
PARK7 cDNA ORF clone, Homo sapiens (human)

Gene Symbol PARK7
Entrez Gene ID 11315
Full Name parkinson protein 7
Synonyms DJ-1, DJ1, HEL-S-67p
General protein information
Preferred Names
protein DJ-1
protein DJ-1
oncogene DJ1
Parkinson disease (autosomal recessive, early onset) 7
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Parkinson disease 7, autosomal recessive early-onset, 606324 (3);

mRNA and Protein(s)

mRNA Protein Name
XM_005263424 XP_005263481 protein DJ-1 isoform X1
NM_007262 NP_009193 protein DJ-1
NM_001123377 NP_001116849 protein DJ-1

hsa05012 Parkinson's disease
Pathway Interaction Database
alphasynuclein_pathway Alpha-synuclein signaling
WP138 Androgen receptor signaling pathway
WP2267 Synaptic Vesicle Pathway
WP2371 Parkinsons Disease Pathway

Homo sapiens (human) PARK7 NP_009193.2
Canis lupus familiaris (dog) PARK7 XP_859031.1
Bos taurus (cattle) PARK7 NP_001015572.1
Mus musculus (house mouse) Park7 NP_065594.2
Rattus norvegicus (Norway rat) Park7 NP_001264180.1
Gallus gallus (chicken) PARK7 NP_989916.1
Danio rerio (zebrafish) park7 NP_001005938.1
Drosophila melanogaster (fruit fly) dj-1beta NP_651825.3
Drosophila melanogaster (fruit fly) DJ-1alpha NP_610916.1
Caenorhabditis elegans djr-1.1 NP_493696.1
Caenorhabditis elegans djr-1.2 NP_504132.1
Arabidopsis thaliana (thale cress) AT3G14990 NP_188117.1
Arabidopsis thaliana (thale cress) AT1G53280 NP_564626.1
Xenopus (Silurana) tropicalis (western clawed frog) park7 NP_001015851.1


ID Name Evidence
GO:0005634 nucleus IDA
GO:0005737 cytoplasm IDA
GO:0005739 mitochondrion IDA
GO:0005829 cytosol IEA
GO:0030424 axon IEA


ID Name Evidence
GO:0003729 mRNA binding IDA
GO:0004601 peroxidase activity ISS
GO:0005515 protein binding IPI
GO:0008233 peptidase activity IDA
GO:0042803 protein homodimerization activity IDA
GO:0051920 peroxiredoxin activity IEA


