Email to GenScript

CHKB choline kinase beta [Homo sapiens (human)]

Gene Symbol CHKB
Entrez Gene ID 1120
Full Name choline kinase beta
General protein information
Preferred Names
choline/ethanolamine kinase
choline/ethanolamine kinase
ethanolamine kinase beta
choline kinase-like protein
Gene Type protein-coding
Organism Homo sapiens (human)



Summary Choline kinase (CK) and ethanolamine kinase (EK) catalyze the phosphorylation of choline/ethanolamine to phosphocholine/phosphoethanolamine. This is the first enzyme in the biosynthesis of phosphatidylcholine/phosphatidylethanolamine in all animal cells. The highly purified CKs from mammalian sources and their recombinant gene products have been shown to have EK activity also, indicating that both activities reside on the same protein. The choline kinase-like protein encoded by CHKL belongs to the choline/ethanolamine kinase family; however, its exact function is not known. Read-through transcripts are expressed from this locus that include exons from the downstream CPT1B locus. [provided by RefSeq, Jun 2009]. lac of sum
Disorder MIM:


Disorder Html:

The following CHKB gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the CHKB gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu19326 NM_005198 Homo sapiens choline kinase beta (CHKB), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu19326
Accession Version NM_005198.4 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1188bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product choline/ethanolamine kinase
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DB106393.1, AB029886.1 and BE676287.1. This sequence is a reference standard in the RefSeqGene project. On Jun 27, 2009 this sequence version replaced gi:23238259. Summary: Choline kinase (CK) and ethanolamine kinase (EK) catalyze the phosphorylation of choline/ethanolamine to phosphocholine/phosphoethanolamine. This is the first enzyme in the biosynthesis of phosphatidylcholine/phosphatidylethanolamine in all animal cells. The highly purified CKs from mammalian sources and their recombinant gene products have been shown to have EK activity also, indicating that both activities reside on the same protein. The choline kinase-like protein encoded by CHKL belongs to the choline/ethanolamine kinase family; however, its exact function is not known. Read-through transcripts are expressed from this locus that include exons from the downstream CPT1B locus. [provided by RefSeq, Jun 2009]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AL096780.1, BC082263.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2152474 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)105..107(+)
Misc Feature(2)222..224(+)
Misc Feature(3)387..1382(+)
Misc Feature(4)423..1373(+)
Misc Feature(5)441..1286(+)
Misc Feature(6)441..1010(+)
Misc Feature(7)447..1286(+)
Misc Feature(8)447..455(+)
Misc Feature(9)567..770(+)
Exon (1)1..442
Gene Synonym:
Exon (2)443..551
Gene Synonym:
Exon (3)552..665
Gene Synonym:
Exon (4)666..799
Gene Synonym:
Exon (5)800..895
Gene Synonym:
Exon (6)896..954
Gene Synonym:
Exon (7)955..1036
Gene Synonym:
Exon (8)1037..1145
Gene Synonym:
Exon (9)1146..1249
Gene Synonym:
Exon (10)1250..1331
Gene Synonym:
Exon (11)1332..1629
Gene Synonym:
Position Chain Variation Link
6 6 c, t dbSNP:552860481
46 46 a, g dbSNP:530520371
72 72 c, t dbSNP:563317195
120 120 a, g dbSNP:541835792
122 122 c, g dbSNP:114094125
129 129 a, g dbSNP:753596700
139 139 -, ccgagcgcggccggaaggaa dbSNP:563836858
144 144 c, t dbSNP:559377304
145 145 -, gcggccggaaggaaccgagc dbSNP:144647670
158 158 a, g dbSNP:540889063
171 171 g, t dbSNP:41282357
176 176 c, g dbSNP:745852927
177 177 a, g dbSNP:777813485
178 178 a, g dbSNP:769924415
189 189 c, t dbSNP:748339458
192 192 a, g dbSNP:367729011
194 194 c, t dbSNP:755323491
196 196 c, t dbSNP:751903069
197 197 a, g dbSNP:780606354
198 198 -, cctgg dbSNP:763326838
200 200 g, t dbSNP:373596637
201 201 c, g, t dbSNP:764836662
203 203 a, c dbSNP:761420355
205 205 c, g dbSNP:753481216
207 207 a, c, g, t dbSNP:775122642
212 212 c, t dbSNP:771910804
213 213 c, t dbSNP:759461992
215 215 c, t dbSNP:774280101
217 217 c, t dbSNP:769811756
227 227 a, c dbSNP:748201669
232 232 c, t dbSNP:199703765
236 236 a, t dbSNP:556978738
246 246 a, g dbSNP:768731051
247 247 g, t dbSNP:747307690
251 251 c, t dbSNP:780553092
252 252 a, g dbSNP:533374333
253 253 a, g dbSNP:746317833
256 256 c, t dbSNP:779585255
262 262 a, g dbSNP:756748863
272 272 a, g dbSNP:753255765
281 281 c, t dbSNP:763705112
283 283 g, t dbSNP:755706573
290 290 a, g dbSNP:535827083
297 297 a, g dbSNP:752457146
298 298 a, g, t dbSNP:149592688
299 299 a, g dbSNP:774227072
301 301 a, g dbSNP:370762990
303 303 c, g dbSNP:762990645
304 304 c, g, t dbSNP:768840882
306 306 g, t dbSNP:747192041
309 309 a, g dbSNP:775859771
310 310 c, g dbSNP:772515920
313 313 c, t dbSNP:746266357
321 321 c, t dbSNP:779458495
330 330 a, g dbSNP:376164304
334 334 a, c dbSNP:387907068
340 340 a, t dbSNP:749862181
343 343 c, t dbSNP:777141897
352 352 c, t dbSNP:755650815
356 356 g, t dbSNP:752292240
357 357 a, c dbSNP:767183656
367 367 a, g dbSNP:138205828
369 369 c, t dbSNP:373091820
370 370 a, t dbSNP:766246670
372 372 c, t dbSNP:762788126
382 382 a, g dbSNP:773266909
386 386 c, g dbSNP:764013683
387 387 c, t dbSNP:760830828
394 394 a, g dbSNP:775814577
398 398 c, g dbSNP:772390023
402 402 c, t dbSNP:147043849
413 413 c, g dbSNP:774840848
414 414 a, c dbSNP:141533752
416 416 -, cc dbSNP:775693513
427 427 a, g dbSNP:749686701
428 428 a, g dbSNP:778353288
429 429 a, g dbSNP:769141695
432 432 c, t dbSNP:747691808
434 434 c, t dbSNP:80067609
436 436 c, t dbSNP:754605636
437 437 c, t dbSNP:751273046
438 438 a, c, g dbSNP:758217425
443 443 c, g dbSNP:746545584
454 454 a, g dbSNP:13054973
457 457 a, g dbSNP:774901785
467 467 c, t dbSNP:180979987
480 480 c, g dbSNP:547428711
481 481 c, t dbSNP:146163970
490 490 a, t dbSNP:757118700
492 492 c, t dbSNP:532210178
493 493 c, t dbSNP:140867913
495 495 a, t dbSNP:564786154
497 497 c, t dbSNP:376846624
505 505 a, g dbSNP:751630140
507 507 a, g dbSNP:766423227
509 509 g, t dbSNP:757428570
511 511 c, t dbSNP:750678988
518 518 c, g dbSNP:765518636
525 525 c, t dbSNP:371960270
