Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

ADARB2 adenosine deaminase, RNA-specific, B2 (non-functional) [Homo sapiens (human)]

Gene Symbol ADARB2
Entrez Gene ID 105
Full Name adenosine deaminase, RNA-specific, B2 (non-functional)
Synonyms ADAR3, RED2
General protein information
Preferred Names
double-stranded RNA-specific editase B2
double-stranded RNA-specific editase B2
RED2 homolog
homolog of rat BLUE
RNA-editing enzyme 2
RNA-editing deaminase 2
dsRNA adenosine deaminase B2
RNA-dependent adenosine deaminase 3
adenosine deaminase, RNA-specific, B2 (RED1 homolog rat)
adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of the double-stranded RNA adenosine deaminase family of RNA-editing enzymes and may play a regulatory role in RNA editing. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html:
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu22812 NM_018702 Homo sapiens adenosine deaminase, RNA-specific, B2 (non-functional) (ADARB2), mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu22812D
Sequence Information ORF Nucleotide Sequence (Length: 2220bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product double-stranded RNA-specific editase B2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AF034837.1, BC140852.1 and AL392083.17. On Jun 1, 2011 this sequence version replaced gi:161377416. Summary: This gene encodes a member of the double-stranded RNA adenosine deaminase family of RNA-editing enzymes and may play a regulatory role in RNA editing. [provided by RefSeq, Jul 2008]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF034837.1, BC137477.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2157437 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)147..149(+)
Misc Feature(2)393..431(+)
Misc Feature(3)702..893(+)
Misc Feature(4)717..860(+)
Misc Feature(5)1158..1343(+)
Misc Feature(6)1158..1310(+)
Misc Feature(7)1407..2534(+)
Exon (1)1..426
Gene Synonym:
Exon (2)427..513
Gene Synonym:
Exon (3)514..1403
Gene Synonym:
Exon (4)1404..1518
Gene Synonym:
Exon (5)1519..1687
Gene Synonym:
Exon (6)1688..1839
Gene Synonym:
Exon (7)1840..2008
Gene Synonym:
Exon (8)2009..2190
Gene Synonym:
Exon (9)2191..2369
Gene Synonym:
Exon (10)2370..8426
Gene Synonym:
Position Chain Variation Link
57 57 a, g dbSNP:563326657
73 73 c, t dbSNP:368107258
87 87 c, t dbSNP:543037099
117 117 c, t dbSNP:750498021
118 118 a, g dbSNP:3750682
129 129 c, g dbSNP:557432796
137 137 a, g dbSNP:540682391
173 173 a, g dbSNP:3750683
188 188 c, g dbSNP:555512180
215 215 c, g dbSNP:373588717
219 219 a, g dbSNP:536173563
253 253 g, t dbSNP:570236610
277 277 a, t dbSNP:749965510
281 281 a, g dbSNP:767170314
284 284 a, g dbSNP:761609570
285 285 a, c, t dbSNP:764585306
287 287 a, g dbSNP:763487633
288 288 -, tgcagg dbSNP:762095242
290 290 c, g dbSNP:776127236
296 296 a, c dbSNP:770270241
298 298 g, t dbSNP:745927847
300 300 g, t dbSNP:776620651
308 308 a, c dbSNP:371415046
309 309 c, g dbSNP:771133246
313 313 a, c, t dbSNP:778607909
318 318 g, t dbSNP:368491065
322 322 c, t dbSNP:3750684
324 324 a, g dbSNP:780040015
332 332 c, g dbSNP:756048728
335 335 c, g dbSNP:749929644
339 339 c, g dbSNP:766960384
343 343 c, g dbSNP:756931124
344 344 g, t dbSNP:751262418
349 349 g, t dbSNP:763896714
354 354 a, g dbSNP:763405778
356 356 a, g dbSNP:775756758
362 362 a, t dbSNP:765750451
365 365 g, t dbSNP:759980818
368 368 a, g dbSNP:372889691
370 370 a, g dbSNP:770999496
371 371 c, t dbSNP:747172516
373 373 g, t dbSNP:773413963
378 378 c, t dbSNP:772350679
384 384 c, t dbSNP:370305318
392 392 c, g dbSNP:749055382
396 396 a, g dbSNP:779764730
403 403 a, g dbSNP:756031726
405 405 -, agg dbSNP:774726932
412 412 a, g dbSNP:776588184
415 415 c, g dbSNP:539447872
418 418 a, g dbSNP:780687020
420 420 a, c dbSNP:570814305
