Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

ADAMTS13 ADAM metallopeptidase with thrombospondin type 1 motif, 13 [Homo sapiens (human)]

Gene Symbol ADAMTS13
Entrez Gene ID 11093
Full Name ADAM metallopeptidase with thrombospondin type 1 motif, 13
Synonyms ADAM-TS13, ADAMTS-13, C9orf8, VWFCP, vWF-CP
General protein information
Preferred Names
A disintegrin and metalloproteinase with thrombospondin motifs 13
A disintegrin and metalloproteinase with thrombospondin motifs 13
vWF-cleaving protease
von Willebrand factor-cleaving protease
a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of a family of proteins containing several distinct regions, including a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. The enzyme encoded by this gene specifically cleaves von Willebrand Factor (vWF). Defects in this gene are associated with thrombotic thrombocytopenic purpura. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]. lac of sum
Disorder MIM:


Disorder Html: Thrombotic thrombocytopenic purpura, familial, 274150 (3)
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu64700 XM_011518174 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu64701 XM_011518175 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu64702 XM_011518176 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 20 Starting from $99.00
OHu64703 XM_011518177 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X4, mRNA. pcDNA3.1-C-(k)DYK Not in stock 20 Starting from $99.00
OHu64704 XM_011518178 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X5, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu64705 XM_011518179 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X6, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu64706 XM_011518180 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X7, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu64700 XM_011548750 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu64701 XM_011548751 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu64702 XM_011548752 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 20 Starting from $99.00
OHu64703 XM_011548753 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X4, mRNA. pcDNA3.1-C-(k)DYK Not in stock 20 Starting from $99.00
OHu64704 XM_011548754 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X5, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu64705 XM_011548755 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X6, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu64706 XM_011548756 PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X7, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu27537 NM_139025 Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu23357 NM_139027 Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu27548 NM_139026 Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant 3, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu64700D
Sequence Information ORF Nucleotide Sequence (Length: 3894bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008470.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)308..766(+)
Misc Feature(2)587..619(+)
Misc Feature(3)1076..1234(+)
Position Chain Variation Link
8 8 c, t dbSNP:145275561
51 51 a, c dbSNP:782570157
52 52 a, c, t dbSNP:146394542
53 53 a, g, t dbSNP:201522226
55 55 g, t dbSNP:369130757
63 63 a, g dbSNP:373832736
67 67 c, g dbSNP:782217202
85 85 a, g dbSNP:782394264
92 92 c, t dbSNP:139735640
93 93 a, g dbSNP:370929256
95 95 a, c dbSNP:370611753
96 96 c, t dbSNP:782677352
98 98 c, g dbSNP:782680569
102 102 c, t dbSNP:375370257
110 110 c, t dbSNP:782453359
112 112 -, cagagg, cagaggcagagg dbSNP:782306107
113 113 -, cagaggcagagg dbSNP:781853881
113 113 -, cagagg dbSNP:782548827
119 119 c, t dbSNP:782576304
130 130 a, g dbSNP:782220406
141 141 c, g dbSNP:142366230
142 142 c, t dbSNP:143856697
144 144 c, t dbSNP:782302107
148 148 c, t dbSNP:367627378
149 149 a, g dbSNP:587712720
150 150 g, t dbSNP:782188171
155 155 c, t dbSNP:200841843
158 158 c, t dbSNP:148644959
159 159 a, g dbSNP:781958663
164 164 a, g dbSNP:587611213
178 178 c, t dbSNP:782777667
184 184 c, t dbSNP:782035751
187 187 c, t dbSNP:756898709
189 189 a, g dbSNP:782149039
201 201 c, t dbSNP:370263552
203 203 c, g dbSNP:121908467
207 207 a, g dbSNP:781788692
208 208 -, ggaggacacagagcgctatgtgctcacca dbSNP:387906345
214 214 c, g dbSNP:782483941
220 220 -, c dbSNP:782203933
221 221 c, t dbSNP:121908469
222 222 a, g dbSNP:782716712
223 223 c, t dbSNP:781864642
230 230 c, t dbSNP:782488906
234 234 a, c dbSNP:782681039
247 247 c, t dbSNP:142107133
251 251 c, g, t dbSNP:782188741
259 259 a, g dbSNP:782615140
263 263 c, t dbSNP:782209298
264 264 a, g dbSNP:151206890
268 268 c, t dbSNP:781983991
270 270 c, t dbSNP:587698109
271 271 a, g dbSNP:28571612
274 274 c, t dbSNP:147563206
277 277 a, g dbSNP:375151732
290 290 a, c dbSNP:776837883
290 290 a, c, t dbSNP:587701622
291 291 a, g dbSNP:587602236
317 317 c, g dbSNP:147643918
321 321 c, t dbSNP:782814321
323 323 a, g dbSNP:142237685
326 326 c, t dbSNP:782464030
332 332 g, t dbSNP:781882283
335 335 a, g dbSNP:782445469
337 337 c, t dbSNP:3118667
344 344 a, g dbSNP:145175796
346 346 c, t dbSNP:782519773
348 348 c, t dbSNP:782644086
352 352 c, t dbSNP:149175416
363 363 c, t dbSNP:377681196
368 368 c, t dbSNP:781937618
376 376 c, t dbSNP:782180043
377 377 a, g dbSNP:369026148
385 385 g, t dbSNP:781950676
393 393 a, c dbSNP:782127630
396 396 c, t dbSNP:587696077
402 402 a, c dbSNP:782747858
412 412 c, t dbSNP:782026673
413 413 a, g dbSNP:781825239
417 417 c, t dbSNP:141932927
418 418 a, g dbSNP:587636999
437 437 c, t dbSNP:372637811
441 441 c, t dbSNP:782799810
443 443 c, t dbSNP:781854972
447 447 a, g dbSNP:200594025
463 463 c, t dbSNP:148849381
469 469 a, g dbSNP:782652490
476 476 c, g dbSNP:148312697
484 484 c, t dbSNP:782555111
485 485 c, t dbSNP:782650307
486 486 a, g dbSNP:142152759
495 495 g, t dbSNP:782083669
499 499 c, t dbSNP:34054981
500 500 a, g dbSNP:138489501
504 504 c, t dbSNP:121908470
505 505 c, t dbSNP:376549668
508 508 a, g dbSNP:782037445
514 514 c, t dbSNP:201048039
515 515 a, g dbSNP:782328666
517 517 g, t dbSNP:781922767
518 518 a, g dbSNP:782095571
526 526 c, t dbSNP:782718222
530 530 a, c dbSNP:781874381
533 533 c, t dbSNP:782116819
535 535 g, t dbSNP:782804156
538 538 c, g dbSNP:781884793
540 540 c, g dbSNP:782442144
544 544 c, g dbSNP:143035878
547 547 g, t dbSNP:199661242
550 550 c, t dbSNP:782534418
556 556 c, t dbSNP:782439387
560 560 a, g dbSNP:782640617
566 566 a, g dbSNP:782305581
569 569 c, t dbSNP:200017456
584 584 a, g dbSNP:782586734
623 623 a, g dbSNP:781916049
666 666 c, t dbSNP:121908478
677 677 a, g dbSNP:782093693
697 697 c, t dbSNP:782774484
717 717 a, g dbSNP:587623575
720 720 c, g dbSNP:121908477
751 751 g, t dbSNP:587671802
761 761 c, g dbSNP:782674608
774 774 c, t dbSNP:782184693
782 782 c, t dbSNP:782429486
785 785 c, t dbSNP:782613885
787 787 c, t dbSNP:754541465
789 789 c, g dbSNP:782379766
790 790 g, t dbSNP:782036565
791 791 a, t dbSNP:782282073
792 792 a, c dbSNP:782322129
794 794 a, g dbSNP:781919201
804 804 a, c dbSNP:782102945
805 805 a, g dbSNP:372413496
807 807 c, t dbSNP:782001479
808 808 a, g dbSNP:782114348
819 819 c, g dbSNP:782818563
820 820 c, t dbSNP:377143536
826 826 c, t dbSNP:782059317
836 836 a, g dbSNP:150518374
850 850 c, t dbSNP:369514834
853 853 c, t dbSNP:36219562
858 858 c, t dbSNP:782291570
862 862 c, t dbSNP:782640937
865 865 -, c dbSNP:781919209
866 866 c, t dbSNP:781911708
871 871 a, g dbSNP:782542948
878 878 a, c, g dbSNP:782601193
885 885 c, g dbSNP:782360062
886 886 c, t dbSNP:782596096
889 889 c, t dbSNP:782268976
890 890 g, t dbSNP:587667471
907 907 c, t dbSNP:782432260
916 916 a, g dbSNP:757725461
930 930 a, t dbSNP:782616826
933 933 c, g dbSNP:149517360
937 937 c, t dbSNP:144498742
939 939 c, t dbSNP:115943536
940 940 a, g dbSNP:199953481
966 966 g, t dbSNP:587706274
970 970 c, t dbSNP:372461655
971 971 a, c, g dbSNP:377191898
1000 1000 c, t dbSNP:587606690
1001 1001 a, g dbSNP:781924046
1017 1017 c, g dbSNP:782270618
1019 1019 a, g dbSNP:782380073
1021 1021 c, g dbSNP:374597782
1025 1025 c, t dbSNP:145252342
1026 1026 a, g dbSNP:200406381
1031 1031 c, t dbSNP:781914134
1032 1032 a, g dbSNP:782091585
1033 1033 c, t dbSNP:782153255
1040 1040 g, t dbSNP:371969346
1042 1042 a, g dbSNP:782806684
1050 1050 c, g dbSNP:782003178
1054 1054 c, t dbSNP:147607799
1055 1055 a, g dbSNP:782810090
1063 1063 a, c dbSNP:781794348
1067 1067 c, t dbSNP:587613745
1069 1069 c, t dbSNP:140640175
1073 1073 a, c, t dbSNP:142214608
1074 1074 a, g dbSNP:151048660
1077 1077 c, g dbSNP:780251348
1084 1084 c, g dbSNP:782641144
