
ADAMTS13 cDNA ORF clone, Homo sapiens (human)

Gene Symbol ADAMTS13
Entrez Gene ID 11093
Full Name ADAM metallopeptidase with thrombospondin type 1 motif, 13
Synonyms ADAM-TS13, ADAMTS-13, C9orf8, VWFCP, vWF-CP
General protein information
Preferred Names
A disintegrin and metalloproteinase with thrombospondin motifs 13
A disintegrin and metalloproteinase with thrombospondin motifs 13
vWF-cleaving protease
von Willebrand factor-cleaving protease
a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of a family of proteins containing several distinct regions, including a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. The enzyme encoded by this gene specifically cleaves von Willebrand Factor (vWF). Defects in this gene are associated with thrombotic thrombocytopenic purpura. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]. lac of sum
Disorder MIM:


Disorder Html: Thrombotic thrombocytopenic purpura, familial, 274150 (3)

mRNA and Protein(s)

mRNA Protein Name
XM_011518174 XP_011516476 A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X1
XM_011518175 XP_011516477 A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X2
XM_011518176 XP_011516478 A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X3
XM_011518177 XP_011516479 A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X4
XM_011518178 XP_011516480 A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X5
XM_011518179 XP_011516481 A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X6
XM_011518180 XP_011516482 A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X7
XM_011548750 XP_011547052 A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X1
XM_011548751 XP_011547053 A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X2
XM_011548752 XP_011547054 A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X3
XM_011548753 XP_011547055 A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X4
XM_011548754 XP_011547056 A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X5
XM_011548755 XP_011547057 A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X6
XM_011548756 XP_011547058 A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X7
NM_139025 NP_620594 A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform 1 preproprotein
NM_139027 NP_620596 A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform 2 preproprotein
NM_139026 NP_620595 A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform 3 preproprotein

R-HSA-392499 Metabolism of proteins
R-HSA-597592 Post-translational protein modification
R-HSA-5173105 O-linked glycosylation
R-HSA-5173214 O-glycosylation of TSR domain-containing proteins

Homo sapiens (human) ADAMTS13 NP_620594.1
Pan troglodytes (chimpanzee) ADAMTS13 XP_003312433.1
Canis lupus familiaris (dog) ADAMTS13 NP_001229641.1
Bos taurus (cattle) ADAMTS13 XP_002691670.2
Mus musculus (house mouse) Adamts13 NP_001001322.1
Rattus norvegicus (Norway rat) LOC102554393 XP_006233941.1
Gallus gallus (chicken) ADAMTS13 XP_415435.4
Danio rerio (zebrafish) adamts13 XP_002663267.3
Xenopus (Silurana) tropicalis (western clawed frog) adamts13 XP_002942962.2


ID Name Evidence
GO:0005576 extracellular region IEA
GO:0005578 proteinaceous extracellular matrix TAS
GO:0005615 extracellular space IEA
GO:0009986 cell surface NAS


ID Name Evidence
GO:0004222 metalloendopeptidase activity IEA
GO:0005178 integrin binding TAS
GO:0005509 calcium ion binding TAS
GO:0005515 protein binding IPI
GO:0008233 peptidase activity IEA
GO:0008237 metallopeptidase activity TAS
GO:0008270 zinc ion binding TAS


ID Name Evidence
GO:0006508 proteolysis IDA
GO:0007160 cell-matrix adhesion NAS
GO:0007229 integrin-mediated signaling pathway NAS
GO:0009100 glycoprotein metabolic process NAS
GO:0016485 protein processing TAS
GO:0030168 platelet activation NAS
GO:0043171 peptide catabolic process IDA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following ADAMTS13 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the ADAMTS13 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu64700 XM_011518174 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu64701 XM_011518175 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu64702 XM_011518176 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu64703 XM_011518177 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu64704 XM_011518178 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu64705 XM_011518179 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu64706 XM_011518180 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu64700 XM_011548750 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu64701 XM_011548751 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu64702 XM_011548752 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu64703 XM_011548753 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 20 Quote Price
OHu64704 XM_011548754 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu64705 XM_011548755 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu64706 XM_011548756 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu27537 NM_139025 Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu23357 NM_139027 Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu27548 NM_139026 Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu64700
Accession Version XM_011518174.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3894bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008470.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)308..766(+)
Misc Feature(2)587..619(+)
Misc Feature(3)1076..1234(+)
Position Chain Variation Link
8 8 c, t dbSNP:145275561
51 51 a, c dbSNP:782570157
52 52 a, c, t dbSNP:146394542
53 53 a, g, t dbSNP:201522226
55 55 g, t dbSNP:369130757
63 63 a, g dbSNP:373832736
67 67 c, g dbSNP:782217202
85 85 a, g dbSNP:782394264
92 92 c, t dbSNP:139735640
93 93 a, g dbSNP:370929256
95 95 a, c dbSNP:370611753
96 96 c, t dbSNP:782677352
98 98 c, g dbSNP:782680569
102 102 c, t dbSNP:375370257
110 110 c, t dbSNP:782453359
112 112 -, cagagg, cagaggcagagg dbSNP:782306107
113 113 -, cagaggcagagg dbSNP:781853881
113 113 -, cagagg dbSNP:782548827
119 119 c, t dbSNP:782576304
130 130 a, g dbSNP:782220406
141 141 c, g dbSNP:142366230
142 142 c, t dbSNP:143856697
144 144 c, t dbSNP:782302107
148 148 c, t dbSNP:367627378
149 149 a, g dbSNP:587712720
150 150 g, t dbSNP:782188171
155 155 c, t dbSNP:200841843
158 158 c, t dbSNP:148644959
159 159 a, g dbSNP:781958663
164 164 a, g dbSNP:587611213
178 178 c, t dbSNP:782777667
184 184 c, t dbSNP:782035751
187 187 c, t dbSNP:756898709
189 189 a, g dbSNP:782149039
201 201 c, t dbSNP:370263552
203 203 c, g dbSNP:121908467
207 207 a, g dbSNP:781788692
208 208 -, ggaggacacagagcgctatgtgctcacca dbSNP:387906345
214 214 c, g dbSNP:782483941
220 220 -, c dbSNP:782203933
221 221 c, t dbSNP:121908469
222 222 a, g dbSNP:782716712
223 223 c, t dbSNP:781864642
230 230 c, t dbSNP:782488906
234 234 a, c dbSNP:782681039
247 247 c, t dbSNP:142107133
251 251 c, g, t dbSNP:782188741
259 259 a, g dbSNP:782615140
263 263 c, t dbSNP:782209298
264 264 a, g dbSNP:151206890
268 268 c, t dbSNP:781983991
270 270 c, t dbSNP:587698109
271 271 a, g dbSNP:28571612
274 274 c, t dbSNP:147563206
277 277 a, g dbSNP:375151732
290 290 a, c dbSNP:776837883
290 290 a, c, t dbSNP:587701622
291 291 a, g dbSNP:587602236
317 317 c, g dbSNP:147643918
321 321 c, t dbSNP:782814321
323 323 a, g dbSNP:142237685
326 326 c, t dbSNP:782464030
332 332 g, t dbSNP:781882283
335 335 a, g dbSNP:782445469
337 337 c, t dbSNP:3118667
344 344 a, g dbSNP:145175796
346 346 c, t dbSNP:782519773
348 348 c, t dbSNP:782644086
352 352 c, t dbSNP:149175416
363 363 c, t dbSNP:377681196
368 368 c, t dbSNP:781937618
376 376 c, t dbSNP:782180043
377 377 a, g dbSNP:369026148
385 385 g, t dbSNP:781950676
393 393 a, c dbSNP:782127630
396 396 c, t dbSNP:587696077
402 402 a, c dbSNP:782747858
412 412 c, t dbSNP:782026673
413 413 a, g dbSNP:781825239
417 417 c, t dbSNP:141932927
418 418 a, g dbSNP:587636999
437 437 c, t dbSNP:372637811