421 421 a, g dbSNP:763862208
426 426 g, t dbSNP:756841096
430 430 a, g dbSNP:552228939
437 437 c, t dbSNP:767339788
439 439 c, t dbSNP:538667175
440 440 a, g dbSNP:752011712
442 442 c, t dbSNP:182864478
448 448 c, t dbSNP:562862928
455 455 c, t dbSNP:763394476
456 456 a, g dbSNP:3793733
457 457 c, t dbSNP:769774725
459 459 c, t dbSNP:759718803
478 478 c, g dbSNP:527533816
479 479 c, g, t dbSNP:141430718
488 488 a, g dbSNP:148713567
491 491 c, t dbSNP:768595539
493 493 c, t dbSNP:749190776
494 494 a, g dbSNP:373102685
502 502 a, g dbSNP:548406067
512 512 c, t dbSNP:146004559
542 542 c, t dbSNP:745350162
545 545 c, t dbSNP:780873922
551 551 g, t dbSNP:756931278
558 558 c, t dbSNP:751268780
563 563 c, t dbSNP:533976121
566 566 a, g, t dbSNP:753144194
570 570 c, t dbSNP:765636382
575 575 a, g dbSNP:755493645
581 581 c, t dbSNP:199718464
583 583 g, t dbSNP:766449261
585 585 a, g dbSNP:554622151
588 588 c, t dbSNP:773296233
589 589 a, c, g dbSNP:200348424
595 595 a, c, g dbSNP:568793305
597 597 a, g dbSNP:3750673
599 599 a, c dbSNP:745834121
602 602 a, c, t dbSNP:371399725
604 604 c, t dbSNP:368485422
605 605 g, t dbSNP:201398511
607 607 c, t dbSNP:777258791
609 609 a, g, t dbSNP:748408152
612 612 a, g dbSNP:779363940
614 614 a, g dbSNP:376014755
617 617 a, g dbSNP:538991022
628 628 c, g dbSNP:766932249
629 629 g, t dbSNP:756186450
632 632 a, g dbSNP:370256785
635 635 a, g dbSNP:767612552
641 641 g, t dbSNP:762117300
646 646 c, g dbSNP:775110188
647 647 a, g dbSNP:765129282
648 648 a, g dbSNP:759460553
649 649 a, g, t dbSNP:376882828
650 650 a, c dbSNP:376778235
652 652 a, c dbSNP:746478528
653 653 c, t dbSNP:772798388
656 656 c, g dbSNP:771580386
664 664 c, t dbSNP:372884521
669 669 c, t dbSNP:370741862
671 671 a, g dbSNP:755325947
690 690 c, t dbSNP:749722366
694 694 c, t dbSNP:780511733
698 698 a, g dbSNP:756666811
701 701 a, g dbSNP:143914218
702 702 a, c dbSNP:781364873
703 703 c, t dbSNP:757357559
705 705 a, c dbSNP:751822052
711 711 c, g dbSNP:764476897
713 713 a, g dbSNP:759372590
728 728 c, g, t dbSNP:766366626
731 731 g, t dbSNP:571661814
736 736 a, g dbSNP:760688924
740 740 a, g dbSNP:772527703
741 741 c, g, t dbSNP:761290394
753 753 c, g, t dbSNP:377136355
757 757 a, c dbSNP:749634630
758 758 a, g dbSNP:146032961
767 767 c, g dbSNP:770161756
769 769 c, t dbSNP:746391870
774 774 c, t dbSNP:781076944
776 776 a, g dbSNP:757352052
781 781 a, c dbSNP:751727246
784 784 c, t dbSNP:778118609
785 785 c, t dbSNP:566764885
789 789 a, g dbSNP:372316430
791 791 c, t dbSNP:35398040
797 797 a, g, t dbSNP:551013892
798 798 a, g dbSNP:767424216
815 815 c, t dbSNP:761357562
823 823 c, g dbSNP:773904207
824 824 a, g dbSNP:768253203
825 825 a, t dbSNP:762625492
831 831 c, g dbSNP:138102156
836 836 a, t dbSNP:530900846
840 840 c, g dbSNP:746278216
844 844 a, c dbSNP:150371863
845 845 a, c dbSNP:771390108
852 852 -, aag dbSNP:780779536
852 852 a, g dbSNP:747035263
861 861 a, t dbSNP:778030646
866 866 c, t dbSNP:758622725
872 872 a, g dbSNP:748392221
875 875 a, g dbSNP:779059890
885 885 a, g dbSNP:755935666
887 887 a, g dbSNP:750228713
890 890 c, t dbSNP:767471032
893 893 c, g, t dbSNP:201957828
896 896 c, g dbSNP:372200566
908 908 a, c dbSNP:751030018
913 913 g, t dbSNP:763599291
915 915 c, t dbSNP:200155907
919 919 a, c, t dbSNP:140367778
920 920 a, g dbSNP:764835387
925 925 g, t dbSNP:759922244
936 936 g, t dbSNP:776880733
940 940 a, g dbSNP:369013795
946 946 g, t dbSNP:747519318
953 953 c, t dbSNP:114767511
964 964 c, t dbSNP:772262270
986 986 c, t dbSNP:748302447
988 988 a, g dbSNP:371841636
991 991 c, t dbSNP:369418990
992 992 a, g dbSNP:745631256
1005 1005 c, t dbSNP:780884791
1008 1008 c, g dbSNP:757120138
1032 1032 c, g, t dbSNP:577247158
1134 1134 a, g dbSNP:3750674
1143 1143 a, g dbSNP:540079223
