
SLC25A15 cDNA ORF clone, Homo sapiens (human)

Gene Symbol SLC25A15
Entrez Gene ID 10166
Full Name solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15
Synonyms D13S327, HHH, ORC1, ORNT1
General protein information
Preferred Names
mitochondrial ornithine transporter 1
mitochondrial ornithine transporter 1
ornithine transporter 1
solute carrier family 25 member 15
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene is a member of the mitochondrial carrier family. The encoded protein transports ornithine across the inner mitochondrial membrane from the cytosol to the mitochondrial matrix. The protein is an essential component of the urea cycle, and functions in ammonium detoxification and biosynthesis of the amino acid arginine. Mutations in this gene result in hyperornithinemia-hyperammonemia-homocitrullinuria (HHH) syndrome. There is a pseudogene of this locus on the Y chromosome.[provided by RefSeq, May 2009]. lac of sum
Disorder MIM:


Disorder Html: Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome, 238970

mRNA and Protein(s)

mRNA Protein Name
NM_014252 NP_055067 mitochondrial ornithine transporter 1

R-HSA-1430728 Metabolism
R-HSA-70635 Urea cycle
R-HSA-71291 Metabolism of amino acids and derivatives

Homo sapiens (human) SLC25A15 NP_055067.1
Pan troglodytes (chimpanzee) SLC25A15 XP_003954299.1
Macaca mulatta (Rhesus monkey) SLC25A15 XP_001088596.1
Canis lupus familiaris (dog) SLC25A15 XP_543118.1
Bos taurus (cattle) SLC25A15 NP_001039791.1
Mus musculus (house mouse) Slc25a15 NP_851842.1
Rattus norvegicus (Norway rat) Slc25a15 NP_001041345.1
Gallus gallus (chicken) SLC25A15 NP_001008442.1
Danio rerio (zebrafish) slc25a15a NP_001074107.1
Danio rerio (zebrafish) LOC565335 NP_001121816.1
Drosophila melanogaster (fruit fly) CG1628 NP_001259423.1
Caenorhabditis elegans T10F2.2 NP_498094.1
Xenopus (Silurana) tropicalis (western clawed frog) slc25a15 NP_001090866.1


ID Name Evidence
GO:0005739 mitochondrion IEA
GO:0005743 mitochondrial inner membrane TAS
GO:0016020 membrane IEA
GO:0016021 integral to membrane IEA


ID Name Evidence
GO:0000064 L-ornithine transmembrane transporter activity TAS


ID Name Evidence
GO:0000050 urea cycle TAS
GO:0000066 mitochondrial ornithine transport TAS
GO:0006520 cellular amino acid metabolic process TAS
GO:0006810 transport IEA
GO:0034641 cellular nitrogen compound metabolic process TAS

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following SLC25A15 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the SLC25A15 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

***CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu22381 NM_014252 Homo sapiens solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 (SLC25A15), mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $69.30

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

***One clone ID might be correlated to multiple accession numbers, which share the same CDS sequence.

CloneID OHu22381
Clone ID Related Accession (Same CDS sequence) NM_014252
Accession Version NM_014252.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 906bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product mitochondrial ornithine transporter 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB505424.1, BI461478.1, BC002702.2, BU726339.1, AL161614.16 and AA948095.1. This sequence is a reference standard in the RefSeqGene project. On May 15, 2009 this sequence version replaced gi:88703039. Summary: This gene is a member of the mitochondrial carrier family. The encoded protein transports ornithine across the inner mitochondrial membrane from the cytosol to the mitochondrial matrix. The protein is an essential component of the urea cycle, and functions in ammonium detoxification and biosynthesis of the amino acid arginine. Mutations in this gene result in hyperornithinemia-hyperammonemia-homocitrullinuria (HHH) syndrome. There is a pseudogene of this locus on the Y chromosome.[provided by RefSeq, May 2009]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## ##Evidence-Data-START## Transcript exon combination :: AF112968.1, AF177333.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