441 441 c, t dbSNP:782799810
443 443 c, t dbSNP:781854972
447 447 a, g dbSNP:200594025
463 463 c, t dbSNP:148849381
469 469 a, g dbSNP:782652490
476 476 c, g dbSNP:148312697
484 484 c, t dbSNP:782555111
485 485 c, t dbSNP:782650307
486 486 a, g dbSNP:142152759
495 495 g, t dbSNP:782083669
499 499 c, t dbSNP:34054981
500 500 a, g dbSNP:138489501
504 504 c, t dbSNP:121908470
505 505 c, t dbSNP:376549668
508 508 a, g dbSNP:782037445
514 514 c, t dbSNP:201048039
515 515 a, g dbSNP:782328666
517 517 g, t dbSNP:781922767
518 518 a, g dbSNP:782095571
526 526 c, t dbSNP:782718222
530 530 a, c dbSNP:781874381
533 533 c, t dbSNP:782116819
535 535 g, t dbSNP:782804156
538 538 c, g dbSNP:781884793
540 540 c, g dbSNP:782442144
544 544 c, g dbSNP:143035878
547 547 g, t dbSNP:199661242
550 550 c, t dbSNP:782534418
556 556 c, t dbSNP:782439387
560 560 a, g dbSNP:782640617
566 566 a, g dbSNP:782305581
569 569 c, t dbSNP:200017456
584 584 a, g dbSNP:782586734
623 623 a, g dbSNP:781916049
666 666 c, t dbSNP:121908478
677 677 a, g dbSNP:782093693
697 697 c, t dbSNP:782774484
717 717 a, g dbSNP:587623575
720 720 c, g dbSNP:121908477
751 751 g, t dbSNP:587671802
761 761 c, g dbSNP:782674608
774 774 c, t dbSNP:782184693
782 782 c, t dbSNP:782429486
785 785 c, t dbSNP:782613885
787 787 c, t dbSNP:754541465
789 789 c, g dbSNP:782379766
790 790 g, t dbSNP:782036565
791 791 a, t dbSNP:782282073
792 792 a, c dbSNP:782322129
794 794 a, g dbSNP:781919201
804 804 a, c dbSNP:782102945
805 805 a, g dbSNP:372413496
807 807 c, t dbSNP:782001479
808 808 a, g dbSNP:782114348
819 819 c, g dbSNP:782818563
820 820 c, t dbSNP:377143536
826 826 c, t dbSNP:782059317
836 836 a, g dbSNP:150518374
850 850 c, t dbSNP:369514834
853 853 c, t dbSNP:36219562
858 858 c, t dbSNP:782291570
862 862 c, t dbSNP:782640937
865 865 -, c dbSNP:781919209
866 866 c, t dbSNP:781911708
871 871 a, g dbSNP:782542948
878 878 a, c, g dbSNP:782601193
885 885 c, g dbSNP:782360062
886 886 c, t dbSNP:782596096
889 889 c, t dbSNP:782268976
890 890 g, t dbSNP:587667471
907 907 c, t dbSNP:782432260
916 916 a, g dbSNP:757725461
930 930 a, t dbSNP:782616826
933 933 c, g dbSNP:149517360
937 937 c, t dbSNP:144498742
939 939 c, t dbSNP:115943536
940 940 a, g dbSNP:199953481
966 966 g, t dbSNP:587706274
970 970 c, t dbSNP:372461655
971 971 a, c, g dbSNP:377191898
1000 1000 c, t dbSNP:587606690
1001 1001 a, g dbSNP:781924046
1017 1017 c, g dbSNP:782270618
1019 1019 a, g dbSNP:782380073
1021 1021 c, g dbSNP:374597782
1025 1025 c, t dbSNP:145252342
1026 1026 a, g dbSNP:200406381
1031 1031 c, t dbSNP:781914134
1032 1032 a, g dbSNP:782091585
1033 1033 c, t dbSNP:782153255
1040 1040 g, t dbSNP:371969346
1042 1042 a, g dbSNP:782806684
1050 1050 c, g dbSNP:782003178
1054 1054 c, t dbSNP:147607799
1055 1055 a, g dbSNP:782810090
1063 1063 a, c dbSNP:781794348
1067 1067 c, t dbSNP:587613745
1069 1069 c, t dbSNP:140640175
1073 1073 a, c, t dbSNP:142214608
1074 1074 a, g dbSNP:151048660
1077 1077 c, g dbSNP:780251348
1084 1084 c, g dbSNP:782641144
1086 1086 a, g dbSNP:374655146
1091 1091 c, t dbSNP:782530823
1094 1094 c, g dbSNP:782570540
1095 1095 a, g dbSNP:140937290
1099 1099 a, t dbSNP:587750968
1108 1108 c, t dbSNP:782609209
1109 1109 c, t dbSNP:376606652
1110 1110 a, g dbSNP:121908471
1117 1117 c, t dbSNP:142570561
1118 1118 a, g dbSNP:782033728
1125 1125 g, t dbSNP:782072116
1129 1129 a, g, t dbSNP:782314532
1132 1132 c, t dbSNP:145768029
1149 1149 a, g dbSNP:140582930
1163 1163 c, t dbSNP:782657509
1164 1164 a, c dbSNP:369465957
1168 1168 c, t dbSNP:781959119
1171 1171 -, g, ggg dbSNP:781886798
1171 1171 a, t dbSNP:782077607
1177 1177 g, t dbSNP:782768459
1178 1178 c, t dbSNP:145825553
1179 1179 a, c, g dbSNP:782541751
1183 1183 a, c dbSNP:781796744
1184 1184 c, t dbSNP:782492477
1191 1191 a, g, t dbSNP:782602523
1199 1199 c, t dbSNP:782519493
1200 1200 c, t dbSNP:782682017
1206 1206 c, t dbSNP:782278375
1207 1207 c, t dbSNP:138401488
1208 1208 a, g dbSNP:781915989
1210 1210 c, g dbSNP:782224267
1213 1213 a, g dbSNP:141471395
1218 1218 a, g dbSNP:781993871
1225 1225 c, g dbSNP:587642546
1231 1231 c, t dbSNP:781989547
1232 1232 a, g dbSNP:748223519
1244 1244 a, c dbSNP:782174746
1247 1247 g, t dbSNP:587708651
1250 1250 g, t dbSNP:781813768
1252 1252 c, t dbSNP:782055451
1253 1253 a, g dbSNP:782733359
1255 1255 a, g, t dbSNP:781815925
1257 1257 c, t dbSNP:782630536
1258 1258 a, c, g dbSNP:587602874
1259 1259 c, g dbSNP:2301612
1262 1262 c, t dbSNP:121908476
1265 1265 c, t dbSNP:782344627
1267 1267 c, t dbSNP:782645434
1268 1268 a, g dbSNP:375508823
1273 1273 a, g dbSNP:782424568
1276 1276 c, t dbSNP:148365271
1277 1277 a, c, g dbSNP:782076268
1279 1279 c, t dbSNP:782355981
1280 1280 a, c, g dbSNP:587613923
1283 1283 c, g dbSNP:781977102
1285 1285 g, t dbSNP:36220239
1287 1287 c, t dbSNP:36220240
1288 1288 a, g dbSNP:781802178
1292 1292 c, g dbSNP:782433445
1293 1293 a, g, t dbSNP:782733057
1302 1302 c, t dbSNP:782497226
1303 1303 c, t dbSNP:587634841
1304 1304 c, g dbSNP:782279962
1306 1306 c, t dbSNP:138035204
1307 1307 a, g dbSNP:587768675
1309 1309 c, t dbSNP:782239711
1320 1320 a, g dbSNP:782339799
1329 1329 g, t dbSNP:781992856
1340 1340 c, t dbSNP:11575933
1344 1344 a, g dbSNP:782410985
1345 1345 c, t dbSNP:782015114
1351 1351 -, g dbSNP:782472621
1354 1354 a, g dbSNP:372953477
1362 1362 c, t dbSNP:782405037
1365 1365 a, g dbSNP:781946010
1368 1368 a, g dbSNP:28375042
1372 1372 c, t dbSNP:199876716
1373 1373 -, at dbSNP:782242503
1374 1374 g, t dbSNP:782052182
1379 1379 c, t dbSNP:782769100
1380 1380 a, g dbSNP:147201977
1383 1383 c, t dbSNP:782128293
1390 1390 c, t dbSNP:140501683
1394 1394 a, c dbSNP:377220995
1396 1396 c, t dbSNP:376102311
1398 1398 -, tca dbSNP:782437870
1402 1402 c, g dbSNP:782540244
1403 1403 a, g dbSNP:782574335
1408 1408 g, t dbSNP:781786860
1409 1409 c, t dbSNP:201457594
1414 1414 a, g dbSNP:782607445
1416 1416 a, c dbSNP:149706655
1421 1421 g, t dbSNP:782419451
1426 1426 c, t dbSNP:782671668
1427 1427 a, g dbSNP:782200160
1435 1435 a, c dbSNP:782315134
1442 1442 a, g dbSNP:782089166
1448 1448 a, g dbSNP:144618753
1452 1452 a, g dbSNP:782392744
1453 1453 c, g dbSNP:75928689
1457 1457 c, g, t dbSNP:370215524
1458 1458 a, g dbSNP:374465629
1464 1464 a, g dbSNP:781807478
1465 1465 a, c, t dbSNP:587612482
1465 1465 c, t dbSNP:758174895
1466 1466 a, g dbSNP:376459838
1468 1468 a, c, g dbSNP:148472763
1470 1470 a, c dbSNP:781894953
1474 1474 a, g dbSNP:587745572
1488 1488 c, t dbSNP:782454600
1499 1499 a, g dbSNP:121908473
1503 1503 c, g dbSNP:782343737
1518 1518 a, g dbSNP:782003053
1524 1524 g, t dbSNP:782292367
1539 1539 c, t dbSNP:782417749
1540 1540 a, g dbSNP:781937390
1549 1549 g, t dbSNP:142282539
1561 1561 c, t dbSNP:369336602
1567 1567 g, t dbSNP:150203373
1570 1570 c, t dbSNP:146779903
1578 1578 c, t dbSNP:782771879
1579 1579 a, g, t dbSNP:781897271
1589 1589 c, t dbSNP:782055634
1608 1608 a, c dbSNP:140628579
1617 1617 a, c, t dbSNP:782272645
1618 1618 a, g dbSNP:374868673
1623 1623 a, t dbSNP:375509487
1624 1624 a, g dbSNP:144282342
1632 1632 c, t dbSNP:781840717
1633 1633 a, g dbSNP:3124768
1650 1650 c, t dbSNP:782647983
1658 1658 a, g dbSNP:782254257
1659 1659 a, c dbSNP:782427556
1669 1669 c, t dbSNP:782660413
1678 1678 c, t dbSNP:369872722
1684 1684 a, g, t dbSNP:372789831
1700 1700 -, tt dbSNP:387906344
1705 1705 a, g dbSNP:782132022
1714 1714 c, t dbSNP:36221216
1715 1715 a, g dbSNP:782036643
1718 1718 a, g dbSNP:782151601
1721 1721 c, t dbSNP:150234885
1723 1723 c, t dbSNP:781783061
1727 1727 a, g dbSNP:34256013
1729 1729 c, t dbSNP:782726724
1730 1730 a, g, t dbSNP:781872245
1732 1732 g, t dbSNP:375622643
1738 1738 a, g dbSNP:371209152
1741 1741 g, t dbSNP:782450096
1747 1747 c, t dbSNP:36221217
1752 1752 c, t dbSNP:782219285
1758 1758 a, c dbSNP:782396358
1765 1765 c, t dbSNP:781993504
1768 1768 c, g, t dbSNP:371266006
1769 1769 c, g dbSNP:28647808
1773 1773 c, t dbSNP:781947512
1777 1777 c, t dbSNP:751652402
1790 1790 c, t dbSNP:587721043
1791 1791 a, g dbSNP:36090624
1795 1795 c, t dbSNP:781945326