533 533 a, c, g dbSNP:369633837
542 542 a, c dbSNP:543205547
552 552 c, g dbSNP:150987240
564 564 c, t dbSNP:189564179
567 567 a, g dbSNP:769546336
570 570 c, g dbSNP:748051557
572 572 a, g dbSNP:142607228
574 574 a, g dbSNP:772143163
578 578 c, t dbSNP:745967029
581 581 c, g dbSNP:779012297
582 582 a, g dbSNP:757454951
583 583 c, t dbSNP:754126452
588 588 a, g dbSNP:778043765
591 591 a, g dbSNP:756445442
598 598 c, g dbSNP:753195116
603 603 c, t dbSNP:767938046
607 607 c, g dbSNP:760126717
614 614 a, g dbSNP:368142650
641 641 g, t dbSNP:766046984
643 643 c, g dbSNP:762694630
646 646 a, c, g dbSNP:201257544
656 656 c, g dbSNP:761535800
658 658 a, g dbSNP:776594113
669 669 c, t dbSNP:148857303
670 670 a, g dbSNP:184839240
675 675 c, t dbSNP:146693439
676 676 -, t dbSNP:786205117
684 684 c, g dbSNP:764016359
694 694 a, g dbSNP:760539135
696 696 a, g dbSNP:775420369
710 710 a, c dbSNP:770944458
719 719 g, t dbSNP:199704510
728 728 a, g dbSNP:773378651
730 730 c, t dbSNP:774685301
731 731 a, g dbSNP:769882854
733 733 c, t dbSNP:748462496
734 734 a, g dbSNP:200220080
737 737 a, g dbSNP:541050089
745 745 c, g dbSNP:747464507
748 748 a, t dbSNP:376194232
757 757 c, t dbSNP:757942378
775 775 a, t dbSNP:749871499
783 783 -, tttg dbSNP:752436924
785 785 g, t dbSNP:764853889
791 791 a, c dbSNP:201476966
798 798 a, c, t dbSNP:763737224
799 799 a, g dbSNP:139818555
801 801 c, t dbSNP:767355484
815 815 c, t dbSNP:146409721
816 816 -, c dbSNP:757369551
824 824 a, g dbSNP:751522981
837 837 c, t dbSNP:552898356
839 839 c, t dbSNP:372742172
848 848 g, t dbSNP:761978769
853 853 a, t dbSNP:776677585
856 856 a, t dbSNP:768970529
860 860 g, t dbSNP:761029141
867 867 a, g dbSNP:565326245
871 871 c, t dbSNP:775986184
883 883 c, t dbSNP:772567324
886 886 a, g dbSNP:369606974
888 888 a, c dbSNP:149858290
890 890 c, g dbSNP:770306965
891 891 c, t dbSNP:543829328
901 901 c, t dbSNP:780848949
905 905 a, g dbSNP:754693809
910 910 c, g dbSNP:199783402
912 912 a, g dbSNP:779762736
913 913 c, t dbSNP:758344083
914 914 c, t dbSNP:750454672
919 919 c, t dbSNP:764209313
920 920 a, g dbSNP:139952595
922 922 c, g, t dbSNP:199847760
923 923 a, c dbSNP:150676350
926 926 c, t dbSNP:141934594
927 927 a, g dbSNP:184254424
928 928 c, t dbSNP:766718421
929 929 a, c, t dbSNP:773724394
940 940 a, g dbSNP:371751084
947 947 a, c dbSNP:747689391
958 958 a, c dbSNP:776962773
963 963 c, t dbSNP:760310819
982 982 a, c dbSNP:775024706
984 984 a, g dbSNP:771856963
989 989 c, t dbSNP:573700239
993 993 a, c dbSNP:778897184
994 994 a, g dbSNP:770978511
997 997 a, t dbSNP:368365086
998 998 c, g dbSNP:781264108
1001 1001 c, g dbSNP:755024138
1016 1016 a, g dbSNP:751758581
1021 1021 a, g dbSNP:201148042
1028 1028 a, c, t dbSNP:750764003
1032 1032 c, t dbSNP:202048376
1047 1047 a, g dbSNP:750714699
1061 1061 c, t dbSNP:760833908
1063 1063 a, g dbSNP:757635030
1071 1071 g, t dbSNP:754327744
1074 1074 c, t dbSNP:764474062
1076 1076 c, t dbSNP:761289961
1077 1077 g, t dbSNP:752131662
1088 1088 a, c, t dbSNP:140020889
1089 1089 a, g dbSNP:374544105
1091 1091 g, t dbSNP:766225706
1099 1099 c, g dbSNP:762690035