RefSeq NP_055067.1
Misc Feature(1)224..226(+)
Misc Feature(2)335..397(+)
Misc Feature(3)341..595(+)
Misc Feature(4)356..604(+)
Misc Feature(5)524..586(+)
Misc Feature(6)632..913(+)
Misc Feature(7)650..712(+)
Misc Feature(8)686..916(+)
Misc Feature(9)824..886(+)
Misc Feature(10)935..1210(+)
Misc Feature(11)941..1201(+)
Misc Feature(12)941..1003(+)
Misc Feature(13)1031..1093(+)
Exon (1)1..253
Gene Synonym:
Exon (2)254..377
Gene Synonym:
Exon (3)378..636
Gene Synonym:
Exon (4)637..774
Gene Synonym:
Exon (5)775..944
Gene Synonym:
Exon (6)945..1103
Gene Synonym:
Exon (7)1104..4021
Gene Synonym:
Position Chain Variation Link
3 3 c, g dbSNP:12372842
13 13 a, c dbSNP:556938832
49 49 c, t dbSNP:7997189
50 50 a, c, g dbSNP:541415883
64 64 c, g dbSNP:191621874
91 91 c, g dbSNP:572015184
151 151 c, t dbSNP:149350759
228 228 c, t dbSNP:540752397
256 256 a, t dbSNP:112276566
273 273 c, t dbSNP:536293334
281 281 a, g dbSNP:371080447
282 282 a, g dbSNP:375382325
291 291 c, t dbSNP:368684475
293 293 c, t dbSNP:767210508
296 296 a, g dbSNP:778530206
298 298 a, g dbSNP:755980686
306 306 c, t dbSNP:766122874
315 315 a, g dbSNP:552939219
317 317 a, g dbSNP:754981827
333 333 a, g dbSNP:778928196
335 335 a, c dbSNP:751757710
337 337 a, t dbSNP:757399947
338 338 c, g dbSNP:781526529
340 340 c, t dbSNP:573033866
342 342 a, t dbSNP:370279404
347 347 a, g dbSNP:770009034
366 366 a, c dbSNP:202247806
367 367 a, g dbSNP:200958757
375 375 c, g dbSNP:749585613
379 379 -, aggtac dbSNP:767135599
386 386 a, g dbSNP:772586133
390 390 a, g dbSNP:772613660
392 392 a, g dbSNP:760167822
401 401 a, g dbSNP:104894430
410 410 c, t dbSNP:776411120
413 413 a, g, t dbSNP:759454598
415 415 c, g dbSNP:752490809
417 417 c, g dbSNP:121908536
418 418 -, aatg dbSNP:752415542
420 420 g, t dbSNP:199737843
422 422 a, g dbSNP:762809317
432 432 g, t dbSNP:121908533
433 433 -, caga dbSNP:756522093
438 438 c, t dbSNP:764024928
439 439 a, g dbSNP:41396747
455 455 c, t dbSNP:540292884
456 456 a, g dbSNP:201647638
460 460 c, t dbSNP:560300254
461 461 c, t dbSNP:144656633
466 466 c, t dbSNP:376634191
467 467 a, g dbSNP:539373322
469 469 c, g dbSNP:187685447
471 471 a, g dbSNP:758838019
474 474 a, g dbSNP:778342930
480 480 a, c dbSNP:746560103
497 497 -, ggcttccgt dbSNP:764589606
503 503 c, g, t dbSNP:552342390
504 504 a, g dbSNP:34615430
513 513 a, g dbSNP:769512206
516 516 a, g dbSNP:774381092
517 517 c, g dbSNP:762803461
518 518 a, g dbSNP:763995098
526 526 a, t dbSNP:774319330
534 534 a, t dbSNP:121908534
538 538 c, t dbSNP:572717478
539 539 a, g dbSNP:531611390
540 540 c, g dbSNP:753868358
545 545 a, g dbSNP:755209386
547 547 c, t dbSNP:765380976
548 548 a, g, t dbSNP:753073964
553 553 g, t dbSNP:778193187
560 560 a, g dbSNP:747522013
563 563 c, t dbSNP:550585368
570 570 c, t dbSNP:192897984
571 571 a, g dbSNP:765128094
577 577 c, t dbSNP:536354947
578 578 a, g, t dbSNP:553002387
581 581 g, t dbSNP:749081821
589 589 g, t dbSNP:768462826