1796 1796 a, g, t dbSNP:60398774
1811 1811 c, g dbSNP:782761353
1816 1816 a, c, t dbSNP:143573766
1817 1817 a, g dbSNP:34569244
1823 1823 c, t dbSNP:201704847
1830 1830 c, t dbSNP:782466560
1832 1832 c, t dbSNP:147166780
1833 1833 a, g, t dbSNP:138699340
1838 1838 a, g dbSNP:782547718
1847 1847 c, t dbSNP:782659882
1848 1848 a, g dbSNP:782184721
1852 1852 a, c dbSNP:141265567
1861 1861 c, t dbSNP:587673448
1875 1875 c, g, t dbSNP:587726180
1886 1886 a, g dbSNP:782470631
1893 1893 a, g dbSNP:150764227
1895 1895 c, t dbSNP:587693885
1896 1896 a, g dbSNP:117943654
1903 1903 c, g dbSNP:199741568
1904 1904 a, g dbSNP:782199892
1906 1906 a, g dbSNP:368018318
1925 1925 c, t dbSNP:139214644
1926 1926 a, g dbSNP:149953167
1937 1937 a, g dbSNP:782028864
1939 1939 c, t dbSNP:782144746
1944 1944 c, t dbSNP:782709302
1948 1948 a, c, t dbSNP:781784468
1951 1951 c, g dbSNP:587765025
1964 1964 c, t dbSNP:781875492
1967 1967 c, t dbSNP:370121816
1976 1976 -, g dbSNP:34245310
1984 1984 a, c, t dbSNP:782806565
1985 1985 a, g dbSNP:374840594
1991 1991 c, t dbSNP:121908475
1992 1992 a, g dbSNP:782214086
2004 2004 c, g, t dbSNP:201605295
2005 2005 a, g dbSNP:782288267
2006 2006 a, c, g dbSNP:367818172
2012 2012 c, t dbSNP:781785491
2018 2018 a, g dbSNP:782177142
2024 2024 c, t dbSNP:146314458
2028 2028 a, g dbSNP:782223605
2032 2032 a, g dbSNP:782400086
2051 2051 c, g dbSNP:781993713
2053 2053 a, c dbSNP:782301837
2072 2072 a, g dbSNP:782421679
2081 2081 c, g dbSNP:781937174
2084 2084 a, c dbSNP:138014548
2090 2090 c, g dbSNP:782354328
2094 2094 a, g dbSNP:372471786
2108 2108 c, t dbSNP:782116595
2112 2112 c, t dbSNP:41314453
2113 2113 a, g dbSNP:781888677
2117 2117 a, c dbSNP:782058485
2128 2128 c, t dbSNP:587731476
2131 2131 c, g dbSNP:781830585
2133 2133 c, t dbSNP:587610691
2134 2134 c, t dbSNP:144178018
2135 2135 a, g dbSNP:36221451
2137 2137 a, t dbSNP:782559298
2144 2144 c, g, t dbSNP:782671915
2157 2157 c, t dbSNP:367887198
2158 2158 g, t dbSNP:782251114
2171 2171 a, g dbSNP:148734700
2176 2176 a, c dbSNP:782037951
2182 2182 c, t dbSNP:372033921
2183 2183 a, g dbSNP:782719456
2185 2185 c, t dbSNP:781923426
2191 2191 g, t dbSNP:587639501
2192 2192 g, t dbSNP:782640568
2195 2195 a, g dbSNP:782729939
2197 2197 c, t dbSNP:3124767
2198 2198 a, g dbSNP:782542048
2204 2204 c, t dbSNP:782807182
2205 2205 a, g, t dbSNP:781804540
2210 2210 c, t dbSNP:782614158
2219 2219 c, t dbSNP:782206311
2220 2220 a, g dbSNP:369510827
2225 2225 a, g dbSNP:374606481
2255 2255 c, t dbSNP:782298936
2259 2259 c, t dbSNP:782406453
2268 2268 a, g dbSNP:377187626
2269 2269 a, g dbSNP:782187097
2275 2275 -, gcag dbSNP:781954210
2278 2278 a, g dbSNP:782365382
2282 2282 a, g dbSNP:781957737
2284 2284 c, g dbSNP:782136497
2293 2293 -, agctgtggcgctggaaacctgcaacc dbSNP:387906342
2301 2301 c, t dbSNP:201607490
2302 2302 a, g dbSNP:782014438
2321 2321 a, c dbSNP:782061756
2327 2327 c, t dbSNP:754909071
2340 2340 a, g dbSNP:782636321
2353 2353 -, c dbSNP:782363784
2355 2355 c, g dbSNP:782279427
2356 2356 c, t dbSNP:782322007
2372 2372 a, g dbSNP:781915055
2373 2373 c, t dbSNP:372962493
2381 2381 a, g dbSNP:782337019
2392 2392 c, t dbSNP:587601722
2402 2402 a, g dbSNP:782110632
2409 2409 a, g dbSNP:782816059
2410 2410 c, t dbSNP:781898935
2411 2411 a, g dbSNP:34104386
2425 2425 c, t dbSNP:36221472
2435 2435 g, t dbSNP:781842149
2437 2437 c, t dbSNP:782466905
2446 2446 a, t dbSNP:782659481
2450 2450 a, g dbSNP:200125026
2461 2461 c, t dbSNP:781855822
2462 2462 a, g dbSNP:140639242
2465 2465 a, g dbSNP:782584684
2469 2469 a, g dbSNP:201106433
2488 2488 a, g dbSNP:587738759
2490 2490 c, g dbSNP:782587447
2491 2491 -, ct dbSNP:782028569
2497 2497 c, t dbSNP:147112200
2499 2499 a, g dbSNP:782362034
2504 2504 a, t dbSNP:782029094
2507 2507 c, t dbSNP:782158020
2517 2517 a, g dbSNP:782335186
2522 2522 a, g dbSNP:781927460
2529 2529 c, t dbSNP:781971794
2532 2532 a, g dbSNP:782082676
2543 2543 -, g dbSNP:782718791
2548 2548 a, g dbSNP:782772606
2568 2568 a, g dbSNP:781844998
2583 2583 c, t dbSNP:377519637
2584 2584 a, g dbSNP:782364269
2586 2586 g, t dbSNP:781809081
2602 2602 c, t dbSNP:370669534
2603 2603 a, g, t dbSNP:147732725
2610 2610 a, c dbSNP:782520598
2616 2616 c, g, t dbSNP:685523
2617 2617 a, c, g dbSNP:782742222
2618 2618 g, t dbSNP:782223061
2625 2625 c, t dbSNP:78977446
2626 2626 a, g dbSNP:782003158
2631 2631 -, c dbSNP:781796310
2632 2632 c, t dbSNP:782111896
2638 2638 c, t dbSNP:587726656
2641 2641 c, t dbSNP:145728650
2642 2642 a, g dbSNP:138742754
2645 2645 c, t dbSNP:781844824
2646 2646 a, g dbSNP:758243645
2649 2649 g, t dbSNP:781896718
2663 2663 c, t dbSNP:374444423
2675 2675 a, g dbSNP:201241072
2681 2681 g, t dbSNP:782189279
2682 2682 c, t dbSNP:587773478
2686 2686 a, c dbSNP:782617353
2690 2690 a, g dbSNP:782263547
2710 2710 a, g dbSNP:782380295
2716 2716 c, t dbSNP:782030553
2721 2721 c, t dbSNP:782154017
2729 2729 a, g dbSNP:782329783
2744 2744 c, t dbSNP:149265456
2745 2745 a, g dbSNP:782160285
2751 2751 a, g, t dbSNP:782770168
2753 2753 g, t dbSNP:782154286
2758 2758 a, g dbSNP:368858347
2760 2760 c, t dbSNP:781805469
2766 2766 c, t dbSNP:372449678
2767 2767 a, g dbSNP:375151860
2768 2768 g, t dbSNP:121908468
2770 2770 c, t dbSNP:781827094
2771 2771 c, t dbSNP:143568784
2778 2778 a, g dbSNP:200273776
2787 2787 a, g dbSNP:781863577
2796 2796 a, c, t dbSNP:368433734
2797 2797 a, g dbSNP:371554437
2798 2798 g, t dbSNP:782453982
2806 2806 c, t dbSNP:148031420
2807 2807 a, g dbSNP:141811556
2808 2808 c, t dbSNP:782502165
2809 2809 c, g dbSNP:782683498
2819 2819 -, agaggggtc dbSNP:781893176
2827 2827 c, t dbSNP:28641026
2831 2831 c, t dbSNP:782315945
2832 2832 a, g dbSNP:139951127
2847 2847 -, gtgccc dbSNP:387906346
2852 2852 c, t dbSNP:782220521
2853 2853 a, g dbSNP:142779872
2859 2859 a, g dbSNP:782009471
2861 2861 a, g dbSNP:36222275
2872 2872 c, t dbSNP:782146228
2874 2874 a, g dbSNP:782020908
2893 2893 c, t dbSNP:587618046
2895 2895 c, t dbSNP:139808736
2897 2897 c, t dbSNP:781842320
2909 2909 c, g dbSNP:782123812
2915 2915 c, t dbSNP:782761491
2916 2916 a, g dbSNP:781905328
2919 2919 c, t dbSNP:782536497
2920 2920 a, g dbSNP:149794949
2926 2926 c, t dbSNP:145835995
2953 2953 a, c dbSNP:781783629
2969 2969 a, g dbSNP:781815720
2970 2970 c, t dbSNP:148560341
2972 2972 a, c dbSNP:587735427
2977 2977 a, c dbSNP:370359180
2978 2978 c, t dbSNP:781908789
2987 2987 g, t dbSNP:121908472
2991 2991 c, t dbSNP:782586641
2992 2992 a, g dbSNP:782185362
2994 2994 c, t dbSNP:782363611
3000 3000 a, g dbSNP:782597967
3014 3014 a, g dbSNP:28503257
3020 3020 c, t dbSNP:782414383
3021 3021 a, g dbSNP:782016923
3024 3024 c, t dbSNP:142607772
3025 3025 a, g dbSNP:34934621
3031 3031 c, t dbSNP:781959371
3044 3044 c, g dbSNP:370081995
3050 3050 a, g dbSNP:782789479
3056 3056 c, g dbSNP:151138896
3058 3058 c, t dbSNP:782167288
3059 3059 a, g dbSNP:782585313
3067 3067 a, g dbSNP:36222579
3069 3069 a, t dbSNP:587681892
3070 3070 c, t dbSNP:782748173
3074 3074 g, t dbSNP:781825145
3075 3075 c, t dbSNP:373530345
3076 3076 a, g dbSNP:200349242
3084 3084 c, g, t dbSNP:376017677
3085 3085 a, g dbSNP:150322366
3088 3088 a, g dbSNP:36222580
3094 3094 a, g dbSNP:782223782
3096 3096 a, g dbSNP:587731517
3098 3098 -, cc dbSNP:782715762
3100 3100 c, t dbSNP:782251596
3101 3101 a, g dbSNP:782421000
3106 3106 -, ca dbSNP:782633692
3113 3113 a, c dbSNP:782025111
3115 3115 -, ct dbSNP:782288601
3123 3123 c, t dbSNP:782071778
3125 3125 a, g dbSNP:782706998
3127 3127 c, t dbSNP:138488999
3128 3128 a, g dbSNP:782090479
3129 3129 a, c dbSNP:782783025
3134 3134 a, t dbSNP:781898659
3135 3135 c, t dbSNP:782531291
3140 3140 c, t dbSNP:782700247
3141 3141 a, g dbSNP:138770906
3154 3154 c, t dbSNP:782478560
3175 3175 c, t dbSNP:200481038
3176 3176 c, t dbSNP:782195157
3184 3184 g, t dbSNP:782307600
3196 3196 -, c dbSNP:782415493
3197 3197 c, t dbSNP:781965782
3198 3198 a, g dbSNP:782080989
3200 3200 c, t dbSNP:782383410
3201 3201 a, g dbSNP:373569027
3203 3203 c, t dbSNP:377572669
3204 3204 a, g dbSNP:61751476
3214 3214 c, t dbSNP:199810396