1144 1144 c, g dbSNP:764893125
1170 1170 c, g dbSNP:574530472
1175 1175 g, t dbSNP:759142098
1180 1180 a, g dbSNP:776987710
1190 1190 c, t dbSNP:766662895
1202 1202 c, t dbSNP:761176439
1214 1214 a, g dbSNP:773849541
1219 1219 c, g dbSNP:377134415
1224 1224 a, g dbSNP:191180422
1241 1241 c, t dbSNP:542842491
1244 1244 c, g dbSNP:774320437
1251 1251 g, t dbSNP:768887778
1253 1253 c, t dbSNP:749476217
1260 1260 a, g dbSNP:780983352
1271 1271 g, t dbSNP:770700995
1274 1274 g, t dbSNP:746874717
1278 1278 a, g dbSNP:777664123
1297 1297 a, g dbSNP:758352727
1301 1301 g, t dbSNP:752210106
1307 1307 c, t dbSNP:778291217
1310 1310 a, g dbSNP:368208673
1312 1312 a, g dbSNP:753415492
1314 1314 c, g dbSNP:766198927
1319 1319 a, c, g dbSNP:750869535
1325 1325 a, g dbSNP:558158478
1327 1327 c, t dbSNP:762445560
1328 1328 c, t dbSNP:774427511
1349 1349 c, t dbSNP:768631166
1355 1355 a, g dbSNP:376154657
1361 1361 c, t dbSNP:372626311
1365 1365 c, t dbSNP:770045643
1371 1371 a, c dbSNP:746756011
1373 1373 c, t dbSNP:777574493
1374 1374 a, g dbSNP:771929457
1381 1381 c, g dbSNP:566838000
1383 1383 a, c dbSNP:778966514
1392 1392 c, t dbSNP:754440582
1395 1395 a, g dbSNP:753426323
1397 1397 a, g dbSNP:779833014
1398 1398 c, t dbSNP:755854917
1399 1399 c, t dbSNP:750777792
1409 1409 c, t dbSNP:752704860
1410 1410 a, g dbSNP:200545586
1412 1412 a, g dbSNP:34353456
1414 1414 a, c dbSNP:776828559
1417 1417 c, g dbSNP:374327418
1428 1428 c, t dbSNP:761488892
1433 1433 c, t dbSNP:774219922
1437 1437 a, c dbSNP:768439031
1439 1439 c, g dbSNP:749243085
1442 1442 c, g dbSNP:775082451
1443 1443 g, t dbSNP:377544433
1446 1446 c, t dbSNP:146672392
1447 1447 a, g dbSNP:745442175
1448 1448 c, t dbSNP:201071907
1449 1449 a, g dbSNP:765731656
1454 1454 a, g dbSNP:747294043
1456 1456 c, g, t dbSNP:373439178
1457 1457 a, g dbSNP:370088825
1459 1459 c, t dbSNP:765800300
1460 1460 a, g, t dbSNP:376318692
1468 1468 c, t dbSNP:766460335
1469 1469 a, g dbSNP:760991235
1470 1470 c, t dbSNP:773952439
1473 1473 -, atgca dbSNP:764518286
1473 1473 -, atg dbSNP:751254987
1473 1473 a, g dbSNP:763963681
1474 1474 c, t dbSNP:762899628
1477 1477 a, c dbSNP:775569070
1478 1478 c, t dbSNP:759916793
1479 1479 a, c, g, t dbSNP:776230414
1482 1482 c, t dbSNP:770421331
1483 1483 a, g, t dbSNP:144565549
1492 1492 c, t dbSNP:538700330
1493 1493 a, g dbSNP:184821602
1495 1495 c, t dbSNP:779370453
1496 1496 a, c, g dbSNP:753872420
1506 1506 a, g dbSNP:780188177
1508 1508 c, t dbSNP:527405355
1514 1514 a, c dbSNP:750196526
1522 1522 c, t dbSNP:537767766
1524 1524 a, c, g dbSNP:538734059
1526 1526 c, t dbSNP:551961865
1530 1530 c, t dbSNP:766263863
1531 1531 a, g, t dbSNP:772619757
1532 1532 g, t dbSNP:140915343
1537 1537 c, t dbSNP:112668147
1538 1538 a, g dbSNP:774641401
1544 1544 c, t dbSNP:371856728
1545 1545 a, g, t dbSNP:200534087
1558 1558 c, t dbSNP:770257869
1559 1559 a, g dbSNP:745915225
1576 1576 g, t dbSNP:11250353
1577 1577 c, t dbSNP:183812854
1578 1578 a, g dbSNP:146452150
1580 1580 c, t dbSNP:560961575
1581 1581 a, g dbSNP:374032478
1598 1598 c, g dbSNP:754786185
1608 1608 a, g dbSNP:753624385
1610 1610 a, g dbSNP:766291371
1622 1622 c, t dbSNP:756034483
1623 1623 a, g dbSNP:749880767
1624 1624 c, g, t dbSNP:761373140
1625 1625 a, g dbSNP:370299598
1629 1629 a, g dbSNP:763776977
1632 1632 a, g dbSNP:201639089
1635 1635 a, g dbSNP:775744384
1642 1642 a, g dbSNP:770297391
1645 1645 c, t dbSNP:200709380
1646 1646 a, g dbSNP:777332641
1650 1650 a, c dbSNP:771127669
1653 1653 a, c dbSNP:142949222
1659 1659 c, t dbSNP:778114818
1666 1666 c, t dbSNP:758570790
1667 1667 a, g dbSNP:139572548
1677 1677 c, t dbSNP:779715693
1679 1679 a, g dbSNP:756019624
1692 1692 c, g, t dbSNP:376850087
1693 1693 a, g, t dbSNP:138937848
1695 1695 a, c, t dbSNP:199735124