1086 1086 a, g dbSNP:374655146
1091 1091 c, t dbSNP:782530823
1094 1094 c, g dbSNP:782570540
1095 1095 a, g dbSNP:140937290
1099 1099 a, t dbSNP:587750968
1108 1108 c, t dbSNP:782609209
1109 1109 c, t dbSNP:376606652
1110 1110 a, g dbSNP:121908471
1117 1117 c, t dbSNP:142570561
1118 1118 a, g dbSNP:782033728
1125 1125 g, t dbSNP:782072116
1129 1129 a, g, t dbSNP:782314532
1132 1132 c, t dbSNP:145768029
1149 1149 a, g dbSNP:140582930
1163 1163 c, t dbSNP:782657509
1164 1164 a, c dbSNP:369465957
1168 1168 c, t dbSNP:781959119
1171 1171 -, g, ggg dbSNP:781886798
1171 1171 a, t dbSNP:782077607
1177 1177 g, t dbSNP:782768459
1178 1178 c, t dbSNP:145825553
1179 1179 a, c, g dbSNP:782541751
1183 1183 a, c dbSNP:781796744
1184 1184 c, t dbSNP:782492477
1191 1191 a, g, t dbSNP:782602523
1199 1199 c, t dbSNP:782519493
1200 1200 c, t dbSNP:782682017
1206 1206 c, t dbSNP:782278375
1207 1207 c, t dbSNP:138401488
1208 1208 a, g dbSNP:781915989
1210 1210 c, g dbSNP:782224267
1213 1213 a, g dbSNP:141471395
1218 1218 a, g dbSNP:781993871
1225 1225 c, g dbSNP:587642546
1231 1231 c, t dbSNP:781989547
1232 1232 a, g dbSNP:748223519
1244 1244 a, c dbSNP:782174746
1247 1247 g, t dbSNP:587708651
1250 1250 g, t dbSNP:781813768
1252 1252 c, t dbSNP:782055451
1253 1253 a, g dbSNP:782733359
1255 1255 a, g, t dbSNP:781815925
1257 1257 c, t dbSNP:782630536
1258 1258 a, c, g dbSNP:587602874
1259 1259 c, g dbSNP:2301612
1262 1262 c, t dbSNP:121908476
1265 1265 c, t dbSNP:782344627
1267 1267 c, t dbSNP:782645434
1268 1268 a, g dbSNP:375508823
1273 1273 a, g dbSNP:782424568
1276 1276 c, t dbSNP:148365271
1277 1277 a, c, g dbSNP:782076268
1279 1279 c, t dbSNP:782355981
1280 1280 a, c, g dbSNP:587613923
1283 1283 c, g dbSNP:781977102
1285 1285 g, t dbSNP:36220239
1287 1287 c, t dbSNP:36220240
1288 1288 a, g dbSNP:781802178
1292 1292 c, g dbSNP:782433445
1293 1293 a, g, t dbSNP:782733057
1302 1302 c, t dbSNP:782497226
1303 1303 c, t dbSNP:587634841
1304 1304 c, g dbSNP:782279962
1306 1306 c, t dbSNP:138035204
1307 1307 a, g dbSNP:587768675
1309 1309 c, t dbSNP:782239711
1320 1320 a, g dbSNP:782339799
1329 1329 g, t dbSNP:781992856
1340 1340 c, t dbSNP:11575933
1344 1344 a, g dbSNP:782410985
1345 1345 c, t dbSNP:782015114
1351 1351 -, g dbSNP:782472621
1354 1354 a, g dbSNP:372953477
1362 1362 c, t dbSNP:782405037
1365 1365 a, g dbSNP:781946010
1368 1368 a, g dbSNP:28375042
1372 1372 c, t dbSNP:199876716
1373 1373 -, at dbSNP:782242503
1374 1374 g, t dbSNP:782052182
1379 1379 c, t dbSNP:782769100
1380 1380 a, g dbSNP:147201977
1383 1383 c, t dbSNP:782128293
1390 1390 c, t dbSNP:140501683
1394 1394 a, c dbSNP:377220995
1396 1396 c, t dbSNP:376102311
1398 1398 -, tca dbSNP:782437870
1402 1402 c, g dbSNP:782540244
1403 1403 a, g dbSNP:782574335
1408 1408 g, t dbSNP:781786860
1409 1409 c, t dbSNP:201457594
1414 1414 a, g dbSNP:782607445
1416 1416 a, c dbSNP:149706655
1421 1421 g, t dbSNP:782419451
1426 1426 c, t dbSNP:782671668
1427 1427 a, g dbSNP:782200160
1435 1435 a, c dbSNP:782315134
1442 1442 a, g dbSNP:782089166
1448 1448 a, g dbSNP:144618753
1452 1452 a, g dbSNP:782392744
1453 1453 c, g dbSNP:75928689
1457 1457 c, g, t dbSNP:370215524
1458 1458 a, g dbSNP:374465629
1464 1464 a, g dbSNP:781807478
1465 1465 a, c, t dbSNP:587612482
1465 1465 c, t dbSNP:758174895
1466 1466 a, g dbSNP:376459838
1468 1468 a, c, g dbSNP:148472763
1470 1470 a, c dbSNP:781894953
1474 1474 a, g dbSNP:587745572
1488 1488 c, t dbSNP:782454600
1499 1499 a, g dbSNP:121908473
1503 1503 c, g dbSNP:782343737
1518 1518 a, g dbSNP:782003053
1524 1524 g, t dbSNP:782292367
1539 1539 c, t dbSNP:782417749
1540 1540 a, g dbSNP:781937390
1549 1549 g, t dbSNP:142282539
1561 1561 c, t dbSNP:369336602
1567 1567 g, t dbSNP:150203373
1570 1570 c, t dbSNP:146779903
1578 1578 c, t dbSNP:782771879
1579 1579 a, g, t dbSNP:781897271
1589 1589 c, t dbSNP:782055634
1608 1608 a, c dbSNP:140628579
1617 1617 a, c, t dbSNP:782272645
1618 1618 a, g dbSNP:374868673
1623 1623 a, t dbSNP:375509487
1624 1624 a, g dbSNP:144282342
1632 1632 c, t dbSNP:781840717
1633 1633 a, g dbSNP:3124768
1650 1650 c, t dbSNP:782647983
1658 1658 a, g dbSNP:782254257
1659 1659 a, c dbSNP:782427556
1669 1669 c, t dbSNP:782660413
1678 1678 c, t dbSNP:369872722
1684 1684 a, g, t dbSNP:372789831
1700 1700 -, tt dbSNP:387906344
1705 1705 a, g dbSNP:782132022
1714 1714 c, t dbSNP:36221216
1715 1715 a, g dbSNP:782036643
1718 1718 a, g dbSNP:782151601
1721 1721 c, t dbSNP:150234885
1723 1723 c, t dbSNP:781783061
1727 1727 a, g dbSNP:34256013
1729 1729 c, t dbSNP:782726724
1730 1730 a, g, t dbSNP:781872245
1732 1732 g, t dbSNP:375622643
1738 1738 a, g dbSNP:371209152
1741 1741 g, t dbSNP:782450096
1747 1747 c, t dbSNP:36221217
1752 1752 c, t dbSNP:782219285
1758 1758 a, c dbSNP:782396358
1765 1765 c, t dbSNP:781993504
1768 1768 c, g, t dbSNP:371266006
1769 1769 c, g dbSNP:28647808
1773 1773 c, t dbSNP:781947512
1777 1777 c, t dbSNP:751652402
1790 1790 c, t dbSNP:587721043
1791 1791 a, g dbSNP:36090624
1795 1795 c, t dbSNP:781945326
1796 1796 a, g, t dbSNP:60398774
1811 1811 c, g dbSNP:782761353
1816 1816 a, c, t dbSNP:143573766
1817 1817 a, g dbSNP:34569244
1823 1823 c, t dbSNP:201704847
1830 1830 c, t dbSNP:782466560
1832 1832 c, t dbSNP:147166780
1833 1833 a, g, t dbSNP:138699340
1838 1838 a, g dbSNP:782547718
1847 1847 c, t dbSNP:782659882
1848 1848 a, g dbSNP:782184721
1852 1852 a, c dbSNP:141265567
1861 1861 c, t dbSNP:587673448
1875 1875 c, g, t dbSNP:587726180
1886 1886 a, g dbSNP:782470631
1893 1893 a, g dbSNP:150764227
1895 1895 c, t dbSNP:587693885
1896 1896 a, g dbSNP:117943654
1903 1903 c, g dbSNP:199741568
1904 1904 a, g dbSNP:782199892
1906 1906 a, g dbSNP:368018318
1925 1925 c, t dbSNP:139214644
1926 1926 a, g dbSNP:149953167
1937 1937 a, g dbSNP:782028864
1939 1939 c, t dbSNP:782144746
1944 1944 c, t dbSNP:782709302
1948 1948 a, c, t dbSNP:781784468
1951 1951 c, g dbSNP:587765025
1964 1964 c, t dbSNP:781875492
1967 1967 c, t dbSNP:370121816
1976 1976 -, g dbSNP:34245310
1984 1984 a, c, t dbSNP:782806565
1985 1985 a, g dbSNP:374840594
1991 1991 c, t dbSNP:121908475
1992 1992 a, g dbSNP:782214086
2004 2004 c, g, t dbSNP:201605295
2005 2005 a, g dbSNP:782288267
2006 2006 a, c, g dbSNP:367818172
2012 2012 c, t dbSNP:781785491
2018 2018 a, g dbSNP:782177142
2024 2024 c, t dbSNP:146314458
2028 2028 a, g dbSNP:782223605
2032 2032 a, g dbSNP:782400086
2051 2051 c, g dbSNP:781993713
2053 2053 a, c dbSNP:782301837
2072 2072 a, g dbSNP:782421679
2081 2081 c, g dbSNP:781937174
2084 2084 a, c dbSNP:138014548
2090 2090 c, g dbSNP:782354328
2094 2094 a, g dbSNP:372471786
2108 2108 c, t dbSNP:782116595
2112 2112 c, t dbSNP:41314453
2113 2113 a, g dbSNP:781888677
2117 2117 a, c dbSNP:782058485
2128 2128 c, t dbSNP:587731476
2131 2131 c, g dbSNP:781830585
2133 2133 c, t dbSNP:587610691
2134 2134 c, t dbSNP:144178018
2135 2135 a, g dbSNP:36221451
2137 2137 a, t dbSNP:782559298
2144 2144 c, g, t dbSNP:782671915
2157 2157 c, t dbSNP:367887198
2158 2158 g, t dbSNP:782251114
2171 2171 a, g dbSNP:148734700
2176 2176 a, c dbSNP:782037951
2182 2182 c, t dbSNP:372033921
2183 2183 a, g dbSNP:782719456
2185 2185 c, t dbSNP:781923426
2191 2191 g, t dbSNP:587639501
2192 2192 g, t dbSNP:782640568
2195 2195 a, g dbSNP:782729939
2197 2197 c, t dbSNP:3124767
2198 2198 a, g dbSNP:782542048
2204 2204 c, t dbSNP:782807182
2205 2205 a, g, t dbSNP:781804540
2210 2210 c, t dbSNP:782614158
2219 2219 c, t dbSNP:782206311
2220 2220 a, g dbSNP:369510827
2225 2225 a, g dbSNP:374606481
2255 2255 c, t dbSNP:782298936
2259 2259 c, t dbSNP:782406453
2268 2268 a, g dbSNP:377187626
2269 2269 a, g dbSNP:782187097
2275 2275 -, gcag dbSNP:781954210
2278 2278 a, g dbSNP:782365382
2282 2282 a, g dbSNP:781957737
2284 2284 c, g dbSNP:782136497
2293 2293 -, agctgtggcgctggaaacctgcaacc dbSNP:387906342
2301 2301 c, t dbSNP:201607490
2302 2302 a, g dbSNP:782014438
2321 2321 a, c dbSNP:782061756
2327 2327 c, t dbSNP:754909071
2340 2340 a, g dbSNP:782636321
2353 2353 -, c dbSNP:782363784
2355 2355 c, g dbSNP:782279427
2356 2356 c, t dbSNP:782322007
2372 2372 a, g dbSNP:781915055
2373 2373 c, t dbSNP:372962493
2381 2381 a, g dbSNP:782337019
2392 2392 c, t dbSNP:587601722
2402 2402 a, g dbSNP:782110632
2409 2409 a, g dbSNP:782816059
2410 2410 c, t dbSNP:781898935
2411 2411 a, g dbSNP:34104386
2425 2425 c, t dbSNP:36221472
2435 2435 g, t dbSNP:781842149
2437 2437 c, t dbSNP:782466905
2446 2446 a, t dbSNP:782659481
2450 2450 a, g dbSNP:200125026
2461 2461 c, t dbSNP:781855822
2462 2462 a, g dbSNP:140639242
2465 2465 a, g dbSNP:782584684
2469 2469 a, g dbSNP:201106433
2488 2488 a, g dbSNP:587738759
2490 2490 c, g dbSNP:782587447
