Email to GenScript

CFTR cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) [Homo sapiens (human)]

Gene Symbol CFTR
Entrez Gene ID 1080
Full Name cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)
Synonyms ABC35, ABCC7, CF, CFTR/MRP, MRP7, TNR-CFTR, dJ760C5.1
General protein information
Preferred Names
cystic fibrosis transmembrane conductance regulator
Names
cystic fibrosis transmembrane conductance regulator
cAMP-dependent chloride channel
channel conductance-controlling ATPase
NP_000483.3
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

7

7q31.2

Summary This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily that is involved in multi-drug resistance. The encoded protein functions as a chloride channel and controls the regulation of other transport pathways. Mutations in this gene are associated with the autosomal recessive disorders cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternatively spliced transcript variants have been described, many of which result from mutations in this gene. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:

602421

Disorder Html: Cystic fibrosis, 219700 (3); Congenital bilateral absence of vas





The following CFTR gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the CFTR gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu56826 XM_011515751 PREDICTED: Homo sapiens cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) (CFTR), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu56827 XM_011515752 PREDICTED: Homo sapiens cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) (CFTR), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 25 Quote Price
OHu56828 XM_011515753 PREDICTED: Homo sapiens cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) (CFTR), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 16 Quote Price
OHu56828 XM_011515754 PREDICTED: Homo sapiens cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) (CFTR), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 16 Quote Price
OHu27239 NM_000492 Homo sapiens cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) (CFTR), mRNA. pcDNA3.1+/C-(K)DYK or customized vector 16 Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.


CloneID OHu56826
Accession Version XM_011515751.1
Sequence Information ORF Nucleotide Sequence (Length: 4533bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product cystic fibrosis transmembrane conductance regulator isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_007933.16) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
3241
3301
3361
3421
3481
3541
3601
3661
3721
3781
3841
3901
3961
4021
4081
4141
4201
4261
4321
4381
4441
4501
ATGAAAACAC AGGTAGAGGA TTTCAAACAA CAGAGTGGAT GTACGTGTCC TAAGATTTCT 
GTGCCACCCT TGGAGTTCAC TCACCTAAAC CTGAAACTAA TAAAGCTTGG TTCTTTTCTC
CGACACGCAA AGGAAGCGCT AAGCTGGACC AGACCAATTT TGAGGAAAGG ATACAGACAG
CGCCTGGAAT TGTCAGACAT ATACCAAATC CCTTCTGTTG ATTCTGCTGA CAATCTATCT
GAAAAATTGG AAAGAGAATG GGATAGAGAG CTGGCTTCAA AGAAAAATCC TAAACTCATT
AATGCCCTTC GGCGATGTTT TTTCTGGAGA TTTATGTTCT ATGGAATCTT TTTATATTTA
GGGGAAGTCA CCAAAGCAGT ACAGCCTCTC TTACTGGGAA GAATCATAGC TTCCTATGAC
CCGGATAACA AGGAGGAACG CTCTATCGCG ATTTATCTAG GCATAGGCTT ATGCCTTCTC
TTTATTGTGA GGACACTGCT CCTACACCCA GCCATTTTTG GCCTTCATCA CATTGGAATG
CAGATGAGAA TAGCTATGTT TAGTTTGATT TATAAGAAGA CTTTAAAGCT GTCAAGCCGT
GTTCTAGATA AAATAAGTAT TGGACAACTT GTTAGTCTCC TTTCCAACAA CCTGAACAAA
TTTGATGAAG GACTTGCATT GGCACATTTC GTGTGGATCG CTCCTTTGCA AGTGGCACTC
CTCATGGGGC TAATCTGGGA GTTGTTACAG GCGTCTGCCT TCTGTGGACT TGGTTTCCTG
ATAGTCCTTG CCCTTTTTCA GGCTGGGCTA GGGAGAATGA TGATGAAGTA CAGAGATCAG
AGAGCTGGGA AGATCAGTGA AAGACTTGTG ATTACCTCAG AAATGATTGA AAATATCCAA
TCTGTTAAGG CATACTGCTG GGAAGAAGCA ATGGAAAAAA TGATTGAAAA CTTAAGACAA
ACAGAACTGA AACTGACTCG GAAGGCAGCC TATGTGAGAT ACTTCAATAG CTCAGCCTTC
TTCTTCTCAG GGTTCTTTGT GGTGTTTTTA TCTGTGCTTC CCTATGCACT AATCAAAGGA
ATCATCCTCC GGAAAATATT CACCACCATC TCATTCTGCA TTGTTCTGCG CATGGCGGTC
ACTCGGCAAT TTCCCTGGGC TGTACAAACA TGGTATGACT CTCTTGGAGC AATAAACAAA
ATACAGGATT TCTTACAAAA GCAAGAATAT AAGACATTGG AATATAACTT AACGACTACA
GAAGTAGTGA TGGAGAATGT AACAGCCTTC TGGGAGGAGG GATTTGGGGA ATTATTTGAG
AAAGCAAAAC AAAACAATAA CAATAGAAAA ACTTCTAATG GTGATGACAG CCTCTTCTTC
AGTAATTTCT CACTTCTTGG TACTCCTGTC CTGAAAGATA TTAATTTCAA GATAGAAAGA
GGACAGTTGT TGGCGGTTGC TGGATCCACT GGAGCAGGCA AGACTTCACT TCTAATGGTG
ATTATGGGAG AACTGGAGCC TTCAGAGGGT AAAATTAAGC ACAGTGGAAG AATTTCATTC
TGTTCTCAGT TTTCCTGGAT TATGCCTGGC ACCATTAAAG AAAATATCAT CTTTGGTGTT
TCCTATGATG AATATAGATA CAGAAGCGTC ATCAAAGCAT GCCAACTAGA AGAGGACATC
TCCAAGTTTG CAGAGAAAGA CAATATAGTT CTTGGAGAAG GTGGAATCAC ACTGAGTGGA
GGTCAACGAG CAAGAATTTC TTTAGCAAGA GCAGTATACA AAGATGCTGA TTTGTATTTA
TTAGACTCTC CTTTTGGATA CCTAGATGTT TTAACAGAAA AAGAAATATT TGAAAGCTGT
GTCTGTAAAC TGATGGCTAA CAAAACTAGG ATTTTGGTCA CTTCTAAAAT GGAACATTTA
AAGAAAGCTG ACAAAATATT AATTTTGCAT GAAGGTAGCA GCTATTTTTA TGGGACATTT
TCAGAACTCC AAAATCTACA GCCAGACTTT AGCTCAAAAC TCATGGGATG TGATTCTTTC
GACCAATTTA GTGCAGAAAG AAGAAATTCA ATCCTAACTG AGACCTTACA CCGTTTCTCA
TTAGAAGGAG ATGCTCCTGT CTCCTGGACA GAAACAAAAA AACAATCTTT TAAACAGACT
GGAGAGTTTG GGGAAAAAAG GAAGAATTCT ATTCTCAATC CAATCAACTC TATACGAAAA
TTTTCCATTG TGCAAAAGAC TCCCTTACAA ATGAATGGCA TCGAAGAGGA TTCTGATGAG
CCTTTAGAGA GAAGGCTGTC CTTAGTACCA GATTCTGAGC AGGGAGAGGC GATACTGCCT
CGCATCAGCG TGATCAGCAC TGGCCCCACG CTTCAGGCAC GAAGGAGGCA GTCTGTCCTG
AACCTGATGA CACACTCAGT TAACCAAGGT CAGAACATTC ACCGAAAGAC AACAGCATCC
ACACGAAAAG TGTCACTGGC CCCTCAGGCA AACTTGACTG AACTGGATAT ATATTCAAGA
AGGTTATCTC AAGAAACTGG CTTGGAAATA AGTGAAGAAA TTAACGAAGA AGACTTAAAG
GAGTGCTTTT TTGATGATAT GGAGAGCATA CCAGCAGTGA CTACATGGAA CACATACCTT
CGATATATTA CTGTCCACAA GAGCTTAATT TTTGTGCTAA TTTGGTGCTT AGTAATTTTT
CTGGCAGAGG TGGCTGCTTC TTTGGTTGTG CTGTGGCTCC TTGGAAACAC TCCTCTTCAA
GACAAAGGGA ATAGTACTCA TAGTAGAAAT AACAGCTATG CAGTGATTAT CACCAGCACC
AGTTCGTATT ATGTGTTTTA CATTTACGTG GGAGTAGCCG ACACTTTGCT TGCTATGGGA
TTCTTCAGAG GTCTACCACT GGTGCATACT CTAATCACAG TGTCGAAAAT TTTACACCAC
AAAATGTTAC ATTCTGTTCT TCAAGCACCT ATGTCAACCC TCAACACGTT GAAAGCAGGT
GGGATTCTTA ATAGATTCTC CAAAGATATA GCAATTTTGG ATGACCTTCT GCCTCTTACC
ATATTTGACT TCATCCAGTT GTTATTAATT GTGATTGGAG CTATAGCAGT TGTCGCAGTT
TTACAACCCT ACATCTTTGT TGCAACAGTG CCAGTGATAG TGGCTTTTAT TATGTTGAGA
GCATATTTCC TCCAAACCTC ACAGCAACTC AAACAACTGG AATCTGAAGG CAGGAGTCCA
ATTTTCACTC ATCTTGTTAC AAGCTTAAAA GGACTATGGA CACTTCGTGC CTTCGGACGG
CAGCCTTACT TTGAAACTCT GTTCCACAAA GCTCTGAATT TACATACTGC CAACTGGTTC
TTGTACCTGT CAACACTGCG CTGGTTCCAA ATGAGAATAG AAATGATTTT TGTCATCTTC
TTCATTGCTG TTACCTTCAT TTCCATTTTA ACAACAGGAG AAGGAGAAGG AAGAGTTGGT
ATTATCCTGA CTTTAGCCAT GAATATCATG AGTACATTGC AGTGGGCTGT AAACTCCAGC
ATAGATGTGG ATAGCTTGAT GCGATCTGTG AGCCGAGTCT TTAAGTTCAT TGACATGCCA
ACAGAAGGTA AACCTACCAA GTCAACCAAA CCATACAAGA ATGGCCAACT CTCGAAAGTT
ATGATTATTG AGAATTCACA CGTGAAGAAA GATGACATCT GGCCCTCAGG GGGCCAAATG
ACTGTCAAAG ATCTCACAGC AAAATACACA GAAGGTGGAA ATGCCATATT AGAGAACATT
TCCTTCTCAA TAAGTCCTGG CCAGAGGGTG GGCCTCTTGG GAAGAACTGG ATCAGGGAAG
AGTACTTTGT TATCAGCTTT TTTGAGACTA CTGAACACTG AAGGAGAAAT CCAGATCGAT
GGTGTGTCTT GGGATTCAAT AACTTTGCAA CAGTGGAGGA AAGCCTTTGG AGTGATACCA
CAGAAAGTAT TTATTTTTTC TGGAACATTT AGAAAAAACT TGGATCCCTA TGAACAGTGG
AGTGATCAAG AAATATGGAA AGTTGCAGAT GAGGTTGGGC TCAGATCTGT GATAGAACAG
TTTCCTGGGA AGCTTGACTT TGTCCTTGTG GATGGGGGCT GTGTCCTAAG CCATGGCCAC
AAGCAGTTGA TGTGCTTGGC TAGATCTGTT CTCAGTAAGG CGAAGATCTT GCTGCTTGAT
GAACCCAGTG CTCATTTGGA TCCAGTAACA TACCAAATAA TTAGAAGAAC TCTAAAACAA
GCATTTGCTG ATTGCACAGT AATTCTCTGT GAACACAGGA TAGAAGCAAT GCTGGAATGC
CAACAATTTT TGGTCATAGA AGAGAACAAA GTGCGGCAGT ACGATTCCAT CCAGAAACTG
CTGAACGAGA GGAGCCTCTT CCGGCAAGCC ATCAGCCCCT CCGACAGGGT GAAGCTCTTT
CCCCACCGGA ACTCAAGCAA GTGCAAGTCT AAGCCCCAGA TTGCTGCTCT GAAAGAGGAG
ACAGAAGAAG AGGTGCAAGA TACAAGGCTT TAG
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_011514053.1
CDS29..4561
Misc Feature(1)155..4558(+)
Misc Feature(2)365..1168(+)
Misc Feature(3)1283..2128(+)
Misc Feature(4)1490..1513(+)
Misc Feature(5)1499..1933(+)
Misc Feature(6)1586..1597(+)
Misc Feature(7)1760..1789(+)
Misc Feature(8)1820..1837(+)
Misc Feature(9)1844..1855(+)
Misc Feature(10)1919..1939(+)
Misc Feature(11)2033..2668(+)
Misc Feature(12)2702..3559(+)
Misc Feature(13)3740..4558(+)
Misc Feature(14)3848..3871(+)
Misc Feature(15)3857..4324(+)
Misc Feature(16)3980..3991(+)
Misc Feature(17)4154..4183(+)
Misc Feature(18)4214..4231(+)
Misc Feature(19)4238..4249(+)
Misc Feature(20)4310..4330(+)
Translation
Position Chain Variation Link
109 109 g, t dbSNP:181008242
126 126 g, t dbSNP:756856572
145 145 c, t dbSNP:370895876
175 175 g, t dbSNP:397508762
178 178 c, t dbSNP:534609552
180 180 g, t dbSNP:777520137
184 184 a, g dbSNP:748899228
190 190 a, c, g dbSNP:55773134
194 194 a, g dbSNP:759726535
197 197 a, c, g, t dbSNP:397508796
198 198 a, g dbSNP:397508797
198 198 -, g dbSNP:397508798
204 204 c, g dbSNP:748005919
206 206 c, t dbSNP:397508815
209 209 a, c, t dbSNP:1800073
210 210 a, g, t dbSNP:149353983
211 211 a, c dbSNP:766315026
212 212 a, c dbSNP:776797377
213 213 c, t dbSNP:397508821
218 218 -, ttgtcagacatataccaa dbSNP:397508141
223 223 -, a dbSNP:397508149
227 227 a, g dbSNP:759721412
229 229 -, at dbSNP:397508162
230 230 -, ta dbSNP:397508164
230 230 a, c, t dbSNP:373112861
231 231 a, g dbSNP:758826243
232 232 c, g dbSNP:193922498
233 233 c, t dbSNP:397508168
235 235 a, c dbSNP:764522674
238 238 c, t dbSNP:376538363
243 243 c, t dbSNP:143456784
245 245 a, c, g dbSNP:370586917
246 246 c, t dbSNP:754657555
249 249 a, g, t dbSNP:1800074
255 255 a, c, t dbSNP:151020603
262 262 g, t dbSNP:771701007
264 264 c, t dbSNP:556662007
265 265 a, c, g dbSNP:140444668
266 266 c, t dbSNP:397508217
267 267 a, c dbSNP:397508220
284 284 a, g dbSNP:397508256
286 286 -, a dbSNP:397508269
287 287 c, g, t dbSNP:397508272
288 288 a, g dbSNP:397508279
289 289 a, g dbSNP:121909025
290 290 a, c, g dbSNP:397508285
291 291 a, g, t dbSNP:397508291
292 292 -, taga dbSNP:397508295
292 292 -, a dbSNP:397508294
296 296 a, g, t dbSNP:77284892
298 298 a, c, g dbSNP:569426839
312 312 a, g dbSNP:769807498
318 318 c, t dbSNP:368505753
320 320 a, g dbSNP:397508332
322 322 a, t dbSNP:397508335
323 323 a, c dbSNP:372421038
331 331 c, t dbSNP:1800075
332 332 a, g dbSNP:774558645
333 333 a, c dbSNP:397508347
335 335 -, c dbSNP:397508348
335 335 c, t dbSNP:762298973