594 594 c, t dbSNP:773974900
599 599 c, t dbSNP:200014560
600 600 a, g dbSNP:369201060
604 604 a, g, t dbSNP:761843636
605 605 a, g dbSNP:765504284
614 614 c, t dbSNP:752943501
616 616 a, g dbSNP:763267150
620 620 a, g dbSNP:771418874
633 633 g, t dbSNP:751822761
637 637 c, g, t dbSNP:762253875
643 643 g, t dbSNP:750924937
646 646 a, g dbSNP:756644906
647 647 a, g dbSNP:779635040
648 648 a, g dbSNP:753227136
651 651 -, cattcattttctaggtgggatcat dbSNP:745892996
652 652 a, g dbSNP:754666431
655 655 c, t dbSNP:9577152
656 656 a, g dbSNP:747998866
658 658 c, t dbSNP:371187770
659 659 a, g, t dbSNP:199894905
667 667 c, t dbSNP:35434090
668 668 a, g dbSNP:770726226
676 676 a, c dbSNP:775654159
684 684 c, t dbSNP:749323553
700 700 -, a dbSNP:758438178
702 702 c, t dbSNP:201902280
703 703 a, g dbSNP:543205273
709 709 c, g, t dbSNP:151093794
710 710 a, g dbSNP:553432772
719 719 c, t dbSNP:573469049
720 720 a, g, t dbSNP:186892167
725 725 c, t dbSNP:754436560
729 729 -, c dbSNP:780201405
734 734 c, t dbSNP:764993422
739 739 a, g dbSNP:752316567
744 744 a, g dbSNP:758007220
745 745 a, g dbSNP:374806769
750 750 c, g, t dbSNP:777568380
759 759 c, t dbSNP:757284575
780 780 c, t dbSNP:200117115
784 784 g, t dbSNP:372332143
788 788 a, g dbSNP:772487311
800 800 a, g dbSNP:769371469
804 804 c, t dbSNP:778131013
809 809 a, g dbSNP:747458822
811 811 a, g dbSNP:771173592
812 812 g, t dbSNP:777014493
825 825 a, g dbSNP:759984675
826 826 a, g dbSNP:770229041
829 829 c, t dbSNP:774986959
835 835 c, g, t dbSNP:200321784
843 843 c, g dbSNP:200873328
857 857 c, t dbSNP:104894429
860 860 a, g dbSNP:104894424
863 863 a, g dbSNP:750171185
870 870 a, g dbSNP:756007568
874 874 c, t dbSNP:374352017
875 875 -, ttc dbSNP:747270765
884 884 -, ttc dbSNP:202247803
886 886 c, g, t dbSNP:141028076
887 887 a, c, g dbSNP:151239794
890 890 a, g dbSNP:747230863
891 891 a, g dbSNP:202247804
898 898 a, g dbSNP:774514708
902 902 a, g dbSNP:781425166
903 903 a, g dbSNP:746179010
906 906 a, g dbSNP:770355365
907 907 a, g dbSNP:775952093
923 923 a, g dbSNP:762489495
930 930 c, t dbSNP:768185714
938 938 a, g dbSNP:773862892
939 939 a, c dbSNP:576852849
946 946 c, t dbSNP:769089733
948 948 c, t dbSNP:773735557
953 953 c, t dbSNP:747686892
954 954 c, t dbSNP:139034961
958 958 a, g dbSNP:61964269
960 960 c, t dbSNP:772900961
961 961 g, t dbSNP:267603823
978 978 a, g dbSNP:760589440
980 980 a, g dbSNP:202247805
984 984 c, t dbSNP:199816618
989 989 c, t dbSNP:766311643
999 999 c, t dbSNP:776523157
1000 1000 a, g, t dbSNP:183697658
1001 1001 g, t dbSNP:751658918
1002 1002 c, t dbSNP:757347762
1003 1003 a, g dbSNP:767671614
1005 1005 a, t dbSNP:201625549
1017 1017 g, t dbSNP:539110848
1023 1023 a, t dbSNP:780409673
1028 1028 a, g dbSNP:142236568
1036 1036 a, g dbSNP:144631850
1037 1037 a, g dbSNP:779459044
1053 1053 a, g dbSNP:747658091
1062 1062 c, t dbSNP:138505594
1065 1065 c, g dbSNP:772560557
1073 1073 a, g dbSNP:746683247