2491 2491 -, ct dbSNP:782028569
2497 2497 c, t dbSNP:147112200
2499 2499 a, g dbSNP:782362034
2504 2504 a, t dbSNP:782029094
2507 2507 c, t dbSNP:782158020
2517 2517 a, g dbSNP:782335186
2522 2522 a, g dbSNP:781927460
2529 2529 c, t dbSNP:781971794
2532 2532 a, g dbSNP:782082676
2543 2543 -, g dbSNP:782718791
2548 2548 a, g dbSNP:782772606
2568 2568 a, g dbSNP:781844998
2583 2583 c, t dbSNP:377519637
2584 2584 a, g dbSNP:782364269
2586 2586 g, t dbSNP:781809081
2602 2602 c, t dbSNP:370669534
2603 2603 a, g, t dbSNP:147732725
2610 2610 a, c dbSNP:782520598
2616 2616 c, g, t dbSNP:685523
2617 2617 a, c, g dbSNP:782742222
2618 2618 g, t dbSNP:782223061
2625 2625 c, t dbSNP:78977446
2626 2626 a, g dbSNP:782003158
2631 2631 -, c dbSNP:781796310
2632 2632 c, t dbSNP:782111896
2638 2638 c, t dbSNP:587726656
2641 2641 c, t dbSNP:145728650
2642 2642 a, g dbSNP:138742754
2645 2645 c, t dbSNP:781844824
2646 2646 a, g dbSNP:758243645
2649 2649 g, t dbSNP:781896718
2663 2663 c, t dbSNP:374444423
2675 2675 a, g dbSNP:201241072
2681 2681 g, t dbSNP:782189279
2682 2682 c, t dbSNP:587773478
2686 2686 a, c dbSNP:782617353
2690 2690 a, g dbSNP:782263547
2710 2710 a, g dbSNP:782380295
2716 2716 c, t dbSNP:782030553
2721 2721 c, t dbSNP:782154017
2729 2729 a, g dbSNP:782329783
2744 2744 c, t dbSNP:149265456
2745 2745 a, g dbSNP:782160285
2751 2751 a, g, t dbSNP:782770168
2753 2753 g, t dbSNP:782154286
2758 2758 a, g dbSNP:368858347
2760 2760 c, t dbSNP:781805469
2766 2766 c, t dbSNP:372449678
2767 2767 a, g dbSNP:375151860
2768 2768 g, t dbSNP:121908468
2770 2770 c, t dbSNP:781827094
2771 2771 c, t dbSNP:143568784
2778 2778 a, g dbSNP:200273776
2787 2787 a, g dbSNP:781863577
2796 2796 a, c, t dbSNP:368433734
2797 2797 a, g dbSNP:371554437
2798 2798 g, t dbSNP:782453982
2806 2806 c, t dbSNP:148031420
2807 2807 a, g dbSNP:141811556
2808 2808 c, t dbSNP:782502165
2809 2809 c, g dbSNP:782683498
2819 2819 -, agaggggtc dbSNP:781893176
2827 2827 c, t dbSNP:28641026
2831 2831 c, t dbSNP:782315945
2832 2832 a, g dbSNP:139951127
2847 2847 -, gtgccc dbSNP:387906346
2852 2852 c, t dbSNP:782220521
2853 2853 a, g dbSNP:142779872
2859 2859 a, g dbSNP:782009471
2861 2861 a, g dbSNP:36222275
2872 2872 c, t dbSNP:782146228
2874 2874 a, g dbSNP:782020908
2893 2893 c, t dbSNP:587618046
2895 2895 c, t dbSNP:139808736
2897 2897 c, t dbSNP:781842320
2909 2909 c, g dbSNP:782123812
2915 2915 c, t dbSNP:782761491
2916 2916 a, g dbSNP:781905328
2919 2919 c, t dbSNP:782536497
2920 2920 a, g dbSNP:149794949
2926 2926 c, t dbSNP:145835995
2953 2953 a, c dbSNP:781783629
2969 2969 a, g dbSNP:781815720
2970 2970 c, t dbSNP:148560341
2972 2972 a, c dbSNP:587735427
2977 2977 a, c dbSNP:370359180
2978 2978 c, t dbSNP:781908789
2987 2987 g, t dbSNP:121908472
2991 2991 c, t dbSNP:782586641
2992 2992 a, g dbSNP:782185362
2994 2994 c, t dbSNP:782363611
3000 3000 a, g dbSNP:782597967
3014 3014 a, g dbSNP:28503257
3020 3020 c, t dbSNP:782414383
3021 3021 a, g dbSNP:782016923
3024 3024 c, t dbSNP:142607772
3025 3025 a, g dbSNP:34934621
3031 3031 c, t dbSNP:781959371
3044 3044 c, g dbSNP:370081995
3050 3050 a, g dbSNP:782789479
3056 3056 c, g dbSNP:151138896
3058 3058 c, t dbSNP:782167288
3059 3059 a, g dbSNP:782585313
3067 3067 a, g dbSNP:36222579
3069 3069 a, t dbSNP:587681892
3070 3070 c, t dbSNP:782748173
3074 3074 g, t dbSNP:781825145
3075 3075 c, t dbSNP:373530345
3076 3076 a, g dbSNP:200349242
3084 3084 c, g, t dbSNP:376017677
3085 3085 a, g dbSNP:150322366
3088 3088 a, g dbSNP:36222580
3094 3094 a, g dbSNP:782223782
3096 3096 a, g dbSNP:587731517
3098 3098 -, cc dbSNP:782715762
3100 3100 c, t dbSNP:782251596
3101 3101 a, g dbSNP:782421000
3106 3106 -, ca dbSNP:782633692
3113 3113 a, c dbSNP:782025111
3115 3115 -, ct dbSNP:782288601
3123 3123 c, t dbSNP:782071778
3125 3125 a, g dbSNP:782706998
3127 3127 c, t dbSNP:138488999
3128 3128 a, g dbSNP:782090479
3129 3129 a, c dbSNP:782783025
3134 3134 a, t dbSNP:781898659
3135 3135 c, t dbSNP:782531291
3140 3140 c, t dbSNP:782700247
3141 3141 a, g dbSNP:138770906
3154 3154 c, t dbSNP:782478560
3175 3175 c, t dbSNP:200481038
3176 3176 c, t dbSNP:782195157
3184 3184 g, t dbSNP:782307600
3196 3196 -, c dbSNP:782415493
3197 3197 c, t dbSNP:781965782
3198 3198 a, g dbSNP:782080989
3200 3200 c, t dbSNP:782383410
3201 3201 a, g dbSNP:373569027
3203 3203 c, t dbSNP:377572669
3204 3204 a, g dbSNP:61751476
3214 3214 c, t dbSNP:199810396
3217 3217 c, t dbSNP:781942887
3218 3218 a, g dbSNP:781809898
3227 3227 a, g dbSNP:782054636
3233 3233 a, g dbSNP:782755326
3234 3234 c, t dbSNP:370060687
3235 3235 a, g dbSNP:782535994
3237 3237 c, t dbSNP:782630291
3241 3241 a, g dbSNP:781883131
3252 3252 g, t dbSNP:587755238
3262 3262 c, t dbSNP:782563217
3265 3265 a, g dbSNP:146073007
3271 3271 a, g dbSNP:782343769
3274 3274 a, g dbSNP:782647758
3280 3280 a, t dbSNP:371737266
3283 3283 a, g dbSNP:782238280
3285 3285 a, g dbSNP:782311861
3308 3308 g, t dbSNP:782018563
3312 3312 c, g dbSNP:782196406
3317 3317 a, g dbSNP:782311486
3321 3321 c, t dbSNP:762112077
3322 3322 a, c, g dbSNP:148715397
3323 3323 a, c dbSNP:781992360
3328 3328 c, t dbSNP:782164825
3334 3334 g, t dbSNP:782724202
3336 3336 c, t dbSNP:781785040
3337 3337 a, c dbSNP:782482318
3340 3340 c, t dbSNP:200547311
3341 3341 a, g dbSNP:587709422
3344 3344 a, g dbSNP:782504511
3345 3345 a, c dbSNP:782670806
3350 3350 a, g dbSNP:782270256
3355 3355 c, t dbSNP:186236347
3362 3362 c, t dbSNP:141494468
3363 3363 a, g dbSNP:782472825
3368 3368 a, g dbSNP:782226132
3370 3370 a, g dbSNP:782345031
3371 3371 g, t dbSNP:782007879
3373 3373 c, t dbSNP:782251776
3374 3374 a, g dbSNP:150853306
3381 3381 a, c dbSNP:781930177
3383 3383 a, g dbSNP:782044988
3409 3409 c, t dbSNP:782731435
3410 3410 c, t dbSNP:587664518
3411 3411 a, g dbSNP:139286990
3414 3414 a, g dbSNP:782760544
3415 3415 c, t dbSNP:781900705
3418 3418 a, g, t dbSNP:782533352
3426 3426 a, c dbSNP:373910725
3428 3428 c, t dbSNP:148500446
3429 3429 c, t dbSNP:200122302
3430 3430 a, c, g dbSNP:368634068
3434 3434 c, t dbSNP:782511560
3440 3440 c, t dbSNP:782689373
3442 3442 c, t dbSNP:782285009
3443 3443 c, t dbSNP:782300864
3444 3444 a, g dbSNP:782621505
3446 3446 a, c, t dbSNP:782200824
3447 3447 a, g dbSNP:370692680
3453 3453 a, t dbSNP:782166349
3457 3457 c, t dbSNP:147292523
3458 3458 a, g dbSNP:192619276
3459 3459 a, g dbSNP:782053981
3466 3466 a, g dbSNP:782741622
3467 3467 a, g dbSNP:781823708
3476 3476 g, t dbSNP:782128103
3480 3480 a, g dbSNP:782783483
3485 3485 a, c dbSNP:781911555
3496 3496 c, t dbSNP:781812128
3505 3505 a, c dbSNP:782230828
3512 3512 c, t dbSNP:782726688
3516 3516 a, c dbSNP:141056078
3522 3522 a, c dbSNP:782488785
3533 3533 c, t dbSNP:782818582
3534 3534 a, g dbSNP:781885530
3555 3555 a, g dbSNP:121908474
3558 3558 c, t dbSNP:782462227
3567 3567 c, t dbSNP:200847393
3568 3568 c, t dbSNP:782235608
3573 3573 a, g dbSNP:782649881
3580 3580 c, t dbSNP:144916851
3587 3587 a, g dbSNP:782422811
3592 3592 a, g dbSNP:782025363
3594 3594 c, t dbSNP:36222894
3599 3599 c, t dbSNP:148824378
3600 3600 a, g dbSNP:781945456
3601 3601 c, t dbSNP:782126709
3602 3602 a, g dbSNP:587643681
3603 3603 a, t dbSNP:782033398
3612 3612 a, g dbSNP:782143486
3616 3616 c, t dbSNP:782703594
3626 3626 a, g dbSNP:781787130
3630 3630 c, t dbSNP:587697598
3631 3631 -, g dbSNP:782771719
3634 3634 a, g dbSNP:781794202
3638 3638 a, c dbSNP:782458888
3641 3641 a, t dbSNP:782655118
3650 3650 c, t dbSNP:781844916
3652 3652 c, g dbSNP:782546720
3656 3656 c, t dbSNP:142489534
3657 3657 a, g dbSNP:782197792
3663 3663 c, t dbSNP:777593573
3666 3666 g, t dbSNP:782606443
3668 3668 a, c dbSNP:782212785
3673 3673 a, g dbSNP:368262020
3674 3674 a, g dbSNP:781990284
3679 3679 c, t dbSNP:782170295
3686 3686 c, t dbSNP:150961996
3687 3687 -, t dbSNP:387906341
3694 3694 c, t dbSNP:781942882
3695 3695 a, g dbSNP:782059952
3697 3697 c, g dbSNP:782767249
3699 3699 c, t dbSNP:781863146
3712 3712 c, g dbSNP:140876480
3713 3713 a, t dbSNP:782798764
3720 3720 c, t dbSNP:781882928
3721 3721 a, g dbSNP:782450286
3729 3729 c, t dbSNP:782564860
3737 3737 c, t dbSNP:371964138
3738 3738 a, g dbSNP:782467873
3741 3741 a, g dbSNP:782661218
3742 3742 a, c, t dbSNP:782463983
3743 3743 a, g dbSNP:144808448
3745 3745 a, g dbSNP:138659427
3746 3746 a, c, t dbSNP:140450669
3747 3747 a, c, g dbSNP:782090689
3760 3760 c, g dbSNP:782028925
3763 3763 a, g dbSNP:36222899
3770 3770 c, t dbSNP:370157837
3771 3771 a, c, g dbSNP:781918148
3773 3773 a, t dbSNP:782729077
3780 3780 a, g dbSNP:373393360
3806 3806 a, g dbSNP:782513398
3819 3819 c, t dbSNP:368010021
3825 3825 c, t dbSNP:782386775
3847 3847 c, t dbSNP:782207691
3848 3848 a, g dbSNP:782025840