1111 1111 c, t dbSNP:370202172
1117 1117 a, c dbSNP:769598051
1120 1120 c, t dbSNP:147485527
1123 1123 a, t dbSNP:775547378
1126 1126 a, g dbSNP:143061031
1134 1134 c, g, t dbSNP:779131876
1136 1136 a, g dbSNP:757507890
1140 1140 c, t dbSNP:387907069
1143 1143 c, g dbSNP:139059552
1144 1144 a, c dbSNP:778253283
1149 1149 c, t dbSNP:766044832
1155 1155 a, g dbSNP:757983603
1157 1157 c, t dbSNP:750097672
1157 1157 -, t dbSNP:772568756
1158 1158 c, t dbSNP:200919604
1159 1159 a, g dbSNP:577953900
1162 1162 a, g dbSNP:199641367
1167 1167 c, t dbSNP:753737479
1168 1168 a, t dbSNP:763993653
1171 1171 c, t dbSNP:377550291
1179 1179 a, g dbSNP:143218928
1182 1182 -, aaag dbSNP:771681297
1188 1188 a, g dbSNP:771047317
1191 1191 -, ga dbSNP:747747221
1194 1194 c, g dbSNP:763028166
1198 1198 c, t dbSNP:371355721
1201 1201 a, g dbSNP:141381896
1205 1205 g, t dbSNP:748494353
1206 1206 c, g dbSNP:781724474
1208 1208 a, g dbSNP:769273259
1209 1209 c, g dbSNP:747586997
1213 1213 c, g dbSNP:779368957
1218 1218 c, g dbSNP:757943503
1219 1219 c, t dbSNP:780983852
1224 1224 a, g dbSNP:374337406
1226 1226 -, aga dbSNP:778645316
1226 1226 a, t dbSNP:559736493
1236 1236 c, g dbSNP:756893592
1239 1239 a, g dbSNP:763938630
1248 1248 a, c, t dbSNP:138074497
1249 1249 a, g dbSNP:766320982
1252 1252 a, g dbSNP:775760883
1255 1255 c, t dbSNP:772616505
1258 1258 c, t dbSNP:746425618
1259 1259 a, g dbSNP:773840563
1274 1274 c, g dbSNP:770437413
1278 1278 c, g dbSNP:748889957
1288 1288 -, cc dbSNP:750412430
1298 1298 a, g dbSNP:777434454
1300 1300 c, t dbSNP:755801840
1303 1303 c, t dbSNP:766753256
1304 1304 c, g dbSNP:747951384
1305 1305 a, g dbSNP:780909094
1307 1307 c, g dbSNP:754941163
1310 1310 c, t dbSNP:376369193
1312 1312 c, t dbSNP:765351782
1322 1322 c, t dbSNP:757439004
1323 1323 a, g dbSNP:761012375
1328 1328 c, t dbSNP:754077285
1329 1329 a, t dbSNP:372078948
1338 1338 -, g dbSNP:758563051
1339 1339 c, t dbSNP:751958642
1347 1347 c, t dbSNP:766848672
1348 1348 a, g, t dbSNP:772705206
1351 1351 g, t dbSNP:769298325
1352 1352 c, g dbSNP:372529332
1364 1364 c, t dbSNP:761473672
1375 1375 a, g dbSNP:140289037
1382 1382 a, g dbSNP:768460701
1385 1385 c, g dbSNP:746752350
1394 1394 c, t dbSNP:780047741
1399 1399 c, t dbSNP:772125270
1412 1412 c, t dbSNP:551576081
1427 1427 a, c, g dbSNP:533323083
1428 1428 a, g dbSNP:756167681
1433 1433 c, t dbSNP:371344816
1439 1439 a, g dbSNP:752921190
1452 1452 c, g dbSNP:781238750
1453 1453 -, g dbSNP:752796169
1502 1502 c, g dbSNP:17001634
1524 1524 c, t dbSNP:9616871
1532 1532 c, g, t dbSNP:112742765
1536 1536 c, t dbSNP:544539307
1540 1540 a, c, g, t dbSNP:1056964
1577 1577 a, g dbSNP:1056971
1580 1580 c, t dbSNP:575362967
1583 1583 c, g, t dbSNP:561575991
1584 1584 a, g dbSNP:540203645
1591 1591 a, g dbSNP:377590719
1600 1600 a, c dbSNP:1135081
1614 1614 g, t dbSNP:41281533
1622 1622 c, g dbSNP:3180872
1623 1623 a, c dbSNP:3180873

Target ORF information:

RefSeq Version NM_005198
Organism Homo sapiens (human)
Definition Homo sapiens choline kinase beta (CHKB), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.