338 338 c, t dbSNP:115545701
339 339 a, g dbSNP:142540482
341 341 c, t dbSNP:121908749
342 342 a, g, t dbSNP:1800076
344 344 c, t dbSNP:757959325
345 345 -, t dbSNP:397508360
346 346 -, t dbSNP:397508362
346 346 g, t dbSNP:777536750
351 351 -, t dbSNP:397508366
351 351 a, t dbSNP:751305135
351 351 -, t dbSNP:397508367
353 353 c, t dbSNP:397508370
354 354 a, g dbSNP:397508371
367 367 c, g dbSNP:780975618
368 368 c, t dbSNP:745756794
369 369 a, g dbSNP:769754499
372 372 a, g, t dbSNP:75961395
374 374 a, g dbSNP:749432776
376 376 a, c dbSNP:374992300
377 377 -, tt dbSNP:754147777
377 377 a, c, t dbSNP:397508403
380 380 -, tt dbSNP:121908769
381 381 -, aa dbSNP:202148006
381 381 a, c, g, t dbSNP:397508412
382 382 a, c dbSNP:149662778
384 384 a, g dbSNP:397508418
387 387 c, t dbSNP:397508421
389 389 a, g dbSNP:121908750
391 391 a, g dbSNP:773739166
392 392 a, g, t dbSNP:121908751
394 394 a, t dbSNP:397508432
397 397 c, t dbSNP:761423802
399 399 c, t dbSNP:767204327
405 405 a, c dbSNP:397508449
410 410 c, t dbSNP:397508461
411 411 a, c, g dbSNP:397508464
414 414 c, t dbSNP:397508467
416 416 c, g dbSNP:375543675
420 420 c, g, t dbSNP:397508484
421 421 -, a dbSNP:397508486
423 423 c, g, t dbSNP:397508490
428 428 -, a dbSNP:397508499
428 428 a, g dbSNP:369715785
430 430 -, a dbSNP:779091180
431 431 -, a dbSNP:121908801
431 431 a, g dbSNP:758675549
432 432 a, t dbSNP:397508509
437 437 -, gcttccta dbSNP:397508516
439 439 g, t dbSNP:778204477
441 441 c, t dbSNP:397508520
443 443 g, tat dbSNP:121908798
443 443 a, t dbSNP:397508522
444 444 -, at dbSNP:397508526
444 444 a, g dbSNP:121909031
445 445 a, t dbSNP:397508528
446 446 c, g, t dbSNP:113993958
446 446 -, g dbSNP:397508530
448 448 a, c dbSNP:397508537
449 449 c, g dbSNP:397508541
450 450 c, t dbSNP:140502196
451 451 a, g dbSNP:776878618
452 452 a, g dbSNP:746344714
453 453 a, g dbSNP:770241677
456 456 a, t dbSNP:397508551
458 458 a, t dbSNP:397508554
461 461 -, gag dbSNP:397508563
462 462 a, t dbSNP:149706251
464 464 a, c, g dbSNP:397508571
465 465 a, c, g dbSNP:761370893
467 467 a, c, g, t dbSNP:77834169
468 468 a, c, g, t dbSNP:78655421
471 471 -, c dbSNP:35871908
473 473 a, g dbSNP:193922518
475 475 -, c dbSNP:397508583
476 476 a, g, t dbSNP:201958172
478 478 a, g dbSNP:1800077
479 479 a, t dbSNP:574654063
482 482 c, t dbSNP:397508592
483 483 a, g dbSNP:377295859
484 484 a, t dbSNP:79660178
488 488 c, g dbSNP:193922519
492 492 c, t dbSNP:141723617
494 494 a, g dbSNP:397508606
495 495 a, g dbSNP:397508609
498 498 g, t dbSNP:397508611
500 500 -, tat dbSNP:193922521
505 505 -, t dbSNP:397508627
506 506 c, g dbSNP:397508632
509 509 c, t dbSNP:780492177
511 511 -, t dbSNP:397508647
512 512 a, g dbSNP:749801869
521 521 a, t dbSNP:771512600
523 523 a, c dbSNP:772733538
527 527 -, ctcc dbSNP:397508671
527 527 -, c dbSNP:397508672
528 528 a, g, t dbSNP:397508674
529 529 -, cta dbSNP:752803445
530 530 -, act dbSNP:397508679
531 531 c, t dbSNP:1800078
532 532 -, cta dbSNP:397508686
533 533 -, ga dbSNP:397508687
534 534 a, g, t dbSNP:76371115
535 535 c, t dbSNP:760281820
536 536 c, t dbSNP:145900055
537 537 c, g, t dbSNP:397508694
538 538 -, a dbSNP:397508698
540 540 a, c dbSNP:397508700
542 542 -, a dbSNP:387906363
547 547 -, t dbSNP:387906364
551 551 c, t dbSNP:749836021
552 552 a, t dbSNP:397508712
555 555 a, g dbSNP:397508713
559 559 c, g dbSNP:759310470
560 560 -, a dbSNP:121908770
561 561 a, c, t dbSNP:35516286
562 562 -, cta dbSNP:397508717
563 563 a, g dbSNP:397508718
564 564 g, t dbSNP:397508719
568 568 a, g dbSNP:752619770
569 569 a, c, t dbSNP:397508720
570 570 a, c dbSNP:764227419
572 572 a, g, t dbSNP:397508721
573 573 g, t dbSNP:397508722
576 576 a, g dbSNP:149197463
577 577 -, aatagctatgtttagttt dbSNP:387906371
579 579 c, t dbSNP:781327181
581 581 c, g dbSNP:397508723
584 584 a, g dbSNP:374689323
587 587 -, t dbSNP:757136340
590 590 a, c, t dbSNP:397508724
591 591 -, t dbSNP:397508726
591 591 a, c, g dbSNP:397508725
593 593 c, t dbSNP:769183771
594 594 a, c, t dbSNP:397508727
598 598 a, t dbSNP:397508728
599 599 a, g, t dbSNP:397508729
600 600 a, c, g dbSNP:397508730
602 602 a, g dbSNP:397508731
607 607 a, g dbSNP:397508733
608 608 a, g dbSNP:200885306
612 612 c, t dbSNP:397508736
612 612 -, t dbSNP:397508737
614 614 a, g dbSNP:397508738
618 618 g, t dbSNP:397508741
622 622 c, t dbSNP:539355562
626 626 a, c, t dbSNP:578029902
627 627 a, g dbSNP:1800079
628 628 a, t dbSNP:780772620
629 629 a, g dbSNP:745468219
632 632 a, c dbSNP:769606990
636 636 -, ataaa dbSNP:397508743
641 641 a, g dbSNP:397508744
644 644 -, a dbSNP:397508745
645 645 c, g dbSNP:762849766
648 648 c, t dbSNP:397508747
649 649 g, t dbSNP:749151514
649 649 -, t dbSNP:121908771
650 650 a, g dbSNP:80282562
651 651 a, g dbSNP:397508748
652 652 a, g dbSNP:770890126
653 653 a, c, t dbSNP:367850319
656 656 c, g dbSNP:374163420
661 661 -, tagt dbSNP:397508750
662 662 a, g dbSNP:1800080
664 664 c, t dbSNP:773374503
665 665 a, c dbSNP:397508751
668 668 -, c dbSNP:397508752
676 676 a, c dbSNP:397508753
679 679 a, c dbSNP:397508754
680 680 a, c dbSNP:368039301
681 681 c, t dbSNP:766640075
685 685 a, c dbSNP:397508755
689 689 g, t dbSNP:141482808
692 692 -, gat dbSNP:397508757
692 692 a, g dbSNP:397508756
693 693 a, g dbSNP:397508758
695 695 a, g, t dbSNP:397508759
696 696 a, g dbSNP:755405930
698 698 a, g dbSNP:376008630
699 699 g, t dbSNP:397508763
700 700 a, g dbSNP:561270322
706 706 a, g dbSNP:749896021
707 707 c, t dbSNP:755619078
710 710 a, c, g dbSNP:193922529
711 711 c, t dbSNP:73215910
713 713 c, t dbSNP:121908802
714 714 a, g dbSNP:397508764
715 715 g, t dbSNP:397508765
716 716 a, t dbSNP:397508766
718 718 a, c dbSNP:753492211
719 719 a, g dbSNP:138338446
719 719 -, g dbSNP:397508767
724 724 a, g dbSNP:397508768
727 727 c, g, t dbSNP:1800081
728 728 a, g dbSNP:748026786
730 730 g, t dbSNP:369247323
731 731 c, t dbSNP:121908803
732 732 c, g, t dbSNP:397508769
735 735 g, t dbSNP:121908752
736 736 g, t dbSNP:397508770
737 737 c, t dbSNP:397508771
741 741 c, t dbSNP:770944337
743 743 g, t dbSNP:397508772
745 745 a, g dbSNP:397508773
746 746 c, t dbSNP:759719664
752 752 a, g dbSNP:540269075
756 756 a, g dbSNP:775701644
757 757 a, g dbSNP:763439293
758 758 c, g, t dbSNP:188457893
760 760 -, t dbSNP:397508774
760 760 a, g dbSNP:762431611
765 765 a, g dbSNP:397508775
766 766 g, t dbSNP:397508776
768 768 a, g dbSNP:121909046
771 771 a, t dbSNP:397508777
776 776 c, t dbSNP:397508778
777 777 a, g dbSNP:397508779
778 778 a, g dbSNP:778686572
780 780 c, t dbSNP:752432390
781 781 a, g dbSNP:758147990
784 784 c, t dbSNP:777446212
788 788 -, t dbSNP:769693190
790 790 c, g dbSNP:746904991
791 791 c, t dbSNP:397508780
793 793 a, t dbSNP:397508781
795 795 a, g dbSNP:770891254
798 798 g, t dbSNP:397508782
802 802 c, t dbSNP:746003305
806 806 c, g dbSNP:201410793
813 813 a, t dbSNP:397508783
815 815 c, g dbSNP:775713428
818 818 g, t dbSNP:763097577
819 819 c, t dbSNP:769016520
822 822 c, t dbSNP:774888069
823 823 g, t dbSNP:762380161
825 825 c, t dbSNP:550709226
827 827 c, g dbSNP:397508784
829 829 c, g dbSNP:397508785
831 831 c, t dbSNP:397508786
832 832 -, t dbSNP:397508787
833 833 a, g dbSNP:397508788
835 835 c, g dbSNP:764661797
836 836 c, g dbSNP:199865300
838 838 -, agggagaatgatgatgaagtac dbSNP:121908804
839 839 a, g dbSNP:397508789
843 843 a, g dbSNP:758012554
845 845 a, g dbSNP:763914313
846 846 c, t dbSNP:751401915
848 848 a, g dbSNP:562538994
849 849 a, t dbSNP:397508790
856 856 a, g dbSNP:35033453
859 859 c, g, t dbSNP:1800082
861 861 a, c, g dbSNP:397508792
872 872 c, g dbSNP:748582435
873 873 c, t dbSNP:113744424
882 882 a, t dbSNP:772704102
884 884 a, g dbSNP:773790621
888 888 a, c dbSNP:761102525
890 890 a, g dbSNP:191456345
891 891 -, g dbSNP:397508794
891 891 g, t dbSNP:377514639
893 893 c, g, t dbSNP:762640483
893 893 c, tcttcctcagattcattgtgattacctca dbSNP:397508795
897 897 g, t dbSNP:751348867
912 912 g, t dbSNP:148519623
921 921 -, a dbSNP:121908772
923 923 -, at dbSNP:121908773
924 924 c, t dbSNP:201016820
928 928 a, g dbSNP:767312350
933 933 c, t dbSNP:750324511
936 936 a, t dbSNP:756036343
943 943 c, g dbSNP:193922532
946 946 a, c dbSNP:397508799
947 947 a, t dbSNP:397508800
948 948 a, g dbSNP:672601317
954 954 -, aag dbSNP:397508801
955 955 a, t dbSNP:773509355
956 956 g, t dbSNP:749377803
959 959 a, g dbSNP:755215339
960 960 c, t dbSNP:397508802
964 964 a, t dbSNP:142864834
966 966 a, g dbSNP:772510035
968 968 -, a dbSNP:786204693
971 971 a, t dbSNP:151073129
972 972 c, t dbSNP:747515655
975 975 -, a dbSNP:397508803
977 977 -, aactt dbSNP:397508805
977 977 a, t dbSNP:397508804
978 978 -, a dbSNP:387906380
978 978 a, g dbSNP:775048504
979 979 -, cttaa dbSNP:397508806
979 979 c, g dbSNP:112162204
986 986 c, t dbSNP:397508808
990 990 c, g, t dbSNP:779120165
992 992 a, g dbSNP:397508811
995 995 a, c dbSNP:397508812
999 999 -, aa dbSNP:397508813
1003 1003 -, ttct dbSNP:765466169
1005 1005 -, c dbSNP:752715236
1006 1006 c, t dbSNP:201465561
1007 1007 a, c, t dbSNP:397508814
1008 1008 a, g dbSNP:143486492
1015 1015 a, t dbSNP:199926595
1017 1017 c, g dbSNP:142134579
1018 1018 a, c dbSNP:146652541
1020 1020 a, g dbSNP:150691494
1030 1030 c, g, t dbSNP:397508816
1031 1031 g, t dbSNP:201885470
1033 1033 c, t dbSNP:1800083
1035 1035 a, g dbSNP:746375310
1036 1036 c, t dbSNP:200046355
1038 1038 a, g dbSNP:397508817
1043 1043 a, g dbSNP:148013312
1044 1044 c, g dbSNP:397508818
1045 1045 -, ctt dbSNP:758477732
1045 1045 a, c, g, t dbSNP:1800084
1051 1051 -, ctt dbSNP:121908768
1051 1051 c, g dbSNP:121909016
1053 1053 -, tct dbSNP:587777924
1057 1057 a, g dbSNP:202168465
1058 1058 c, g dbSNP:397508819
1059 1059 a, g, t dbSNP:75763344
1062 1062 c, t dbSNP:760319837
1064 1064 -, t dbSNP:75528968
1064 1064 -, t dbSNP:775056460
1065 1065 c, t dbSNP:779201407
1066 1066 g, t dbSNP:78742051
1066 1066 -, t dbSNP:121908744
1072 1072 a, g dbSNP:766189605
1076 1076 g, t dbSNP:144476686
1077 1077 a, t dbSNP:397508820
1078 1078 a, t dbSNP:56093012
1079 1079 c, t dbSNP:765443528
1081 1081 c, t dbSNP:752781052
1082 1082 a, g dbSNP:1800085
1089 1089 c, t dbSNP:397508822
1090 1090 c, g dbSNP:1799834
1092 1092 a, g dbSNP:373998255
1096 1096 a, g dbSNP:757622174
1098 1098 g, t dbSNP:141115171
1098 1098 -, t dbSNP:397508823