3217 3217 c, t dbSNP:781942887
3218 3218 a, g dbSNP:781809898
3227 3227 a, g dbSNP:782054636
3233 3233 a, g dbSNP:782755326
3234 3234 c, t dbSNP:370060687
3235 3235 a, g dbSNP:782535994
3237 3237 c, t dbSNP:782630291
3241 3241 a, g dbSNP:781883131
3252 3252 g, t dbSNP:587755238
3262 3262 c, t dbSNP:782563217
3265 3265 a, g dbSNP:146073007
3271 3271 a, g dbSNP:782343769
3274 3274 a, g dbSNP:782647758
3280 3280 a, t dbSNP:371737266
3283 3283 a, g dbSNP:782238280
3285 3285 a, g dbSNP:782311861
3308 3308 g, t dbSNP:782018563
3312 3312 c, g dbSNP:782196406
3317 3317 a, g dbSNP:782311486
3321 3321 c, t dbSNP:762112077
3322 3322 a, c, g dbSNP:148715397
3323 3323 a, c dbSNP:781992360
3328 3328 c, t dbSNP:782164825
3334 3334 g, t dbSNP:782724202
3336 3336 c, t dbSNP:781785040
3337 3337 a, c dbSNP:782482318
3340 3340 c, t dbSNP:200547311
3341 3341 a, g dbSNP:587709422
3344 3344 a, g dbSNP:782504511
3345 3345 a, c dbSNP:782670806
3350 3350 a, g dbSNP:782270256
3355 3355 c, t dbSNP:186236347
3362 3362 c, t dbSNP:141494468
3363 3363 a, g dbSNP:782472825
3368 3368 a, g dbSNP:782226132
3370 3370 a, g dbSNP:782345031
3371 3371 g, t dbSNP:782007879
3373 3373 c, t dbSNP:782251776
3374 3374 a, g dbSNP:150853306
3381 3381 a, c dbSNP:781930177
3383 3383 a, g dbSNP:782044988
3409 3409 c, t dbSNP:782731435
3410 3410 c, t dbSNP:587664518
3411 3411 a, g dbSNP:139286990
3414 3414 a, g dbSNP:782760544
3415 3415 c, t dbSNP:781900705
3418 3418 a, g, t dbSNP:782533352
3426 3426 a, c dbSNP:373910725
3428 3428 c, t dbSNP:148500446
3429 3429 c, t dbSNP:200122302
3430 3430 a, c, g dbSNP:368634068
3434 3434 c, t dbSNP:782511560
3440 3440 c, t dbSNP:782689373
3442 3442 c, t dbSNP:782285009
3443 3443 c, t dbSNP:782300864
3444 3444 a, g dbSNP:782621505
3446 3446 a, c, t dbSNP:782200824
3447 3447 a, g dbSNP:370692680
3453 3453 a, t dbSNP:782166349
3457 3457 c, t dbSNP:147292523
3458 3458 a, g dbSNP:192619276
3459 3459 a, g dbSNP:782053981
3466 3466 a, g dbSNP:782741622
3467 3467 a, g dbSNP:781823708
3476 3476 g, t dbSNP:782128103
3480 3480 a, g dbSNP:782783483
3485 3485 a, c dbSNP:781911555
3496 3496 c, t dbSNP:781812128
3505 3505 a, c dbSNP:782230828
3512 3512 c, t dbSNP:782726688
3516 3516 a, c dbSNP:141056078
3522 3522 a, c dbSNP:782488785
3533 3533 c, t dbSNP:782818582
3534 3534 a, g dbSNP:781885530
3555 3555 a, g dbSNP:121908474
3558 3558 c, t dbSNP:782462227
3567 3567 c, t dbSNP:200847393
3568 3568 c, t dbSNP:782235608
3573 3573 a, g dbSNP:782649881
3580 3580 c, t dbSNP:144916851
3587 3587 a, g dbSNP:782422811
3592 3592 a, g dbSNP:782025363
3594 3594 c, t dbSNP:36222894
3599 3599 c, t dbSNP:148824378
3600 3600 a, g dbSNP:781945456
3601 3601 c, t dbSNP:782126709
3602 3602 a, g dbSNP:587643681
3603 3603 a, t dbSNP:782033398
3612 3612 a, g dbSNP:782143486
3616 3616 c, t dbSNP:782703594
3626 3626 a, g dbSNP:781787130
3630 3630 c, t dbSNP:587697598
3631 3631 -, g dbSNP:782771719
3634 3634 a, g dbSNP:781794202
3638 3638 a, c dbSNP:782458888
3641 3641 a, t dbSNP:782655118
3650 3650 c, t dbSNP:781844916
3652 3652 c, g dbSNP:782546720
3656 3656 c, t dbSNP:142489534
3657 3657 a, g dbSNP:782197792
3663 3663 c, t dbSNP:777593573
3666 3666 g, t dbSNP:782606443
3668 3668 a, c dbSNP:782212785
3673 3673 a, g dbSNP:368262020
3674 3674 a, g dbSNP:781990284
3679 3679 c, t dbSNP:782170295
3686 3686 c, t dbSNP:150961996
3687 3687 -, t dbSNP:387906341
3694 3694 c, t dbSNP:781942882
3695 3695 a, g dbSNP:782059952
3697 3697 c, g dbSNP:782767249
3699 3699 c, t dbSNP:781863146
3712 3712 c, g dbSNP:140876480
3713 3713 a, t dbSNP:782798764
3720 3720 c, t dbSNP:781882928
3721 3721 a, g dbSNP:782450286
3729 3729 c, t dbSNP:782564860
3737 3737 c, t dbSNP:371964138
3738 3738 a, g dbSNP:782467873
3741 3741 a, g dbSNP:782661218
3742 3742 a, c, t dbSNP:782463983
3743 3743 a, g dbSNP:144808448
3745 3745 a, g dbSNP:138659427
3746 3746 a, c, t dbSNP:140450669
3747 3747 a, c, g dbSNP:782090689
3760 3760 c, g dbSNP:782028925
3763 3763 a, g dbSNP:36222899
3770 3770 c, t dbSNP:370157837
3771 3771 a, c, g dbSNP:781918148
3773 3773 a, t dbSNP:782729077
3780 3780 a, g dbSNP:373393360
3806 3806 a, g dbSNP:782513398
3819 3819 c, t dbSNP:368010021
3825 3825 c, t dbSNP:782386775
3847 3847 c, t dbSNP:782207691
3848 3848 a, g dbSNP:782025840
3856 3856 c, t dbSNP:371841724
3859 3859 a, g dbSNP:782408438
3871 3871 c, g dbSNP:781935926
3873 3873 c, t dbSNP:375824927
3874 3874 a, g dbSNP:369087803
3879 3879 a, g, t dbSNP:200645384
3880 3880 c, t dbSNP:377265919
3881 3881 a, g dbSNP:369447661
3885 3885 c, g dbSNP:781880041
3887 3887 a, g dbSNP:768168577
3893 3893 c, t dbSNP:587618950
3893 3893 c, t dbSNP:774722082
3894 3894 a, g dbSNP:782693351
3905 3905 a, g dbSNP:781834668
3907 3907 c, t dbSNP:782477635
3912 3912 c, t dbSNP:782641810
3914 3914 c, t dbSNP:781854383
3915 3915 c, t dbSNP:782554524
3916 3916 a, g dbSNP:782669437
3919 3919 c, t dbSNP:782202074
3920 3920 a, g dbSNP:374154360
3924 3924 a, g dbSNP:782213090
3927 3927 g, t dbSNP:201841682
3929 3929 a, g dbSNP:782401854
3934 3934 c, t dbSNP:377686931
3942 3942 c, t dbSNP:782139077
3953 3953 a, g dbSNP:149354083
3955 3955 g, t dbSNP:144662080
3958 3958 c, t dbSNP:782321856
3959 3959 a, g dbSNP:587682066
3960 3960 c, t dbSNP:782097021
3967 3967 c, t dbSNP:587756604
3971 3971 a, g dbSNP:781870882
3977 3977 a, g dbSNP:782109481
3980 3980 a, g dbSNP:199856010
3982 3982 a, c dbSNP:138416072
3995 3995 a, g dbSNP:372967395
3999 3999 a, g dbSNP:782261759
4021 4021 c, g, t dbSNP:199775013
4026 4026 c, t dbSNP:782145338
4027 4027 a, g dbSNP:782708034
4031 4031 c, t dbSNP:781921050
4032 4032 a, t dbSNP:201687626
4046 4046 c, g dbSNP:782735074
4050 4050 a, c dbSNP:781880610
4051 4051 c, t dbSNP:751466560
4059 4059 -, a dbSNP:781855393
4059 4059 c, g dbSNP:782820940
4060 4060 -, a dbSNP:387906343
4072 4072 a, g dbSNP:781800177
4084 4084 g, t dbSNP:782443626
4091 4091 a, g dbSNP:782604159
4093 4093 a, g dbSNP:782213683
4105 4105 g, t dbSNP:782518928
4107 4107 -, c dbSNP:35876612
4107 4107 c, g dbSNP:587750566
4114 4114 c, t dbSNP:201166759
4122 4122 a, g dbSNP:782297535
4129 4129 a, g dbSNP:376932692
4135 4135 a, g dbSNP:781941841
4138 4138 a, c, t dbSNP:1055432
4142 4142 c, t dbSNP:781956159
4144 4144 a, g dbSNP:782139922
4145 4145 a, t dbSNP:370267598
4156 4156 a, g dbSNP:587765258
4158 4158 a, g dbSNP:782044465
4167 4167 -, a dbSNP:782551802
4174 4174 a, g dbSNP:782061067
4187 4187 a, g dbSNP:782684106
4197 4197 c, t dbSNP:781834087
4200 4200 a, g dbSNP:782460891
4206 4206 c, t dbSNP:782789529
4207 4207 a, g dbSNP:781851634
4222 4222 c, t dbSNP:375554257
4223 4223 a, c, g dbSNP:377151755
4229 4229 a, g dbSNP:782451905
4242 4242 a, g dbSNP:369498637
4260 4260 -, ag dbSNP:782656133
4271 4271 a, g dbSNP:782214749
4278 4278 c, t dbSNP:180910039
4281 4281 c, t dbSNP:587597243
4318 4318 a, g dbSNP:782302228
4337 4337 a, g dbSNP:782411652
4338 4338 c, t dbSNP:36223202
4369 4369 c, t dbSNP:142792179
4374 4374 c, t dbSNP:368574327
4386 4386 a, g dbSNP:587600594

Target ORF information:

RefSeq Version XM_011518174
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu64701
Accession Version XM_011518175.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3594bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008470.20) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)1463..2074(+)
Misc Feature(2)1895..1927(+)
Misc Feature(3)2384..2542(+)
Position Chain Variation Link
10 10 a, t dbSNP:782648444
38 38 a, c dbSNP:36218236
59 59 a, g dbSNP:767510548
114 114 a, g dbSNP:782090120
148 148 a, g dbSNP:782756873
182 182 c, g dbSNP:782012158
191 191 a, c dbSNP:145664073
225 225 c, t dbSNP:781847132
235 235 -, a dbSNP:587610698
286 286 g, t dbSNP:750520194
303 303 c, g dbSNP:587756844
383 383 a, g dbSNP:186407464
386 386 c, t dbSNP:148897705
428 428 g, t dbSNP:375814137
446 446 c, g dbSNP:587612486
451 451 a, g dbSNP:77533110
468 468 -, agg dbSNP:782503636
515 515 c, g dbSNP:587722424
537 537 c, g, t dbSNP:190858293
543 543 a, g dbSNP:34785487
554 554 a, g dbSNP:117446670