1696 1696 a, g dbSNP:149857202
1697 1697 c, t dbSNP:754708655
1698 1698 a, g dbSNP:754187753
1701 1701 c, g dbSNP:766861417
1706 1706 -, ctca dbSNP:768483385
1706 1706 a, g dbSNP:371206658
1710 1710 a, c dbSNP:750891542
1711 1711 a, c, g dbSNP:139936295
1714 1714 c, t dbSNP:761776908
1715 1715 a, g dbSNP:35356097
1716 1716 a, c dbSNP:143822275
1721 1721 a, c, t dbSNP:267602405
1722 1722 a, g dbSNP:140028838
1723 1723 c, t dbSNP:199540152
1725 1725 c, t dbSNP:767557012
1726 1726 a, g dbSNP:183096272
1728 1728 c, t dbSNP:772997267
1730 1730 a, c dbSNP:772067169
1733 1733 a, g dbSNP:191642114
1740 1740 a, g dbSNP:759478975
1741 1741 a, g dbSNP:778488278
1744 1744 a, g dbSNP:147477539
1746 1746 c, t dbSNP:748935715
1747 1747 a, g dbSNP:185909498
1751 1751 g, t dbSNP:756516330
1752 1752 c, g, t dbSNP:141751719
1753 1753 a, g dbSNP:757814695
1757 1757 c, g dbSNP:201411121
1762 1762 g, t dbSNP:764176219
1772 1772 c, t dbSNP:770798641
1773 1773 c, t dbSNP:763082042
1778 1778 c, t dbSNP:565396172
1779 1779 a, g dbSNP:765487943
1785 1785 a, g dbSNP:200449688
1786 1786 c, t dbSNP:760336358
1787 1787 c, t dbSNP:773087929
1789 1789 c, t dbSNP:771837708
1794 1794 -, t dbSNP:749050015
1796 1796 c, t dbSNP:748127296
1797 1797 a, g dbSNP:774213881
1802 1802 c, t dbSNP:563819822
1803 1803 a, g, t dbSNP:200268465
1810 1810 g, t dbSNP:769594686
1814 1814 c, t dbSNP:768131113
1821 1821 c, t dbSNP:148037900
1823 1823 c, t dbSNP:144533631
1824 1824 a, g dbSNP:781626081
1832 1832 c, t dbSNP:757650389
1836 1836 c, g dbSNP:752097463
1841 1841 g, t dbSNP:775086157
1851 1851 a, g dbSNP:769335700
1859 1859 c, t dbSNP:149325076
1860 1860 a, g dbSNP:138734198
1863 1863 a, g dbSNP:770509238
1872 1872 c, t dbSNP:184297552
1873 1873 a, g dbSNP:747329974
1874 1874 a, c, t dbSNP:772506968
1875 1875 a, g dbSNP:748640363
1883 1883 a, g dbSNP:144626861
1884 1884 a, c dbSNP:755053826
1885 1885 a, g dbSNP:749375883
1895 1895 c, t dbSNP:780275876
1896 1896 a, g dbSNP:528915733
1898 1898 g, t dbSNP:367967112
1899 1899 g, t dbSNP:763996513
1901 1901 a, c dbSNP:758330444
1902 1902 a, g dbSNP:562949646
1904 1904 a, g, t dbSNP:140800577
1913 1913 a, g dbSNP:181497558
1920 1920 a, g dbSNP:374363014
1924 1924 a, g dbSNP:137952643
1934 1934 c, t dbSNP:772906125
1935 1935 a, g, t dbSNP:150320038
1936 1936 c, t dbSNP:375619418
1937 1937 a, g dbSNP:140160847
1946 1946 c, g dbSNP:769066420
1952 1952 c, t dbSNP:749348675
1953 1953 a, g dbSNP:780003937
1955 1955 c, t dbSNP:371274182
1956 1956 a, g dbSNP:151300637
1959 1959 c, t dbSNP:572576793
1964 1964 c, g, t dbSNP:142381078
1967 1967 a, g dbSNP:765177523
1984 1984 c, t dbSNP:754871932
1985 1985 g, t dbSNP:753328079
1988 1988 c, t dbSNP:765790012
1993 1993 c, t dbSNP:760242914
1994 1994 a, g, t dbSNP:368268294
2003 2003 a, c, t dbSNP:776366797
2004 2004 a, g dbSNP:142663256
2024 2024 a, g dbSNP:147744504
2033 2033 c, t dbSNP:560087481
2035 2035 c, t dbSNP:540618743
2036 2036 a, g dbSNP:138375235
2040 2040 c, t dbSNP:763208199
2042 2042 g, t dbSNP:139854730
2047 2047 a, g dbSNP:765803187
2051 2051 c, t dbSNP:759105715
2052 2052 a, g dbSNP:371248659
2060 2060 c, t dbSNP:766559928
2061 2061 a, g dbSNP:561178267
2062 2062 c, t dbSNP:773282207
2066 2066 c, t dbSNP:144659227
2082 2082 a, g dbSNP:748996624
2090 2090 c, g dbSNP:775269145
2096 2096 a, c dbSNP:575402947
2099 2099 a, c dbSNP:745793654
2102 2102 a, g dbSNP:373932020
2111 2111 c, t dbSNP:756692633
2112 2112 a, g dbSNP:746581733
2114 2114 a, g, t dbSNP:79155735
2116 2116 a, g dbSNP:758104833
2118 2118 a, g dbSNP:376165135
2122 2122 c, t dbSNP:753048964
2123 2123 a, g dbSNP:765680338
2144 2144 c, t dbSNP:755457871
2154 2154 a, c dbSNP:558626681
2156 2156 c, t dbSNP:766957726
2157 2157 c, g dbSNP:369397900
2158 2158 c, t dbSNP:773372364
2166 2166 c, t dbSNP:149804621