3856 3856 c, t dbSNP:371841724
3859 3859 a, g dbSNP:782408438
3871 3871 c, g dbSNP:781935926
3873 3873 c, t dbSNP:375824927
3874 3874 a, g dbSNP:369087803
3879 3879 a, g, t dbSNP:200645384
3880 3880 c, t dbSNP:377265919
3881 3881 a, g dbSNP:369447661
3885 3885 c, g dbSNP:781880041
3887 3887 a, g dbSNP:768168577
3893 3893 c, t dbSNP:587618950
3893 3893 c, t dbSNP:774722082
3894 3894 a, g dbSNP:782693351
3905 3905 a, g dbSNP:781834668
3907 3907 c, t dbSNP:782477635
3912 3912 c, t dbSNP:782641810
3914 3914 c, t dbSNP:781854383
3915 3915 c, t dbSNP:782554524
3916 3916 a, g dbSNP:782669437
3919 3919 c, t dbSNP:782202074
3920 3920 a, g dbSNP:374154360
3924 3924 a, g dbSNP:782213090
3927 3927 g, t dbSNP:201841682
3929 3929 a, g dbSNP:782401854
3934 3934 c, t dbSNP:377686931
3942 3942 c, t dbSNP:782139077
3953 3953 a, g dbSNP:149354083
3955 3955 g, t dbSNP:144662080
3958 3958 c, t dbSNP:782321856
3959 3959 a, g dbSNP:587682066
3960 3960 c, t dbSNP:782097021
3967 3967 c, t dbSNP:587756604
3971 3971 a, g dbSNP:781870882
3977 3977 a, g dbSNP:782109481
3980 3980 a, g dbSNP:199856010
3982 3982 a, c dbSNP:138416072
3995 3995 a, g dbSNP:372967395
3999 3999 a, g dbSNP:782261759
4021 4021 c, g, t dbSNP:199775013
4026 4026 c, t dbSNP:782145338
4027 4027 a, g dbSNP:782708034
4031 4031 c, t dbSNP:781921050
4032 4032 a, t dbSNP:201687626
4046 4046 c, g dbSNP:782735074
4050 4050 a, c dbSNP:781880610
4051 4051 c, t dbSNP:751466560
4059 4059 -, a dbSNP:781855393
4059 4059 c, g dbSNP:782820940
4060 4060 -, a dbSNP:387906343
4072 4072 a, g dbSNP:781800177
4084 4084 g, t dbSNP:782443626
4091 4091 a, g dbSNP:782604159
4093 4093 a, g dbSNP:782213683
4105 4105 g, t dbSNP:782518928
4107 4107 -, c dbSNP:35876612
4107 4107 c, g dbSNP:587750566
4114 4114 c, t dbSNP:201166759
4122 4122 a, g dbSNP:782297535
4129 4129 a, g dbSNP:376932692
4135 4135 a, g dbSNP:781941841
4138 4138 a, c, t dbSNP:1055432
4142 4142 c, t dbSNP:781956159
4144 4144 a, g dbSNP:782139922
4145 4145 a, t dbSNP:370267598
4156 4156 a, g dbSNP:587765258
4158 4158 a, g dbSNP:782044465
4167 4167 -, a dbSNP:782551802
4174 4174 a, g dbSNP:782061067
4187 4187 a, g dbSNP:782684106
4197 4197 c, t dbSNP:781834087
4200 4200 a, g dbSNP:782460891
4206 4206 c, t dbSNP:782789529
4207 4207 a, g dbSNP:781851634
4222 4222 c, t dbSNP:375554257
4223 4223 a, c, g dbSNP:377151755
4229 4229 a, g dbSNP:782451905
4242 4242 a, g dbSNP:369498637
4260 4260 -, ag dbSNP:782656133
4271 4271 a, g dbSNP:782214749
4278 4278 c, t dbSNP:180910039
4281 4281 c, t dbSNP:587597243
4318 4318 a, g dbSNP:782302228
4337 4337 a, g dbSNP:782411652
4338 4338 c, t dbSNP:36223202
4369 4369 c, t dbSNP:142792179
4374 4374 c, t dbSNP:368574327
4386 4386 a, g dbSNP:587600594

Target ORF information:

RefSeq Version XM_011518174
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu64701D
Sequence Information ORF Nucleotide Sequence (Length: 3594bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008470.20) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1463..2074(+)
Misc Feature(2)1895..1927(+)
Misc Feature(3)2384..2542(+)
Position Chain Variation Link
10 10 a, t dbSNP:782648444
38 38 a, c dbSNP:36218236
59 59 a, g dbSNP:767510548
114 114 a, g dbSNP:782090120
148 148 a, g dbSNP:782756873
182 182 c, g dbSNP:782012158
191 191 a, c dbSNP:145664073
225 225 c, t dbSNP:781847132
235 235 -, a dbSNP:587610698
286 286 g, t dbSNP:750520194
303 303 c, g dbSNP:587756844
383 383 a, g dbSNP:186407464
386 386 c, t dbSNP:148897705
428 428 g, t dbSNP:375814137
446 446 c, g dbSNP:587612486
451 451 a, g dbSNP:77533110
468 468 -, agg dbSNP:782503636
515 515 c, g dbSNP:587722424
537 537 c, g, t dbSNP:190858293
543 543 a, g dbSNP:34785487
554 554 a, g dbSNP:117446670
585 585 a, g dbSNP:752590894
612 612 c, t dbSNP:781940384
619 619 a, g dbSNP:373574095
687 687 c, t dbSNP:587620710
692 692 a, g dbSNP:36218238
716 716 a, g dbSNP:587764211
733 733 a, g dbSNP:587637739
761 761 a, g dbSNP:587713277
805 805 c, t dbSNP:782438988
815 815 c, t dbSNP:782583225
832 832 a, c dbSNP:782336591
867 867 c, g dbSNP:782213648
869 869 c, t dbSNP:34265876
880 880 a, g dbSNP:782661656
946 946 a, g dbSNP:777585429
955 955 c, t dbSNP:587625933
1056 1056 c, t dbSNP:112367941
1057 1057 a, g dbSNP:587757210
1058 1058 c, t dbSNP:36218240
1071 1071 c, t dbSNP:587712950
1137 1137 c, t dbSNP:782434247
1174 1174 c, g dbSNP:587771364
1176 1176 c, t dbSNP:782752692
1180 1180 c, g dbSNP:587642688
1182 1182 c, t dbSNP:375938330
1195 1195 c, t dbSNP:201526748
1200 1200 c, t dbSNP:372036592
1202 1202 c, t dbSNP:374861060
1204 1204 c, t dbSNP:782561704
1207 1207 c, t dbSNP:782227169
1208 1208 a, c, g dbSNP:782338252
1215 1215 a, c dbSNP:782244801
1217 1217 c, t dbSNP:782417016
1229 1229 c, t dbSNP:782013900
1231 1231 c, t dbSNP:782193624
1232 1232 a, c dbSNP:782300973
1235 1235 c, t dbSNP:782204201
1236 1236 a, g dbSNP:370406676
1240 1240 c, g, t dbSNP:77985067
1241 1241 c, t dbSNP:375023076
1242 1242 c, g dbSNP:782717483
1244 1244 c, g, t dbSNP:34024143
1245 1245 a, g dbSNP:782744929
1252 1252 a, g dbSNP:782112627
1258 1258 -, cc dbSNP:782769020
1258 1258 g, t dbSNP:781869468
1261 1261 c, t dbSNP:782511371
1265 1265 -, tgtg dbSNP:781957622
1266 1266 c, g dbSNP:782679501
1273 1273 c, t dbSNP:782274726
1277 1277 a, g dbSNP:138886920
1280 1280 c, t dbSNP:782561010
1283 1283 a, g dbSNP:142293909
1297 1297 c, t dbSNP:782392800
1312 1312 a, g dbSNP:781994399
1315 1315 c, t dbSNP:368237030
1317 1317 c, t dbSNP:782296373
1323 1323 -, tc dbSNP:782134844
1359 1359 a, c dbSNP:782570157
1360 1360 a, c, t dbSNP:146394542
1361 1361 a, g, t dbSNP:201522226
1363 1363 g, t dbSNP:369130757
1371 1371 a, g dbSNP:373832736
1375 1375 c, g dbSNP:782217202
1393 1393 a, g dbSNP:782394264
1400 1400 c, t dbSNP:139735640
1401 1401 a, g dbSNP:370929256
1403 1403 a, c dbSNP:370611753
1404 1404 c, t dbSNP:782677352
1406 1406 c, g dbSNP:782680569
1410 1410 c, t dbSNP:375370257
1418 1418 c, t dbSNP:782453359
1420 1420 -, cagagg, cagaggcagagg dbSNP:782306107
1421 1421 -, cagaggcagagg dbSNP:781853881
1421 1421 -, cagagg dbSNP:782548827
1427 1427 c, t dbSNP:782576304
1438 1438 a, g dbSNP:782220406
1449 1449 c, g dbSNP:142366230
1450 1450 c, t dbSNP:143856697
1452 1452 c, t dbSNP:782302107
1456 1456 c, t dbSNP:367627378
1457 1457 a, g dbSNP:587712720
1458 1458 g, t dbSNP:782188171
1463 1463 c, t dbSNP:200841843
1466 1466 c, t dbSNP:148644959
1467 1467 a, g dbSNP:781958663
1472 1472 a, g dbSNP:587611213
1486 1486 c, t dbSNP:782777667
1492 1492 c, t dbSNP:782035751
1495 1495 c, t dbSNP:756898709
1497 1497 a, g dbSNP:782149039
1509 1509 c, t dbSNP:370263552
1511 1511 c, g dbSNP:121908467
1515 1515 a, g dbSNP:781788692
1516 1516 -, ggaggacacagagcgctatgtgctcacca dbSNP:387906345
1522 1522 c, g dbSNP:782483941
1528 1528 -, c dbSNP:782203933
1529 1529 c, t dbSNP:121908469
1530 1530 a, g dbSNP:782716712
1531 1531 c, t dbSNP:781864642
1538 1538 c, t dbSNP:782488906
1542 1542 a, c dbSNP:782681039
1555 1555 c, t dbSNP:142107133
1559 1559 c, g, t dbSNP:782188741
1567 1567 a, g dbSNP:782615140
1571 1571 c, t dbSNP:782209298
1572 1572 a, g dbSNP:151206890
1576 1576 c, t dbSNP:781983991
1578 1578 c, t dbSNP:587698109
1579 1579 a, g dbSNP:28571612
1582 1582 c, t dbSNP:147563206
1585 1585 a, g dbSNP:375151732
1598 1598 a, c dbSNP:776837883
1598 1598 a, c, t dbSNP:587701622
1599 1599 a, g dbSNP:587602236
1625 1625 c, g dbSNP:147643918
1629 1629 c, t dbSNP:782814321
1631 1631 a, g dbSNP:142237685
1634 1634 c, t dbSNP:782464030
1640 1640 g, t dbSNP:781882283
1643 1643 a, g dbSNP:782445469
1645 1645 c, t dbSNP:3118667
1652 1652 a, g dbSNP:145175796
1654 1654 c, t dbSNP:782519773
1656 1656 c, t dbSNP:782644086
1660 1660 c, t dbSNP:149175416
1671 1671 c, t dbSNP:377681196
1676 1676 c, t dbSNP:781937618
1684 1684 c, t dbSNP:782180043
1685 1685 a, g dbSNP:369026148
1693 1693 g, t dbSNP:781950676
1701 1701 a, c dbSNP:782127630
1704 1704 c, t dbSNP:587696077
1710 1710 a, c dbSNP:782747858
1720 1720 c, t dbSNP:782026673
1721 1721 a, g dbSNP:781825239
1725 1725 c, t dbSNP:141932927
1726 1726 a, g dbSNP:587636999
1745 1745 c, t dbSNP:372637811
1749 1749 c, t dbSNP:782799810
1751 1751 c, t dbSNP:781854972
1755 1755 a, g dbSNP:200594025
1771 1771 c, t dbSNP:148849381
1777 1777 a, g dbSNP:782652490
1784 1784 c, g dbSNP:148312697
1792 1792 c, t dbSNP:782555111
1793 1793 c, t dbSNP:782650307
1794 1794 a, g dbSNP:142152759
1803 1803 g, t dbSNP:782083669
1807 1807 c, t dbSNP:34054981
1808 1808 a, g dbSNP:138489501
1812 1812 c, t dbSNP:121908470
1813 1813 c, t dbSNP:376549668
1816 1816 a, g dbSNP:782037445
1822 1822 c, t dbSNP:201048039
1823 1823 a, g dbSNP:782328666
1825 1825 g, t dbSNP:781922767