1078 1078 c, t dbSNP:11618618
1082 1082 a, t dbSNP:17849654
1087 1087 -, tgt dbSNP:774165156
1099 1099 c, g, t dbSNP:759403492
1101 1101 a, g dbSNP:775464165
1110 1110 c, t dbSNP:140242288
1111 1111 a, g, t dbSNP:144478411
1114 1114 c, g dbSNP:768406331
1117 1117 a, g dbSNP:773346578
1122 1122 c, g dbSNP:368504524
1133 1133 c, t dbSNP:766635909
1137 1137 c, t dbSNP:121908535
1140 1140 a, t dbSNP:202247808
1145 1145 c, t dbSNP:202247807
1146 1146 a, g dbSNP:104894431
1154 1154 c, t dbSNP:759639317
1165 1165 a, t dbSNP:199850093
1167 1167 c, t dbSNP:765658299
1168 1168 a, g dbSNP:751245001
1169 1169 c, t dbSNP:202247809
1183 1183 c, t dbSNP:148422923
1184 1184 a, g dbSNP:751176510
1186 1186 a, g dbSNP:756808391
1187 1187 c, t dbSNP:141751422
1188 1188 a, g dbSNP:201442495
1193 1193 a, g dbSNP:745535622
1195 1195 a, g dbSNP:769268831
1213 1213 a, g dbSNP:779899101
1215 1215 -, g dbSNP:771527035
1230 1230 a, g dbSNP:749031700
1241 1241 g, t dbSNP:368080925
1243 1243 c, g, t dbSNP:188641299
1256 1256 c, t dbSNP:760782484
1259 1259 a, g dbSNP:541920185
1276 1276 a, t dbSNP:145530626
1279 1279 a, g dbSNP:374447889
1280 1280 c, t dbSNP:372905618
1286 1286 g, t dbSNP:17090557
1358 1358 c, t dbSNP:541601218
1360 1360 c, g dbSNP:779462191
1387 1387 c, g dbSNP:9577153
1417 1417 a, g dbSNP:147308374
1441 1441 g, t dbSNP:550247099
1457 1457 c, g dbSNP:140939224
1468 1468 a, g dbSNP:772189045
1473 1473 c, g dbSNP:562908906
1507 1507 a, g dbSNP:570358113
1531 1531 c, t dbSNP:532779255
1532 1532 a, g dbSNP:185312797
1537 1537 c, t dbSNP:556640392
1550 1550 a, g dbSNP:548853171
1581 1581 a, g dbSNP:9549293
1648 1648 g, t dbSNP:75842883
1691 1691 c, t dbSNP:770568597
1699 1699 a, g dbSNP:188637038
1742 1742 c, t dbSNP:571591018
1743 1743 a, g dbSNP:7322603
1754 1754 -, t dbSNP:760958784
1782 1782 c, t dbSNP:759466423
1783 1783 g, t dbSNP:556607959
1806 1806 a, g dbSNP:558972736
1807 1807 c, t dbSNP:7321976
1812 1812 a, t dbSNP:555617523
1834 1834 c, g dbSNP:555003166
1838 1838 g, t dbSNP:7320743
1867 1867 a, g dbSNP:192586176
1868 1868 c, t dbSNP:763688411
1869 1869 a, g dbSNP:146515586
1876 1876 c, g, t dbSNP:377697585
1904 1904 a, t dbSNP:543666696
1912 1912 c, t dbSNP:111782657
1916 1916 g, t dbSNP:528923394
1943 1943 c, t dbSNP:542592916
1951 1951 c, t dbSNP:559212233
1955 1955 c, g dbSNP:543664356
2000 2000 a, t dbSNP:528162632
2014 2014 a, g dbSNP:551620153
2016 2016 a, g dbSNP:571430068
2019 2019 -, c dbSNP:34065528
2088 2088 a, g dbSNP:761539006
2099 2099 c, t dbSNP:767132355
2110 2110 g, t dbSNP:754225262
2126 2126 c, t dbSNP:12585190
2157 2157 c, g dbSNP:17061602
2196 2196 c, g dbSNP:753226524
2218 2218 c, t dbSNP:183698412
2242 2242 g, t dbSNP:758434737
2270 2270 a, g dbSNP:370933385
2279 2279 c, t dbSNP:765309918
2301 2301 c, t dbSNP:555708514
2303 2303 c, t dbSNP:763217854
2333 2333 a, g dbSNP:764750734
2339 2339 g, t dbSNP:752084290
2355 2355 c, t dbSNP:566061389
2356 2356 a, g dbSNP:188415420