2167 2167 a, g dbSNP:762109021
2175 2175 c, t dbSNP:139728897
2189 2189 c, t dbSNP:553327334
2192 2192 c, t dbSNP:758463503
2193 2193 a, c, g dbSNP:779126022
2201 2201 c, t dbSNP:755187591
2202 2202 a, g dbSNP:2271275
2204 2204 a, c, g, t dbSNP:189789673
2205 2205 a, g dbSNP:184837669
2209 2209 a, c, t dbSNP:762464849
2210 2210 a, c, g dbSNP:371127491
2211 2211 c, t dbSNP:141253548
2212 2212 a, g dbSNP:377469652
2218 2218 c, g, t dbSNP:138785387
2219 2219 a, g dbSNP:201079175
2227 2227 c, t dbSNP:373191144
2228 2228 a, g, t dbSNP:370602765
2233 2233 a, c, t dbSNP:201553265
2238 2238 a, g dbSNP:780489867
2241 2241 a, g dbSNP:201828709
2253 2253 a, g dbSNP:570530473
2257 2257 c, g dbSNP:777784484
2258 2258 c, g, t dbSNP:547394035
2261 2261 c, t dbSNP:764627297
2262 2262 a, g dbSNP:146024921
2263 2263 c, t dbSNP:753480287
2264 2264 a, c, g dbSNP:200195986
2266 2266 a, g dbSNP:773601670
2282 2282 c, t dbSNP:372778779
2294 2294 a, g dbSNP:762204316
2295 2295 c, g, t dbSNP:201838719
2296 2296 a, g dbSNP:141298814
2300 2300 a, g dbSNP:768614342
2319 2319 a, c dbSNP:749435838
2320 2320 a, g dbSNP:780364775
2321 2321 a, g dbSNP:770142632
2328 2328 a, c dbSNP:746757303
2329 2329 a, g dbSNP:777448423
2333 2333 c, t dbSNP:574833779
2334 2334 a, g dbSNP:758258253
2339 2339 a, g dbSNP:752542590
2346 2346 c, t dbSNP:137892593
2347 2347 a, g dbSNP:143420247
2353 2353 c, t dbSNP:753353463
2354 2354 a, g dbSNP:369865323
2355 2355 a, c, t dbSNP:369823256
2356 2356 a, g dbSNP:202198509
2359 2359 a, t dbSNP:762305456
2360 2360 a, g dbSNP:148852353
2372 2372 a, g dbSNP:764467589
2379 2379 c, t dbSNP:763573681
2380 2380 a, g dbSNP:138438667
2382 2382 a, g dbSNP:765372434
2385 2385 c, g dbSNP:759753736
2388 2388 a, g dbSNP:781768263
2389 2389 a, g dbSNP:369818587
2390 2390 c, t dbSNP:776663345
2397 2397 a, g dbSNP:150271214
2401 2401 c, t dbSNP:367615505
2402 2402 a, g, t dbSNP:552533216
2403 2403 c, t dbSNP:749195347
2410 2410 c, t dbSNP:142515034
2415 2415 c, t dbSNP:755609405
2416 2416 a, g dbSNP:755496869
2420 2420 g, t dbSNP:745396541
2423 2423 c, t dbSNP:780641621
2429 2429 a, g dbSNP:532321111
2434 2434 c, t dbSNP:751820473
2435 2435 a, g dbSNP:764528211
2439 2439 a, c dbSNP:758871856
2453 2453 a, g dbSNP:753247366
2468 2468 c, t dbSNP:560367404
2480 2480 g, t dbSNP:12572589
2483 2483 a, g dbSNP:200586132
2486 2486 c, t dbSNP:765898849
2489 2489 c, t dbSNP:201879769
2494 2494 a, g dbSNP:776807532
2497 2497 c, g dbSNP:766466120
2503 2503 c, t dbSNP:760933000
2514 2514 a, c dbSNP:773347607
2515 2515 c, t dbSNP:376184563
2516 2516 a, c, g dbSNP:199683238
2518 2518 a, g dbSNP:769727859
2534 2534 a, g dbSNP:745328565
2536 2536 c, t dbSNP:780774922
2541 2541 c, t dbSNP:371586209
2544 2544 -, t dbSNP:754434726
2551 2551 c, t dbSNP:746639102
2552 2552 a, g dbSNP:777631162
2557 2557 c, t dbSNP:758818786
2564 2564 a, g dbSNP:113366929
2570 2570 a, g dbSNP:780324876
2573 2573 a, g dbSNP:779526038
2577 2577 a, g, t dbSNP:754354574
2581 2581 c, t dbSNP:375643211
2582 2582 a, g dbSNP:17156072
2588 2588 a, g dbSNP:750631279
2598 2598 c, t dbSNP:377067946
2625 2625 a, g dbSNP:141081834
2643 2643 a, g dbSNP:151093478
2660 2660 c, t dbSNP:573459488
2669 2669 a, g dbSNP:544631735
2670 2670 c, t dbSNP:904960
2690 2690 a, g dbSNP:188140176
2701 2701 c, t dbSNP:532573672
2706 2706 g, t dbSNP:537527913
2708 2708 a, g dbSNP:571735114
2713 2713 a, g dbSNP:764048940
2723 2723 c, g dbSNP:760645596
2730 2730 a, g dbSNP:775474216
2757 2757 a, c dbSNP:551822712
2769 2769 c, t dbSNP:904959
2770 2770 a, g dbSNP:375444205
2774 2774 c, t dbSNP:11250317
2776 2776 c, t dbSNP:773881090
2783 2783 a, c dbSNP:529876180
2789 2789 a, g dbSNP:573109361
2797 2797 -, c dbSNP:747736416
2798 2798 c, t dbSNP:560730657
2831 2831 a, g dbSNP:553582431