1099 1099 a, g dbSNP:200112521
1105 1105 -, a dbSNP:397508824
1106 1106 g, t dbSNP:79031340
1110 1110 a, t dbSNP:397508825
1115 1115 c, t dbSNP:193922533
1118 1118 c, t dbSNP:121909011
1119 1119 a, g, t dbSNP:397508137
1120 1120 a, g dbSNP:201115310
1124 1124 -, g dbSNP:397508138
1125 1125 a, c, t dbSNP:397508139
1127 1127 g, t dbSNP:771716655
1130 1130 a, g dbSNP:397508142
1131 1131 c, t dbSNP:77409459
1132 1132 a, c dbSNP:202100193
1136 1136 -, tc dbSNP:751437088
1136 1136 -, a dbSNP:397508143
1136 1136 a, g dbSNP:150239014
1137 1137 -, attcaccaccat dbSNP:397508140
1139 1139 c, t dbSNP:397508144
1140 1140 -, tc dbSNP:387906360
1141 1141 a, g dbSNP:200268636
1146 1146 g, t dbSNP:746657594
1147 1147 -, g dbSNP:397508145
1147 1147 -, c dbSNP:121908774
1148 1148 a, g dbSNP:770678816
1150 1150 c, t dbSNP:201387280
1153 1153 c, t dbSNP:202116910
1154 1154 c, t dbSNP:575762281
1155 1155 c, t dbSNP:397508146
1157 1157 c, t dbSNP:397508147
1158 1158 a, c, g, t dbSNP:77932196
1161 1161 a, t dbSNP:142920240
1164 1164 c, t dbSNP:121909021
1165 1165 a, g dbSNP:200520623
1170 1170 c, g, t dbSNP:1800086
1172 1172 c, t dbSNP:193922497
1173 1173 a, g dbSNP:121908753
1175 1175 c, t dbSNP:397508148
1177 1177 a, c, g dbSNP:1800087
1180 1180 c, t dbSNP:199566942
1181 1181 c, t dbSNP:144720913
1182 1182 c, t dbSNP:562012226
1185 1185 c, g dbSNP:573808767
1186 1186 a, g dbSNP:397508150
1187 1187 -, g dbSNP:397508151
1192 1192 a, g dbSNP:200708728
1193 1193 aaaaa, caaac dbSNP:397508152
1193 1193 a, c dbSNP:76879328
1194 1194 a, g dbSNP:397508153
1195 1195 a, g dbSNP:761324191
1197 1197 a, c, g, t dbSNP:75053309
1198 1198 a, g dbSNP:201246833
1199 1199 a, c, t dbSNP:397508154
1199 1199 -, t dbSNP:387906361
1201 1201 -, g dbSNP:387906375
1204 1204 a, c, g, t dbSNP:397508155
1207 1207 c, t dbSNP:776586449
1208 1208 c, t dbSNP:78909279
1211 1211 -, ct dbSNP:387906365
1212 1212 c, t dbSNP:76727851
1216 1216 a, g dbSNP:112369969
1225 1225 c, t dbSNP:199742619
1229 1229 -, acaaaa dbSNP:397508156
1230 1230 c, t dbSNP:140026105
1231 1231 a, g dbSNP:769711210
1235 1235 a, g dbSNP:556880586
1243 1243 a, c dbSNP:73215912
1245 1245 -, a dbSNP:397508163
1246 1246 -, a dbSNP:587777926
1251 1251 a, g dbSNP:768589673
1253 1253 a, g, t dbSNP:397508165
1255 1255 a, c dbSNP:774308232
1257 1257 a, g dbSNP:761884881
1262 1262 a, c dbSNP:375975969
1266 1266 c, t dbSNP:397508166
1269 1269 -, at dbSNP:779935991
1270 1270 -, a dbSNP:397508167
1271 1271 -, at dbSNP:121908785
1276 1276 c, t dbSNP:773479329
1280 1280 -, acgacta dbSNP:397508169
1281 1281 c, t dbSNP:143860237
1282 1282 a, g, t dbSNP:1800088
1283 1283 a, t dbSNP:754159235
1286 1286 a, g dbSNP:759980456
1293 1293 c, g, t dbSNP:397508170
1294 1294 a, g dbSNP:542860881
1295 1295 -, g dbSNP:397508171
1299 1299 g, t dbSNP:397508172
1304 1304 a, t dbSNP:753143757
1314 1314 a, c, g, t dbSNP:146463120
1315 1315 c, t dbSNP:750143745
1320 1320 a, g, t dbSNP:397508174
1321 1321 a, c, g dbSNP:397508175
1327 1327 a, c, g dbSNP:397508177
1328 1328 c, g dbSNP:200899224
1335 1335 a, g dbSNP:559197407
1336 1336 a, g dbSNP:532798256
1337 1337 a, g dbSNP:766063304
1338 1338 a, t dbSNP:397508180
1343 1343 a, t dbSNP:754860444
1345 1345 c, t dbSNP:778548877
1349 1349 a, g dbSNP:748155731
1352 1352 -, gcaaa dbSNP:3034796
1352 1352 -, g dbSNP:397508181
1353 1353 -, c dbSNP:397508182
1358 1358 -, caaaa dbSNP:397508184
1358 1358 c, t dbSNP:397508183
1359 1359 a, c dbSNP:758289310
1365 1365 a, g dbSNP:777850419
1369 1369 a, c dbSNP:4727853
1371 1371 a, g dbSNP:397508185
1372 1372 c, t dbSNP:62469440
1376 1376 a, g dbSNP:377629509
1383 1383 c, t dbSNP:201880593
1387 1387 a, t dbSNP:376039579
1388 1388 a, g dbSNP:371107552
1396 1396 c, t dbSNP:2896225
1400 1400 a, c dbSNP:563443356
1405 1405 c, t dbSNP:763577850
1408 1408 c, t dbSNP:764640445
1409 1409 a, g dbSNP:772853317
1415 1415 -, ttctcac dbSNP:397508186
1417 1417 a, c dbSNP:11531593
1419 1419 a, c dbSNP:367934560
1422 1422 c, t dbSNP:760329565
1428 1428 a, g dbSNP:765791986
1430 1430 a, g dbSNP:201434579
1433 1433 c, t dbSNP:397508187
1437 1437 c, t dbSNP:754553074
1440 1440 c, t dbSNP:397508188
1443 1443 -, agat dbSNP:746521543
1445 1445 g, t dbSNP:147422190
1447 1447 -, agat dbSNP:397508189
1447 1447 g, t dbSNP:148056476
1448 1448 -, atta dbSNP:749854099
1448 1448 -, at dbSNP:397508190
1448 1448 -, gata dbSNP:786204587
1448 1448 a, g dbSNP:758342553
1449 1449 c, g, t dbSNP:397508191
1457 1457 -, a dbSNP:771409475
1458 1458 -, a dbSNP:397508192
1458 1458 a, g dbSNP:746941790
1461 1461 g, t dbSNP:748642635
1473 1473 a, c dbSNP:397508193
1474 1474 -, gtt dbSNP:377319489
1477 1477 -, gtt dbSNP:397508194
1482 1482 a, c, t dbSNP:74551128
1483 1483 a, g, t dbSNP:79074685
1484 1484 g, t dbSNP:397508195
1485 1485 c, t dbSNP:193922500
1488 1488 -, ctggatcca dbSNP:786205658
1491 1491 -, g dbSNP:397508196
1491 1491 g, t dbSNP:121909009
1495 1495 c, t dbSNP:749599371
1510 1510 a, g, t dbSNP:397508198
1512 1512 a, c dbSNP:758900656
1515 1515 a, c, g, t dbSNP:121908805
1517 1517 c, t dbSNP:1800089
1518 1518 c, t dbSNP:139573311
1521 1521 c, t dbSNP:397508202
1523 1523 a, g dbSNP:397508203
1525 1525 a, g, t dbSNP:143218779
1526 1526 -, gtgattatgg dbSNP:397508204
1526 1526 a, g dbSNP:213950
1536 1536 -, g dbSNP:397508205
1538 1538 c, g dbSNP:756206533
1547 1547 c, t dbSNP:139054556
1551 1551 -, ca dbSNP:397508206
1553 1553 g, t dbSNP:397508207
1555 1555 c, g dbSNP:754152822
1556 1556 a, g, t dbSNP:79282516
1557 1557 a, g dbSNP:397508208
1558 1558 c, t dbSNP:1800090
1562 1562 -, t dbSNP:397508209
1568 1568 c, t dbSNP:397508210
1571 1571 a, t dbSNP:138427145
1572 1572 c, g dbSNP:143980575
1578 1578 a, g dbSNP:748461979
1584 1584 a, c dbSNP:397508211
1586 1586 -, t dbSNP:775663783
1587 1587 -, tc dbSNP:397508212
1587 1587 g, t dbSNP:772635060
1589 1589 c, t dbSNP:397508213
1590 1590 g, t dbSNP:778205742
1593 1593 c, t dbSNP:121909017
1595 1595 -, ca dbSNP:121908775
1595 1595 c, t dbSNP:77101217
1596 1596 a, c, g dbSNP:397508214
1600 1600 -, tt dbSNP:397508215
1605 1605 a, g dbSNP:397508216
1606 1606 c, g dbSNP:200626971
1612 1612 c, g dbSNP:397508218
1613 1613 c, g dbSNP:397508219
1617 1617 a, g dbSNP:774945680
1618 1618 a, c dbSNP:762619288
1619 1619 a, g dbSNP:397508221
1622 1622 a, g dbSNP:768243039
1623 1623 a, c, t dbSNP:397508222
1628 1628 c, g, t dbSNP:397508223
1634 1634 -, atc dbSNP:763199062
1634 1634 a, c, g dbSNP:1800091
1635 1635 c, g, t dbSNP:397508224
1636 1636 a, c, g dbSNP:1800092
1637 1637 -, atc dbSNP:121908745
1637 1637 a, g dbSNP:1801178
1638 1638 -, tct dbSNP:199826652
1639 1639 -, ctt dbSNP:113993960
1640 1640 -, ttt dbSNP:121909001
1640 1640 c, g, t dbSNP:753920616
1641 1641 c, g, t dbSNP:74571530
1646 1646 a, g dbSNP:752955846
1655 1655 g, t dbSNP:758745885
1656 1656 a, g dbSNP:397508225
1660 1660 a, c dbSNP:781680305
1661 1661 c, t dbSNP:778175128
1663 1663 -, ta dbSNP:121908776
1663 1663 c, t dbSNP:747504631
1664 1664 a, g dbSNP:397508226
1675 1675 c, t dbSNP:757736710
1676 1676 a, c, g, t dbSNP:77646904
1678 1678 c, t dbSNP:768151081
1681 1681 c, g dbSNP:140552874
1688 1688 c, t dbSNP:368516826
1690 1690 a, c dbSNP:121908754
1690 1690 -, c dbSNP:774433839
1691 1691 c, t dbSNP:397508227
1697 1697 c, g dbSNP:397508228
1698 1698 a, g dbSNP:374453187
1699 1699 a, g dbSNP:1800094
1700 1700 a, g dbSNP:773018372
1702 1702 a, g, t dbSNP:1800095
1703 1703 c, g dbSNP:397508235
1704 1704 a, g dbSNP:397508236
1705 1705 c, t dbSNP:772895745
1706 1706 a, c, g dbSNP:397508237
1708 1708 c, g dbSNP:770841527
1712 1712 a, g dbSNP:35032490
1715 1715 c, t dbSNP:397508238
1719 1719 a, c dbSNP:387906368
1724 1724 a, g, t dbSNP:148173473
1728 1728 -, ac dbSNP:397508239
1729 1729 a, c, t dbSNP:397508240
1734 1734 c, t dbSNP:144745159
1736 1736 a, g dbSNP:187318937
1742 1742 g, t dbSNP:113993959
1743 1743 a, g dbSNP:764314119
1747 1747 a, g dbSNP:751730446
1748 1748 a, g dbSNP:762224063
1749 1749 g, t dbSNP:397508241
1750 1750 g, t dbSNP:767846505
1753 1753 -, aatcac dbSNP:397508242
1755 1755 g, t dbSNP:747633221
1757 1757 a, g dbSNP:750970412
1759 1759 a, t dbSNP:1800096
1760 1760 -, ct dbSNP:397508246
1763 1763 a, c dbSNP:121908757
1764 1764 a, g, t dbSNP:121908755
1765 1765 g, t dbSNP:121909005
1766 1766 a, g, t dbSNP:397508247
1768 1768 -, a dbSNP:397508251
1769 1769 a, g dbSNP:121909013
1770 1770 a, g dbSNP:75527207
1770 1770 -, g dbSNP:397508252
1772 1772 c, t dbSNP:76554633
1774 1774 -, a dbSNP:397508253
1775 1775 c, g, t dbSNP:74597325
1776 1776 a, g dbSNP:121909044
1778 1778 -, a dbSNP:397508254
1779 1779 a, c dbSNP:121909022
1781 1781 a, g dbSNP:397508255
1784 1784 a, g dbSNP:75789129
1787 1787 a, t dbSNP:746642567
1788 1788 -, c dbSNP:397508257
1791 1791 c, t dbSNP:193922504
1792 1792 -, a dbSNP:397508258
1792 1792 a, g dbSNP:770896561
1793 1793 a, g dbSNP:75549581
1794 1794 a, c, t dbSNP:397508259
1796 1796 a, g dbSNP:397508260
1797 1797 a, c, g dbSNP:80055610
1798 1798 a, c dbSNP:397508267
1799 1799 -, c dbSNP:397508268
1800 1800 a, c dbSNP:121909047
1802 1802 a, c, g dbSNP:1800097
1805 1805 a, g, t dbSNP:121909006
1808 1808 -, a dbSNP:753782103
1808 1808 a, g dbSNP:371291116
1809 1809 a, g dbSNP:375325315
1810 1810 -, a dbSNP:193922505
1811 1811 c, g, t dbSNP:769476932
1812 1812 a, g dbSNP:397508270
1814 1814 a, g dbSNP:397508271
1821 1821 a, t dbSNP:397508273
1821 1821 -, t dbSNP:397508274
1822 1822 g, t dbSNP:397508275
1823 1823 c, g, t dbSNP:397508276
1824 1824 a, g dbSNP:397508277
1825 1825 a, c, t dbSNP:397508278
1829 1829 c, t dbSNP:774376246
1830 1830 c, t dbSNP:397508280
1831 1831 -, ag dbSNP:397508281
1832 1832 a, g dbSNP:397508282
1834 1834 c, g dbSNP:748393295
1836 1836 c, t dbSNP:772223589
1838 1838 c, t dbSNP:397508283
1839 1839 a, c dbSNP:121908758
1842 1842 a, t dbSNP:773569201
1844 1844 g, t dbSNP:397508284
1845 1845 c, g, t dbSNP:1800098
1848 1848 a, t dbSNP:397508286
1849 1849 c, t dbSNP:55928397
1852 1852 a, g dbSNP:201025424
1853 1853 -, c dbSNP:34347530
1853 1853 g, t dbSNP:397508287
1854 1854 a, c, g dbSNP:397508288
1856 1856 -, g dbSNP:397508289
1857 1857 -, t dbSNP:397508290
1862 1862 a, t dbSNP:397508292
1863 1863 c, g, t dbSNP:397508293
1864 1864 a, c dbSNP:751058333
1871 1871 g, t dbSNP:397508296
1877 1877 a, g, t dbSNP:767349773
1880 1880 a, g dbSNP:755986694