585 585 a, g dbSNP:752590894
612 612 c, t dbSNP:781940384
619 619 a, g dbSNP:373574095
687 687 c, t dbSNP:587620710
692 692 a, g dbSNP:36218238
716 716 a, g dbSNP:587764211
733 733 a, g dbSNP:587637739
761 761 a, g dbSNP:587713277
805 805 c, t dbSNP:782438988
815 815 c, t dbSNP:782583225
832 832 a, c dbSNP:782336591
867 867 c, g dbSNP:782213648
869 869 c, t dbSNP:34265876
880 880 a, g dbSNP:782661656
946 946 a, g dbSNP:777585429
955 955 c, t dbSNP:587625933
1056 1056 c, t dbSNP:112367941
1057 1057 a, g dbSNP:587757210
1058 1058 c, t dbSNP:36218240
1071 1071 c, t dbSNP:587712950
1137 1137 c, t dbSNP:782434247
1174 1174 c, g dbSNP:587771364
1176 1176 c, t dbSNP:782752692
1180 1180 c, g dbSNP:587642688
1182 1182 c, t dbSNP:375938330
1195 1195 c, t dbSNP:201526748
1200 1200 c, t dbSNP:372036592
1202 1202 c, t dbSNP:374861060
1204 1204 c, t dbSNP:782561704
1207 1207 c, t dbSNP:782227169
1208 1208 a, c, g dbSNP:782338252
1215 1215 a, c dbSNP:782244801
1217 1217 c, t dbSNP:782417016
1229 1229 c, t dbSNP:782013900
1231 1231 c, t dbSNP:782193624
1232 1232 a, c dbSNP:782300973
1235 1235 c, t dbSNP:782204201
1236 1236 a, g dbSNP:370406676
1240 1240 c, g, t dbSNP:77985067
1241 1241 c, t dbSNP:375023076
1242 1242 c, g dbSNP:782717483
1244 1244 c, g, t dbSNP:34024143
1245 1245 a, g dbSNP:782744929
1252 1252 a, g dbSNP:782112627
1258 1258 -, cc dbSNP:782769020
1258 1258 g, t dbSNP:781869468
1261 1261 c, t dbSNP:782511371
1265 1265 -, tgtg dbSNP:781957622
1266 1266 c, g dbSNP:782679501
1273 1273 c, t dbSNP:782274726
1277 1277 a, g dbSNP:138886920
1280 1280 c, t dbSNP:782561010
1283 1283 a, g dbSNP:142293909
1297 1297 c, t dbSNP:782392800
1312 1312 a, g dbSNP:781994399
1315 1315 c, t dbSNP:368237030
1317 1317 c, t dbSNP:782296373
1323 1323 -, tc dbSNP:782134844
1359 1359 a, c dbSNP:782570157
1360 1360 a, c, t dbSNP:146394542
1361 1361 a, g, t dbSNP:201522226
1363 1363 g, t dbSNP:369130757
1371 1371 a, g dbSNP:373832736
1375 1375 c, g dbSNP:782217202
1393 1393 a, g dbSNP:782394264
1400 1400 c, t dbSNP:139735640
1401 1401 a, g dbSNP:370929256
1403 1403 a, c dbSNP:370611753
1404 1404 c, t dbSNP:782677352
1406 1406 c, g dbSNP:782680569
1410 1410 c, t dbSNP:375370257
1418 1418 c, t dbSNP:782453359
1420 1420 -, cagagg, cagaggcagagg dbSNP:782306107
1421 1421 -, cagaggcagagg dbSNP:781853881
1421 1421 -, cagagg dbSNP:782548827
1427 1427 c, t dbSNP:782576304
1438 1438 a, g dbSNP:782220406
1449 1449 c, g dbSNP:142366230
1450 1450 c, t dbSNP:143856697
1452 1452 c, t dbSNP:782302107
1456 1456 c, t dbSNP:367627378
1457 1457 a, g dbSNP:587712720
1458 1458 g, t dbSNP:782188171
1463 1463 c, t dbSNP:200841843
1466 1466 c, t dbSNP:148644959
1467 1467 a, g dbSNP:781958663
1472 1472 a, g dbSNP:587611213
1486 1486 c, t dbSNP:782777667
1492 1492 c, t dbSNP:782035751
1495 1495 c, t dbSNP:756898709
1497 1497 a, g dbSNP:782149039
1509 1509 c, t dbSNP:370263552
1511 1511 c, g dbSNP:121908467
1515 1515 a, g dbSNP:781788692
1516 1516 -, ggaggacacagagcgctatgtgctcacca dbSNP:387906345
1522 1522 c, g dbSNP:782483941
1528 1528 -, c dbSNP:782203933
1529 1529 c, t dbSNP:121908469
1530 1530 a, g dbSNP:782716712
1531 1531 c, t dbSNP:781864642
1538 1538 c, t dbSNP:782488906
1542 1542 a, c dbSNP:782681039
1555 1555 c, t dbSNP:142107133
1559 1559 c, g, t dbSNP:782188741
1567 1567 a, g dbSNP:782615140
1571 1571 c, t dbSNP:782209298
1572 1572 a, g dbSNP:151206890
1576 1576 c, t dbSNP:781983991
1578 1578 c, t dbSNP:587698109
1579 1579 a, g dbSNP:28571612
1582 1582 c, t dbSNP:147563206
1585 1585 a, g dbSNP:375151732
1598 1598 a, c dbSNP:776837883
1598 1598 a, c, t dbSNP:587701622
1599 1599 a, g dbSNP:587602236
1625 1625 c, g dbSNP:147643918
1629 1629 c, t dbSNP:782814321
1631 1631 a, g dbSNP:142237685
1634 1634 c, t dbSNP:782464030
1640 1640 g, t dbSNP:781882283
1643 1643 a, g dbSNP:782445469
1645 1645 c, t dbSNP:3118667
1652 1652 a, g dbSNP:145175796
1654 1654 c, t dbSNP:782519773
1656 1656 c, t dbSNP:782644086
1660 1660 c, t dbSNP:149175416
1671 1671 c, t dbSNP:377681196
1676 1676 c, t dbSNP:781937618
1684 1684 c, t dbSNP:782180043
1685 1685 a, g dbSNP:369026148
1693 1693 g, t dbSNP:781950676
1701 1701 a, c dbSNP:782127630
1704 1704 c, t dbSNP:587696077
1710 1710 a, c dbSNP:782747858
1720 1720 c, t dbSNP:782026673
1721 1721 a, g dbSNP:781825239
1725 1725 c, t dbSNP:141932927
1726 1726 a, g dbSNP:587636999
1745 1745 c, t dbSNP:372637811
1749 1749 c, t dbSNP:782799810
1751 1751 c, t dbSNP:781854972
1755 1755 a, g dbSNP:200594025
1771 1771 c, t dbSNP:148849381
1777 1777 a, g dbSNP:782652490
1784 1784 c, g dbSNP:148312697
1792 1792 c, t dbSNP:782555111
1793 1793 c, t dbSNP:782650307
1794 1794 a, g dbSNP:142152759
1803 1803 g, t dbSNP:782083669
1807 1807 c, t dbSNP:34054981
1808 1808 a, g dbSNP:138489501
1812 1812 c, t dbSNP:121908470
1813 1813 c, t dbSNP:376549668
1816 1816 a, g dbSNP:782037445
1822 1822 c, t dbSNP:201048039
1823 1823 a, g dbSNP:782328666
1825 1825 g, t dbSNP:781922767
1826 1826 a, g dbSNP:782095571
1834 1834 c, t dbSNP:782718222
1838 1838 a, c dbSNP:781874381
1841 1841 c, t dbSNP:782116819
1843 1843 g, t dbSNP:782804156
1846 1846 c, g dbSNP:781884793
1848 1848 c, g dbSNP:782442144
1852 1852 c, g dbSNP:143035878
1855 1855 g, t dbSNP:199661242
1858 1858 c, t dbSNP:782534418
1864 1864 c, t dbSNP:782439387
1868 1868 a, g dbSNP:782640617
1874 1874 a, g dbSNP:782305581
1877 1877 c, t dbSNP:200017456
1892 1892 a, g dbSNP:782586734
1931 1931 a, g dbSNP:781916049
1974 1974 c, t dbSNP:121908478
1985 1985 a, g dbSNP:782093693
2005 2005 c, t dbSNP:782774484
2025 2025 a, g dbSNP:587623575
2028 2028 c, g dbSNP:121908477
2059 2059 g, t dbSNP:587671802
2069 2069 c, g dbSNP:782674608
2082 2082 c, t dbSNP:782184693
2090 2090 c, t dbSNP:782429486
2093 2093 c, t dbSNP:782613885
2095 2095 c, t dbSNP:754541465
2097 2097 c, g dbSNP:782379766
2098 2098 g, t dbSNP:782036565
2099 2099 a, t dbSNP:782282073
2100 2100 a, c dbSNP:782322129
2102 2102 a, g dbSNP:781919201
2112 2112 a, c dbSNP:782102945
2113 2113 a, g dbSNP:372413496
2115 2115 c, t dbSNP:782001479
2116 2116 a, g dbSNP:782114348
2127 2127 c, g dbSNP:782818563
2128 2128 c, t dbSNP:377143536
2134 2134 c, t dbSNP:782059317
2144 2144 a, g dbSNP:150518374
2158 2158 c, t dbSNP:369514834
2161 2161 c, t dbSNP:36219562
2166 2166 c, t dbSNP:782291570
2170 2170 c, t dbSNP:782640937
2173 2173 -, c dbSNP:781919209
2174 2174 c, t dbSNP:781911708
2179 2179 a, g dbSNP:782542948
2186 2186 a, c, g dbSNP:782601193
2193 2193 c, g dbSNP:782360062
2194 2194 c, t dbSNP:782596096
2197 2197 c, t dbSNP:782268976
2198 2198 g, t dbSNP:587667471
2215 2215 c, t dbSNP:782432260
2224 2224 a, g dbSNP:757725461
2238 2238 a, t dbSNP:782616826
2241 2241 c, g dbSNP:149517360
2245 2245 c, t dbSNP:144498742
2247 2247 c, t dbSNP:115943536
2248 2248 a, g dbSNP:199953481
2274 2274 g, t dbSNP:587706274
2278 2278 c, t dbSNP:372461655
2279 2279 a, c, g dbSNP:377191898
2308 2308 c, t dbSNP:587606690
2309 2309 a, g dbSNP:781924046
2325 2325 c, g dbSNP:782270618
2327 2327 a, g dbSNP:782380073
2329 2329 c, g dbSNP:374597782
2333 2333 c, t dbSNP:145252342
2334 2334 a, g dbSNP:200406381
2339 2339 c, t dbSNP:781914134
2340 2340 a, g dbSNP:782091585
2341 2341 c, t dbSNP:782153255
2348 2348 g, t dbSNP:371969346
2350 2350 a, g dbSNP:782806684
2358 2358 c, g dbSNP:782003178
2362 2362 c, t dbSNP:147607799
2363 2363 a, g dbSNP:782810090
2371 2371 a, c dbSNP:781794348
2375 2375 c, t dbSNP:587613745
2377 2377 c, t dbSNP:140640175
2381 2381 a, c, t dbSNP:142214608
2382 2382 a, g dbSNP:151048660
2385 2385 c, g dbSNP:780251348
2392 2392 c, g dbSNP:782641144
2394 2394 a, g dbSNP:374655146
2399 2399 c, t dbSNP:782530823
2402 2402 c, g dbSNP:782570540
2403 2403 a, g dbSNP:140937290
2407 2407 a, t dbSNP:587750968
2416 2416 c, t dbSNP:782609209
2417 2417 c, t dbSNP:376606652
2418 2418 a, g dbSNP:121908471
2425 2425 c, t dbSNP:142570561
2426 2426 a, g dbSNP:782033728
2433 2433 g, t dbSNP:782072116
2437 2437 a, g, t dbSNP:782314532
2440 2440 c, t dbSNP:145768029
2457 2457 a, g dbSNP:140582930
2471 2471 c, t dbSNP:782657509
2472 2472 a, c dbSNP:369465957