2835 2835 c, g dbSNP:774475440
2848 2848 a, g dbSNP:182528471
2870 2870 c, t dbSNP:370242438
2883 2883 c, g dbSNP:144381217
2922 2922 a, g dbSNP:140636737
2925 2925 c, t dbSNP:768733734
2951 2951 c, g dbSNP:572788743
2974 2974 a, g dbSNP:553439141
3027 3027 a, g dbSNP:552363159
3044 3044 c, t dbSNP:748829838
3056 3056 a, g dbSNP:3750679
3078 3078 c, t dbSNP:560510842
3091 3091 a, g dbSNP:574187536
3103 3103 a, g dbSNP:540868044
3104 3104 c, t dbSNP:76022202
3113 3113 c, g dbSNP:747521086
3132 3132 c, t dbSNP:537614860
3165 3165 a, g dbSNP:780600947
3167 3167 a, c dbSNP:569965986
3171 3171 c, t dbSNP:551894806
3202 3202 c, t dbSNP:146813738
3211 3211 c, t dbSNP:566043656
3228 3228 -, tggcccacgcgtgctgcagatgtggggagcctggaaacacc dbSNP:140271421
3230 3230 c, t dbSNP:3833727
3237 3237 c, t dbSNP:530015226
3246 3246 c, t dbSNP:112876044
3247 3247 a, c dbSNP:567193394
3267 3267 a, c dbSNP:111999232
3271 3271 c, t dbSNP:111737617
3281 3281 a, g dbSNP:544518391
3287 3287 c, t dbSNP:111596066
3308 3308 a, c dbSNP:112530953
3312 3312 c, t dbSNP:111712951
3320 3320 -, gcgtgctgc dbSNP:751889786
3322 3322 a, g dbSNP:576914845
3327 3327 a, g dbSNP:2016287
3328 3328 c, t dbSNP:3750681
3341 3341 c, t dbSNP:7091963
3349 3349 a, c dbSNP:1129226
3353 3353 c, t dbSNP:1129227
3360 3360 c, t dbSNP:564680608
3361 3361 a, g dbSNP:545086319
3369 3369 c, t dbSNP:11250316
3383 3383 c, t dbSNP:904957
3384 3384 c, t dbSNP:11250315
3390 3390 a, c dbSNP:11250314
3393 3393 -, ggcccacgcgtgctgtagatgtggggagcctggaaaaacct dbSNP:146702386
3399 3399 c, t dbSNP:559288822
3401 3401 c, t dbSNP:10903400
3408 3408 g, t dbSNP:755883255
3415 3415 a, g dbSNP:187337462
3440 3440 c, t dbSNP:574408006
3473 3473 a, g dbSNP:1046914
3504 3504 a, c dbSNP:754028335
3519 3519 a, g dbSNP:764206870
3550 3550 a, g dbSNP:544040437
3621 3621 c, t dbSNP:550123591
3679 3679 a, c dbSNP:183046821
3689 3689 g, t dbSNP:141177206
3725 3725 c, g dbSNP:148198624
3768 3768 c, t dbSNP:11250313
3771 3771 c, g dbSNP:560586028
3792 3792 a, c dbSNP:72760988
3811 3811 a, g dbSNP:10903399
3825 3825 a, g dbSNP:567230611
3828 3828 c, t dbSNP:550452470
3937 3937 c, t dbSNP:192193992
3946 3946 c, t dbSNP:762739450
3982 3982 a, g dbSNP:544479632
3986 3986 a, g dbSNP:375693049
3994 3994 c, t dbSNP:10903398
3995 3995 a, g dbSNP:551224915
4042 4042 g, t dbSNP:747624347
4055 4055 c, t dbSNP:775871439
4058 4058 c, t dbSNP:528205045
4082 4082 c, t dbSNP:10794729
4093 4093 c, t dbSNP:143008521
4113 4113 c, t dbSNP:528855306
4138 4138 a, c dbSNP:77791002
4192 4192 c, t dbSNP:564017107
4242 4242 c, t dbSNP:149648896
4250 4250 a, c dbSNP:578233404
4256 4256 a, g dbSNP:779288903
4259 4259 a, t dbSNP:370547869
4267 4267 a, g dbSNP:138479563
4274 4274 a, g dbSNP:541236083
4282 4282 c, t dbSNP:572502086
4313 4313 c, t dbSNP:555535712
4380 4380 c, t dbSNP:7894015
4381 4381 g, t dbSNP:2280014
4430 4430 c, t dbSNP:752766048
4436 4436 c, t dbSNP:112379877
4461 4461 a, g dbSNP:556868086
4465 4465 a, g dbSNP:536934737
4469 4469 -, a dbSNP:11431343
4484 4484 c, t dbSNP:187357920
4494 4494 a, t dbSNP:7914228
4495 4495 a, g dbSNP:34795993
4498 4498 -, a dbSNP:549977692
4498 4498 a, g dbSNP:7914227
4502 4502 a, g dbSNP:77593162
4521 4521 a, g dbSNP:775555201
4618 4618 -, aaatgaa dbSNP:553160970
4649 4649 c, t dbSNP:112040634
4664 4664 a, g dbSNP:769544524
4671 4671 c, t dbSNP:548796211
4688 4688 c, t dbSNP:4880485
4689 4689 c, t dbSNP:563256946
4695 4695 a, g dbSNP:549762081
4696 4696 -, c dbSNP:34755746
4708 4708 c, t dbSNP:530332867
4732 4732 a, g dbSNP:564575037
4735 4735 a, g dbSNP:4880484
4743 4743 a, g dbSNP:572536285
4752 4752 c, g dbSNP:562258682
4774 4774 a, g dbSNP:541901923
4779 4779 a, g, t dbSNP:182679520
4784 4784 c, t dbSNP:556156713
4792 4792 c, t dbSNP:539419856
4793 4793 a, g dbSNP:577873322