1881 1881 a, g, t dbSNP:397508297
1884 1884 a, c, g, t dbSNP:397508300
1893 1893 a, g dbSNP:767117028
1901 1901 a, g, t dbSNP:750140050
1904 1904 -, gc dbSNP:397508301
1905 1905 a, c dbSNP:139027193
1908 1908 a, c dbSNP:766220110
1909 1909 c, g, t dbSNP:186147668
1910 1910 -, aaaacta dbSNP:397508303
1910 1910 a, t dbSNP:397508302
1914 1914 c, g dbSNP:754945422
1915 1915 a, t dbSNP:397508304
1916 1916 a, g dbSNP:397508305
1919 1919 a, t dbSNP:397508306
1920 1920 c, t dbSNP:397508307
1925 1925 a, g, t dbSNP:143036685
1926 1926 c, t dbSNP:758518645
1927 1927 c, t dbSNP:777795393
1929 1929 c, g, t dbSNP:397508308
1931 1931 c, t dbSNP:747283431
1932 1932 c, t dbSNP:766874
1934 1934 -, ggagttctgaaaatgtcccataaaaatagctgctaccttcatgcaaaa ttaatattttgtcagctttctttaaatgttccattt dbSNP:201572956
1935 1935 -, aaatggaacatttaaagaaagctgacaaaatattaattttgcatgaag gtagcagctatttttatgggacattttcagaactcc dbSNP:121908777
1941 1941 a, g dbSNP:397508309
1944 1944 a, g, t dbSNP:397508310
1946 1946 a, t dbSNP:771007967
1947 1947 c, t dbSNP:397508311
1955 1955 a, g dbSNP:201978662
1958 1958 g, t dbSNP:397508312
1959 1959 a, g dbSNP:201124247
1964 1964 a, g dbSNP:746288410
1969 1969 a, t dbSNP:770273307
1971 1971 c, t dbSNP:139468767
1974 1974 c, t dbSNP:397508313
1977 1977 a, c, g, t dbSNP:397508314
1978 1978 g, t dbSNP:397508315
1983 1983 a, g dbSNP:121908759
1991 1991 a, t dbSNP:760390633
1996 1996 g, t dbSNP:765879588
2000 2000 a, c, g dbSNP:397508316
2005 2005 -, t dbSNP:752572716
2015 2015 a, c dbSNP:397508317
2016 2016 c, t dbSNP:397508318
2018 2018 c, t dbSNP:397508319
2025 2025 c, t dbSNP:374702882
2027 2027 c, t dbSNP:397508320
2029 2029 -, c dbSNP:201289677
2029 2029 -, g dbSNP:121908778
2033 2033 g, t dbSNP:397508321
2037 2037 -, tt dbSNP:397508322
2038 2038 c, t dbSNP:145877746
2039 2039 a, g dbSNP:752666475
2041 2041 a, ctcaaaact dbSNP:121908779
2042 2042 c, t dbSNP:758401664
2050 2050 c, g dbSNP:779674687
2052 2052 a, c, t dbSNP:377731410
2056 2056 a, t dbSNP:769948218
2060 2060 a, g dbSNP:757356196
2061 2061 a, t dbSNP:121909033
2065 2065 c, t dbSNP:781329459
2068 2068 a, c, t dbSNP:200204024
2069 2069 a, g dbSNP:780526529
2072 2072 a, c, g dbSNP:546234059
2078 2078 a, g dbSNP:1800099
2084 2084 g, t dbSNP:397508323
2091 2091 agaaa, gaaattcaatcct dbSNP:121908780
2094 2094 -, a dbSNP:121908809
2099 2099 -, a dbSNP:397508324
2099 2099 a, g dbSNP:777973729
2102 2102 -, ctaa dbSNP:397508325
2104 2104 -, aact dbSNP:397508326
2108 2108 g, t dbSNP:397508327
2119 2119 c, t dbSNP:772786141
2120 2120 c, t dbSNP:1800100
2121 2121 a, g dbSNP:199623561
2127 2127 -, a dbSNP:397508329
2129 2129 -, t dbSNP:758077237
2130 2130 -, t dbSNP:121908812
2131 2131 -, aga dbSNP:397508330
2132 2132 a, g dbSNP:776194796
2135 2135 g, t dbSNP:397508331
2139 2139 a, g, t dbSNP:765043844
2144 2144 c, g, t dbSNP:762888022
2146 2146 c, t dbSNP:751504707
2151 2151 c, t dbSNP:757333389
2154 2154 a, g dbSNP:397508333
2160 2160 a, t dbSNP:201295415
2162 2162 -, c dbSNP:397508334
2163 2163 -, a dbSNP:746460279
2164 2164 -, a dbSNP:777301769
2166 2166 a, g dbSNP:181878120
2169 2169 -, aa dbSNP:730882055
2169 2169 -, aa, g dbSNP:121908799
2169 2169 a, g dbSNP:79471689
2170 2170 -, a dbSNP:121908786
2170 2170 -, a dbSNP:121908746
2170 2170 a, g dbSNP:750642366
2171 2171 c, t dbSNP:397508336
2175 2175 a, c dbSNP:201444561
2186 2186 a, g dbSNP:780579840
2192 2192 g, t dbSNP:397508337
2195 2195 -, tt dbSNP:756784172
2195 2195 c, t dbSNP:397508338
2197 2197 -, g dbSNP:781715088
2197 2197 g, t dbSNP:145540754
2201 2201 -, g dbSNP:397508339
2202 2202 a, g dbSNP:755388239
2205 2205 a, g dbSNP:397508340
2207 2207 -, a dbSNP:397508341
2215 2215 a, t dbSNP:779344666
2224 2224 c, g dbSNP:1800102
2226 2226 a, t dbSNP:748664864
2227 2227 c, t dbSNP:770386926
2229 2229 c, t dbSNP:776162972
2231 2231 a, g dbSNP:745538406
2235 2235 a, t dbSNP:774331535
2241 2241 c, t dbSNP:769375972
2243 2243 c, t dbSNP:121908760
2244 2244 a, g dbSNP:397508342
2244 2244 -, g dbSNP:35722447
2246 2246 a, t dbSNP:75115087
2257 2257 a, t dbSNP:763930691
2258 2258 g, t dbSNP:774199624
2261 2261 c, t dbSNP:397508343
2263 2263 aa, gt dbSNP:397508344
2263 2263 a, c dbSNP:141235765
2264 2264 a, t dbSNP:121909023
2268 2268 c, t dbSNP:767516547
2271 2271 c, g dbSNP:142432539
2274 2274 a, t dbSNP:397508345
2276 2276 c, t dbSNP:397508346
2277 2277 a, g dbSNP:766776518
2286 2286 g, t dbSNP:200531709
2290 2290 c, t dbSNP:368599862
2291 2291 -, a dbSNP:746418935
2291 2291 a, g dbSNP:199791061
2293 2293 -, a dbSNP:121908787
2294 2294 -, a dbSNP:200007348
2302 2302 g, t dbSNP:779304728
2306 2306 g, t dbSNP:397508349
2310 2310 c, t dbSNP:748634753
2313 2313 g, t dbSNP:397508350
2321 2321 -, a dbSNP:397508351
2322 2322 a, g dbSNP:397508352
2327 2327 a, t dbSNP:780578035
2328 2328 c, t dbSNP:186089140
2333 2333 a, g dbSNP:769282153
2333 2333 -, g dbSNP:397508353
2337 2337 c, t dbSNP:150772285
2351 2351 g, t dbSNP:397508354
2358 2358 -, cgatactg dbSNP:397508355
2358 2358 c, t dbSNP:748908591
2359 2359 a, g dbSNP:146645194
2363 2363 c, t dbSNP:151235408
2366 2366 -, cctcgcat dbSNP:397508356
2367 2367 c, t dbSNP:140455771
2369 2369 c, t dbSNP:772661780
2370 2370 a, c, g dbSNP:397508357
2371 2371 c, t dbSNP:760893687
2373 2373 g, t dbSNP:766541549
2376 2376 a, g dbSNP:754150498
2377 2377 c, g, t dbSNP:201888075
2378 2378 a, g dbSNP:150157202
2381 2381 a, t dbSNP:753047779
2394 2394 -, cc dbSNP:397508358
2397 2397 c, g, t dbSNP:397508359
2398 2398 a, g dbSNP:138634146
2400 2400 c, t dbSNP:77083601
2404 2404 g, t dbSNP:397508361
2408 2408 c, t dbSNP:121908810
2409 2409 -, g dbSNP:387906376
2412 2412 a, g dbSNP:557228597
2415 2415 a, g, t dbSNP:397508363
2431 2431 c, t dbSNP:768301278
2440 2440 a, t dbSNP:778581398
2441 2441 c, t dbSNP:748045283
2442 2442 -, ac dbSNP:397508364
2442 2442 a, g dbSNP:771752335
2445 2445 c, g dbSNP:397508365
2459 2459 c, t dbSNP:397508368
2464 2464 a, c dbSNP:397508369
2465 2465 a, g dbSNP:773328681
2466 2466 g, t dbSNP:760654830
2471 2471 c, t dbSNP:374946172
2472 2472 a, c, g dbSNP:141880790
2476 2476 c, g dbSNP:765432538
2491 2491 a, g dbSNP:202115503
2492 2492 c, g, t dbSNP:145449046
2493 2493 a, g dbSNP:369040061
2508 2508 -, c dbSNP:397508372
2509 2509 a, c dbSNP:773521854
2510 2510 c, t dbSNP:138069616
2516 2516 g, t dbSNP:764413025
2517 2517 c, g dbSNP:397508373
2521 2521 c, t dbSNP:752093682
2529 2529 a, t dbSNP:397508374
2535 2535 a, g dbSNP:397508375
2539 2539 a, g dbSNP:1800103
2540 2540 -, at dbSNP:387906359
2542 2542 c, t dbSNP:143954792
2546 2546 a, g dbSNP:377447726
2551 2551 g, t dbSNP:778688276
2552 2552 -, t dbSNP:397508376
2558 2558 c, t dbSNP:397508377
2561 2561 g, t dbSNP:672601316
2568 2568 g, t dbSNP:148604667
2571 2571 -, t dbSNP:397515498
2578 2578 a, t dbSNP:369664216
2582 2582 a, g, t dbSNP:397508378
2585 2585 g, t dbSNP:397508379
2587 2587 a, t dbSNP:777667933
2590 2590 -, t dbSNP:397508380
2593 2593 c, t dbSNP:746961486
2594 2594 a, g dbSNP:397508381
2596 2596 a, c dbSNP:776854526
2597 2597 g, t dbSNP:121909018
2600 2600 a, g dbSNP:759726447
2606 2606 a, t dbSNP:397508382
2609 2609 g, t dbSNP:397508387
2610 2610 a, g dbSNP:373264826
2613 2613 a, g dbSNP:565589205
2614 2614 a, c dbSNP:397508388
2620 2620 -, t dbSNP:397508389
2620 2620 g, t dbSNP:200735475
2620 2620 -, t dbSNP:397508390
2623 2623 c, t dbSNP:761043298
2624 2624 g, t dbSNP:201386642
2626 2626 -, t dbSNP:397508391
2628 2628 c, t dbSNP:752086705
2640 2640 c, g dbSNP:397508392
2644 2644 a, g dbSNP:758128209
2655 2655 a, g dbSNP:397508393
2656 2656 a, g dbSNP:267606722
2658 2658 a, g dbSNP:562851847
2662 2662 a, t dbSNP:751242146
2663 2663 c, t dbSNP:757165481
2664 2664 a, g dbSNP:780811333
2665 2665 a, c dbSNP:397508394
2669 2669 c, t dbSNP:121909012
2670 2670 a, g, t dbSNP:397508395
2675 2675 a, g, t dbSNP:780187979
2677 2677 c, t dbSNP:1800104
2679 2679 c, t dbSNP:566908587
2680 2680 a, g, t dbSNP:1042077
2680 2680 -, t dbSNP:397508396
2681 2681 a, g dbSNP:397508397
2683 2683 -, cta dbSNP:774507425
2686 2686 c, t dbSNP:761255045
2689 2689 a, c, g dbSNP:397508398
2695 2695 a, c dbSNP:777190367
2701 2701 -, t dbSNP:397508399
2702 2702 g, t dbSNP:762608972
2707 2707 -, aatttggtgct dbSNP:397508400
2709 2709 -, tt dbSNP:397508401
2714 2714 c, t dbSNP:397508402
2715 2715 a, g dbSNP:193922506
2718 2718 -, a dbSNP:397508405
2718 2718 a, t dbSNP:397508404
2720 2720 -, g dbSNP:397508406
2722 2722 a, g dbSNP:1800105
2733 2733 a, c dbSNP:145714303
2737 2737 a, g dbSNP:397508409
2738 2738 c, g dbSNP:773943545
2747 2747 g, t dbSNP:761531223
2752 2752 -, ggttgtgc dbSNP:397508411
2763 2763 a, g dbSNP:397508413
2769 2769 a, t dbSNP:141508280
2777 2777 a, c dbSNP:770359007
2778 2778 a, c dbSNP:776137464
2781 2781 a, c dbSNP:747674073
2783 2783 c, t dbSNP:61738523
2786 2786 c, t dbSNP:79633941
2787 2787 a, g dbSNP:397508417
2789 2789 a, g dbSNP:760339182
2790 2790 a, g dbSNP:766181463
2791 2791 c, t dbSNP:776350132
2797 2797 g, t dbSNP:397508419
2802 2802 a, c, g dbSNP:201864483
2805 2805 ctca, tgagtactatgag dbSNP:397508420
2805 2805 c, t dbSNP:752617117
2807 2807 c, t dbSNP:567934887
2818 2818 a, t dbSNP:672601315
2821 2821 c, t dbSNP:764201518
2824 2824 c, g dbSNP:397508422
2825 2825 c, t dbSNP:1800106
2826 2826 a, g dbSNP:147297080
2837 2837 a, g dbSNP:397508423
2838 2838 g, t dbSNP:757444123
2841 2841 a, c dbSNP:369521395
2844 2844 g, t dbSNP:1800107
2850 2850 a, g dbSNP:746301481
2853 2853 a, c, t dbSNP:121909034
2854 2854 -, g dbSNP:397508424
2854 2854 a, c, g, t dbSNP:200901072
2855 2855 -, g dbSNP:121908788
2856 2856 a, g dbSNP:121909008
2857 2857 a, t dbSNP:149790377
2860 2860 c, t dbSNP:769879940
2861 2861 c, g dbSNP:770502501
2867 2867 g, t dbSNP:397508427
2868 2868 a, g dbSNP:397508428
2872 2872 g, t dbSNP:397508429
2874 2874 a, g dbSNP:397508430
2876 2876 a, g, t dbSNP:373885282
2878 2878 -, g dbSNP:752480683
2879 2879 a, g dbSNP:199564652
2880 2880 a, g dbSNP:193922508
2882 2882 -, ag dbSNP:397508431
2884 2884 a, g dbSNP:762906556
2886 2886 a, c dbSNP:193922509
2887 2887 c, t dbSNP:1800108
2888 2888 a, g dbSNP:201759207
2892 2892 c, t dbSNP:376827439
2893 2893 -, tt dbSNP:397508433
2895 2895 c, t dbSNP:757410423
2895 2895 -, t dbSNP:397508434
2896 2896 g, t dbSNP:767910302
2898 2898 c, t dbSNP:397508435