2476 2476 c, t dbSNP:781959119
2479 2479 -, g, ggg dbSNP:781886798
2479 2479 a, t dbSNP:782077607
2485 2485 g, t dbSNP:782768459
2486 2486 c, t dbSNP:145825553
2487 2487 a, c, g dbSNP:782541751
2491 2491 a, c dbSNP:781796744
2492 2492 c, t dbSNP:782492477
2499 2499 a, g, t dbSNP:782602523
2507 2507 c, t dbSNP:782519493
2508 2508 c, t dbSNP:782682017
2514 2514 c, t dbSNP:782278375
2515 2515 c, t dbSNP:138401488
2516 2516 a, g dbSNP:781915989
2518 2518 c, g dbSNP:782224267
2521 2521 a, g dbSNP:141471395
2526 2526 a, g dbSNP:781993871
2533 2533 c, g dbSNP:587642546
2539 2539 c, t dbSNP:781989547
2540 2540 a, g dbSNP:748223519
2552 2552 a, c dbSNP:782174746
2555 2555 g, t dbSNP:587708651
2558 2558 g, t dbSNP:781813768
2560 2560 c, t dbSNP:782055451
2561 2561 a, g dbSNP:782733359
2563 2563 a, g, t dbSNP:781815925
2565 2565 c, t dbSNP:782630536
2566 2566 a, c, g dbSNP:587602874
2567 2567 c, g dbSNP:2301612
2570 2570 c, t dbSNP:121908476
2573 2573 c, t dbSNP:782344627
2575 2575 c, t dbSNP:782645434
2576 2576 a, g dbSNP:375508823
2581 2581 a, g dbSNP:782424568
2584 2584 c, t dbSNP:148365271
2585 2585 a, c, g dbSNP:782076268
2587 2587 c, t dbSNP:782355981
2588 2588 a, c, g dbSNP:587613923
2591 2591 c, g dbSNP:781977102
2593 2593 g, t dbSNP:36220239
2595 2595 c, t dbSNP:36220240
2596 2596 a, g dbSNP:781802178
2600 2600 c, g dbSNP:782433445
2601 2601 a, g, t dbSNP:782733057
2610 2610 c, t dbSNP:782497226
2611 2611 c, t dbSNP:587634841
2612 2612 c, g dbSNP:782279962
2614 2614 c, t dbSNP:138035204
2615 2615 a, g dbSNP:587768675
2617 2617 c, t dbSNP:782239711
2628 2628 a, g dbSNP:782339799
2637 2637 g, t dbSNP:781992856
2648 2648 c, t dbSNP:11575933
2652 2652 a, g dbSNP:782410985
2653 2653 c, t dbSNP:782015114
2659 2659 -, g dbSNP:782472621
2662 2662 a, g dbSNP:372953477
2670 2670 c, t dbSNP:782405037
2673 2673 a, g dbSNP:781946010
2676 2676 a, g dbSNP:28375042
2680 2680 c, t dbSNP:199876716
2681 2681 -, at dbSNP:782242503
2682 2682 g, t dbSNP:782052182
2687 2687 c, t dbSNP:782769100
2688 2688 a, g dbSNP:147201977
2691 2691 c, t dbSNP:782128293
2698 2698 c, t dbSNP:140501683
2702 2702 a, c dbSNP:377220995
2704 2704 c, t dbSNP:376102311
2706 2706 -, tca dbSNP:782437870
2710 2710 c, g dbSNP:782540244
2711 2711 a, g dbSNP:782574335
2716 2716 g, t dbSNP:781786860
2717 2717 c, t dbSNP:201457594
2722 2722 a, g dbSNP:782607445
2724 2724 a, c dbSNP:149706655
2729 2729 g, t dbSNP:782419451
2734 2734 c, t dbSNP:782671668
2735 2735 a, g dbSNP:782200160
2743 2743 a, c dbSNP:782315134
2750 2750 a, g dbSNP:782089166
2756 2756 a, g dbSNP:144618753
2760 2760 a, g dbSNP:782392744
2761 2761 c, g dbSNP:75928689
2765 2765 c, g, t dbSNP:370215524
2766 2766 a, g dbSNP:374465629
2772 2772 a, g dbSNP:781807478
2773 2773 a, c, t dbSNP:587612482
2773 2773 c, t dbSNP:758174895
2774 2774 a, g dbSNP:376459838
2776 2776 a, c, g dbSNP:148472763
2778 2778 a, c dbSNP:781894953
2782 2782 a, g dbSNP:587745572
2796 2796 c, t dbSNP:782454600
2807 2807 a, g dbSNP:121908473
2811 2811 c, g dbSNP:782343737
2826 2826 a, g dbSNP:782003053
2832 2832 g, t dbSNP:782292367
2847 2847 c, t dbSNP:782417749
2848 2848 a, g dbSNP:781937390
2857 2857 g, t dbSNP:142282539
2869 2869 c, t dbSNP:369336602
2875 2875 g, t dbSNP:150203373
2878 2878 c, t dbSNP:146779903
2886 2886 c, t dbSNP:782771879
2887 2887 a, g, t dbSNP:781897271
2897 2897 c, t dbSNP:782055634
2916 2916 a, c dbSNP:140628579
2925 2925 a, c, t dbSNP:782272645
2926 2926 a, g dbSNP:374868673
2931 2931 a, t dbSNP:375509487
2932 2932 a, g dbSNP:144282342
2940 2940 c, t dbSNP:781840717
2941 2941 a, g dbSNP:3124768
2958 2958 c, t dbSNP:782647983
2966 2966 a, g dbSNP:782254257
2967 2967 a, c dbSNP:782427556
2977 2977 c, t dbSNP:782660413
2986 2986 c, t dbSNP:369872722
2992 2992 a, g, t dbSNP:372789831
3008 3008 -, tt dbSNP:387906344
3013 3013 a, g dbSNP:782132022
3022 3022 c, t dbSNP:36221216
3023 3023 a, g dbSNP:782036643
3026 3026 a, g dbSNP:782151601
3029 3029 c, t dbSNP:150234885
3031 3031 c, t dbSNP:781783061
3035 3035 a, g dbSNP:34256013
3037 3037 c, t dbSNP:782726724
3038 3038 a, g, t dbSNP:781872245
3040 3040 g, t dbSNP:375622643
3046 3046 a, g dbSNP:371209152
3049 3049 g, t dbSNP:782450096
3055 3055 c, t dbSNP:36221217
3060 3060 c, t dbSNP:782219285
3066 3066 a, c dbSNP:782396358
3073 3073 c, t dbSNP:781993504
3076 3076 c, g, t dbSNP:371266006
3077 3077 c, g dbSNP:28647808
3081 3081 c, t dbSNP:781947512
3085 3085 c, t dbSNP:751652402
3098 3098 c, t dbSNP:587721043
3099 3099 a, g dbSNP:36090624
3103 3103 c, t dbSNP:781945326
3104 3104 a, g, t dbSNP:60398774
3119 3119 c, g dbSNP:782761353
3124 3124 a, c, t dbSNP:143573766
3125 3125 a, g dbSNP:34569244
3131 3131 c, t dbSNP:201704847
3138 3138 c, t dbSNP:782466560
3140 3140 c, t dbSNP:147166780
3141 3141 a, g, t dbSNP:138699340
3146 3146 a, g dbSNP:782547718
3155 3155 c, t dbSNP:782659882
3156 3156 a, g dbSNP:782184721
3160 3160 a, c dbSNP:141265567
3169 3169 c, t dbSNP:587673448
3183 3183 c, g, t dbSNP:587726180
3194 3194 a, g dbSNP:782470631
3201 3201 a, g dbSNP:150764227
3203 3203 c, t dbSNP:587693885
3204 3204 a, g dbSNP:117943654
3211 3211 c, g dbSNP:199741568
3212 3212 a, g dbSNP:782199892
3214 3214 a, g dbSNP:368018318
3233 3233 c, t dbSNP:139214644
3234 3234 a, g dbSNP:149953167
3245 3245 a, g dbSNP:782028864
3247 3247 c, t dbSNP:782144746
3252 3252 c, t dbSNP:782709302
3256 3256 a, c, t dbSNP:781784468
3259 3259 c, g dbSNP:587765025
3272 3272 c, t dbSNP:781875492
3275 3275 c, t dbSNP:370121816
3284 3284 -, g dbSNP:34245310
3292 3292 a, c, t dbSNP:782806565
3293 3293 a, g dbSNP:374840594
3299 3299 c, t dbSNP:121908475
3300 3300 a, g dbSNP:782214086
3312 3312 c, g, t dbSNP:201605295
3313 3313 a, g dbSNP:782288267
3314 3314 a, c, g dbSNP:367818172
3320 3320 c, t dbSNP:781785491
3326 3326 a, g dbSNP:782177142
3332 3332 c, t dbSNP:146314458
3336 3336 a, g dbSNP:782223605
3340 3340 a, g dbSNP:782400086
3359 3359 c, g dbSNP:781993713
3361 3361 a, c dbSNP:782301837
3380 3380 a, g dbSNP:782421679
3389 3389 c, g dbSNP:781937174
3392 3392 a, c dbSNP:138014548
3398 3398 c, g dbSNP:782354328
3402 3402 a, g dbSNP:372471786
3416 3416 c, t dbSNP:782116595
3420 3420 c, t dbSNP:41314453
3421 3421 a, g dbSNP:781888677
3425 3425 a, c dbSNP:782058485
3436 3436 c, t dbSNP:587731476
3439 3439 c, g dbSNP:781830585
3441 3441 c, t dbSNP:587610691
3442 3442 c, t dbSNP:144178018
3443 3443 a, g dbSNP:36221451
3445 3445 a, t dbSNP:782559298
3452 3452 c, g, t dbSNP:782671915
3465 3465 c, t dbSNP:367887198
3466 3466 g, t dbSNP:782251114
3479 3479 a, g dbSNP:148734700
3484 3484 a, c dbSNP:782037951
3490 3490 c, t dbSNP:372033921
3491 3491 a, g dbSNP:782719456
3493 3493 c, t dbSNP:781923426
3499 3499 g, t dbSNP:587639501
3500 3500 g, t dbSNP:782640568
3503 3503 a, g dbSNP:782729939
3505 3505 c, t dbSNP:3124767
3506 3506 a, g dbSNP:782542048
3512 3512 c, t dbSNP:782807182
3513 3513 a, g, t dbSNP:781804540
3518 3518 c, t dbSNP:782614158
3527 3527 c, t dbSNP:782206311
3528 3528 a, g dbSNP:369510827
3533 3533 a, g dbSNP:374606481
3563 3563 c, t dbSNP:782298936
3567 3567 c, t dbSNP:782406453
3576 3576 a, g dbSNP:377187626
3577 3577 a, g dbSNP:782187097
3583 3583 -, gcag dbSNP:781954210
3586 3586 a, g dbSNP:782365382
3590 3590 a, g dbSNP:781957737
3592 3592 c, g dbSNP:782136497
3601 3601 -, agctgtggcgctggaaacctgcaacc dbSNP:387906342
3609 3609 c, t dbSNP:201607490
3610 3610 a, g dbSNP:782014438
3629 3629 a, c dbSNP:782061756
3635 3635 c, t dbSNP:754909071
3648 3648 a, g dbSNP:782636321
3661 3661 -, c dbSNP:782363784
3663 3663 c, g dbSNP:782279427
3664 3664 c, t dbSNP:782322007
3680 3680 a, g dbSNP:781915055
3681 3681 c, t dbSNP:372962493
3689 3689 a, g dbSNP:782337019
3700 3700 c, t dbSNP:587601722
3710 3710 a, g dbSNP:782110632
3717 3717 a, g dbSNP:782816059
3718 3718 c, t dbSNP:781898935
3719 3719 a, g dbSNP:34104386
3733 3733 c, t dbSNP:36221472
3743 3743 g, t dbSNP:781842149
3745 3745 c, t dbSNP:782466905
3754 3754 a, t dbSNP:782659481
3758 3758 a, g dbSNP:200125026
3769 3769 c, t dbSNP:781855822
3770 3770 a, g dbSNP:140639242