4822 4822 -, a dbSNP:753321335
4853 4853 c, t dbSNP:190866858
4885 4885 a, g dbSNP:534859730
4896 4896 a, g dbSNP:17293692
4950 4950 g, t dbSNP:549131998
4974 4974 a, g dbSNP:4880784
4976 4976 g, t dbSNP:758457171
4993 4993 a, c dbSNP:117085612
5023 5023 a, g dbSNP:145840469
5064 5064 -, gcagagg dbSNP:56179836
5072 5072 -, cagaggg dbSNP:144363283
5073 5073 c, g dbSNP:78759449
5096 5096 c, t dbSNP:532914008
5102 5102 -, c dbSNP:36094845
5115 5115 a, g dbSNP:17156053
5142 5142 a, g dbSNP:547768001
5151 5151 c, t dbSNP:7082665
5155 5155 c, t dbSNP:375143293
5156 5156 a, g dbSNP:76820357
5167 5167 a, g dbSNP:79269884
5181 5181 c, t dbSNP:140671095
5182 5182 a, g dbSNP:545803127
5189 5189 a, g dbSNP:577160265
5207 5207 g, t dbSNP:754250064
5243 5243 a, g dbSNP:7098887
5267 5267 a, c, t dbSNP:181313797
5268 5268 a, g dbSNP:572269383
5305 5305 a, g dbSNP:7098774
5315 5315 a, g dbSNP:567502318
5324 5324 c, t dbSNP:1983025
5355 5355 c, g dbSNP:531110604
5364 5364 a, g dbSNP:1983026
5370 5370 a, g dbSNP:565528888
5378 5378 c, g dbSNP:561526296
5391 5391 a, g dbSNP:111824093
5392 5392 -, tg dbSNP:559531139
5405 5405 c, t dbSNP:556281810
5406 5406 a, g dbSNP:545389629
5439 5439 c, t dbSNP:539463908
5484 5484 c, g dbSNP:570332612
5492 5492 a, g dbSNP:548105681
5552 5552 c, t dbSNP:527995105
5575 5575 a, g dbSNP:532100641
5604 5604 a, c dbSNP:559915579
5606 5606 c, g dbSNP:7097304
5627 5627 c, t dbSNP:761533243
5628 5628 a, g dbSNP:531751120
5645 5645 a, g dbSNP:780138234
5656 5656 a, g dbSNP:562684482
5673 5673 c, t dbSNP:7081909
5679 5679 c, t dbSNP:750191081
5705 5705 c, t dbSNP:17156051
5743 5743 -, g dbSNP:201644925
5744 5744 c, t dbSNP:188846984
5746 5746 a, g dbSNP:540592421
5762 5762 c, t dbSNP:572250648
5791 5791 a, g dbSNP:761563663
5799 5799 a, c dbSNP:555659422
5815 5815 c, t dbSNP:142773112
5822 5822 a, c dbSNP:186088520
5833 5833 c, t dbSNP:181695444
5834 5834 c, t dbSNP:753409293
5852 5852 c, t dbSNP:148702791
5860 5860 a, g dbSNP:539145052
5861 5861 g, t dbSNP:570494968
5884 5884 a, c dbSNP:553510570
5911 5911 a, g dbSNP:763717260
5922 5922 c, t dbSNP:1983027
5927 5927 c, t dbSNP:374467841
5928 5928 c, t dbSNP:774841822
5934 5934 c, t dbSNP:568426262
5945 5945 c, t dbSNP:190488894
5952 5952 c, t dbSNP:185633219
5988 5988 a, c dbSNP:147638824
6011 6011 c, t dbSNP:192514006
6013 6013 a, t dbSNP:552701851
6014 6014 a, c dbSNP:189199431
6033 6033 c, t dbSNP:560583968
6039 6039 a, c dbSNP:540273820
6057 6057 c, t dbSNP:771371390
6093 6093 c, t dbSNP:530096923
6111 6111 c, t dbSNP:763332279
6126 6126 c, t dbSNP:773526266
6156 6156 c, g dbSNP:770024395
6197 6197 c, t dbSNP:562009026
6204 6204 a, g dbSNP:7094153
6206 6206 a, g dbSNP:576340568
6220 6220 c, g, t dbSNP:145274840
6239 6239 c, t dbSNP:576869189
6252 6252 a, g dbSNP:552466004
6258 6258 a, g dbSNP:76851642
6280 6280 a, g dbSNP:17156046
6286 6286 c, g dbSNP:76048130
6323 6323 c, t dbSNP:183761406
6332 6332 c, t dbSNP:139665517
6373 6373 a, g dbSNP:767459817
6392 6392 a, g dbSNP:147396650
6406 6406 g, t dbSNP:191666208
6466 6466 c, t dbSNP:187106432
6495 6495 c, t dbSNP:539180009
6513 6513 c, t dbSNP:566893065
6514 6514 a, g, t dbSNP:17156043
6519 6519 -, t, tt dbSNP:369469327
6529 6529 -, t, tt dbSNP:57572696
6530 6530 -, t dbSNP:768221912
6530 6530 g, t dbSNP:199703770
6548 6548 a, g dbSNP:561250478
6562 6562 a, g dbSNP:28406307
6594 6594 aa, gt dbSNP:386739808
6599 6599 -, tagag dbSNP:60847260
6599 6599 ag, t dbSNP:367778130
6599 6599 g, t dbSNP:201172607
6600 6600 -, gagta dbSNP:33916833
6601 6601 -, ga, gagta dbSNP:10667837
6603 6603 -, tagag dbSNP:144915037
6670 6670 c, t dbSNP:531661319
6676 6676 c, t dbSNP:770572467
6686 6686 a, g dbSNP:562755274
6689 6689 c, t dbSNP:753590822
6761 6761 -, t dbSNP:111229495
6768 6768 c, t dbSNP:567465251