2915 2915 a, g dbSNP:397508436
2917 2917 a, t dbSNP:397508437
2918 2918 a, g dbSNP:750655055
2923 2923 a, g dbSNP:368967922
2924 2924 a, c dbSNP:780528577
2926 2926 a, g dbSNP:397508438
2928 2928 -, t dbSNP:193922510
2930 2930 c, g, t dbSNP:749784731
2931 2931 g, t dbSNP:193922511
2933 2933 c, g dbSNP:397508439
2934 2934 a, g dbSNP:397508440
2935 2935 a, t dbSNP:770410806
2937 2937 c, t dbSNP:780871325
2938 2938 g, t dbSNP:60887846
2940 2940 -, t dbSNP:762844777
2943 2943 -, t dbSNP:397508441
2949 2949 c, t dbSNP:141747560
2950 2950 a, g, t dbSNP:193922512
2952 2952 c, t dbSNP:397508442
2953 2953 a, g dbSNP:193922513
2954 2954 a, t dbSNP:397508443
2958 2958 c, t dbSNP:774142582
2961 2961 c, t dbSNP:775570582
2963 2963 c, t dbSNP:121909035
2964 2964 a, g, t dbSNP:397508444
2965 2965 c, t dbSNP:767677110
2969 2969 a, g dbSNP:181137679
2973 2973 c, t dbSNP:142773283
2974 2974 a, c, g dbSNP:151048781
2977 2977 -, acattctgttcttcaagcacctatgtcaaccc dbSNP:397508445
2977 2977 a, g dbSNP:755291650
2978 2978 c, t dbSNP:779528411
2979 2979 a, c dbSNP:397508446
2984 2984 c, g dbSNP:753177202
2993 2993 a, g dbSNP:756799384
2993 2993 -, g dbSNP:397508447
2994 2994 c, t dbSNP:397508448
2996 2996 c, t dbSNP:185397588
3000 3000 c, t dbSNP:769377991
3001 3001 g, t dbSNP:397508450
3006 3006 a, c, t dbSNP:551092617
3013 3013 a, c dbSNP:779569793
3014 3014 -, a dbSNP:397508451
3016 3016 a, g dbSNP:1800109
3018 3018 c, t dbSNP:1800110
3025 3025 a, c, g dbSNP:377502207
3026 3026 a, c, g dbSNP:397508453
3027 3027 a, g dbSNP:386134230
3027 3027 -, g dbSNP:397508458
3034 3034 at, tc dbSNP:397508459
3034 3034 a, t dbSNP:773273576
3035 3035 c, t dbSNP:747139295
3036 3036 a, c, t dbSNP:397508460
3045 3045 c, t dbSNP:770891418
3046 3046 a, c, g dbSNP:776948957
3047 3047 c, g, t dbSNP:137975784
3048 3048 c, t dbSNP:141033578
3050 3050 a, t dbSNP:193922514
3054 3054 a, c, t dbSNP:397508462
3057 3057 a, t dbSNP:397508463
3064 3064 g, t dbSNP:748430234
3068 3068 a, g dbSNP:764644021
3071 3071 a, c, g, t dbSNP:397508465
3073 3073 a, c dbSNP:755691985
3075 3075 c, t dbSNP:565971160
3086 3086 -, a dbSNP:397508466
3087 3087 a, c, g dbSNP:201761547
3089 3089 a, g dbSNP:778858736
3091 3091 a, g dbSNP:370181570
3094 3094 a, t dbSNP:758250836
3095 3095 g, t dbSNP:397508468
3096 3096 a, g dbSNP:777904861
3099 3099 g, t dbSNP:397508469
3100 3100 a, c dbSNP:373561883
3101 3101 a, c dbSNP:776522386
3106 3106 a, g dbSNP:121908797
3109 3109 c, g dbSNP:1800111
3112 3112 -, atta dbSNP:397508472
3112 3112 -, a dbSNP:749963273
3112 3112 a, g dbSNP:751537272
3115 3115 -, aatt dbSNP:397508473
3116 3116 -, attgtgattggagctatagcag dbSNP:397508474
3116 3116 -, a dbSNP:397508475
3119 3119 a, c, g dbSNP:193922731
3120 3120 -, tg dbSNP:397508477
3122 3122 a, t dbSNP:781336456
3125 3125 g, t dbSNP:397508478
3126 3126 a, g dbSNP:55803548
3129 3129 c, g dbSNP:746000445
3132 3132 g, t dbSNP:397508479
3134 3134 a, g dbSNP:780295120
3135 3135 a, c dbSNP:397508480
3139 3139 -, t dbSNP:397508481
3140 3140 -, g dbSNP:397508482
3141 3141 a, t dbSNP:397508483
3142 3142 c, t dbSNP:774643457
3143 3143 a, g dbSNP:184724618
3144 3144 c, t dbSNP:772525578
3151 3151 a, g dbSNP:773752573
3154 3154 a, g dbSNP:537934752
3156 3156 a, c, g, t dbSNP:193922516
3157 3157 -, c dbSNP:397508485
3157 3157 -, c dbSNP:121908781
3159 3159 -, ac dbSNP:397508487
3159 3159 a, g dbSNP:149279509
3165 3165 c, t dbSNP:397508488
3170 3170 a, g dbSNP:757069965
3173 3173 a, g dbSNP:61729420
3177 3177 a, t dbSNP:397508489
3179 3179 a, c, t dbSNP:397508491
3181 3181 -, agtgat dbSNP:397508492
3182 3182 a, g dbSNP:144441835
3185 3185 -, atagtg dbSNP:121908767
3186 3186 -, tagtg dbSNP:397508493
3186 3186 g, t dbSNP:756219310
3190 3190 -, cactat dbSNP:201667497
3192 3192 c, t dbSNP:780061408
3197 3197 a, t dbSNP:79539988
3198 3198 c, t dbSNP:1800112
3199 3199 a, t dbSNP:768801808
3200 3200 a, g dbSNP:200512336
3201 3201 g, t dbSNP:397508494
3202 3202 g, t dbSNP:200553511
3210 3210 c, t dbSNP:779196228
3211 3211 a, g dbSNP:748522610
3212 3212 a, t dbSNP:397508495
3213 3213 a, g dbSNP:144055758
3221 3221 c, t dbSNP:397508496
3224 3224 -, a dbSNP:397508497
3225 3225 a, c dbSNP:397508498
3226 3226 c, t dbSNP:773627677
3234 3234 a, g dbSNP:761221420
3239 3239 a, c dbSNP:769448889
3242 3242 c, t dbSNP:397508500
3249 3249 a, g dbSNP:397508501
3257 3257 c, g dbSNP:397508504
3257 3257 -, g dbSNP:780546355
3258 3258 a, g, t dbSNP:397508508
3266 3266 c, g dbSNP:370430187
3269 3269 a, g, t dbSNP:374403559
3272 3272 g, t dbSNP:150212784
3276 3276 c, t dbSNP:140883683
3278 3278 c, g dbSNP:397508510
3279 3279 -, a dbSNP:387906377
3280 3280 a, t dbSNP:199990040
3287 3287 a, g dbSNP:397508511
3293 3293 c, t dbSNP:758586061
3294 3294 g, t dbSNP:397508512
3295 3295 a, g dbSNP:1800113
3297 3297 a, c dbSNP:397508513
3298 3298 a, g dbSNP:142526976
3299 3299 c, g dbSNP:142394380
3306 3306 -, ctatg dbSNP:387906366
3307 3307 a, g dbSNP:397508514
3311 3311 c, t dbSNP:397508515
3312 3312 c, g, t dbSNP:121909036
3314 3314 a, c, t dbSNP:78194216
3315 3315 a, g, t dbSNP:121909019
3317 3317 a, c, g dbSNP:121909020
3318 3318 a, c, g, t dbSNP:1800114
3319 3319 c, t dbSNP:1800115
3322 3322 c, t dbSNP:1800116
3323 3323 a, g dbSNP:200321110
3326 3326 c, t dbSNP:202179988
3327 3327 a, c, g dbSNP:78769542
3329 3329 c, t dbSNP:397508517
3330 3330 a, c dbSNP:121909037
3333 3333 -, t dbSNP:768963919
3340 3340 a, t dbSNP:186045772
3347 3347 -, ct dbSNP:397508518
3348 3348 -, tg dbSNP:779177972
3348 3348 c, t dbSNP:139304906
3354 3354 a, c dbSNP:397508519
3356 3356 a, c dbSNP:766126240
3357 3357 a, g dbSNP:564165440
3359 3359 c, g dbSNP:397508521
3370 3370 a, g dbSNP:1800117
3372 3372 a, g dbSNP:79635528
3374 3374 a, t dbSNP:373043500
3375 3375 c, t dbSNP:77958296
3377 3377 g, t dbSNP:771259493
3378 3378 c, t dbSNP:774050249
3380 3380 a, g dbSNP:397508523
3381 3381 -, a dbSNP:397508524
3382 3382 -, c dbSNP:397508525
3384 3384 a, g dbSNP:78802634
3385 3385 c, g dbSNP:150020260
3391 3391 c, g dbSNP:752753702
3392 3392 c, t dbSNP:376968326
3393 3393 a, g dbSNP:764434414
3394 3394 a, c, g dbSNP:121908761
3396 3396 c, t dbSNP:397508527
3400 3400 a, g dbSNP:757727766
3403 3403 a, t dbSNP:1800118
3405 3405 -, t dbSNP:397508529
3407 3407 c, t dbSNP:201591901
3408 3408 a, g dbSNP:756579825
3410 3410 c, t dbSNP:397508531
3411 3411 a, g dbSNP:397508532
3412 3412 c, g dbSNP:397508533
3412 3412 -, g dbSNP:397508534
3415 3415 a, c dbSNP:747754623
3417 3417 a, c dbSNP:397508535
3420 3420 a, g, t dbSNP:36210737
3421 3421 a, g dbSNP:777445862
3422 3422 a, t dbSNP:397508536
3423 3423 a, g dbSNP:35813506
3424 3424 a, g dbSNP:746620950
3428 3428 g, t dbSNP:397508538
3432 3432 g, t dbSNP:397508539
3433 3433 -, g dbSNP:397508540
3435 3435 c, t dbSNP:770731635
3440 3440 c, g dbSNP:397508542
3443 3443 a, g dbSNP:759394109
3445 3445 c, t dbSNP:568020045
3449 3449 c, t dbSNP:775276221
3451 3451 c, t dbSNP:144135742
3457 3457 c, t dbSNP:1800119
3458 3458 c, g dbSNP:762831873
3465 3465 c, t dbSNP:764237956
3468 3468 c, t dbSNP:751853765
3471 3471 c, g, t dbSNP:146521846
3482 3482 -, a dbSNP:397508543
3485 3485 c, g dbSNP:397508546
3487 3487 -, aga dbSNP:772371866
3489 3489 -, aag dbSNP:397508548
3493 3493 a, g dbSNP:751140170
3500 3500 a, t dbSNP:397508549
3507 3507 c, g dbSNP:397508550
3509 3509 a, g dbSNP:755472768
3511 3511 c, t dbSNP:745480432
3518 3518 ac, gta dbSNP:397508552
3524 3524 a, g dbSNP:755968404
3527 3527 a, g dbSNP:397508553
3528 3528 c, g, t dbSNP:397508555
3529 3529 c, g dbSNP:141150961
3533 3533 a, g dbSNP:397508556
3536 3536 -, atg dbSNP:397508557
3536 3536 a, g dbSNP:774415786
3537 3537 a, t dbSNP:397508558
3541 3541 a, t dbSNP:748284173
3542 3542 -, agta dbSNP:397508559
3545 3545 c, t dbSNP:768276513
3547 3547 a, g dbSNP:375845215
3548 3548 c, t dbSNP:397508560
3553 3553 a, g dbSNP:397508561
3555 3555 a, c dbSNP:773511304
3557 3557 a, g dbSNP:397508562
3559 3559 a, g dbSNP:375687401
3561 3561 a, g dbSNP:397508564
3562 3562 a, c dbSNP:397508565
3563 3563 c, t dbSNP:374202054
3563 3563 -, t dbSNP:397508566
3572 3572 c, g dbSNP:75541969
3575 3575 a, g dbSNP:143120209
3576 3576 a, t dbSNP:397508567
3578 3578 g, t dbSNP:397508568
3579 3579 a, g dbSNP:397508569
3586 3586 a, g, t dbSNP:139729994
3589 3589 a, g dbSNP:770114378
3591 3591 a, g dbSNP:763401376
3593 3593 c, t dbSNP:397508572
3594 3594 c, t dbSNP:397508573
3599 3599 a, c dbSNP:397508574
3602 3602 c, t dbSNP:74767530
3603 3603 -, ga dbSNP:397508575
3603 3603 a, c, g, t dbSNP:1800120
3606 3606 g, t dbSNP:776696255
3608 3608 -, t dbSNP:397508576
3610 3610 -, t dbSNP:387906379
3612 3612 a, g dbSNP:753508195
3614 3614 c, t dbSNP:754847820
3615 3615 g, t dbSNP:397508577
3621 3621 a, g dbSNP:150326506
3629 3629 a, g dbSNP:778797502
3635 3635 a, g dbSNP:368393738
3639 3639 a, c dbSNP:137875514
3645 3645 -, c dbSNP:78984783
3645 3645 -, c dbSNP:762828343
3646 3646 -, c dbSNP:121908747
3647 3647 a, t dbSNP:397508578
3648 3648 -, a dbSNP:397508579
3648 3648 a, c, g dbSNP:777765549
3649 3649 a, g dbSNP:771022957
3653 3653 -, acca dbSNP:121908782
3653 3653 -, tcaa dbSNP:387906378
3655 3655 c, t dbSNP:781434862
3658 3658 -, a dbSNP:397508580
3660 3660 a, c dbSNP:746050496
3662 3662 c, t dbSNP:770167300
3664 3664 c, g dbSNP:397508581
3672 3672 a, g dbSNP:532200317
3674 3674 c, t dbSNP:397508582
3676 3676 a, g dbSNP:1800121
3677 3677 a, c, g dbSNP:763298273
3680 3680 c, t dbSNP:762167681
3682 3682 a, g dbSNP:146804928
3690 3690 c, t dbSNP:765869179
3702 3702 a, c dbSNP:397508584
3705 3705 c, g dbSNP:121908763
3706 3706 a, g dbSNP:759202870
3708 3708 a, g, t dbSNP:765133036
3710 3710 a, g, t dbSNP:576710089
3710 3710 -, g dbSNP:397508585
3712 3712 g, t dbSNP:1800122
3714 3714 a, g dbSNP:751486159
3716 3716 a, c dbSNP:757314646
3718 3718 a, g dbSNP:397508586
3723 3723 -, a dbSNP:397508587
3725 3725 a, g dbSNP:75647395
3729 3729 a, g dbSNP:121908764
3730 3730 a, g dbSNP:121908765
3735 3735 a, c, g dbSNP:397508588
3736 3736 -, ag dbSNP:397508589
3741 3741 a, g dbSNP:746103666
3741 3741 -, g dbSNP:35396083
3745 3745 a, g dbSNP:770069168
3746 3746 a, c, g dbSNP:151264397
3747 3747 a, t dbSNP:397508590
3752 3752 a, g dbSNP:397508591
3768 3768 c, t dbSNP:749662161
3773 3773 c, t dbSNP:769032865
3777 3777 -, c dbSNP:121908811