3773 3773 a, g dbSNP:782584684
3777 3777 a, g dbSNP:201106433
3796 3796 a, g dbSNP:587738759
3798 3798 c, g dbSNP:782587447
3799 3799 -, ct dbSNP:782028569
3805 3805 c, t dbSNP:147112200
3807 3807 a, g dbSNP:782362034
3812 3812 a, t dbSNP:782029094
3815 3815 c, t dbSNP:782158020
3825 3825 a, g dbSNP:782335186
3830 3830 a, g dbSNP:781927460
3837 3837 c, t dbSNP:781971794
3840 3840 a, g dbSNP:782082676
3851 3851 -, g dbSNP:782718791
3856 3856 a, g dbSNP:782772606
3876 3876 a, g dbSNP:781844998
3891 3891 c, t dbSNP:377519637
3892 3892 a, g dbSNP:782364269
3894 3894 g, t dbSNP:781809081
3910 3910 c, t dbSNP:370669534
3911 3911 a, g, t dbSNP:147732725
3918 3918 a, c dbSNP:782520598
3924 3924 c, g, t dbSNP:685523
3925 3925 a, c, g dbSNP:782742222
3926 3926 g, t dbSNP:782223061
3933 3933 c, t dbSNP:78977446
3934 3934 a, g dbSNP:782003158
3939 3939 -, c dbSNP:781796310
3940 3940 c, t dbSNP:782111896
3946 3946 c, t dbSNP:587726656
3949 3949 c, t dbSNP:145728650
3950 3950 a, g dbSNP:138742754
3953 3953 c, t dbSNP:781844824
3954 3954 a, g dbSNP:758243645
3957 3957 g, t dbSNP:781896718
3971 3971 c, t dbSNP:374444423
3983 3983 a, g dbSNP:201241072
3989 3989 g, t dbSNP:782189279
3990 3990 c, t dbSNP:587773478
3994 3994 a, c dbSNP:782617353
3998 3998 a, g dbSNP:782263547
4018 4018 a, g dbSNP:782380295
4024 4024 c, t dbSNP:782030553
4029 4029 c, t dbSNP:782154017
4037 4037 a, g dbSNP:782329783
4052 4052 c, t dbSNP:149265456
4053 4053 a, g dbSNP:782160285
4059 4059 a, g, t dbSNP:782770168
4061 4061 g, t dbSNP:782154286
4066 4066 a, g dbSNP:368858347
4068 4068 c, t dbSNP:781805469
4074 4074 c, t dbSNP:372449678
4075 4075 a, g dbSNP:375151860
4076 4076 g, t dbSNP:121908468
4078 4078 c, t dbSNP:781827094
4079 4079 c, t dbSNP:143568784
4086 4086 a, g dbSNP:200273776
4095 4095 a, g dbSNP:781863577
4104 4104 a, c, t dbSNP:368433734
4105 4105 a, g dbSNP:371554437
4106 4106 g, t dbSNP:782453982
4114 4114 c, t dbSNP:148031420
4115 4115 a, g dbSNP:141811556
4116 4116 c, t dbSNP:782502165
4117 4117 c, g dbSNP:782683498
4127 4127 -, agaggggtc dbSNP:781893176
4135 4135 c, t dbSNP:28641026
4139 4139 c, t dbSNP:782315945
4140 4140 a, g dbSNP:139951127
4155 4155 -, gtgccc dbSNP:387906346
4160 4160 c, t dbSNP:782220521
4161 4161 a, g dbSNP:142779872
4167 4167 a, g dbSNP:782009471
4169 4169 a, g dbSNP:36222275
4180 4180 c, t dbSNP:782146228
4182 4182 a, g dbSNP:782020908
4201 4201 c, t dbSNP:587618046
4203 4203 c, t dbSNP:139808736
4205 4205 c, t dbSNP:781842320
4217 4217 c, g dbSNP:782123812
4223 4223 c, t dbSNP:782761491
4224 4224 a, g dbSNP:781905328
4227 4227 c, t dbSNP:782536497
4228 4228 a, g dbSNP:149794949
4234 4234 c, t dbSNP:145835995
4261 4261 a, c dbSNP:781783629
4277 4277 a, g dbSNP:781815720
4278 4278 c, t dbSNP:148560341
4280 4280 a, c dbSNP:587735427
4285 4285 a, c dbSNP:370359180
4286 4286 c, t dbSNP:781908789
4295 4295 g, t dbSNP:121908472
4299 4299 c, t dbSNP:782586641
4300 4300 a, g dbSNP:782185362
4302 4302 c, t dbSNP:782363611
4308 4308 a, g dbSNP:782597967
4322 4322 a, g dbSNP:28503257
4328 4328 c, t dbSNP:782414383
4329 4329 a, g dbSNP:782016923
4332 4332 c, t dbSNP:142607772
4333 4333 a, g dbSNP:34934621
4339 4339 c, t dbSNP:781959371
4352 4352 c, g dbSNP:370081995
4358 4358 a, g dbSNP:782789479
4364 4364 c, g dbSNP:151138896
4366 4366 c, t dbSNP:782167288
4367 4367 a, g dbSNP:782585313
4375 4375 a, g dbSNP:36222579
4377 4377 a, t dbSNP:587681892
4378 4378 c, t dbSNP:782748173
4382 4382 g, t dbSNP:781825145
4383 4383 c, t dbSNP:373530345
4384 4384 a, g dbSNP:200349242
4392 4392 c, g, t dbSNP:376017677
4393 4393 a, g dbSNP:150322366
4396 4396 a, g dbSNP:36222580
4402 4402 a, g dbSNP:782223782
4404 4404 a, g dbSNP:587731517
4406 4406 -, cc dbSNP:782715762
4408 4408 c, t dbSNP:782251596
4409 4409 a, g dbSNP:782421000
4414 4414 -, ca dbSNP:782633692
4421 4421 a, c dbSNP:782025111
4423 4423 -, ct dbSNP:782288601
4431 4431 c, t dbSNP:782071778
4433 4433 a, g dbSNP:782706998
4435 4435 c, t dbSNP:138488999
4436 4436 a, g dbSNP:782090479
4437 4437 a, c dbSNP:782783025
4442 4442 a, t dbSNP:781898659
4443 4443 c, t dbSNP:782531291
4448 4448 c, t dbSNP:782700247
4449 4449 a, g dbSNP:138770906
4462 4462 c, t dbSNP:782478560
4483 4483 c, t dbSNP:200481038
4484 4484 c, t dbSNP:782195157
4492 4492 g, t dbSNP:782307600
4504 4504 -, c dbSNP:782415493
4505 4505 c, t dbSNP:781965782
4506 4506 a, g dbSNP:782080989
4508 4508 c, t dbSNP:782383410
4509 4509 a, g dbSNP:373569027
4511 4511 c, t dbSNP:377572669
4512 4512 a, g dbSNP:61751476
4522 4522 c, t dbSNP:199810396
4525 4525 c, t dbSNP:781942887
4526 4526 a, g dbSNP:781809898
4535 4535 a, g dbSNP:782054636
4541 4541 a, g dbSNP:782755326
4542 4542 c, t dbSNP:370060687
4543 4543 a, g dbSNP:782535994
4545 4545 c, t dbSNP:782630291
4549 4549 a, g dbSNP:781883131
4560 4560 g, t dbSNP:587755238
4570 4570 c, t dbSNP:782563217
4573 4573 a, g dbSNP:146073007
4579 4579 a, g dbSNP:782343769
4582 4582 a, g dbSNP:782647758
4588 4588 a, t dbSNP:371737266
4591 4591 a, g dbSNP:782238280
4593 4593 a, g dbSNP:782311861
4616 4616 g, t dbSNP:782018563
4620 4620 c, g dbSNP:782196406
4625 4625 a, g dbSNP:782311486
4629 4629 c, t dbSNP:762112077
4630 4630 a, c, g dbSNP:148715397
4631 4631 a, c dbSNP:781992360
4636 4636 c, t dbSNP:782164825
4642 4642 g, t dbSNP:782724202
4644 4644 c, t dbSNP:781785040
4645 4645 a, c dbSNP:782482318
4648 4648 c, t dbSNP:200547311
4649 4649 a, g dbSNP:587709422
4652 4652 a, g dbSNP:782504511
4653 4653 a, c dbSNP:782670806
4658 4658 a, g dbSNP:782270256
4663 4663 c, t dbSNP:186236347
4670 4670 c, t dbSNP:141494468
4671 4671 a, g dbSNP:782472825
4676 4676 a, g dbSNP:782226132
4678 4678 a, g dbSNP:782345031
4679 4679 g, t dbSNP:782007879
4681 4681 c, t dbSNP:782251776
4682 4682 a, g dbSNP:150853306
4689 4689 a, c dbSNP:781930177
4691 4691 a, g dbSNP:782044988
4717 4717 c, t dbSNP:782731435
4718 4718 c, t dbSNP:587664518
4719 4719 a, g dbSNP:139286990
4722 4722 a, g dbSNP:782760544
4723 4723 c, t dbSNP:781900705
4726 4726 a, g, t dbSNP:782533352
4734 4734 a, c dbSNP:373910725
4736 4736 c, t dbSNP:148500446
4737 4737 c, t dbSNP:200122302
4738 4738 a, c, g dbSNP:368634068
4742 4742 c, t dbSNP:782511560
4748 4748 c, t dbSNP:782689373
4750 4750 c, t dbSNP:782285009
4751 4751 c, t dbSNP:782300864
4752 4752 a, g dbSNP:782621505
4754 4754 a, c, t dbSNP:782200824
4755 4755 a, g dbSNP:370692680
4761 4761 a, t dbSNP:782166349
4765 4765 c, t dbSNP:147292523
4766 4766 a, g dbSNP:192619276
4767 4767 a, g dbSNP:782053981
4774 4774 a, g dbSNP:782741622
4775 4775 a, g dbSNP:781823708
4784 4784 g, t dbSNP:782128103
4788 4788 a, g dbSNP:782783483
4793 4793 a, c dbSNP:781911555
4805 4805 c, t dbSNP:781812128
4814 4814 a, c dbSNP:782230828
4821 4821 c, t dbSNP:782726688
4825 4825 a, c dbSNP:141056078
4831 4831 a, c dbSNP:782488785
4842 4842 c, t dbSNP:782818582
4843 4843 a, g dbSNP:781885530
4864 4864 a, g dbSNP:121908474
4867 4867 c, t dbSNP:782462227
4876 4876 c, t dbSNP:200847393
4877 4877 c, t dbSNP:782235608
4882 4882 a, g dbSNP:782649881
4889 4889 c, t dbSNP:144916851
4896 4896 a, g dbSNP:782422811
4901 4901 a, g dbSNP:782025363
4903 4903 c, t dbSNP:36222894
4908 4908 c, t dbSNP:148824378
4909 4909 a, g dbSNP:781945456
4910 4910 c, t dbSNP:782126709
4911 4911 a, g dbSNP:587643681
4912 4912 a, t dbSNP:782033398

Target ORF information:

RefSeq Version XM_011518175
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu64702
Accession Version XM_011518176.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3300bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008470.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)255..413(+)
Position Chain Variation Link
10 10 c, t dbSNP:782031676
13 13 c, t dbSNP:782142895
14 14 c, t dbSNP:28729234
16 16 a, c, g dbSNP:781918765
25 25 -, g dbSNP:782093351
28 28 c, g dbSNP:782740878
29 29 a, t dbSNP:781870655
32 32 a, g dbSNP:587616629
36 36 g, t dbSNP:375767052
38 38 a, g dbSNP:782798456
43 43 a, c dbSNP:781808050
44 44 a, c dbSNP:782444847
46 46 g, t dbSNP:782616591
47 47 c, g dbSNP:781828222