ID Name Evidence
GO:0006914 autophagy IEA
GO:0007005 mitochondrion organization ISS
GO:0007338 single fertilization IEA
GO:0008344 adult locomotory behavior IEA
GO:0032091 negative regulation of protein binding IDA
GO:0034599 cellular response to oxidative stress IEA
GO:0042493 response to drug IEA
GO:0042743 hydrogen peroxide metabolic process IEA
GO:0043526 neuroprotection IDA
GO:0050727 regulation of inflammatory response ISS
GO:0050821 protein stabilization IMP
GO:0051583 dopamine uptake IEA
GO:0051899 membrane depolarization IEA
GO:0060081 membrane hyperpolarization IEA
GO:0060548 negative regulation of cell death IDA
GO:0060765 regulation of androgen receptor signaling pathway IDA
GO:0070301 cellular response to hydrogen peroxide IDA
GO:2000277 positive regulation of oxidative phosphorylation uncoupler activity IEA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following PARK7 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the PARK7 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu26877 XM_005263424 PREDICTED: Homo sapiens parkinson protein 7 (PARK7), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $99.00
OHu26877 NM_007262 Homo sapiens parkinson protein 7 (PARK7), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $99.00
OHu26877 NM_001123377 Homo sapiens parkinson protein 7 (PARK7), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu26877
Accession Version XM_005263424.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 570bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product protein DJ-1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_032977.10) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:530360486. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)196..735(+)
Misc Feature(2)199..699(+)
Misc Feature(3)499..501(+)
Position Chain Variation Link
17 17 c, t dbSNP:774954085
26 26 c, g dbSNP:773650813
28 28 g, t dbSNP:549890716
30 30 c, t dbSNP:571699528
35 35 c, t dbSNP:760230488
53 53 c, t dbSNP:549306462
59 59 c, g dbSNP:533019831
66 66 c, t dbSNP:764574651
126 126 c, t dbSNP:551550334
143 143 c, t dbSNP:566498850
153 153 c, t dbSNP:763511622
159 159 c, t dbSNP:534088150
162 162 c, g, t dbSNP:11548933
164 164 c, t dbSNP:747578176
165 165 g, t dbSNP:757971913
171 171 -, at dbSNP:766562733
173 173 a, g dbSNP:200286981
174 174 a, t dbSNP:746902331
177 177 a, c, t dbSNP:770994769
178 178 a, g dbSNP:745735399
179 179 c, t dbSNP:768757739
181 181 a, t dbSNP:774674506
194 194 a, g dbSNP:190738218
199 199 g, t dbSNP:767539467
200 200 c, t dbSNP:773313843
223 223 a, g dbSNP:761107607
231 231 a, g dbSNP:771692484
232 232 a, c, g dbSNP:147698459
235 235 a, g dbSNP:764771957
237 237 a, g dbSNP:752342660
239 239 c, t dbSNP:758016497
240 240 a, g dbSNP:777350692
242 242 c, t dbSNP:370430693
249 249 a, t dbSNP:775184804
250 250 a, g dbSNP:757247182
256 256 a, g dbSNP:781346135
258 258 c, t dbSNP:745618719
261 261 a, g dbSNP:74315351
263 263 a, g dbSNP:769681126
265 265 a, c dbSNP:374429170
266 266 a, g dbSNP:142405016
269 269 c, g dbSNP:376428939
274 274 a, t dbSNP:749054218
284 284 c, t dbSNP:772272696
285 285 c, g, t dbSNP:374236728
286 286 -, t dbSNP:781600849
286 286 a, g dbSNP:770946447
298 298 g, t dbSNP:137853051
318 318 a, g dbSNP:776602132
325 325 c, t dbSNP:760020407
326 326 a, g dbSNP:145727915
337 337 a, g dbSNP:775909660
342 342 g, t dbSNP:763477392
344 344 a, c dbSNP:368405677
349 349 a, g dbSNP:114601558
360 360 a, c dbSNP:751305698
364 364 a, g dbSNP:761582953
365 365 -, a dbSNP:759703272
371 371 a, g dbSNP:767015117
375 375 c, g dbSNP:74315353
381 381 a, g dbSNP:201258798
385 385 c, g dbSNP:538300305
386 386 a, g dbSNP:753722802
388 388 a, g dbSNP:754937535
390 390 a, g dbSNP:764942388
391 391 a, g dbSNP:200113696
401 401 c, t dbSNP:367584305
409 409 a, g dbSNP:553957802
412 412 a, c dbSNP:781335529
417 417 c, t dbSNP:11548937
418 418 a, g dbSNP:45601537
429 429 a, g dbSNP:780303707
430 430 -, a dbSNP:35566631
435 435 a, g dbSNP:749774196
441 441 a, t dbSNP:758945306
444 444 c, t dbSNP:777939211
445 445 a, g dbSNP:377263767
455 455 c, t dbSNP:770564079
475 475 c, t dbSNP:182164240
476 476 a, g dbSNP:71653619
481 481 a, g dbSNP:200696147
482 482 c, g dbSNP:199529022
484 484 c, g dbSNP:199719494
492 492 c, t dbSNP:368221790
493 493 a, g dbSNP:774005786
502 502 c, g, t dbSNP:145196092
508 508 c, t dbSNP:757792657
511 511 a, g dbSNP:45577037
512 512 c, g dbSNP:750800796
527 527 a, g dbSNP:755752639
529 529 a, g dbSNP:779825454
554 554 c, g dbSNP:371246061
556 556 -, cac dbSNP:763978579
562 562 c, g, t dbSNP:373618614
565 565 c, t dbSNP:748028245
566 566 c, t dbSNP:772145589
572 572 a, c dbSNP:552097955
577 577 a, g dbSNP:200894731
579 579 a, g dbSNP:200099666
582 582 c, g dbSNP:398124657
583 583 a, g dbSNP:202097100
586 586 a, g dbSNP:201016410
596 596 a, g dbSNP:770710019
601 601 a, g dbSNP:199728189
612 612 a, g dbSNP:140517273
614 614 a, g dbSNP:749485971
616 616 c, t dbSNP:768782230
617 617 a, g dbSNP:148682310
619 619 a, g dbSNP:375023875
620 620 g, t dbSNP:761919138
627 627 a, g dbSNP:772561823
629 629 a, c dbSNP:74315352
630 630 c, t dbSNP:144764347
631 631 a, g dbSNP:368420490
636 636 c, g dbSNP:754180902
649 649 c, t dbSNP:61772692
650 650 a, g dbSNP:765024957
654 654 -, gcc dbSNP:764877312
657 657 c, t dbSNP:752253803
663 663 a, c, t dbSNP:370308517
669 669 c, t dbSNP:777440876
670 670 a, g dbSNP:74315354
672 672 a, g dbSNP:757172943
675 675 g, t dbSNP:780991489
677 677 c, t dbSNP:371514726
678 678 a, g, t dbSNP:768890106
680 680 c, t dbSNP:28938172
682 682 a, g dbSNP:748211203
684 684 a, g dbSNP:71653621
685 685 a, g dbSNP:374962638
690 690 c, g, t dbSNP:368818999
694 694 g, t dbSNP:777026628
716 716 c, t dbSNP:759888524
717 717 a, g dbSNP:149974320
718 718 a, g dbSNP:71653622
721 721 c, g dbSNP:762700748
723 723 a, g dbSNP:763658742
724 724 a, c, g dbSNP:751053636
732 732 c, t dbSNP:767393780
735 735 a, c dbSNP:3203837
741 741 c, t dbSNP:767480482
756 756 -, c dbSNP:754483095
759 759 c, t dbSNP:532144863
760 760 a, g dbSNP:750226268
760 760 -, g dbSNP:778234049
763 763 c, g dbSNP:755957845
766 766 c, g dbSNP:752679225
767 767 a, g dbSNP:779834654
769 769 c, t dbSNP:540890409
770 770 a, c, g dbSNP:758646477
775 775 c, t dbSNP:747102087
781 781 g, t dbSNP:771468418
788 788 c, g dbSNP:777064688
790 790 c, t dbSNP:199752316
791 791 a, g dbSNP:375081848
791 791 -, g dbSNP:771358968
794 794 a, t dbSNP:770218250
798 798 a, t dbSNP:776029338
800 800 c, t dbSNP:762645646
802 802 a, g dbSNP:371482698
816 816 c, t dbSNP:544344069
835 835 c, g dbSNP:753624096
837 837 a, t dbSNP:112196008
868 868 c, t dbSNP:562641550
871 871 -, ctt dbSNP:751840879
875 875 c, t dbSNP:578012560
877 877 c, t dbSNP:147437667
878 878 a, g dbSNP:779587926
903 903 -, ag dbSNP:756195290
940 940 c, t dbSNP:1044766
964 964 a, c dbSNP:746552212