1826 1826 a, g dbSNP:782095571
1834 1834 c, t dbSNP:782718222
1838 1838 a, c dbSNP:781874381
1841 1841 c, t dbSNP:782116819
1843 1843 g, t dbSNP:782804156
1846 1846 c, g dbSNP:781884793
1848 1848 c, g dbSNP:782442144
1852 1852 c, g dbSNP:143035878
1855 1855 g, t dbSNP:199661242
1858 1858 c, t dbSNP:782534418
1864 1864 c, t dbSNP:782439387
1868 1868 a, g dbSNP:782640617
1874 1874 a, g dbSNP:782305581
1877 1877 c, t dbSNP:200017456
1892 1892 a, g dbSNP:782586734
1931 1931 a, g dbSNP:781916049
1974 1974 c, t dbSNP:121908478
1985 1985 a, g dbSNP:782093693
2005 2005 c, t dbSNP:782774484
2025 2025 a, g dbSNP:587623575
2028 2028 c, g dbSNP:121908477
2059 2059 g, t dbSNP:587671802
2069 2069 c, g dbSNP:782674608
2082 2082 c, t dbSNP:782184693
2090 2090 c, t dbSNP:782429486
2093 2093 c, t dbSNP:782613885
2095 2095 c, t dbSNP:754541465
2097 2097 c, g dbSNP:782379766
2098 2098 g, t dbSNP:782036565
2099 2099 a, t dbSNP:782282073
2100 2100 a, c dbSNP:782322129
2102 2102 a, g dbSNP:781919201
2112 2112 a, c dbSNP:782102945
2113 2113 a, g dbSNP:372413496
2115 2115 c, t dbSNP:782001479
2116 2116 a, g dbSNP:782114348
2127 2127 c, g dbSNP:782818563
2128 2128 c, t dbSNP:377143536
2134 2134 c, t dbSNP:782059317
2144 2144 a, g dbSNP:150518374
2158 2158 c, t dbSNP:369514834
2161 2161 c, t dbSNP:36219562
2166 2166 c, t dbSNP:782291570
2170 2170 c, t dbSNP:782640937
2173 2173 -, c dbSNP:781919209
2174 2174 c, t dbSNP:781911708
2179 2179 a, g dbSNP:782542948
2186 2186 a, c, g dbSNP:782601193
2193 2193 c, g dbSNP:782360062
2194 2194 c, t dbSNP:782596096
2197 2197 c, t dbSNP:782268976
2198 2198 g, t dbSNP:587667471
2215 2215 c, t dbSNP:782432260
2224 2224 a, g dbSNP:757725461
2238 2238 a, t dbSNP:782616826
2241 2241 c, g dbSNP:149517360
2245 2245 c, t dbSNP:144498742
2247 2247 c, t dbSNP:115943536
2248 2248 a, g dbSNP:199953481
2274 2274 g, t dbSNP:587706274
2278 2278 c, t dbSNP:372461655
2279 2279 a, c, g dbSNP:377191898
2308 2308 c, t dbSNP:587606690
2309 2309 a, g dbSNP:781924046
2325 2325 c, g dbSNP:782270618
2327 2327 a, g dbSNP:782380073
2329 2329 c, g dbSNP:374597782
2333 2333 c, t dbSNP:145252342
2334 2334 a, g dbSNP:200406381
2339 2339 c, t dbSNP:781914134
2340 2340 a, g dbSNP:782091585
2341 2341 c, t dbSNP:782153255
2348 2348 g, t dbSNP:371969346
2350 2350 a, g dbSNP:782806684
2358 2358 c, g dbSNP:782003178
2362 2362 c, t dbSNP:147607799
2363 2363 a, g dbSNP:782810090
2371 2371 a, c dbSNP:781794348
2375 2375 c, t dbSNP:587613745
2377 2377 c, t dbSNP:140640175
2381 2381 a, c, t dbSNP:142214608
2382 2382 a, g dbSNP:151048660
2385 2385 c, g dbSNP:780251348
2392 2392 c, g dbSNP:782641144
2394 2394 a, g dbSNP:374655146
2399 2399 c, t dbSNP:782530823
2402 2402 c, g dbSNP:782570540
2403 2403 a, g dbSNP:140937290
2407 2407 a, t dbSNP:587750968
2416 2416 c, t dbSNP:782609209
2417 2417 c, t dbSNP:376606652
2418 2418 a, g dbSNP:121908471
2425 2425 c, t dbSNP:142570561
2426 2426 a, g dbSNP:782033728
2433 2433 g, t dbSNP:782072116
2437 2437 a, g, t dbSNP:782314532
2440 2440 c, t dbSNP:145768029
2457 2457 a, g dbSNP:140582930
2471 2471 c, t dbSNP:782657509
2472 2472 a, c dbSNP:369465957
2476 2476 c, t dbSNP:781959119
2479 2479 -, g, ggg dbSNP:781886798
2479 2479 a, t dbSNP:782077607
2485 2485 g, t dbSNP:782768459
2486 2486 c, t dbSNP:145825553
2487 2487 a, c, g dbSNP:782541751
2491 2491 a, c dbSNP:781796744
2492 2492 c, t dbSNP:782492477
2499 2499 a, g, t dbSNP:782602523
2507 2507 c, t dbSNP:782519493
2508 2508 c, t dbSNP:782682017
2514 2514 c, t dbSNP:782278375
2515 2515 c, t dbSNP:138401488
2516 2516 a, g dbSNP:781915989
2518 2518 c, g dbSNP:782224267
2521 2521 a, g dbSNP:141471395
2526 2526 a, g dbSNP:781993871
2533 2533 c, g dbSNP:587642546
2539 2539 c, t dbSNP:781989547
2540 2540 a, g dbSNP:748223519
2552 2552 a, c dbSNP:782174746
2555 2555 g, t dbSNP:587708651
2558 2558 g, t dbSNP:781813768
2560 2560 c, t dbSNP:782055451
2561 2561 a, g dbSNP:782733359
2563 2563 a, g, t dbSNP:781815925
2565 2565 c, t dbSNP:782630536
2566 2566 a, c, g dbSNP:587602874
2567 2567 c, g dbSNP:2301612
2570 2570 c, t dbSNP:121908476
2573 2573 c, t dbSNP:782344627
2575 2575 c, t dbSNP:782645434
2576 2576 a, g dbSNP:375508823
2581 2581 a, g dbSNP:782424568
2584 2584 c, t dbSNP:148365271
2585 2585 a, c, g dbSNP:782076268
2587 2587 c, t dbSNP:782355981
2588 2588 a, c, g dbSNP:587613923
2591 2591 c, g dbSNP:781977102
2593 2593 g, t dbSNP:36220239
2595 2595 c, t dbSNP:36220240
2596 2596 a, g dbSNP:781802178
2600 2600 c, g dbSNP:782433445
2601 2601 a, g, t dbSNP:782733057
2610 2610 c, t dbSNP:782497226
2611 2611 c, t dbSNP:587634841
2612 2612 c, g dbSNP:782279962
2614 2614 c, t dbSNP:138035204
2615 2615 a, g dbSNP:587768675
2617 2617 c, t dbSNP:782239711
2628 2628 a, g dbSNP:782339799
2637 2637 g, t dbSNP:781992856
2648 2648 c, t dbSNP:11575933
2652 2652 a, g dbSNP:782410985
2653 2653 c, t dbSNP:782015114
2659 2659 -, g dbSNP:782472621
2662 2662 a, g dbSNP:372953477
2670 2670 c, t dbSNP:782405037
2673 2673 a, g dbSNP:781946010
2676 2676 a, g dbSNP:28375042
2680 2680 c, t dbSNP:199876716
2681 2681 -, at dbSNP:782242503
2682 2682 g, t dbSNP:782052182
2687 2687 c, t dbSNP:782769100
2688 2688 a, g dbSNP:147201977
2691 2691 c, t dbSNP:782128293
2698 2698 c, t dbSNP:140501683
2702 2702 a, c dbSNP:377220995
2704 2704 c, t dbSNP:376102311
2706 2706 -, tca dbSNP:782437870
2710 2710 c, g dbSNP:782540244
2711 2711 a, g dbSNP:782574335
2716 2716 g, t dbSNP:781786860
2717 2717 c, t dbSNP:201457594
2722 2722 a, g dbSNP:782607445
2724 2724 a, c dbSNP:149706655
2729 2729 g, t dbSNP:782419451
2734 2734 c, t dbSNP:782671668
2735 2735 a, g dbSNP:782200160
2743 2743 a, c dbSNP:782315134
2750 2750 a, g dbSNP:782089166
2756 2756 a, g dbSNP:144618753
2760 2760 a, g dbSNP:782392744
2761 2761 c, g dbSNP:75928689
2765 2765 c, g, t dbSNP:370215524
2766 2766 a, g dbSNP:374465629
2772 2772 a, g dbSNP:781807478
2773 2773 a, c, t dbSNP:587612482
2773 2773 c, t dbSNP:758174895
2774 2774 a, g dbSNP:376459838
2776 2776 a, c, g dbSNP:148472763
2778 2778 a, c dbSNP:781894953
2782 2782 a, g dbSNP:587745572
2796 2796 c, t dbSNP:782454600
2807 2807 a, g dbSNP:121908473
2811 2811 c, g dbSNP:782343737
2826 2826 a, g dbSNP:782003053
2832 2832 g, t dbSNP:782292367
2847 2847 c, t dbSNP:782417749
2848 2848 a, g dbSNP:781937390
2857 2857 g, t dbSNP:142282539
2869 2869 c, t dbSNP:369336602
2875 2875 g, t dbSNP:150203373
2878 2878 c, t dbSNP:146779903
2886 2886 c, t dbSNP:782771879
2887 2887 a, g, t dbSNP:781897271
2897 2897 c, t dbSNP:782055634
2916 2916 a, c dbSNP:140628579
2925 2925 a, c, t dbSNP:782272645
2926 2926 a, g dbSNP:374868673
2931 2931 a, t dbSNP:375509487
2932 2932 a, g dbSNP:144282342
2940 2940 c, t dbSNP:781840717
2941 2941 a, g dbSNP:3124768
2958 2958 c, t dbSNP:782647983
2966 2966 a, g dbSNP:782254257
2967 2967 a, c dbSNP:782427556
2977 2977 c, t dbSNP:782660413
2986 2986 c, t dbSNP:369872722
2992 2992 a, g, t dbSNP:372789831
3008 3008 -, tt dbSNP:387906344
3013 3013 a, g dbSNP:782132022
3022 3022 c, t dbSNP:36221216
3023 3023 a, g dbSNP:782036643
3026 3026 a, g dbSNP:782151601
3029 3029 c, t dbSNP:150234885
3031 3031 c, t dbSNP:781783061
3035 3035 a, g dbSNP:34256013
3037 3037 c, t dbSNP:782726724
3038 3038 a, g, t dbSNP:781872245
3040 3040 g, t dbSNP:375622643
3046 3046 a, g dbSNP:371209152
3049 3049 g, t dbSNP:782450096
3055 3055 c, t dbSNP:36221217
3060 3060 c, t dbSNP:782219285
3066 3066 a, c dbSNP:782396358
3073 3073 c, t dbSNP:781993504
3076 3076 c, g, t dbSNP:371266006
3077 3077 c, g dbSNP:28647808
3081 3081 c, t dbSNP:781947512
3085 3085 c, t dbSNP:751652402
3098 3098 c, t dbSNP:587721043
3099 3099 a, g dbSNP:36090624
3103 3103 c, t dbSNP:781945326
3104 3104 a, g, t dbSNP:60398774
3119 3119 c, g dbSNP:782761353
3124 3124 a, c, t dbSNP:143573766
3125 3125 a, g dbSNP:34569244
3131 3131 c, t dbSNP:201704847
3138 3138 c, t dbSNP:782466560
3140 3140 c, t dbSNP:147166780
3141 3141 a, g, t dbSNP:138699340
3146 3146 a, g dbSNP:782547718
3155 3155 c, t dbSNP:782659882
3156 3156 a, g dbSNP:782184721
3160 3160 a, c dbSNP:141265567
3169 3169 c, t dbSNP:587673448
3183 3183 c, g, t dbSNP:587726180
3194 3194 a, g dbSNP:782470631
3201 3201 a, g dbSNP:150764227
3203 3203 c, t dbSNP:587693885
3204 3204 a, g dbSNP:117943654
3211 3211 c, g dbSNP:199741568
3212 3212 a, g dbSNP:782199892
3214 3214 a, g dbSNP:368018318
3233 3233 c, t dbSNP:139214644
3234 3234 a, g dbSNP:149953167
3245 3245 a, g dbSNP:782028864
3247 3247 c, t dbSNP:782144746
3252 3252 c, t dbSNP:782709302
3256 3256 a, c, t dbSNP:781784468
3259 3259 c, g dbSNP:587765025
3272 3272 c, t dbSNP:781875492
3275 3275 c, t dbSNP:370121816
3284 3284 -, g dbSNP:34245310
3292 3292 a, c, t dbSNP:782806565