3777 3777 c, t dbSNP:1800123
3790 3790 a, t dbSNP:371475225
3792 3792 c, t dbSNP:770358073
3798 3798 c, t dbSNP:397508593
3800 3800 c, g dbSNP:759116351
3805 3805 a, c dbSNP:139322772
3807 3807 -, t dbSNP:77035409
3807 3807 c, t dbSNP:775263210
3809 3809 -, t dbSNP:121908783
3823 3823 g, t dbSNP:34911792
3828 3828 a, g dbSNP:751474685
3830 3830 a, c, t dbSNP:121908766
3831 3831 a, g dbSNP:397508594
3835 3835 a, g dbSNP:144781064
3837 3837 g, t dbSNP:397508598
3841 3841 a, c, t dbSNP:185065886
3844 3844 c, t dbSNP:758818517
3848 3848 a, g dbSNP:397508599
3849 3849 a, g, t dbSNP:267606723
3853 3853 a, g dbSNP:1800128
3855 3855 c, t dbSNP:397508600
3857 3857 c, g dbSNP:397508601
3861 3861 c, t dbSNP:148122007
3862 3862 -, a dbSNP:121908784
3863 3863 a, g dbSNP:397508602
3864 3864 a, g dbSNP:121909040
3870 3870 a, g dbSNP:74503330
3871 3871 c, t dbSNP:200837037
3872 3872 a, c dbSNP:397508603
3875 3875 c, t dbSNP:201382911
3877 3877 a, c, g dbSNP:117400534
3879 3879 g, t dbSNP:397508604
3880 3880 a, t dbSNP:768411899
3881 3881 c, t dbSNP:121909041
3882 3882 a, c, t dbSNP:76649725
3883 3883 a, g dbSNP:200174447
3884 3884 -, c dbSNP:397508605
3885 3885 -, c dbSNP:387906370
3885 3885 c, t dbSNP:773852510
3887 3887 c, t dbSNP:200926076
3889 3889 g, t dbSNP:397508607
3890 3890 c, t dbSNP:202074317
3891 3891 -, a, t dbSNP:121908789
3892 3892 -, g dbSNP:397508608
3898 3898 -, act dbSNP:397508610
3898 3898 a, g dbSNP:112339787
3901 3901 g, t dbSNP:771812900
3906 3906 c, t dbSNP:773151957
3907 3907 c, t dbSNP:200921635
3921 3921 a, g dbSNP:766370233
3925 3925 c, g, t dbSNP:1800129
3926 3926 -, g dbSNP:763843966
3927 3927 a, g dbSNP:765549490
3933 3933 g, t dbSNP:752834717
3934 3934 -, gt dbSNP:397508612
3940 3940 a, g dbSNP:397508613
3947 3947 -, a dbSNP:397508614
3948 3948 c, t dbSNP:758867957
3959 3959 c, g, t dbSNP:397508615
3960 3960 a, g dbSNP:752127256
3962 3962 c, g, t dbSNP:397508616
3964 3964 a, c, g dbSNP:77010898
3970 3970 a, g dbSNP:547248892
3972 3972 c, t dbSNP:397508617
3973 3973 -, c dbSNP:397508618
3973 3973 c, g dbSNP:747748817
3975 3975 c, t dbSNP:121909028
3984 3984 a, t dbSNP:771864168
3986 3986 a, c, t dbSNP:397508619
3987 3987 c, t dbSNP:760455218
3988 3988 a, g dbSNP:1800130
3989 3989 c, t dbSNP:397508620
3990 3990 a, g dbSNP:397508621
3991 3991 c, g dbSNP:121909015
3994 3994 -, a dbSNP:397508626
3995 3995 a, g dbSNP:769931559
3996 3996 -, tatt dbSNP:387906373
4000 4000 -, tatt dbSNP:397508628
4001 4001 -, attt dbSNP:397508629
4001 4001 -, t dbSNP:749871110
4001 4001 -, a dbSNP:397508630
4002 4002 -, t dbSNP:121908808
4003 4003 -, t dbSNP:587777927
4007 4007 -, t dbSNP:397508631
4008 4008 -, t dbSNP:397508633
4011 4011 c, g dbSNP:193922522
4013 4013 a, g dbSNP:750604866
4014 4014 c, t dbSNP:397508634
4015 4015 a, g dbSNP:1800131
4016 4016 c, t dbSNP:764469050
4020 4020 -, a dbSNP:755691269
4021 4021 -, a dbSNP:780529834
4021 4021 a, g dbSNP:774683612
4025 4025 a, c dbSNP:121909042
4026 4026 -, a dbSNP:397508638
4026 4026 -, a dbSNP:397508637
4026 4026 a, t dbSNP:397508636
4027 4027 cttgga, tgt dbSNP:397508639
4027 4027 c, g dbSNP:80034486
4033 4033 a, t dbSNP:397508640
4034 4034 c, t dbSNP:201503139
4036 4036 c, g, t dbSNP:1800132
4037 4037 a, t dbSNP:766864834
4038 4038 a, g dbSNP:397508641
4039 4039 a, t dbSNP:397508642
4040 4040 g, t dbSNP:397508643
4043 4043 c, g, t dbSNP:193922732
4045 4045 g, t dbSNP:397508644
4046 4046 g, t dbSNP:573448832
4047 4047 a, g dbSNP:397508645
4053 4053 a, g dbSNP:397508646
4055 4055 a, c, t dbSNP:121909026
4058 4058 -, gaaatatg dbSNP:754392413
4065 4065 a, g dbSNP:121909010
4071 4071 c, t dbSNP:397508648
4072 4072 c, t dbSNP:1800133
4074 4074 a, c dbSNP:397508649
4075 4075 -, aggg dbSNP:193922523
4079 4079 a, g dbSNP:757100665
4082 4082 a, g, t dbSNP:756794531
4089 4089 c, t dbSNP:397508653
4094 4094 -, t dbSNP:397508654
4100 4100 ata, tt dbSNP:397508655
4101 4101 c, t dbSNP:115762793
4102 4102 a, g dbSNP:755917129
4103 4103 c, g dbSNP:397508656
4106 4106 c, g dbSNP:375661578
4111 4111 a, t dbSNP:780170679
4115 4115 g, t dbSNP:193922524
4121 4121 c, t dbSNP:145545286
4122 4122 c, t dbSNP:397508658
4127 4127 g, t dbSNP:397508659
4133 4133 c, t dbSNP:397508660
4134 4134 c, t dbSNP:544710550
4140 4140 a, g dbSNP:748251646
4145 4145 a, g dbSNP:747324955
4146 4146 -, gggg dbSNP:397508661
4146 4146 a, c, g dbSNP:773458471
4149 4149 c, g dbSNP:368427311
4154 4154 -, ctaagcc dbSNP:397508662
4157 4157 -, a dbSNP:397508663
4158 4158 -, gc dbSNP:397508664
4158 4158 a, g dbSNP:777147679
4160 4160 -, c dbSNP:397508665
4163 4163 a, g dbSNP:201686600
4164 4164 a, g dbSNP:193922525
4169 4169 a, g dbSNP:397508666
4171 4171 a, g dbSNP:763602969
4172 4172 c, g, t dbSNP:751098333
4174 4174 c, g, t dbSNP:113857788
4177 4177 c, g dbSNP:374276008
4179 4179 c, t dbSNP:755993775
4180 4180 a, g dbSNP:779937212
4181 4181 g, t dbSNP:753830751
4182 4182 g, t dbSNP:755028771
4186 4186 a, g dbSNP:778892767
4189 4189 aa, tag dbSNP:397508667
4191 4191 c, g dbSNP:748223886
4195 4195 aa, tgtt dbSNP:397508668
4199 4199 c, g dbSNP:772157232
4203 4203 a, c, g dbSNP:777892053
4204 4204 -, t dbSNP:397508669
4209 4209 c, t dbSNP:397508670
4210 4210 a, g dbSNP:148878126
4213 4213 a, g dbSNP:759891255
4214 4214 a, t dbSNP:770345073
4215 4215 c, t dbSNP:200955612
4216 4216 c, t dbSNP:761271867
4223 4223 c, t dbSNP:767002769
4225 4225 c, t dbSNP:772750690
4226 4226 c, g dbSNP:760336091
4227 4227 a, g dbSNP:766124395
4229 4229 g, t dbSNP:397508675
4232 4232 a, c dbSNP:397508676
4233 4233 c, t dbSNP:397508677
4236 4236 g, t dbSNP:587780313
4239 4239 c, g dbSNP:115147093
4241 4241 a, c dbSNP:146947665
4242 4242 a, c, g dbSNP:397508678
4247 4247 a, c, g dbSNP:150683293
4251 4251 c, t dbSNP:752637215
4253 4253 c, g dbSNP:758433792
4257 4257 -, c dbSNP:397508680
4258 4258 -, a dbSNP:397508681
4259 4259 c, t dbSNP:397508682
4260 4260 a, c dbSNP:776388660
4261 4261 a, c dbSNP:397508683
4262 4262 a, c, t dbSNP:397508684
4264 4264 a, c, g dbSNP:765036437
4265 4265 -, a dbSNP:397508685
4281 4281 a, t dbSNP:397508688
4286 4286 c, t dbSNP:397508689
4288 4288 -, a dbSNP:397508690
4292 4292 c, t dbSNP:758292940
4300 4300 c, t dbSNP:763937782
4304 4304 a, c dbSNP:375552160
4308 4308 a, t dbSNP:397508691
4311 4311 g, t dbSNP:397508692
4314 4314 -, tc dbSNP:397508693
4315 4315 c, g, t dbSNP:79688066
4318 4318 -, tg dbSNP:397508695
4319 4319 a, g, t dbSNP:397508696
4320 4320 a, c, g dbSNP:397508697
4324 4324 c, t dbSNP:368044495
4326 4326 a, g dbSNP:780396890
4342 4342 a, g dbSNP:1800134
4343 4343 a, g dbSNP:397508699
4349 4349 c, t dbSNP:397508701
4350 4350 a, c dbSNP:150177304
4352 4352 c, t dbSNP:397508702
4354 4354 a, g dbSNP:541737583
4355 4355 c, t dbSNP:142092183
4359 4359 c, t dbSNP:397508703
4362 4362 a, t dbSNP:779591474
4369 4369 -, a dbSNP:397508706
4370 4370 g, t dbSNP:397508707
4379 4379 g, t dbSNP:578237673
4382 4382 c, t dbSNP:373172017
4383 4383 a, g dbSNP:780785939
4384 4384 a, g dbSNP:545385510
4390 4390 c, t dbSNP:1800135
4394 4394 c, t dbSNP:397508708
4395 4395 a, c, t dbSNP:762847468
4398 4398 c, t dbSNP:193922528
4403 4403 -, a dbSNP:778143253
4409 4409 c, t dbSNP:774296351
4414 4414 -, ga dbSNP:397508709
4414 4414 c, g, t dbSNP:761669740
4415 4415 a, g dbSNP:750559671
4424 4424 c, t dbSNP:760649031
4430 4430 c, t dbSNP:397508711
4440 4440 c, t dbSNP:766659587
4444 4444 a, c dbSNP:753963572
4449 4449 c, t dbSNP:755388886
4450 4450 a, c dbSNP:779359608
4451 4451 a, g dbSNP:148783445
4462 4462 a, g dbSNP:759044436
4466 4466 a, t dbSNP:778414934
4475 4475 c, g, t dbSNP:4148725
4476 4476 a, g dbSNP:141554123
4481 4481 g, t dbSNP:748845320
4482 4482 c, g dbSNP:121909043
4489 4489 g, t dbSNP:774196298
4507 4507 a, g dbSNP:1800136
4509 4509 c, t dbSNP:772046085
4514 4514 g, t dbSNP:199827645
4535 4535 g, t dbSNP:397508716
4541 4541 a, g, t dbSNP:369464175
4543 4543 a, g dbSNP:776922524
4544 4544 c, t dbSNP:374705585
4549 4549 c, t dbSNP:765554812
4551 4551 c, g dbSNP:753173837
4557 4557 c, t dbSNP:758818611
4563 4563 a, g dbSNP:150914702
4570 4570 a, t dbSNP:751972142
4572 4572 a, g dbSNP:755673570
4574 4574 a, g dbSNP:373479656
4578 4578 c, t dbSNP:376476454
4579 4579 a, g dbSNP:748825872
4582 4582 a, g dbSNP:754682917
4590 4590 c, t dbSNP:778513859
4591 4591 c, t dbSNP:747976427
4594 4594 c, t dbSNP:370433011
4603 4603 c, t dbSNP:532413191
4609 4609 c, t dbSNP:113068756
4612 4612 a, g dbSNP:372463411
4634 4634 c, t dbSNP:142602860
4641 4641 g, t dbSNP:397508135
4642 4642 c, t dbSNP:139492880
4655 4655 c, t dbSNP:144214399
4685 4685 -, c dbSNP:145697705
4685 4685 a, g dbSNP:368444938
4686 4686 g, t dbSNP:201842480
4686 4686 -, t dbSNP:67380110
4693 4693 a, t dbSNP:146567608
4694 4694 a, t dbSNP:4148726
4694 4694 -, t dbSNP:372350028
4705 4705 c, t dbSNP:149810643
4711 4711 a, g dbSNP:766514320
4716 4716 a, g dbSNP:574052503
4730 4730 c, t dbSNP:558545826
4732 4732 g, t dbSNP:751949844
4843 4843 c, g dbSNP:375677859
4859 4859 a, t dbSNP:151066046
4864 4864 c, g dbSNP:755544507
4886 4886 a, g dbSNP:17140308
4901 4901 c, t dbSNP:769123432
4916 4916 c, t dbSNP:73716217
4924 4924 a, g dbSNP:575912292
4931 4931 a, t dbSNP:542828566
4994 4994 a, t dbSNP:367622983
5000 5000 c, t dbSNP:762751298
5003 5003 c, t dbSNP:180783619
5012 5012 a, t dbSNP:185819383
5029 5029 c, t dbSNP:569373813
5035 5035 c, g dbSNP:192385679
5043 5043 c, t dbSNP:147862180
5107 5107 a, g dbSNP:756595615
5148 5148 c, t dbSNP:532380395
5159 5159 c, t dbSNP:544627832
5163 5163 a, g dbSNP:777260465
5179 5179 c, g dbSNP:562606012
5189 5189 c, t dbSNP:61481156
5243 5243 a, g dbSNP:748999686
5245 5245 a, g dbSNP:146818281
5302 5302 -, ag dbSNP:559905860
5351 5351 a, g dbSNP:560400140
5442 5442 c, t dbSNP:371815480
5457 5457 a, g dbSNP:778500377
5487 5487 a, g dbSNP:530023263
5504 5504 a, c dbSNP:548356641
5515 5515 a, c dbSNP:771992860
5588 5588 -, ag dbSNP:528660478
5593 5593 -, ga dbSNP:139314714
5600 5600 a, g dbSNP:566680427
5604 5604 a, c dbSNP:10234329
5607 5607 a, c dbSNP:759454406
5648 5648 c, t dbSNP:149773701
5651 5651 c, t dbSNP:549412899
5718 5718 a, t dbSNP:1042166
5747 5747 c, t dbSNP:183653587
5750 5750 a, g dbSNP:760445168
5810 5810 c, t dbSNP:150494700
5812 5812 c, t dbSNP:1042180
5855 5855 a, g dbSNP:55831234
5883 5883 c, g dbSNP:190470955
