248 c, t dbSNP:746771215
2261 2261