2365 2365 a, g dbSNP:138641855
2368 2368 c, t dbSNP:376547074
2384 2384 g, t dbSNP:779559610
2391 2391 a, g dbSNP:749156194
2396 2396 c, t dbSNP:754736093
2398 2398 a, g dbSNP:778638112
2399 2399 c, t dbSNP:577768238
2400 2400 a, g dbSNP:371045614
2401 2401 -, cttac dbSNP:775263243
2409 2409 c, t dbSNP:771941464
2419 2419 c, g dbSNP:776697549
2421 2421 c, t dbSNP:745931350
2422 2422 c, g dbSNP:181274589
2433 2433 -, cat dbSNP:760464704
2435 2435 a, g dbSNP:557403062
2439 2439 a, g dbSNP:763418495
2451 2451 c, t dbSNP:375736936
2454 2454 c, t dbSNP:574255399
2469 2469 -, cctccaccaatcagaaac dbSNP:764550786
2478 2478 a, c dbSNP:140321147
2500 2500 c, g dbSNP:559268726
2608 2608 c, t dbSNP:528186507
2610 2610 g, t dbSNP:771176038
2622 2622 a, g dbSNP:753167467
2626 2626 c, g dbSNP:781339579
2653 2653 a, g dbSNP:745632043
2656 2656 c, g dbSNP:150310747
2703 2703 a, g dbSNP:551210492
2709 2709 a, g dbSNP:564967592
2722 2722 a, g dbSNP:113342797
2740 2740 a, c dbSNP:775526297
2810 2810 a, g dbSNP:527365373
2812 2812 a, g dbSNP:184567699
2817 2817 c, t dbSNP:567475177
2826 2826 c, t dbSNP:762985091
2831 2831 c, t dbSNP:552771107
2838 2838 c, t dbSNP:529972305
2848 2848 a, g dbSNP:374682223
2854 2854 a, g dbSNP:59670947
2869 2869 g, t dbSNP:149457069
2910 2910 c, t dbSNP:557871939
2931 2931 g, t dbSNP:571391978
2949 2949 c, t dbSNP:536553279
2960 2960 a, g dbSNP:558978847
2965 2965 g, t dbSNP:574269155
3029 3029 a, g dbSNP:536912632
3036 3036 c, t dbSNP:767166451
3050 3050 -, a dbSNP:560954922
3057 3057 -, aaaag dbSNP:201178711
3058 3058 a, g dbSNP:552700500
3075 3075 g, t dbSNP:750125078
3079 3079 a, t dbSNP:759846184
3080 3080 c, t dbSNP:189882750
3083 3083 a, c dbSNP:9566580
3163 3163 c, t dbSNP:753138248
3173 3173 a, g dbSNP:114817943
3195 3195 a, g dbSNP:575387776
3200 3200 a, g dbSNP:544095405
3248 3248 a, g dbSNP:758922316
3268 3268 a, g dbSNP:41286983
3270 3270 g, t dbSNP:147147914
3275 3275 g, t dbSNP:751658728
3299 3299 c, t dbSNP:757326840
3325 3325 a, t dbSNP:17592947
3328 3328 a, g dbSNP:75778183
3332 3332 -, taa dbSNP:568137620
3343 3343 c, t dbSNP:558654535
3418 3418 c, t dbSNP:117823875
3492 3492 c, t dbSNP:544170849
3550 3550 a, g dbSNP:17080831
3553 3553 g, t dbSNP:746120990
3556 3556 g, t dbSNP:9577154
3560 3560 c, t dbSNP:551340341
3582 3582 c, t dbSNP:534792041
3598 3598 -, a dbSNP:760176316
3609 3609 c, t dbSNP:571430821
3635 3635 c, t dbSNP:777575420
3666 3666 a, g, t dbSNP:181523869
3668 3668 c, t dbSNP:550905917
3722 3722 -, ccct dbSNP:536717655
3732 3732 c, t dbSNP:567801930
3746 3746 c, t dbSNP:768634322
3791 3791 g, t dbSNP:574652330
3793 3793 c, t dbSNP:553666156
3799 3799 c, t dbSNP:747673089
3826 3826 -, agaa dbSNP:776345416
3858 3858 c, t dbSNP:138530613
3860 3860 a, g dbSNP:538665273
3862 3862 a, g dbSNP:187064041
3864 3864 a, c dbSNP:558557587
3881 3881 -, t dbSNP:111506631
3937 3937 a, g dbSNP:575425399
3954 3954 a, c dbSNP:569263375