48 48 c, t dbSNP:782517734
49 49 a, g, t dbSNP:367819139
50 50 c, t dbSNP:782402561
55 55 c, g dbSNP:371350265
64 64 c, t dbSNP:782579493
65 65 a, g dbSNP:782183226
66 66 -, c dbSNP:782744649
69 69 a, c dbSNP:587744487
72 72 -, a dbSNP:781863038
72 72 a, c, g dbSNP:3124773
77 77 g, t dbSNP:782254917
80 80 a, c dbSNP:782420537
81 81 a, c dbSNP:782020311
86 86 c, t dbSNP:782432260
95 95 a, g dbSNP:757725461
109 109 a, t dbSNP:782616826
112 112 c, g dbSNP:149517360
116 116 c, t dbSNP:144498742
118 118 c, t dbSNP:115943536
119 119 a, g dbSNP:199953481
145 145 g, t dbSNP:587706274
149 149 c, t dbSNP:372461655
150 150 a, c, g dbSNP:377191898
179 179 c, t dbSNP:587606690
180 180 a, g dbSNP:781924046
196 196 c, g dbSNP:782270618
198 198 a, g dbSNP:782380073
200 200 c, g dbSNP:374597782
204 204 c, t dbSNP:145252342
205 205 a, g dbSNP:200406381
210 210 c, t dbSNP:781914134
211 211 a, g dbSNP:782091585
212 212 c, t dbSNP:782153255
219 219 g, t dbSNP:371969346
221 221 a, g dbSNP:782806684
229 229 c, g dbSNP:782003178
233 233 c, t dbSNP:147607799
234 234 a, g dbSNP:782810090
242 242 a, c dbSNP:781794348
246 246 c, t dbSNP:587613745
248 248 c, t dbSNP:140640175
252 252 a, c, t dbSNP:142214608
253 253 a, g dbSNP:151048660
256 256 c, g dbSNP:780251348
263 263 c, g dbSNP:782641144
265 265 a, g dbSNP:374655146
270 270 c, t dbSNP:782530823
273 273 c, g dbSNP:782570540
274 274 a, g dbSNP:140937290
278 278 a, t dbSNP:587750968
287 287 c, t dbSNP:782609209
288 288 c, t dbSNP:376606652
289 289 a, g dbSNP:121908471
296 296 c, t dbSNP:142570561
297 297 a, g dbSNP:782033728
304 304 g, t dbSNP:782072116
308 308 a, g, t dbSNP:782314532
311 311 c, t dbSNP:145768029
328 328 a, g dbSNP:140582930
342 342 c, t dbSNP:782657509
343 343 a, c dbSNP:369465957
347 347 c, t dbSNP:781959119
350 350 -, g, ggg dbSNP:781886798
350 350 a, t dbSNP:782077607
356 356 g, t dbSNP:782768459
357 357 c, t dbSNP:145825553
358 358 a, c, g dbSNP:782541751
362 362 a, c dbSNP:781796744
363 363 c, t dbSNP:782492477
370 370 a, g, t dbSNP:782602523
378 378 c, t dbSNP:782519493
379 379 c, t dbSNP:782682017
385 385 c, t dbSNP:782278375
386 386 c, t dbSNP:138401488
387 387 a, g dbSNP:781915989
389 389 c, g dbSNP:782224267
392 392 a, g dbSNP:141471395
397 397 a, g dbSNP:781993871
404 404 c, g dbSNP:587642546
410 410 c, t dbSNP:781989547
411 411 a, g dbSNP:748223519
423 423 a, c dbSNP:782174746
426 426 g, t dbSNP:587708651
429 429 g, t dbSNP:781813768
431 431 c, t dbSNP:782055451
432 432 a, g dbSNP:782733359
434 434 a, g, t dbSNP:781815925
436 436 c, t dbSNP:782630536
437 437 a, c, g dbSNP:587602874
438 438 c, g dbSNP:2301612
441 441 c, t dbSNP:121908476
444 444 c, t dbSNP:782344627
446 446 c, t dbSNP:782645434
447 447 a, g dbSNP:375508823
452 452 a, g dbSNP:782424568
455 455 c, t dbSNP:148365271
456 456 a, c, g dbSNP:782076268
458 458 c, t dbSNP:782355981
459 459 a, c, g dbSNP:587613923
462 462 c, g dbSNP:781977102
464 464 g, t dbSNP:36220239
466 466 c, t dbSNP:36220240
467 467 a, g dbSNP:781802178
471 471 c, g dbSNP:782433445
472 472 a, g, t dbSNP:782733057
481 481 c, t dbSNP:782497226
482 482 c, t dbSNP:587634841
483 483 c, g dbSNP:782279962
485 485 c, t dbSNP:138035204
486 486 a, g dbSNP:587768675
488 488 c, t dbSNP:782239711
499 499 a, g dbSNP:782339799
508 508 g, t dbSNP:781992856
519 519 c, t dbSNP:11575933
523 523 a, g dbSNP:782410985
524 524 c, t dbSNP:782015114
530 530 -, g dbSNP:782472621
533 533 a, g dbSNP:372953477
541 541 c, t dbSNP:782405037
544 544 a, g dbSNP:781946010
547 547 a, g dbSNP:28375042
551 551 c, t dbSNP:199876716
552 552 -, at dbSNP:782242503
553 553 g, t dbSNP:782052182
558 558 c, t dbSNP:782769100
559 559 a, g dbSNP:147201977
562 562 c, t dbSNP:782128293
569 569 c, t dbSNP:140501683
573 573 a, c dbSNP:377220995
575 575 c, t dbSNP:376102311
577 577 -, tca dbSNP:782437870
581 581 c, g dbSNP:782540244
582 582 a, g dbSNP:782574335
587 587 g, t dbSNP:781786860
588 588 c, t dbSNP:201457594
593 593 a, g dbSNP:782607445
595 595 a, c dbSNP:149706655
600 600 g, t dbSNP:782419451
605 605 c, t dbSNP:782671668
606 606 a, g dbSNP:782200160
614 614 a, c dbSNP:782315134
621 621 a, g dbSNP:782089166
627 627 a, g dbSNP:144618753
631 631 a, g dbSNP:782392744
632 632 c, g dbSNP:75928689
636 636 c, g, t dbSNP:370215524
637 637 a, g dbSNP:374465629
643 643 a, g dbSNP:781807478
644 644 a, c, t dbSNP:587612482
644 644 c, t dbSNP:758174895
645 645 a, g dbSNP:376459838
647 647 a, c, g dbSNP:148472763
649 649 a, c dbSNP:781894953
653 653 a, g dbSNP:587745572
667 667 c, t dbSNP:782454600
678 678 a, g dbSNP:121908473
682 682 c, g dbSNP:782343737
697 697 a, g dbSNP:782003053
703 703 g, t dbSNP:782292367
718 718 c, t dbSNP:782417749
719 719 a, g dbSNP:781937390
728 728 g, t dbSNP:142282539
740 740 c, t dbSNP:369336602
746 746 g, t dbSNP:150203373
749 749 c, t dbSNP:146779903
757 757 c, t dbSNP:782771879
758 758 a, g, t dbSNP:781897271
768 768 c, t dbSNP:782055634
787 787 a, c dbSNP:140628579
796 796 a, c, t dbSNP:782272645
797 797 a, g dbSNP:374868673
802 802 a, t dbSNP:375509487
803 803 a, g dbSNP:144282342
811 811 c, t dbSNP:781840717
812 812 a, g dbSNP:3124768
829 829 c, t dbSNP:782647983
837 837 a, g dbSNP:782254257
838 838 a, c dbSNP:782427556
848 848 c, t dbSNP:782660413
857 857 c, t dbSNP:369872722
863 863 a, g, t dbSNP:372789831
879 879 -, tt dbSNP:387906344
884 884 a, g dbSNP:782132022
893 893 c, t dbSNP:36221216
894 894 a, g dbSNP:782036643
897 897 a, g dbSNP:782151601
900 900 c, t dbSNP:150234885
902 902 c, t dbSNP:781783061
906 906 a, g dbSNP:34256013
908 908 c, t dbSNP:782726724
909 909 a, g, t dbSNP:781872245
911 911 g, t dbSNP:375622643
917 917 a, g dbSNP:371209152
920 920 g, t dbSNP:782450096
926 926 c, t dbSNP:36221217
931 931 c, t dbSNP:782219285
937 937 a, c dbSNP:782396358
944 944 c, t dbSNP:781993504
947 947 c, g, t dbSNP:371266006
948 948 c, g dbSNP:28647808
952 952 c, t dbSNP:781947512
956 956 c, t dbSNP:751652402
969 969 c, t dbSNP:587721043
970 970 a, g dbSNP:36090624
974 974 c, t dbSNP:781945326
975 975 a, g, t dbSNP:60398774
990 990 c, g dbSNP:782761353
995 995 a, c, t dbSNP:143573766
996 996 a, g dbSNP:34569244
1002 1002 c, t dbSNP:201704847
1009 1009 c, t dbSNP:782466560
1011 1011 c, t dbSNP:147166780
1012 1012 a, g, t dbSNP:138699340
1017 1017 a, g dbSNP:782547718
1026 1026 c, t dbSNP:782659882
1027 1027 a, g dbSNP:782184721
1031 1031 a, c dbSNP:141265567
1040 1040 c, t dbSNP:587673448
1054 1054 c, g, t dbSNP:587726180
1065 1065 a, g dbSNP:782470631
1072 1072 a, g dbSNP:150764227
1074 1074 c, t dbSNP:587693885
1075 1075 a, g dbSNP:117943654
1082 1082 c, g dbSNP:199741568
1083 1083 a, g dbSNP:782199892
1085 1085 a, g dbSNP:368018318
1104 1104 c, t dbSNP:139214644
1105 1105 a, g dbSNP:149953167
1116 1116 a, g dbSNP:782028864
1118 1118 c, t dbSNP:782144746
1123 1123 c, t dbSNP:782709302
1127 1127 a, c, t dbSNP:781784468
1130 1130 c, g dbSNP:587765025
1143 1143 c, t dbSNP:781875492
1146 1146 c, t dbSNP:370121816
1155 1155 -, g dbSNP:34245310
1163 1163 a, c, t dbSNP:782806565
1164 1164 a, g dbSNP:374840594
1170 1170 c, t dbSNP:121908475
1171 1171 a, g dbSNP:782214086
1183 1183 c, g, t dbSNP:201605295
1184 1184 a, g dbSNP:782288267
1185 1185 a, c, g dbSNP:367818172
1191 1191 c, t dbSNP:781785491
1197 1197 a, g dbSNP:782177142
1203 1203 c, t dbSNP:146314458
1207 1207 a, g dbSNP:782223605
1211 1211 a, g dbSNP:782400086
1230 1230 c, g dbSNP:781993713
1232 1232 a, c dbSNP:782301837
1251 1251 a, g dbSNP:782421679
1260 1260 c, g dbSNP:781937174
1263 1263 a, c dbSNP:138014548
1269 1269 c, g dbSNP:782354328
1273 1273 a, g dbSNP:372471786
1287 1287 c, t dbSNP:782116595
1291 1291 c, t dbSNP:41314453
1292 1292 a, g dbSNP:781888677
1296 1296 a, c dbSNP:782058485
1307 1307 c, t dbSNP:587731476
1310 1310 c, g dbSNP:781830585
1312 1312 c, t dbSNP:587610691
1313 1313 c, t dbSNP:144178018
1314 1314 a, g dbSNP:36221451
1316 1316 a, t dbSNP:782559298
1323 1323 c, g, t dbSNP:782671915
1336 1336 c, t dbSNP:367887198
1337 1337 g, t dbSNP:782251114
1350 1350 a, g dbSNP:148734700
1355 1355 a, c dbSNP:782037951