3293 3293 a, g dbSNP:374840594
3299 3299 c, t dbSNP:121908475
3300 3300 a, g dbSNP:782214086
3312 3312 c, g, t dbSNP:201605295
3313 3313 a, g dbSNP:782288267
3314 3314 a, c, g dbSNP:367818172
3320 3320 c, t dbSNP:781785491
3326 3326 a, g dbSNP:782177142
3332 3332 c, t dbSNP:146314458
3336 3336 a, g dbSNP:782223605
3340 3340 a, g dbSNP:782400086
3359 3359 c, g dbSNP:781993713
3361 3361 a, c dbSNP:782301837
3380 3380 a, g dbSNP:782421679
3389 3389 c, g dbSNP:781937174
3392 3392 a, c dbSNP:138014548
3398 3398 c, g dbSNP:782354328
3402 3402 a, g dbSNP:372471786
3416 3416 c, t dbSNP:782116595
3420 3420 c, t dbSNP:41314453
3421 3421 a, g dbSNP:781888677
3425 3425 a, c dbSNP:782058485
3436 3436 c, t dbSNP:587731476
3439 3439 c, g dbSNP:781830585
3441 3441 c, t dbSNP:587610691
3442 3442 c, t dbSNP:144178018
3443 3443 a, g dbSNP:36221451
3445 3445 a, t dbSNP:782559298
3452 3452 c, g, t dbSNP:782671915
3465 3465 c, t dbSNP:367887198
3466 3466 g, t dbSNP:782251114
3479 3479 a, g dbSNP:148734700
3484 3484 a, c dbSNP:782037951
3490 3490 c, t dbSNP:372033921
3491 3491 a, g dbSNP:782719456
3493 3493 c, t dbSNP:781923426
3499 3499 g, t dbSNP:587639501
3500 3500 g, t dbSNP:782640568
3503 3503 a, g dbSNP:782729939
3505 3505 c, t dbSNP:3124767
3506 3506 a, g dbSNP:782542048
3512 3512 c, t dbSNP:782807182
3513 3513 a, g, t dbSNP:781804540
3518 3518 c, t dbSNP:782614158
3527 3527 c, t dbSNP:782206311
3528 3528 a, g dbSNP:369510827
3533 3533 a, g dbSNP:374606481
3563 3563 c, t dbSNP:782298936
3567 3567 c, t dbSNP:782406453
3576 3576 a, g dbSNP:377187626
3577 3577 a, g dbSNP:782187097
3583 3583 -, gcag dbSNP:781954210
3586 3586 a, g dbSNP:782365382
3590 3590 a, g dbSNP:781957737
3592 3592 c, g dbSNP:782136497
3601 3601 -, agctgtggcgctggaaacctgcaacc dbSNP:387906342
3609 3609 c, t dbSNP:201607490
3610 3610 a, g dbSNP:782014438
3629 3629 a, c dbSNP:782061756
3635 3635 c, t dbSNP:754909071
3648 3648 a, g dbSNP:782636321
3661 3661 -, c dbSNP:782363784
3663 3663 c, g dbSNP:782279427
3664 3664 c, t dbSNP:782322007
3680 3680 a, g dbSNP:781915055
3681 3681 c, t dbSNP:372962493
3689 3689 a, g dbSNP:782337019
3700 3700 c, t dbSNP:587601722
3710 3710 a, g dbSNP:782110632
3717 3717 a, g dbSNP:782816059
3718 3718 c, t dbSNP:781898935
3719 3719 a, g dbSNP:34104386
3733 3733 c, t dbSNP:36221472
3743 3743 g, t dbSNP:781842149
3745 3745 c, t dbSNP:782466905
3754 3754 a, t dbSNP:782659481
3758 3758 a, g dbSNP:200125026
3769 3769 c, t dbSNP:781855822
3770 3770 a, g dbSNP:140639242
3773 3773 a, g dbSNP:782584684
3777 3777 a, g dbSNP:201106433
3796 3796 a, g dbSNP:587738759
3798 3798 c, g dbSNP:782587447
3799 3799 -, ct dbSNP:782028569
3805 3805 c, t dbSNP:147112200
3807 3807 a, g dbSNP:782362034
3812 3812 a, t dbSNP:782029094
3815 3815 c, t dbSNP:782158020
3825 3825 a, g dbSNP:782335186
3830 3830 a, g dbSNP:781927460
3837 3837 c, t dbSNP:781971794
3840 3840 a, g dbSNP:782082676
3851 3851 -, g dbSNP:782718791
3856 3856 a, g dbSNP:782772606
3876 3876 a, g dbSNP:781844998
3891 3891 c, t dbSNP:377519637
3892 3892 a, g dbSNP:782364269
3894 3894 g, t dbSNP:781809081
3910 3910 c, t dbSNP:370669534
3911 3911 a, g, t dbSNP:147732725
3918 3918 a, c dbSNP:782520598
3924 3924 c, g, t dbSNP:685523
3925 3925 a, c, g dbSNP:782742222
3926 3926 g, t dbSNP:782223061
3933 3933 c, t dbSNP:78977446
3934 3934 a, g dbSNP:782003158
3939 3939 -, c dbSNP:781796310
3940 3940 c, t dbSNP:782111896
3946 3946 c, t dbSNP:587726656
3949 3949 c, t dbSNP:145728650
3950 3950 a, g dbSNP:138742754
3953 3953 c, t dbSNP:781844824
3954 3954 a, g dbSNP:758243645
3957 3957 g, t dbSNP:781896718
3971 3971 c, t dbSNP:374444423
3983 3983 a, g dbSNP:201241072
3989 3989 g, t dbSNP:782189279
3990 3990 c, t dbSNP:587773478
3994 3994 a, c dbSNP:782617353
3998 3998 a, g dbSNP:782263547
4018 4018 a, g dbSNP:782380295
4024 4024 c, t dbSNP:782030553
4029 4029 c, t dbSNP:782154017
4037 4037 a, g dbSNP:782329783
4052 4052 c, t dbSNP:149265456
4053 4053 a, g dbSNP:782160285
4059 4059 a, g, t dbSNP:782770168
4061 4061 g, t dbSNP:782154286
4066 4066 a, g dbSNP:368858347
4068 4068 c, t dbSNP:781805469
4074 4074 c, t dbSNP:372449678
4075 4075 a, g dbSNP:375151860
4076 4076 g, t dbSNP:121908468
4078 4078 c, t dbSNP:781827094
4079 4079 c, t dbSNP:143568784
4086 4086 a, g dbSNP:200273776
4095 4095 a, g dbSNP:781863577
4104 4104 a, c, t dbSNP:368433734
4105 4105 a, g dbSNP:371554437
4106 4106 g, t dbSNP:782453982
4114 4114 c, t dbSNP:148031420
4115 4115 a, g dbSNP:141811556
4116 4116 c, t dbSNP:782502165
4117 4117 c, g dbSNP:782683498
4127 4127 -, agaggggtc dbSNP:781893176
4135 4135 c, t dbSNP:28641026
4139 4139 c, t dbSNP:782315945
4140 4140 a, g dbSNP:139951127
4155 4155 -, gtgccc dbSNP:387906346
4160 4160 c, t dbSNP:782220521
4161 4161 a, g dbSNP:142779872
4167 4167 a, g dbSNP:782009471
4169 4169 a, g dbSNP:36222275
4180 4180 c, t dbSNP:782146228
4182 4182 a, g dbSNP:782020908
4201 4201 c, t dbSNP:587618046
4203 4203 c, t dbSNP:139808736
4205 4205 c, t dbSNP:781842320
4217 4217 c, g dbSNP:782123812
4223 4223 c, t dbSNP:782761491
4224 4224 a, g dbSNP:781905328
4227 4227 c, t dbSNP:782536497
4228 4228 a, g dbSNP:149794949
4234 4234 c, t dbSNP:145835995
4261 4261 a, c dbSNP:781783629
4277 4277 a, g dbSNP:781815720
4278 4278 c, t dbSNP:148560341
4280 4280 a, c dbSNP:587735427
4285 4285 a, c dbSNP:370359180
4286 4286 c, t dbSNP:781908789
4295 4295 g, t dbSNP:121908472
4299 4299 c, t dbSNP:782586641
4300 4300 a, g dbSNP:782185362
4302 4302 c, t dbSNP:782363611
4308 4308 a, g dbSNP:782597967
4322 4322 a, g dbSNP:28503257
4328 4328 c, t dbSNP:782414383
4329 4329 a, g dbSNP:782016923
4332 4332 c, t dbSNP:142607772
4333 4333 a, g dbSNP:34934621
4339 4339 c, t dbSNP:781959371
4352 4352 c, g dbSNP:370081995
4358 4358 a, g dbSNP:782789479
4364 4364 c, g dbSNP:151138896
4366 4366 c, t dbSNP:782167288
4367 4367 a, g dbSNP:782585313
4375 4375 a, g dbSNP:36222579
4377 4377 a, t dbSNP:587681892
4378 4378 c, t dbSNP:782748173
4382 4382 g, t dbSNP:781825145
4383 4383 c, t dbSNP:373530345
4384 4384 a, g dbSNP:200349242
4392 4392 c, g, t dbSNP:376017677
4393 4393 a, g dbSNP:150322366
4396 4396 a, g dbSNP:36222580
4402 4402 a, g dbSNP:782223782
4404 4404 a, g dbSNP:587731517
4406 4406 -, cc dbSNP:782715762
4408 4408 c, t dbSNP:782251596
4409 4409 a, g dbSNP:782421000
4414 4414 -, ca dbSNP:782633692
4421 4421 a, c dbSNP:782025111
4423 4423 -, ct dbSNP:782288601
4431 4431 c, t dbSNP:782071778
4433 4433 a, g dbSNP:782706998
4435 4435 c, t dbSNP:138488999
4436 4436 a, g dbSNP:782090479
4437 4437 a, c dbSNP:782783025
4442 4442 a, t dbSNP:781898659
4443 4443 c, t dbSNP:782531291
4448 4448 c, t dbSNP:782700247
4449 4449 a, g dbSNP:138770906
4462 4462 c, t dbSNP:782478560
4483 4483 c, t dbSNP:200481038
4484 4484 c, t dbSNP:782195157
4492 4492 g, t dbSNP:782307600
4504 4504 -, c dbSNP:782415493
4505 4505 c, t dbSNP:781965782
4506 4506 a, g dbSNP:782080989
4508 4508 c, t dbSNP:782383410
4509 4509 a, g dbSNP:373569027
4511 4511 c, t dbSNP:377572669
4512 4512 a, g dbSNP:61751476
4522 4522 c, t dbSNP:199810396
4525 4525 c, t dbSNP:781942887
4526 4526 a, g dbSNP:781809898
4535 4535 a, g dbSNP:782054636
4541 4541 a, g dbSNP:782755326
4542 4542 c, t dbSNP:370060687
4543 4543 a, g dbSNP:782535994
4545 4545 c, t dbSNP:782630291
4549 4549 a, g dbSNP:781883131
4560 4560 g, t dbSNP:587755238
4570 4570 c, t dbSNP:782563217
4573 4573 a, g dbSNP:146073007
4579 4579 a, g dbSNP:782343769
4582 4582 a, g dbSNP:782647758
4588 4588 a, t dbSNP:371737266
4591 4591 a, g dbSNP:782238280
4593 4593 a, g dbSNP:782311861
4616 4616 g, t dbSNP:782018563
4620 4620 c, g dbSNP:782196406
4625 4625 a, g dbSNP:782311486
4629 4629 c, t dbSNP:762112077
4630 4630 a, c, g dbSNP:148715397
4631 4631 a, c dbSNP:781992360
4636 4636 c, t dbSNP:782164825
4642 4642 g, t dbSNP:782724202
4644 4644 c, t dbSNP:781785040
4645 4645 a, c dbSNP:782482318
4648 4648 c, t dbSNP:200547311
4649 4649 a, g dbSNP:587709422
4652 4652 a, g dbSNP:782504511
4653 4653 a, c dbSNP:782670806
4658 4658 a, g dbSNP:782270256
4663 4663 c, t dbSNP:186236347
4670 4670 c, t dbSNP:141494468
4671 4671 a, g dbSNP:782472825
4676 4676 a, g dbSNP:782226132
4678 4678 a, g dbSNP:782345031
4679 4679 g, t dbSNP:782007879
4681 4681 c, t dbSNP:782251776
4682 4682 a, g dbSNP:150853306
4689 4689 a, c dbSNP:781930177
4691 4691 a, g dbSNP:782044988
4717 4717 c, t dbSNP:782731435
4718 4718 c, t dbSNP:587664518
4719 4719 a, g dbSNP:139286990
4722 4722 a, g dbSNP:782760544
4723 4723 c, t dbSNP:781900705
4726 4726 a, g, t dbSNP:782533352
4734 4734 a, c dbSNP:373910725
4736 4736 c, t dbSNP:148500446
4737 4737 c, t dbSNP:200122302
4738 4738 a, c, g dbSNP:368634068