5904 5904 c, t dbSNP:571454309
5953 5953 c, g dbSNP:143911642
5959 5959 c, t dbSNP:3181644
6014 6014 a, g dbSNP:554885039
6053 6053 a, g dbSNP:374134325
6070 6070 -, a dbSNP:757513835
6117 6117 a, c dbSNP:34255446

Target ORF information:

RefSeq Version XM_011515751
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) (CFTR), transcript variant X1, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_011515751

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
3241
3301
3361
3421
3481
3541
3601
3661
3721
3781
3841
3901
3961
4021
4081
4141
4201
4261
4321
4381
4441
4501
ATGAAAACAC AGGTAGAGGA TTTCAAACAA CAGAGTGGAT GTACGTGTCC TAAGATTTCT 
GTGCCACCCT TGGAGTTCAC TCACCTAAAC CTGAAACTAA TAAAGCTTGG TTCTTTTCTC
CGACACGCAA AGGAAGCGCT AAGCTGGACC AGACCAATTT TGAGGAAAGG ATACAGACAG
CGCCTGGAAT TGTCAGACAT ATACCAAATC CCTTCTGTTG ATTCTGCTGA CAATCTATCT
GAAAAATTGG AAAGAGAATG GGATAGAGAG CTGGCTTCAA AGAAAAATCC TAAACTCATT
AATGCCCTTC GGCGATGTTT TTTCTGGAGA TTTATGTTCT ATGGAATCTT TTTATATTTA
GGGGAAGTCA CCAAAGCAGT ACAGCCTCTC TTACTGGGAA GAATCATAGC TTCCTATGAC
CCGGATAACA AGGAGGAACG CTCTATCGCG ATTTATCTAG GCATAGGCTT ATGCCTTCTC
TTTATTGTGA GGACACTGCT CCTACACCCA GCCATTTTTG GCCTTCATCA CATTGGAATG
CAGATGAGAA TAGCTATGTT TAGTTTGATT TATAAGAAGA CTTTAAAGCT GTCAAGCCGT
GTTCTAGATA AAATAAGTAT TGGACAACTT GTTAGTCTCC TTTCCAACAA CCTGAACAAA
TTTGATGAAG GACTTGCATT GGCACATTTC GTGTGGATCG CTCCTTTGCA AGTGGCACTC
CTCATGGGGC TAATCTGGGA GTTGTTACAG GCGTCTGCCT TCTGTGGACT TGGTTTCCTG
ATAGTCCTTG CCCTTTTTCA GGCTGGGCTA GGGAGAATGA TGATGAAGTA CAGAGATCAG
AGAGCTGGGA AGATCAGTGA AAGACTTGTG ATTACCTCAG AAATGATTGA AAATATCCAA
TCTGTTAAGG CATACTGCTG GGAAGAAGCA ATGGAAAAAA TGATTGAAAA CTTAAGACAA
ACAGAACTGA AACTGACTCG GAAGGCAGCC TATGTGAGAT ACTTCAATAG CTCAGCCTTC
TTCTTCTCAG GGTTCTTTGT GGTGTTTTTA TCTGTGCTTC CCTATGCACT AATCAAAGGA
ATCATCCTCC GGAAAATATT CACCACCATC TCATTCTGCA TTGTTCTGCG CATGGCGGTC
ACTCGGCAAT TTCCCTGGGC TGTACAAACA TGGTATGACT CTCTTGGAGC AATAAACAAA
ATACAGGATT TCTTACAAAA GCAAGAATAT AAGACATTGG AATATAACTT AACGACTACA
GAAGTAGTGA TGGAGAATGT AACAGCCTTC TGGGAGGAGG GATTTGGGGA ATTATTTGAG
AAAGCAAAAC AAAACAATAA CAATAGAAAA ACTTCTAATG GTGATGACAG CCTCTTCTTC
AGTAATTTCT CACTTCTTGG TACTCCTGTC CTGAAAGATA TTAATTTCAA GATAGAAAGA
GGACAGTTGT TGGCGGTTGC TGGATCCACT GGAGCAGGCA AGACTTCACT TCTAATGGTG
ATTATGGGAG AACTGGAGCC TTCAGAGGGT AAAATTAAGC ACAGTGGAAG AATTTCATTC
TGTTCTCAGT TTTCCTGGAT TATGCCTGGC ACCATTAAAG AAAATATCAT CTTTGGTGTT
TCCTATGATG AATATAGATA CAGAAGCGTC ATCAAAGCAT GCCAACTAGA AGAGGACATC
TCCAAGTTTG CAGAGAAAGA CAATATAGTT CTTGGAGAAG GTGGAATCAC ACTGAGTGGA
GGTCAACGAG CAAGAATTTC TTTAGCAAGA GCAGTATACA AAGATGCTGA TTTGTATTTA
TTAGACTCTC CTTTTGGATA CCTAGATGTT TTAACAGAAA AAGAAATATT TGAAAGCTGT
GTCTGTAAAC TGATGGCTAA CAAAACTAGG ATTTTGGTCA CTTCTAAAAT GGAACATTTA
AAGAAAGCTG ACAAAATATT AATTTTGCAT GAAGGTAGCA GCTATTTTTA TGGGACATTT
TCAGAACTCC AAAATCTACA GCCAGACTTT AGCTCAAAAC TCATGGGATG TGATTCTTTC
GACCAATTTA GTGCAGAAAG AAGAAATTCA ATCCTAACTG AGACCTTACA CCGTTTCTCA
TTAGAAGGAG ATGCTCCTGT CTCCTGGACA GAAACAAAAA AACAATCTTT TAAACAGACT
GGAGAGTTTG GGGAAAAAAG GAAGAATTCT ATTCTCAATC CAATCAACTC TATACGAAAA
TTTTCCATTG TGCAAAAGAC TCCCTTACAA ATGAATGGCA TCGAAGAGGA TTCTGATGAG
CCTTTAGAGA GAAGGCTGTC CTTAGTACCA GATTCTGAGC AGGGAGAGGC GATACTGCCT
CGCATCAGCG TGATCAGCAC TGGCCCCACG CTTCAGGCAC GAAGGAGGCA GTCTGTCCTG
AACCTGATGA CACACTCAGT TAACCAAGGT CAGAACATTC ACCGAAAGAC AACAGCATCC
ACACGAAAAG TGTCACTGGC CCCTCAGGCA AACTTGACTG AACTGGATAT ATATTCAAGA
AGGTTATCTC AAGAAACTGG CTTGGAAATA AGTGAAGAAA TTAACGAAGA AGACTTAAAG
GAGTGCTTTT TTGATGATAT GGAGAGCATA CCAGCAGTGA CTACATGGAA CACATACCTT
CGATATATTA CTGTCCACAA GAGCTTAATT TTTGTGCTAA TTTGGTGCTT AGTAATTTTT
CTGGCAGAGG TGGCTGCTTC TTTGGTTGTG CTGTGGCTCC TTGGAAACAC TCCTCTTCAA
GACAAAGGGA ATAGTACTCA TAGTAGAAAT AACAGCTATG CAGTGATTAT CACCAGCACC
AGTTCGTATT ATGTGTTTTA CATTTACGTG GGAGTAGCCG ACACTTTGCT TGCTATGGGA
TTCTTCAGAG GTCTACCACT GGTGCATACT CTAATCACAG TGTCGAAAAT TTTACACCAC
AAAATGTTAC ATTCTGTTCT TCAAGCACCT ATGTCAACCC TCAACACGTT GAAAGCAGGT
GGGATTCTTA ATAGATTCTC CAAAGATATA GCAATTTTGG ATGACCTTCT GCCTCTTACC
ATATTTGACT TCATCCAGTT GTTATTAATT GTGATTGGAG CTATAGCAGT TGTCGCAGTT
TTACAACCCT ACATCTTTGT TGCAACAGTG CCAGTGATAG TGGCTTTTAT TATGTTGAGA
GCATATTTCC TCCAAACCTC ACAGCAACTC AAACAACTGG AATCTGAAGG CAGGAGTCCA
ATTTTCACTC ATCTTGTTAC AAGCTTAAAA GGACTATGGA CACTTCGTGC CTTCGGACGG
CAGCCTTACT TTGAAACTCT GTTCCACAAA GCTCTGAATT TACATACTGC CAACTGGTTC
TTGTACCTGT CAACACTGCG CTGGTTCCAA ATGAGAATAG AAATGATTTT TGTCATCTTC
TTCATTGCTG TTACCTTCAT TTCCATTTTA ACAACAGGAG AAGGAGAAGG AAGAGTTGGT
ATTATCCTGA CTTTAGCCAT GAATATCATG AGTACATTGC AGTGGGCTGT AAACTCCAGC
ATAGATGTGG ATAGCTTGAT GCGATCTGTG AGCCGAGTCT TTAAGTTCAT TGACATGCCA
ACAGAAGGTA AACCTACCAA GTCAACCAAA CCATACAAGA ATGGCCAACT CTCGAAAGTT
ATGATTATTG AGAATTCACA CGTGAAGAAA GATGACATCT GGCCCTCAGG GGGCCAAATG
ACTGTCAAAG ATCTCACAGC AAAATACACA GAAGGTGGAA ATGCCATATT AGAGAACATT
TCCTTCTCAA TAAGTCCTGG CCAGAGGGTG GGCCTCTTGG GAAGAACTGG ATCAGGGAAG
AGTACTTTGT TATCAGCTTT TTTGAGACTA CTGAACACTG AAGGAGAAAT CCAGATCGAT
GGTGTGTCTT GGGATTCAAT AACTTTGCAA CAGTGGAGGA AAGCCTTTGG AGTGATACCA
CAGAAAGTAT TTATTTTTTC TGGAACATTT AGAAAAAACT TGGATCCCTA TGAACAGTGG
AGTGATCAAG AAATATGGAA AGTTGCAGAT GAGGTTGGGC TCAGATCTGT GATAGAACAG
TTTCCTGGGA AGCTTGACTT TGTCCTTGTG GATGGGGGCT GTGTCCTAAG CCATGGCCAC
AAGCAGTTGA TGTGCTTGGC TAGATCTGTT CTCAGTAAGG CGAAGATCTT GCTGCTTGAT
GAACCCAGTG CTCATTTGGA TCCAGTAACA TACCAAATAA TTAGAAGAAC TCTAAAACAA
GCATTTGCTG ATTGCACAGT AATTCTCTGT GAACACAGGA TAGAAGCAAT GCTGGAATGC
CAACAATTTT TGGTCATAGA AGAGAACAAA GTGCGGCAGT ACGATTCCAT CCAGAAACTG
CTGAACGAGA GGAGCCTCTT CCGGCAAGCC ATCAGCCCCT CCGACAGGGT GAAGCTCTTT
CCCCACCGGA ACTCAAGCAA GTGCAAGTCT AAGCCCCAGA TTGCTGCTCT GAAAGAGGAG
ACAGAAGAAG AGGTGCAAGA TACAAGGCTT TAG

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu56827
Accession Version XM_011515752.1
Sequence Information ORF Nucleotide Sequence (Length: 4350bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product cystic fibrosis transmembrane conductance regulator isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_007933.16) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
3241
3301
3361
3421
3481
3541
3601
3661
3721
3781
3841
3901
3961
4021
4081
4141
4201
4261
4321
ATGAAAACAC AGGTAGAGGA TTTCAAACAA CAGAGTGGAT GTACGTGTCC TAAGATTTCT 
GTGCCACCCT TGGAGTTCAC TCACCTAAAC CTGAAACTAA TAAAGCTTGG TTCTTTTCTC
CGACACGCAA AGGAAGCGCT AAGCTGGACC AGACCAATTT TGAGGAAAGG ATACAGACAG
CGCCTGGAAT TGTCAGACAT ATACCAAATC CCTTCTGTTG ATTCTGCTGA CAATCTATCT
GAAAAATTGG AAAGAGAATG GGATAGAGAG CTGGCTTCAA AGAAAAATCC TAAACTCATT
AATGCCCTTC GGCGATGTTT TTTCTGGAGA TTTATGTTCT ATGGAATCTT TTTATATTTA
GGGGAAGTCA CCAAAGCAGT ACAGCCTCTC TTACTGGGAA GAATCATAGC TTCCTATGAC
CCGGATAACA AGGAGGAACG CTCTATCGCG ATTTATCTAG GCATAGGCTT ATGCCTTCTC
TTTATTGTGA GGACACTGCT CCTACACCCA GCCATTTTTG GCCTTCATCA CATTGGAATG
CAGATGAGAA TAGCTATGTT TAGTTTGATT TATAAGAAGA CTTTAAAGCT GTCAAGCCGT
GTTCTAGATA AAATAAGTAT TGGACAACTT GTTAGTCTCC TTTCCAACAA CCTGAACAAA
TTTGATGAAG GACTTGCATT GGCACATTTC GTGTGGATCG CTCCTTTGCA AGTGGCACTC
CTCATGGGGC TAATCTGGGA GTTGTTACAG GCGTCTGCCT TCTGTGGACT TGGTTTCCTG
ATAGTCCTTG CCCTTTTTCA GGCTGGGCTA GGGAGAATGA TGATGAAGTA CAGAGATCAG
AGAGCTGGGA AGATCAGTGA AAGACTTGTG ATTACCTCAG AAATGATTGA AAATATCCAA
TCTGTTAAGG CATACTGCTG GGAAGAAGCA ATGGAAAAAA TGATTGAAAA CTTAAGACAA
ACAGAACTGA AACTGACTCG GAAGGCAGCC TATGTGAGAT ACTTCAATAG CTCAGCCTTC
TTCTTCTCAG GGTTCTTTGT GGTGTTTTTA TCTGTGCTTC CCTATGCACT AATCAAAGGA
ATCATCCTCC GGAAAATATT CACCACCATC TCATTCTGCA TTGTTCTGCG CATGGCGGTC
ACTCGGCAAT TTCCCTGGGC TGTACAAACA TGGTATGACT CTCTTGGAGC AATAAACAAA
ATACAGGATT TCTTACAAAA GCAAGAATAT AAGACATTGG AATATAACTT AACGACTACA
GAAGTAGTGA TGGAGAATGT AACAGCCTTC TGGGAGGAGG GATTTGGGGA ATTATTTGAG
AAAGCAAAAC AAAACAATAA CAATAGAAAA ACTTCTAATG GTGATGACAG CCTCTTCTTC
AGTAATTTCT CACTTCTTGG TACTCCTGTC CTGAAAGATA TTAATTTCAA GATAGAAAGA
GGACAGTTGT TGGCGGTTGC TGGATCCACT GGAGCAGGCA AGACTTCACT TCTAATGGTG
ATTATGGGAG AACTGGAGCC TTCAGAGGGT AAAATTAAGC ACAGTGGAAG AATTTCATTC
TGTTCTCAGT TTTCCTGGAT TATGCCTGGC ACCATTAAAG AAAATATCAT CTTTGGTGTT
TCCTATGATG AATATAGATA CAGAAGCGTC ATCAAAGCAT GCCAACTAGA AGAGGACATC
TCCAAGTTTG CAGAGAAAGA CAATATAGTT CTTGGAGAAG GTGGAATCAC ACTGAGTGGA
GGTCAACGAG CAAGAATTTC TTTAGCAAGA GCAGTATACA AAGATGCTGA TTTGTATTTA
TTAGACTCTC CTTTTGGATA CCTAGATGTT TTAACAGAAA AAGAAATATT TGAAAGCTGT
GTCTGTAAAC TGATGGCTAA CAAAACTAGG ATTTTGGTCA CTTCTAAAAT GGAACATTTA
AAGAAAGCTG ACAAAATATT AATTTTGCAT GAAGGTAGCA GCTATTTTTA TGGGACATTT
TCAGAACTCC AAAATCTACA GCCAGACTTT AGCTCAAAAC TCATGGGATG TGATTCTTTC
GACCAATTTA GTGCAGAAAG AAGAAATTCA ATCCTAACTG AGACCTTACA CCGTTTCTCA
TTAGAAGGAG ATGCTCCTGT CTCCTGGACA GAAACAAAAA AACAATCTTT TAAACAGACT
GGAGAGTTTG GGGAAAAAAG GAAGAATTCT ATTCTCAATC CAATCAACTC TATACGAAAA
TTTTCCATTG TGCAAAAGAC TCCCTTACAA ATGAATGGCA TCGAAGAGGA TTCTGATGAG
CCTTTAGAGA GAAGGCTGTC CTTAGTACCA GATTCTGAGC AGGGAGAGGC GATACTGCCT
CGCATCAGCG TGATCAGCAC TGGCCCCACG CTTCAGGCAC GAAGGAGGCA GTCTGTCCTG
AACCTGATGA CACACTCAGT TAACCAAGGT CAGAACATTC ACCGAAAGAC AACAGCATCC
ACACGAAAAG TGTCACTGGC CCCTCAGGCA AACTTGACTG AACTGGATAT ATATTCAAGA
AGGTTATCTC AAGAAACTGG CTTGGAAATA AGTGAAGAAA TTAACGAAGA AGACTTAAAG
GAGTGCTTTT TTGATGATAT GGAGAGCATA CCAGCAGTGA CTACATGGAA CACATACCTT
CGATATATTA CTGTCCACAA GAGCTTAATT TTTGTGCTAA TTTGGTGCTT AGTAATTTTT
CTGGCAGAGG TGGCTGCTTC TTTGGTTGTG CTGTGGCTCC TTGGAAACAC TCCTCTTCAA
GACAAAGGGA ATAGTACTCA TAGTAGAAAT AACAGCTATG CAGTGATTAT CACCAGCACC
AGTTCGTATT ATGTGTTTTA CATTTACGTG GGAGTAGCCG ACACTTTGCT TGCTATGGGA
TTCTTCAGAG GTCTACCACT GGTGCATACT CTAATCACAG TGTCGAAAAT TTTACACCAC
AAAATGTTAC ATTCTGTTCT TCAAGCACCT ATGTCAACCC TCAACACGTT GAAAGCAGGT
GGGATTCTTA ATAGATTCTC CAAAGATATA GCAATTTTGG ATGACCTTCT GCCTCTTACC
ATATTTGACT TCATCCAGTT GTTATTAATT GTGATTGGAG CTATAGCAGT TGTCGCAGTT
TTACAACCCT ACATCTTTGT TGCAACAGTG CCAGTGATAG TGGCTTTTAT TATGTTGAGA
GCATATTTCC TCCAAACCTC ACAGCAACTC AAACAACTGG AATCTGAAGG CAGGAGTCCA
ATTTTCACTC ATCTTGTTAC AAGCTTAAAA GGACTATGGA CACTTCGTGC CTTCGGACGG
CAGCCTTACT TTGAAACTCT GTTCCACAAA GCTCTGAATT TACATACTGC CAACTGGTTC
TTGTACCTGT CAACACTGCG CTGGTTCCAA ATGAGAATAG AAATGATTTT TGTCATCTTC
TTCATTGCTG TTACCTTCAT TTCCATTTTA ACAACAGGAG AAGGAGAAGG AAGAGTTGGT
ATTATCCTGA CTTTAGCCAT GAATATCATG AGTACATTGC AGTGGGCTGT AAACTCCAGC
ATAGATGTGG ATAGCTTGAT GCGATCTGTG AGCCGAGTCT TTAAGTTCAT TGACATGCCA
ACAGAAGGTA AACCTACCAA GTCAACCAAA CCATACAAGA ATGGCCAACT CTCGAAAGTT
ATGATTATTG AGAATTCACA CGTGAAGAAA GATGACATCT GGCCCTCAGG GGGCCAAATG
ACTGTCAAAG ATCTCACAGC AAAATACACA GAAGGTGGAA ATGCCATATT AGAGAACATT