6823 6823 a, g dbSNP:755633993
6841 6841 c, t dbSNP:545688418
6853 6853 c, t dbSNP:576961455
6854 6854 a, g dbSNP:373771216
6858 6858 c, t dbSNP:544126817
6861 6861 c, t dbSNP:182836494
6867 6867 c, t dbSNP:766903552
6880 6880 a, g dbSNP:574131441
6888 6888 c, t dbSNP:149275018
6889 6889 a, g dbSNP:763493192
6891 6891 c, t dbSNP:550667225
6898 6898 c, t dbSNP:537399793
6910 6910 c, t dbSNP:773689934
6913 6913 a, g dbSNP:575539760
6914 6914 a, g dbSNP:55750636
6921 6921 a, g dbSNP:60715981
6925 6925 a, g dbSNP:57606623
6958 6958 c, t dbSNP:546812331
6982 6982 c, g dbSNP:772174905
6990 6990 a, g dbSNP:536757147
7012 7012 a, g dbSNP:567736137
7041 7041 a, g dbSNP:550998775
7050 7050 c, g dbSNP:79143765
7080 7080 a, g dbSNP:7901513
7085 7085 a, g dbSNP:552445214
7098 7098 c, g dbSNP:6560717
7105 7105 c, t dbSNP:560281636
7106 7106 a, g dbSNP:540008912
7154 7154 c, t dbSNP:574194993
7156 7156 g, t dbSNP:747112799
7167 7167 a, g dbSNP:560605871
7171 7171 c, t dbSNP:114252136
7186 7186 c, t dbSNP:372469903
7202 7202 c, t dbSNP:772253806
7220 7220 a, g dbSNP:1500966
7247 7247 a, g dbSNP:559014262
7250 7250 a, g dbSNP:17156036
7265 7265 c, t dbSNP:372138852
7282 7282 c, t dbSNP:369792357
7283 7283 a, g dbSNP:757080078
7320 7320 c, t dbSNP:573422651
7343 7343 a, g dbSNP:6560716
7355 7355 a, g dbSNP:192936934
7359 7359 c, g dbSNP:777505724
7399 7399 a, c dbSNP:567771408
7408 7408 a, c, g dbSNP:752316968
7425 7425 a, g dbSNP:767065019
7428 7428 ca, tcccttcttgcccctttctctcctccc dbSNP:386739807
7435 7435 c, t dbSNP:756534680
7449 7449 a, g dbSNP:115469149
7450 7450 c, t dbSNP:537493160
7461 7461 a, g dbSNP:61374726
7462 7462 a, c dbSNP:60078522
7478 7478 -, tcg dbSNP:200190573
7545 7545 a, g dbSNP:571598223
7548 7548 a, g dbSNP:529717155
7557 7557 a, g dbSNP:188944007
7580 7580 a, c dbSNP:199836862
7582 7582 -, c, t, tc dbSNP:34381966
7583 7583 c, t dbSNP:77767853
7588 7588 -, cg, g dbSNP:36093407
7588 7588 c, g dbSNP:201324201
7589 7589 -, a dbSNP:748536127
7590 7590 c, t dbSNP:532454262
7598 7598 c, g dbSNP:762604787
7602 7602 a, c dbSNP:752277438
7603 7603 c, t dbSNP:566600558
7626 7626 a, g dbSNP:754474216
7635 7635 a, g dbSNP:751008865
7660 7660 -, g dbSNP:34033894
7691 7691 c, t dbSNP:546396561
7693 7693 c, g dbSNP:183891805
7713 7713 a, g dbSNP:560693711
7721 7721 c, t dbSNP:762255962
7746 7746 c, t dbSNP:190884476
7751 7751 c, g dbSNP:543882229
7759 7759 c, t dbSNP:141625067
7762 7762 a, g dbSNP:137862805
7800 7800 g, t dbSNP:776816770
7818 7818 a, g dbSNP:764483743
7827 7827 c, t dbSNP:544649685
7878 7878 c, t dbSNP:10903397
7880 7880 a, g dbSNP:775838983
7881 7881 a, g dbSNP:772343778
7889 7889 a, g dbSNP:199681628
7910 7910 a, g dbSNP:764615138
7918 7918 a, g dbSNP:185287284
7937 7937 a, c dbSNP:4880783
7967 7967 c, t dbSNP:543986571
7968 7968 a, g dbSNP:142218058
7973 7973 c, t dbSNP:770723966
7980 7980 a, c dbSNP:182486608
8039 8039 a, g dbSNP:749139938
8100 8100 c, g dbSNP:537528255
8113 8113 -, at dbSNP:766260805
8135 8135 a, g dbSNP:571617445
8138 8138 -, aa dbSNP:58161691
8149 8149 -, aa dbSNP:10605813
8149 8149 a, t dbSNP:377359871
8150 8150 a, c dbSNP:374117592
8218 8218 a, c dbSNP:56802016
8239 8239 a, c dbSNP:534667921
8250 8250 a, t dbSNP:17156029
8273 8273 g, t dbSNP:190168090
8303 8303 -, a dbSNP:202240328
8310 8310 a, g dbSNP:529866996
8329 8329 -, at dbSNP:397811235
8330 8330 -, at dbSNP:66801726
8331 8331 -, at dbSNP:4002635
8356 8356 a, c dbSNP:567108232
8372 8372 c, t dbSNP:185754538
8374 8374 c, t dbSNP:181674188
8401 8401 a, g dbSNP:60741147
8424 8424 c, g dbSNP:552943336

Target ORF information:

RefSeq Version NM_018702
Organism Homo sapiens (human)
Definition Homo sapiens adenosine deaminase, RNA-specific, B2 (non-functional) (ADARB2), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.