4742 4742 c, t dbSNP:782511560
4748 4748 c, t dbSNP:782689373
4750 4750 c, t dbSNP:782285009
4751 4751 c, t dbSNP:782300864
4752 4752 a, g dbSNP:782621505
4754 4754 a, c, t dbSNP:782200824
4755 4755 a, g dbSNP:370692680
4761 4761 a, t dbSNP:782166349
4765 4765 c, t dbSNP:147292523
4766 4766 a, g dbSNP:192619276
4767 4767 a, g dbSNP:782053981
4774 4774 a, g dbSNP:782741622
4775 4775 a, g dbSNP:781823708
4784 4784 g, t dbSNP:782128103
4788 4788 a, g dbSNP:782783483
4793 4793 a, c dbSNP:781911555
4805 4805 c, t dbSNP:781812128
4814 4814 a, c dbSNP:782230828
4821 4821 c, t dbSNP:782726688
4825 4825 a, c dbSNP:141056078
4831 4831 a, c dbSNP:782488785
4842 4842 c, t dbSNP:782818582
4843 4843 a, g dbSNP:781885530
4864 4864 a, g dbSNP:121908474
4867 4867 c, t dbSNP:782462227
4876 4876 c, t dbSNP:200847393
4877 4877 c, t dbSNP:782235608
4882 4882 a, g dbSNP:782649881
4889 4889 c, t dbSNP:144916851
4896 4896 a, g dbSNP:782422811
4901 4901 a, g dbSNP:782025363
4903 4903 c, t dbSNP:36222894
4908 4908 c, t dbSNP:148824378
4909 4909 a, g dbSNP:781945456
4910 4910 c, t dbSNP:782126709
4911 4911 a, g dbSNP:587643681
4912 4912 a, t dbSNP:782033398

Target ORF information:

RefSeq Version XM_011518175
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif, 13 (ADAMTS13), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu64702D
Sequence Information ORF Nucleotide Sequence (Length: 3300bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product A disintegrin and metalloproteinase with thrombospondin motifs 13 isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_008470.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)255..413(+)
Position Chain Variation Link
10 10 c, t dbSNP:782031676
13 13 c, t dbSNP:782142895
14 14 c, t dbSNP:28729234
16 16 a, c, g dbSNP:781918765
25 25 -, g dbSNP:782093351
28 28 c, g dbSNP:782740878
29 29 a, t dbSNP:781870655
32 32 a, g dbSNP:587616629
36 36 g, t dbSNP:375767052
38 38 a, g dbSNP:782798456
43 43 a, c dbSNP:781808050
44 44 a, c dbSNP:782444847
46 46 g, t dbSNP:782616591
47 47 c, g dbSNP:781828222
48 48 c, t dbSNP:782517734
49 49 a, g, t dbSNP:367819139
50 50 c, t dbSNP:782402561
55 55 c, g dbSNP:371350265
64 64 c, t dbSNP:782579493
65 65 a, g dbSNP:782183226
66 66 -, c dbSNP:782744649
69 69 a, c dbSNP:587744487
72 72 -, a dbSNP:781863038
72 72 a, c, g dbSNP:3124773
77 77 g, t dbSNP:782254917
80 80 a, c dbSNP:782420537
81 81 a, c dbSNP:782020311
86 86 c, t dbSNP:782432260
95 95 a, g dbSNP:757725461
109 109 a, t dbSNP:782616826
112 112 c, g dbSNP:149517360
116 116 c, t dbSNP:144498742
118 118 c, t dbSNP:115943536
119 119 a, g dbSNP:199953481
145 145 g, t dbSNP:587706274
149 149 c, t dbSNP:372461655
150 150 a, c, g dbSNP:377191898
179 179 c, t dbSNP:587606690
180 180 a, g dbSNP:781924046
196 196 c, g dbSNP:782270618
198 198 a, g dbSNP:782380073
200 200 c, g dbSNP:374597782
204 204 c, t dbSNP:145252342
205 205 a, g dbSNP:200406381
210 210 c, t dbSNP:781914134
211 211 a, g dbSNP:782091585
212 212 c, t dbSNP:782153255
219 219 g, t dbSNP:371969346
221 221 a, g dbSNP:782806684
229 229 c, g dbSNP:782003178
233 233 c, t dbSNP:147607799
234 234 a, g dbSNP:782810090
242 242 a, c dbSNP:781794348
246 246 c, t dbSNP:587613745
248 248 c, t dbSNP:140640175
252 252 a, c, t dbSNP:142214608
253 253 a, g dbSNP:151048660
256 256 c, g dbSNP:780251348
263 263 c, g dbSNP:782641144
265 265 a, g dbSNP:374655146
270 270 c, t dbSNP:782530823
273 273 c, g dbSNP:782570540
274 274 a, g dbSNP:140937290
278 278 a, t dbSNP:587750968
287 287 c, t dbSNP:782609209
288 288 c, t dbSNP:376606652
289 289 a, g dbSNP:121908471
296 296 c, t dbSNP:142570561
297 297 a, g dbSNP:782033728
304 304 g, t dbSNP:782072116
308 308 a, g, t dbSNP:782314532
311 311 c, t dbSNP:145768029
328 328 a, g dbSNP:140582930
342 342 c, t dbSNP:782657509
343 343 a, c dbSNP:369465957
347 347 c, t dbSNP:781959119
350 350 -, g, ggg dbSNP:781886798
350 350 a, t dbSNP:782077607
356 356 g, t dbSNP:782768459
357 357 c, t dbSNP:145825553
358 358 a, c, g dbSNP:782541751
362 362 a, c dbSNP:781796744
363 363 c, t dbSNP:782492477
370 370 a, g, t dbSNP:782602523
378 378 c, t dbSNP:782519493
379 379 c, t dbSNP:782682017
385 385 c, t dbSNP:782278375
386 386 c, t dbSNP:138401488
387 387 a, g dbSNP:781915989
389 389 c, g dbSNP:782224267
392 392 a, g dbSNP:141471395
397 397 a, g dbSNP:781993871
404 404 c, g dbSNP:587642546
410 410 c, t dbSNP:781989547
411 411 a, g dbSNP:748223519
423 423 a, c dbSNP:782174746
426 426 g, t dbSNP:587708651
429 429 g, t dbSNP:781813768
431 431 c, t dbSNP:782055451
432 432 a, g dbSNP:782733359
434 434 a, g, t dbSNP:781815925
436 436 c, t dbSNP:782630536
437 437 a, c, g dbSNP:587602874
438 438 c, g dbSNP:2301612
441 441 c, t dbSNP:121908476
444 444 c, t dbSNP:782344627
446 446 c, t dbSNP:782645434
447 447 a, g dbSNP:375508823
452 452 a, g dbSNP:782424568
455 455 c, t dbSNP:148365271
456 456 a, c, g dbSNP:782076268
458 458 c, t dbSNP:782355981
459 459 a, c, g dbSNP:587613923
462 462 c, g dbSNP:781977102
464 464 g, t dbSNP:36220239
466 466 c, t dbSNP:36220240
467 467 a, g dbSNP:781802178
471 471 c, g dbSNP:782433445
472 472 a, g, t dbSNP:782733057
481 481 c, t dbSNP:782497226
482 482 c, t dbSNP:587634841
483 483 c, g dbSNP:782279962
485 485 c, t dbSNP:138035204
486 486 a, g dbSNP:587768675
488 488 c, t dbSNP:782239711
499 499 a, g dbSNP:782339799
508 508 g, t dbSNP:781992856
519 519 c, t dbSNP:11575933
523 523 a, g dbSNP:782410985
524 524 c, t dbSNP:782015114
530 530 -, g dbSNP:782472621
533 533 a, g dbSNP:372953477
541 541 c, t dbSNP:782405037
544 544 a, g dbSNP:781946010
547 547 a, g dbSNP:28375042
551 551 c, t dbSNP:199876716
552 552 -, at dbSNP:782242503
553 553 g, t dbSNP:782052182
558 558 c, t dbSNP:782769100
559 559 a, g dbSNP:147201977
562 562 c, t dbSNP:782128293
569 569 c, t dbSNP:140501683
573 573 a, c dbSNP:377220995
575 575 c, t dbSNP:376102311
577 577 -, tca dbSNP:782437870
581 581 c, g dbSNP:782540244
582 582 a, g dbSNP:782574335
587 587 g, t dbSNP:781786860
588 588 c, t dbSNP:201457594
593 593 a, g dbSNP:782607445
595 595 a, c dbSNP:149706655
600 600 g, t dbSNP:782419451
605 605 c, t dbSNP:782671668
606 606 a, g dbSNP:782200160
614 614 a, c dbSNP:782315134
621 621 a, g dbSNP:782089166
627 627 a, g dbSNP:144618753
631 631 a, g dbSNP:782392744
632 632 c, g dbSNP:75928689
636 636 c, g, t dbSNP:370215524
637 637 a, g dbSNP:374465629
643 643 a, g dbSNP:781807478
644 644 a, c, t dbSNP:587612482
644 644 c, t dbSNP:758174895
645 645 a, g dbSNP:376459838
647 647 a, c, g dbSNP:148472763
649 649 a, c dbSNP:781894953
653 653 a, g dbSNP:587745572
667 667 c, t dbSNP:782454600
678 678 a, g dbSNP:121908473
682 682 c, g dbSNP:782343737
697 697 a, g dbSNP:782003053
703 703 g, t dbSNP:782292367
718 718 c, t dbSNP:782417749
719 719 a, g dbSNP:781937390
728 728 g, t dbSNP:142282539
740 740 c, t dbSNP:369336602
746 746 g, t dbSNP:150203373
749 749 c, t dbSNP:146779903
757 757 c, t dbSNP:782771879
758 758 a, g, t dbSNP:781897271
768 768 c, t dbSNP:782055634
787 787 a, c dbSNP:140628579
796 796 a, c, t dbSNP:782272645
797 797 a, g dbSNP:374868673
802 802 a, t dbSNP:375509487
803 803 a, g dbSNP:144282342
811 811 c, t dbSNP:781840717
812 812 a, g dbSNP:3124768
829 829 c, t dbSNP:782647983
837 837 a, g dbSNP:782254257
838 838 a, c dbSNP:782427556
848 848 c, t dbSNP:782660413
857 857 c, t dbSNP:369872722
863 863 a, g, t dbSNP:372789831
879 879 -, tt dbSNP:387906344
884 884 a, g dbSNP:782132022
893 893 c, t dbSNP:36221216
894 894 a, g dbSNP:782036643
897 897 a, g dbSNP:782151601
900 900 c, t dbSNP:150234885
902 902 c, t dbSNP:781783061
906 906 a, g dbSNP:34256013
908 908 c, t dbSNP:782726724
909 909 a, g, t dbSNP:781872245
911 911 g, t dbSNP:375622643
917 917 a, g dbSNP:371209152
920 920 g, t dbSNP:782450096
926 926 c, t dbSNP:36221217
931 931 c, t dbSNP:782219285
937 937 a, c dbSNP:782396358
944 944 c, t dbSNP:781993504
947 947 c, g, t dbSNP:371266006
948 948 c, g dbSNP:28647808
952 952 c, t dbSNP:781947512
956 956 c, t dbSNP:751652402
969 969 c, t dbSNP:587721043
970 970 a, g dbSNP:36090624
974 974 c, t dbSNP:781945326
975 975 a, g, t dbSNP:60398774
990 990 c, g dbSNP:782761353
995 995 a, c, t dbSNP:143573766
996 996 a, g dbSNP:34569244
1002 1002 c, t dbSNP:201704847
1009 1009 c, t dbSNP:782466560
1011 1011 c, t dbSNP:147166780
1012 1012 a, g, t dbSNP:138699340
1017 1017 a, g dbSNP:782547718
1026 1026 c, t dbSNP:782659882
1027 1027 a, g dbSNP:782184721
1031 1031 a, c dbSNP:141265567
1040 1040 c, t dbSNP:587673448
1054 1054 c, g, t dbSNP:587726180
1065 1065 a, g dbSNP:782470631
1072 1072 a, g dbSNP:150764227
1074 1074 c, t dbSNP:587693885
1075 1075 a, g dbSNP:117943654
1082 1082 c, g dbSNP:199741568
1083 1083 a, g dbSNP:782199892