Target ORF information:

RefSeq Version NM_014252
Organism Homo sapiens (human)
Definition Homo sapiens solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 (SLC25A15), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


A genome-wide association study identifies 2 susceptibility Loci for Crohn's disease in a Japanese population
Gastroenterology 144 (4), 781-788 (2013)
Yamazaki K, Umeno J, Takahashi A, Hirano A, Johnson TA, Kumasaka N, Morizono T, Hosono N, Kawaguchi T, Takazoe M, Yamada T, Suzuki Y, Tanaka H, Motoya S, Hosokawa M, Arimura Y, Shinomura Y, Matsui T, Matsumoto T, Iida M, Tsunoda T, Nakamura Y, Kamatani N and Kubo M.


The mitochondrial transporter family SLC25: identification, properties and physiopathology
Mol. Aspects Med. 34 (2-3), 465-484 (2013)
Palmieri F.


Long-term follow-up of four patients affected by HHH syndrome
Clin. Chim. Acta 413 (13-14), 1151-1155 (2012)
Kim SZ, Song WJ, Nyhan WL, Ficicioglu C, Mandell R and Shih VE.


Substrate specificity of the two mitochondrial ornithine carriers can be swapped by single mutation in substrate binding site
J. Biol. Chem. 287 (11), 7925-7934 (2012)
Monne M, Miniero DV, Daddabbo L, Robinson AJ, Kunji ER and Palmieri F.


Insights into the mutation-induced HHH syndrome from modeling human mitochondrial ornithine transporter-1
PLoS ONE 7 (1), E31048 (2012)
Wang JF and Chou KC.


Clinical and molecular findings in hyperornithinemia-hyperammonemia-homocitrullinuria syndrome
Neurology 57 (5), 911-914 (2001)
Salvi S, Santorelli FM, Bertini E, Boldrini R, Meli C, Donati A, Burlina AB, Rizzo C, Di Capua M, Fariello G and Dionisi-Vici C.


Diagnosis of Japanese patients with HHH syndrome by molecular genetic analysis: a common mutation, R179X
J. Hum. Genet. 46 (5), 260-262 (2001)
Miyamoto T, Kanazawa N, Kato S, Kawakami M, Inoue Y, Kuhara T, Inoue T, Takeshita K and Tsujino S.


Three novel mutations (G27E, insAAC, R179X) in the ORNT1 gene of Japanese patients with hyperornithinemia, hyperammonemia, and homocitrullinuria syndrome
Ann. Neurol. 47 (5), 625-631 (2000)
Tsujino S, Kanazawa N, Ohashi T, Eto Y, Saito T, Kira J and Yamada T.


Hyperornithinaemia-hyperammonaemia-homocitrullinuria syndrome is caused by mutations in a gene encoding a mitochondrial ornithine transporter
Nat. Genet. 22 (2), 151-158 (1999)
Camacho JA, Obie C, Biery B, Goodman BK, Hu CA, Almashanu S, Steel G, Casey R, Lambert M, Mitchell GA and Valle D.


Hyperornithinemia-Hyperammonemia-Homocitrullinuria Syndrome
(in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)
Camacho,J. and Rioseco-Camacho,N.