TCCTTCTCAA TAAGTCCTGG CCAGAGGGTG GGCCTCTTGG GAAGAACTGG ATCAGGGAAG
AGTACTTTGT TATCAGCTTT TTTGAGACTA CTGAACACTG AAGGAGAAAT CCAGATCGAT
GGTGTGTCTT GGGATTCAAT AACTTTGCAA CAGTGGAGGA AAGCCTTTGG AGTGATACCA
CAGAAAGTAT TTATTTTTTC TGGAACATTT AGAAAAAACT TGGATCCCTA TGAACAGTGG
AGTGATCAAG AAATATGGAA AGTTGCAGAT GAGGTTGGGC TCAGATCTGT GATAGAACAG
TTTCCTGGGA AGCTTGACTT TGTCCTTGTG GATGGGGGCT GTGTCCTAAG CCATGGCCAC
AAGCAGTTGA TGTGCTTGGC TAGATCTGTT CTCAGTAAGG CGAAGATCTT GCTGCTTGAT
GAACCCAGTG CTCATTTGGA TCCAGTAACA TACCAAATAA TTAGAAGAAC TCTAAAACAA
GCATTTGCTG ATTGCACAGT AATTCTCTGT GAACACAGGA TAGAAGCAAT GCTGGAATGC
CAACAATTTT TGCAACTTCA GTTCTACTAA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_011514054.1
CDS43..4392
Misc Feature(1)169..4383(+)
Misc Feature(2)379..1182(+)
Misc Feature(3)1297..2142(+)
Misc Feature(4)1504..1527(+)
Misc Feature(5)1513..1947(+)
Misc Feature(6)1600..1611(+)
Misc Feature(7)1774..1803(+)
Misc Feature(8)1834..1851(+)
Misc Feature(9)1858..1869(+)
Misc Feature(10)1933..1953(+)
Misc Feature(11)2047..2682(+)
Misc Feature(12)2716..3573(+)
Misc Feature(13)3754..>4383(+)
Misc Feature(14)3862..3885(+)
Misc Feature(15)3871..4347(+)
Misc Feature(16)3994..4005(+)
Misc Feature(17)4168..4197(+)
Misc Feature(18)4228..4245(+)
Misc Feature(19)4252..4263(+)
Misc Feature(20)4333..4353(+)
Translation
Position Chain Variation Link
123 123 g, t dbSNP:181008242
140 140 g, t dbSNP:756856572
159 159 c, t dbSNP:370895876
189 189 g, t dbSNP:397508762
192 192 c, t dbSNP:534609552
194 194 g, t dbSNP:777520137
198 198 a, g dbSNP:748899228
204 204 a, c, g dbSNP:55773134
208 208 a, g dbSNP:759726535
211 211 a, c, g, t dbSNP:397508796
212 212 a, g dbSNP:397508797
212 212 -, g dbSNP:397508798
218 218 c, g dbSNP:748005919
220 220 c, t dbSNP:397508815
223 223 a, c, t dbSNP:1800073
224 224 a, g, t dbSNP:149353983
225 225 a, c dbSNP:766315026
226 226 a, c dbSNP:776797377
227 227 c, t dbSNP:397508821
232 232 -, ttgtcagacatataccaa dbSNP:397508141
237 237 -, a dbSNP:397508149
241 241 a, g dbSNP:759721412
243 243 -, at dbSNP:397508162
244 244 -, ta dbSNP:397508164
244 244 a, c, t dbSNP:373112861
245 245 a, g dbSNP:758826243
246 246 c, g dbSNP:193922498
247 247 c, t dbSNP:397508168
249 249 a, c dbSNP:764522674
252 252 c, t dbSNP:376538363
257 257 c, t dbSNP:143456784
259 259 a, c, g dbSNP:370586917
260 260 c, t dbSNP:754657555
263 263 a, g, t dbSNP:1800074
269 269 a, c, t dbSNP:151020603
276 276 g, t dbSNP:771701007
278 278 c, t dbSNP:556662007
279 279 a, c, g dbSNP:140444668
280 280 c, t dbSNP:397508217
281 281 a, c dbSNP:397508220
298 298 a, g dbSNP:397508256
300 300 -, a dbSNP:397508269
301 301 c, g, t dbSNP:397508272
302 302 a, g dbSNP:397508279
303 303 a, g dbSNP:121909025
304 304 a, c, g dbSNP:397508285
305 305 a, g, t dbSNP:397508291
306 306 -, taga dbSNP:397508295
306 306 -, a dbSNP:397508294
310 310 a, g, t dbSNP:77284892
312 312 a, c, g dbSNP:569426839
326 326 a, g dbSNP:769807498
332 332 c, t dbSNP:368505753
334 334 a, g dbSNP:397508332
336 336 a, t dbSNP:397508335
337 337 a, c dbSNP:372421038
345 345 c, t dbSNP:1800075
346 346 a, g dbSNP:774558645
347 347 a, c dbSNP:397508347
349 349 -, c dbSNP:397508348
349 349 c, t dbSNP:762298973
352 352 c, t dbSNP:115545701
353 353 a, g dbSNP:142540482
355 355 c, t dbSNP:121908749
356 356 a, g, t dbSNP:1800076
358 358 c, t dbSNP:757959325
359 359 -, t dbSNP:397508360
360 360 -, t dbSNP:397508362
360 360 g, t dbSNP:777536750
365 365 -, t dbSNP:397508366
365 365 a, t dbSNP:751305135
365 365 -, t dbSNP:397508367
367 367 c, t dbSNP:397508370
368 368 a, g dbSNP:397508371
381 381 c, g dbSNP:780975618
382 382 c, t dbSNP:745756794
383 383 a, g dbSNP:769754499
386 386 a, g, t dbSNP:75961395
388 388 a, g dbSNP:749432776
390 390 a, c dbSNP:374992300
391 391 -, tt dbSNP:754147777
391 391 a, c, t dbSNP:397508403
394 394 -, tt dbSNP:121908769
395 395 -, aa dbSNP:202148006
395 395 a, c, g, t dbSNP:397508412
396 396 a, c dbSNP:149662778
398 398 a, g dbSNP:397508418
401 401 c, t dbSNP:397508421
403 403 a, g dbSNP:121908750
405 405 a, g dbSNP:773739166
406 406 a, g, t dbSNP:121908751
408 408 a, t dbSNP:397508432
411 411 c, t dbSNP:761423802
413 413 c, t dbSNP:767204327
419 419 a, c dbSNP:397508449
424 424 c, t dbSNP:397508461
425 425 a, c, g dbSNP:397508464
428 428 c, t dbSNP:397508467
430 430 c, g dbSNP:375543675
434 434 c, g, t dbSNP:397508484
435 435 -, a dbSNP:397508486
437 437 c, g, t dbSNP:397508490
442 442 -, a dbSNP:397508499
442 442 a, g dbSNP:369715785
444 444 -, a dbSNP:779091180
445 445 -, a dbSNP:121908801
445 445 a, g dbSNP:758675549
446 446 a, t dbSNP:397508509
451 451 -, gcttccta dbSNP:397508516
453 453 g, t dbSNP:778204477
455 455 c, t dbSNP:397508520
457 457 g, tat dbSNP:121908798
457 457 a, t dbSNP:397508522
458 458 -, at dbSNP:397508526
458 458 a, g dbSNP:121909031
459 459 a, t dbSNP:397508528
460 460 c, g, t dbSNP:113993958
460 460 -, g dbSNP:397508530
462 462 a, c dbSNP:397508537
463 463 c, g dbSNP:397508541
464 464 c, t dbSNP:140502196
465 465 a, g dbSNP:776878618
466 466 a, g dbSNP:746344714
467 467 a, g dbSNP:770241677
470 470 a, t dbSNP:397508551
472 472 a, t dbSNP:397508554
475 475 -, gag dbSNP:397508563
476 476 a, t dbSNP:149706251
478 478 a, c, g dbSNP:397508571
479 479 a, c, g dbSNP:761370893
481 481 a, c, g, t dbSNP:77834169
482 482 a, c, g, t dbSNP:78655421
485 485 -, c dbSNP:35871908
487 487 a, g dbSNP:193922518
489 489 -, c dbSNP:397508583
490 490 a, g, t dbSNP:201958172
492 492 a, g dbSNP:1800077
493 493 a, t dbSNP:574654063
496 496 c, t dbSNP:397508592
497 497 a, g dbSNP:377295859
498 498 a, t dbSNP:79660178
502 502 c, g dbSNP:193922519
506 506 c, t dbSNP:141723617
508 508 a, g dbSNP:397508606
509 509 a, g dbSNP:397508609
512 512 g, t dbSNP:397508611
514 514 -, tat dbSNP:193922521
519 519 -, t dbSNP:397508627
520 520 c, g dbSNP:397508632
523 523 c, t dbSNP:780492177
525 525 -, t dbSNP:397508647
526 526 a, g dbSNP:749801869
535 535 a, t dbSNP:771512600
537 537 a, c dbSNP:772733538
541 541 -, ctcc dbSNP:397508671
541 541 -, c dbSNP:397508672
542 542 a, g, t dbSNP:397508674
543 543 -, cta dbSNP:752803445
544 544 -, act dbSNP:397508679
545 545 c, t dbSNP:1800078
546 546 -, cta dbSNP:397508686
547 547 -, ga dbSNP:397508687
548 548 a, g, t dbSNP:76371115
549 549 c, t dbSNP:760281820
550 550 c, t dbSNP:145900055
551 551 c, g, t dbSNP:397508694
552 552 -, a dbSNP:397508698
554 554 a, c dbSNP:397508700
556 556 -, a dbSNP:387906363
561 561 -, t dbSNP:387906364
565 565 c, t dbSNP:749836021
566 566 a, t dbSNP:397508712
569 569 a, g dbSNP:397508713
573 573 c, g dbSNP:759310470
574 574 -, a dbSNP:121908770
575 575 a, c, t dbSNP:35516286
576 576 -, cta dbSNP:397508717
577 577 a, g dbSNP:397508718
578 578 g, t dbSNP:397508719
582 582 a, g dbSNP:752619770
583 583 a, c, t dbSNP:397508720
584 584 a, c dbSNP:764227419
586 586 a, g, t dbSNP:397508721
587 587 g, t dbSNP:397508722
590 590 a, g dbSNP:149197463
591 591 -, aatagctatgtttagttt dbSNP:387906371
593 593 c, t dbSNP:781327181
595 595 c, g dbSNP:397508723
598 598 a, g dbSNP:374689323
601 601 -, t dbSNP:757136340
604 604 a, c, t dbSNP:397508724
605 605 -, t dbSNP:397508726
605 605 a, c, g dbSNP:397508725
607 607 c, t dbSNP:769183771
608 608 a, c, t dbSNP:397508727
612 612 a, t dbSNP:397508728
613 613 a, g, t dbSNP:397508729
614 614 a, c, g dbSNP:397508730
616 616 a, g dbSNP:397508731
621 621 a, g dbSNP:397508733
622 622 a, g dbSNP:200885306
626 626 c, t dbSNP:397508736
626 626 -, t dbSNP:397508737
628 628 a, g dbSNP:397508738
632 632 g, t dbSNP:397508741
636 636 c, t dbSNP:539355562
640 640 a, c, t dbSNP:578029902
641 641 a, g dbSNP:1800079
642 642 a, t dbSNP:780772620
643 643 a, g dbSNP:745468219
646 646 a, c dbSNP:769606990
650 650 -, ataaa dbSNP:397508743
655 655 a, g dbSNP:397508744
658 658 -, a dbSNP:397508745
659 659 c, g dbSNP:762849766
662 662 c, t dbSNP:397508747
663 663 g, t dbSNP:749151514
663 663 -, t dbSNP:121908771
664 664 a, g dbSNP:80282562
665 665 a, g dbSNP:397508748
666 666 a, g dbSNP:770890126
667 667 a, c, t dbSNP:367850319
670 670 c, g dbSNP:374163420
675 675 -, tagt dbSNP:397508750
676 676 a, g dbSNP:1800080
678 678 c, t dbSNP:773374503
679 679 a, c dbSNP:397508751
682 682 -, c dbSNP:397508752
690 690 a, c dbSNP:397508753
693 693 a, c dbSNP:397508754
694 694 a, c dbSNP:368039301
695 695 c, t dbSNP:766640075
699 699 a, c dbSNP:397508755
703 703 g, t dbSNP:141482808
706 706 -, gat dbSNP:397508757
706 706 a, g dbSNP:397508756
707 707 a, g dbSNP:397508758
709 709 a, g, t dbSNP:397508759
710 710 a, g dbSNP:755405930
712 712 a, g dbSNP:376008630
713 713 g, t dbSNP:397508763
714 714 a, g dbSNP:561270322
720 720 a, g dbSNP:749896021
721 721 c, t dbSNP:755619078
724 724 a, c, g dbSNP:193922529
725 725 c, t dbSNP:73215910
727 727 c, t dbSNP:121908802
728 728 a, g dbSNP:397508764
729 729 g, t dbSNP:397508765
730 730 a, t dbSNP:397508766
732 732 a, c dbSNP:753492211
733 733 a, g dbSNP:138338446
733 733 -, g dbSNP:397508767
738 738 a, g dbSNP:397508768
741 741 c, g, t dbSNP:1800081
742 742 a, g dbSNP:748026786
744 744 g, t dbSNP:369247323
745 745 c, t dbSNP:121908803
746 746 c, g, t dbSNP:397508769
749 749 g, t dbSNP:121908752
750 750 g, t dbSNP:397508770
751 751 c, t dbSNP:397508771
755 755 c, t dbSNP:770944337
757 757 g, t dbSNP:397508772
759 759 a, g dbSNP:397508773
760 760 c, t dbSNP:759719664
766 766 a, g dbSNP:540269075
770 770 a, g dbSNP:775701644
771 771 a, g dbSNP:763439293
772 772 c, g, t dbSNP:188457893
774 774 -, t dbSNP:397508774
774 774 a, g dbSNP:762431611
779 779 a, g dbSNP:397508775
780 780 g, t dbSNP:397508776
782 782 a, g dbSNP:121909046
785 785 a, t dbSNP:397508777
790 790 c, t dbSNP:397508778
791 791 a, g dbSNP:397508779
792 792 a, g dbSNP:778686572
794 794 c, t dbSNP:752432390
795 795 a, g dbSNP:758147990
798 798 c, t dbSNP:777446212
802 802 -, t dbSNP:769693190
804 804 c, g dbSNP:746904991
805 805 c, t dbSNP:397508780
807 807 a, t dbSNP:397508781
809 809 a, g dbSNP:770891254
812 812 g, t dbSNP:397508782
816 816 c, t dbSNP:746003305
820 820 c, g dbSNP:201410793
827 827 a, t dbSNP:397508783
829 829 c, g dbSNP:775713428
832 832 g, t dbSNP:763097577
833 833 c, t dbSNP:769016520
836 836 c, t dbSNP:774888069
837 837 g, t dbSNP:762380161
839 839 c, t dbSNP:550709226
841 841 c, g dbSNP:397508784