1085 1085 a, g dbSNP:368018318
1104 1104 c, t dbSNP:139214644
1105 1105 a, g dbSNP:149953167
1116 1116 a, g dbSNP:782028864
1118 1118 c, t dbSNP:782144746
1123 1123 c, t dbSNP:782709302
1127 1127 a, c, t dbSNP:781784468
1130 1130 c, g dbSNP:587765025
1143 1143 c, t dbSNP:781875492
1146 1146 c, t dbSNP:370121816
1155 1155 -, g dbSNP:34245310
1163 1163 a, c, t dbSNP:782806565
1164 1164 a, g dbSNP:374840594
1170 1170 c, t dbSNP:121908475
1171 1171 a, g dbSNP:782214086
1183 1183 c, g, t dbSNP:201605295
1184 1184 a, g dbSNP:782288267
1185 1185 a, c, g dbSNP:367818172
1191 1191 c, t dbSNP:781785491
1197 1197 a, g dbSNP:782177142
1203 1203 c, t dbSNP:146314458
1207 1207 a, g dbSNP:782223605
1211 1211 a, g dbSNP:782400086
1230 1230 c, g dbSNP:781993713
1232 1232 a, c dbSNP:782301837
1251 1251 a, g dbSNP:782421679
1260 1260 c, g dbSNP:781937174
1263 1263 a, c dbSNP:138014548
1269 1269 c, g dbSNP:782354328
1273 1273 a, g dbSNP:372471786
1287 1287 c, t dbSNP:782116595
1291 1291 c, t dbSNP:41314453
1292 1292 a, g dbSNP:781888677
1296 1296 a, c dbSNP:782058485
1307 1307 c, t dbSNP:587731476
1310 1310 c, g dbSNP:781830585
1312 1312 c, t dbSNP:587610691
1313 1313 c, t dbSNP:144178018
1314 1314 a, g dbSNP:36221451
1316 1316 a, t dbSNP:782559298
1323 1323 c, g, t dbSNP:782671915
1336 1336 c, t dbSNP:367887198
1337 1337 g, t dbSNP:782251114
1350 1350 a, g dbSNP:148734700
1355 1355 a, c dbSNP:782037951
1361 1361 c, t dbSNP:372033921
1362 1362 a, g dbSNP:782719456
1364 1364 c, t dbSNP:781923426
1370 1370 g, t dbSNP:587639501
1371 1371 g, t dbSNP:782640568
1374 1374 a, g dbSNP:782729939
1376 1376 c, t dbSNP:3124767
1377 1377 a, g dbSNP:782542048
1383 1383 c, t dbSNP:782807182
1384 1384 a, g, t dbSNP:781804540
1389 1389 c, t dbSNP:782614158
1398 1398 c, t dbSNP:782206311
1399 1399 a, g dbSNP:369510827
1404 1404 a, g dbSNP:374606481
1434 1434 c, t dbSNP:782298936
1438 1438 c, t dbSNP:782406453
1447 1447 a, g dbSNP:377187626
1448 1448 a, g dbSNP:782187097
1454 1454 -, gcag dbSNP:781954210
1457 1457 a, g dbSNP:782365382
1461 1461 a, g dbSNP:781957737
1463 1463 c, g dbSNP:782136497
1472 1472 -, agctgtggcgctggaaacctgcaacc dbSNP:387906342
1480 1480 c, t dbSNP:201607490
1481 1481 a, g dbSNP:782014438
1500 1500 a, c dbSNP:782061756
1506 1506 c, t dbSNP:754909071
1519 1519 a, g dbSNP:782636321
1532 1532 -, c dbSNP:782363784
1534 1534 c, g dbSNP:782279427
1535 1535 c, t dbSNP:782322007
1551 1551 a, g dbSNP:781915055
1552 1552 c, t dbSNP:372962493
1560 1560 a, g dbSNP:782337019
1571 1571 c, t dbSNP:587601722
1581 1581 a, g dbSNP:782110632
1588 1588 a, g dbSNP:782816059
1589 1589 c, t dbSNP:781898935
1590 1590 a, g dbSNP:34104386
1604 1604 c, t dbSNP:36221472
1614 1614 g, t dbSNP:781842149
1616 1616 c, t dbSNP:782466905
1625 1625 a, t dbSNP:782659481
1629 1629 a, g dbSNP:200125026
1640 1640 c, t dbSNP:781855822
1641 1641 a, g dbSNP:140639242
1644 1644 a, g dbSNP:782584684
1648 1648 a, g dbSNP:201106433
1667 1667 a, g dbSNP:587738759
1669 1669 c, g dbSNP:782587447
1670 1670 -, ct dbSNP:782028569
1676 1676 c, t dbSNP:147112200
1678 1678 a, g dbSNP:782362034
1683 1683 a, t dbSNP:782029094
1686 1686 c, t dbSNP:782158020
1696 1696 a, g dbSNP:782335186
1701 1701 a, g dbSNP:781927460
1708 1708 c, t dbSNP:781971794
1711 1711 a, g dbSNP:782082676
1722 1722 -, g dbSNP:782718791
1727 1727 a, g dbSNP:782772606
1747 1747 a, g dbSNP:781844998
1762 1762 c, t dbSNP:377519637
1763 1763 a, g dbSNP:782364269
1765 1765 g, t dbSNP:781809081
1781 1781 c, t dbSNP:370669534
1782 1782 a, g, t dbSNP:147732725
1789 1789 a, c dbSNP:782520598
1795 1795 c, g, t dbSNP:685523
1796 1796 a, c, g dbSNP:782742222
1797 1797 g, t dbSNP:782223061
1804 1804 c, t dbSNP:78977446
1805 1805 a, g dbSNP:782003158
1810 1810 -, c dbSNP:781796310
1811 1811 c, t dbSNP:782111896
1817 1817 c, t dbSNP:587726656
1820 1820 c, t dbSNP:145728650
1821 1821 a, g dbSNP:138742754
1824 1824 c, t dbSNP:781844824
1825 1825 a, g dbSNP:758243645
1828 1828 g, t dbSNP:781896718
1842 1842 c, t dbSNP:374444423
1854 1854 a, g dbSNP:201241072
1860 1860 g, t dbSNP:782189279
1861 1861 c, t dbSNP:587773478
1865 1865 a, c dbSNP:782617353
1869 1869 a, g dbSNP:782263547
1889 1889 a, g dbSNP:782380295
1895 1895 c, t dbSNP:782030553
1900 1900 c, t dbSNP:782154017
1908 1908 a, g dbSNP:782329783
1923 1923 c, t dbSNP:149265456
1924 1924 a, g dbSNP:782160285
1930 1930 a, g, t dbSNP:782770168
1932 1932 g, t dbSNP:782154286
1937 1937 a, g dbSNP:368858347
1939 1939 c, t dbSNP:781805469
1945 1945 c, t dbSNP:372449678
1946 1946 a, g dbSNP:375151860
1947 1947 g, t dbSNP:121908468
1949 1949 c, t dbSNP:781827094
1950 1950 c, t dbSNP:143568784
1957 1957 a, g dbSNP:200273776
1966 1966 a, g dbSNP:781863577
1975 1975 a, c, t dbSNP:368433734
1976 1976 a, g dbSNP:371554437
1977 1977 g, t dbSNP:782453982
1985 1985 c, t dbSNP:148031420
1986 1986 a, g dbSNP:141811556
1987 1987 c, t dbSNP:782502165
1988 1988 c, g dbSNP:782683498
1998 1998 -, agaggggtc dbSNP:781893176
2006 2006 c, t dbSNP:28641026
2010 2010 c, t dbSNP:782315945
2011 2011 a, g dbSNP:139951127
2026 2026 -, gtgccc dbSNP:387906346
2031 2031 c, t dbSNP:782220521
2032 2032 a, g dbSNP:142779872
2038 2038 a, g dbSNP:782009471
2040 2040 a, g dbSNP:36222275
2051 2051 c, t dbSNP:782146228
2053 2053 a, g dbSNP:782020908
2072 2072 c, t dbSNP:587618046
2074 2074 c, t dbSNP:139808736
2076 2076 c, t dbSNP:781842320
2088 2088 c, g dbSNP:782123812
2094 2094 c, t dbSNP:782761491
2095 2095 a, g dbSNP:781905328
2098 2098 c, t dbSNP:782536497
2099 2099 a, g dbSNP:149794949
2105 2105 c, t dbSNP:145835995
2132 2132 a, c dbSNP:781783629
2148 2148 a, g dbSNP:781815720
2149 2149 c, t dbSNP:148560341
2151 2151 a, c dbSNP:587735427
2156 2156 a, c dbSNP:370359180
2157 2157 c, t dbSNP:781908789
2166 2166 g, t dbSNP:121908472
2170 2170 c, t dbSNP:782586641
2171 2171 a, g dbSNP:782185362
2173 2173 c, t dbSNP:782363611
2179 2179 a, g dbSNP:782597967
2193 2193 a, g dbSNP:28503257
2199 2199 c, t dbSNP:782414383
2200 2200 a, g dbSNP:782016923
2203 2203 c, t dbSNP:142607772
2204 2204 a, g dbSNP:34934621
2210 2210 c, t dbSNP:781959371
2223 2223 c, g dbSNP:370081995
2229 2229 a, g dbSNP:782789479
2235 2235 c, g dbSNP:151138896
2237 2237 c, t dbSNP:782167288
2238 2238 a, g dbSNP:782585313
2246 2246 a, g dbSNP:36222579
2248 2248 a, t dbSNP:587681892
2249 2249 c, t dbSNP:782748173
2253 2253 g, t dbSNP:781825145
2254 2254 c, t dbSNP:373530345
2255 2255 a, g dbSNP:200349242
2263 2263 c, g, t dbSNP:376017677
2264 2264 a, g dbSNP:150322366
2267 2267 a, g dbSNP:36222580
2273 2273 a, g dbSNP:782223782
2275 2275 a, g dbSNP:587731517
2277 2277 -, cc dbSNP:782715762
2279 2279 c, t dbSNP:782251596
2280 2280 a, g dbSNP:782421000
2285 2285 -, ca dbSNP:782633692
2292 2292 a, c dbSNP:782025111
2294 2294 -, ct dbSNP:782288601
2302 2302 c, t dbSNP:782071778
2304 2304 a, g dbSNP:782706998
2306 2306 c, t dbSNP:138488999
2307 2307 a, g dbSNP:782090479
2308 2308 a, c dbSNP:782783025
2313 2313 a, t dbSNP:781898659
2314 2314 c, t dbSNP:782531291
2319 2319 c, t dbSNP:782700247
2320 2320 a, g dbSNP:138770906
2333 2333 c, t dbSNP:782478560
2354 2354 c, t dbSNP:200481038
2355 2355 c, t dbSNP:782195157
2363 2363 g, t dbSNP:782307600
2375 2375 -, c dbSNP:782415493
2376 2376 c, t dbSNP:781965782
2377 2377 a, g dbSNP:782080989
2379 2379 c, t dbSNP:782383410
2380 2380 a, g dbSNP:373569027
2382 2382 c, t dbSNP:377572669
2383 2383 a, g dbSNP:61751476
2393 2393 c, t dbSNP:199810396
2396 2396 c, t dbSNP:781942887
2397 2397 a, g dbSNP:781809898
2406 2406 a, g dbSNP:782054636
2412 2412 a, g dbSNP:782755326
2413 2413 c, t dbSNP:370060687
2414 2414 a, g dbSNP:782535994
2416 2416 c, t dbSNP:782630291
2420 2420 a, g dbSNP:781883131
2431 2431 g, t dbSNP:587755238
2441 2441 c, t dbSNP:782563217
2444 2444 a, g dbSNP:146073007
2450 2450 a, g dbSNP:782343769
2453 2453 a, g dbSNP:782647758
2459 2459 a, t dbSNP:371737266
2462 2462 a, g dbSNP:782238280
2464 2464 a, g dbSNP:782311861
2487 2487 g, t dbSNP:782018563
2491 2491 c, g dbSNP:782196406
2496 2496 a, g dbSNP:782311486
2500 2500 c, t dbSNP:762112077
2501 2501 a, c, g dbSNP:148715397
2502 2502 a, c dbSNP:781992360
2507 2507 c, t dbSNP:782164825
2513 2513 g, t dbSNP:782724202
2515 2515 c, t dbSNP:781785040
2516 2516 a, c dbSNP:782482318
2519 2519 c, t dbSNP:200547311
2520 2520 a, g dbSNP:587709422
2523 2523 a, g dbSNP:782504511
2524 2524 a, c dbSNP:782670806
2529 2529 a, g dbSNP:782270256
2534 2534 c, t dbSNP:186236347
2541 2541 c, t dbSNP:141494468
2542 2542 a, g dbSNP:782472825
2547 2547 a, g dbSNP:782226132
2549 2549 a, g dbSNP:782345031
2550 2550 g, t dbSNP:782007879
2552 2552 c, t dbSNP:782251776
2553 2553 a, g dbSNP:150853306
2560 2560 a, c