Target ORF information:

RefSeq Version XM_005263424
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens parkinson protein 7 (PARK7), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu26877
Accession Version NM_007262.4 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 570bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product protein DJ-1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BP248330.1, BC008188.2, AK312000.1 and D61380.2. This sequence is a reference standard in the RefSeqGene project. On Apr 16, 2008 this sequence version replaced gi:34222306. Summary: The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BQ436114.1, BI552690.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)146..148(+)
Misc Feature(2)176..715(+)
Misc Feature(3)179..679(+)
Misc Feature(4)362..364(+)
Misc Feature(5)362..364(+)
Misc Feature(6)479..481(+)
Misc Feature(7)479..481(+)
Misc Feature(8)551..553(+)
Exon (1)1..140
Gene Synonym:
Exon (2)141..253
Gene Synonym:
Exon (3)254..355
Gene Synonym:
Exon (4)356..415
Gene Synonym:
Exon (5)416..485
Gene Synonym:
Exon (6)486..572
Gene Synonym:
Exon (7)573..961
Gene Synonym:
Position Chain Variation Link
3 3 a, g dbSNP:549829441
27 27 aaggccggacggcgcgcgtgcgtgctggcgtgcgttcac, gaggccggacggcgcgcgtgcgtgctggcgtgcgttcat dbSNP:386628237
27 27 a, g dbSNP:17523802
32 32 a, c dbSNP:539598498
36 36 c, t dbSNP:559287709
37 37 c, g dbSNP:557801400
41 41 c, t dbSNP:775145974
51 51 c, t dbSNP:566749983
56 56 c, g dbSNP:533597069
58 58 c, g dbSNP:555404334
65 65 c, t dbSNP:11548935
65 65 c, t dbSNP:226249
80 80 gg, tc dbSNP:367687042
80 80 g, t dbSNP:544337761
81 81 c, g dbSNP:556263350
84 84 a, t dbSNP:140230911
85 85 a, g dbSNP:545577153
94 94 c, t dbSNP:11121064
99 99 a, g dbSNP:527992433
142 142 c, g, t dbSNP:11548933
144 144 c, t dbSNP:747578176
145 145 g, t dbSNP:757971913
151 151 -, at dbSNP:766562733
153 153 a, g dbSNP:200286981
154 154 a, t dbSNP:746902331
157 157 a, c, t dbSNP:770994769
158 158 a, g dbSNP:745735399
159 159 c, t dbSNP:768757739
161 161 a, t dbSNP:774674506
174 174 a, g dbSNP:190738218
179 179 g, t dbSNP:767539467
180 180 c, t dbSNP:773313843
203 203 a, g dbSNP:761107607
211 211 a, g dbSNP:771692484
212 212 a, c, g dbSNP:147698459
215 215 a, g dbSNP:764771957
217 217 a, g dbSNP:752342660
219 219 c, t dbSNP:758016497
220 220 a, g dbSNP:777350692
222 222 c, t dbSNP:370430693
229 229 a, t dbSNP:775184804
230 230 a, g dbSNP:757247182
236 236 a, g dbSNP:781346135
238 238 c, t dbSNP:745618719
241 241 a, g dbSNP:74315351
243 243 a, g dbSNP:769681126
245 245 a, c dbSNP:374429170
246 246 a, g dbSNP:142405016
249 249 c, g dbSNP:376428939
254 254 a, t dbSNP:749054218
264 264 c, t dbSNP:772272696
265 265 c, g, t dbSNP:374236728
266 266 -, t dbSNP:781600849
266 266 a, g dbSNP:770946447
278 278 g, t dbSNP:137853051
298 298 a, g dbSNP:776602132
305 305 c, t dbSNP:760020407
306 306 a, g dbSNP:145727915
317 317 a, g dbSNP:775909660
322 322 g, t dbSNP:763477392
324 324 a, c dbSNP:368405677
329 329 a, g dbSNP:114601558
340 340 a, c dbSNP:751305698
344 344 a, g dbSNP:761582953
345 345 -, a dbSNP:759703272
351 351 a, g dbSNP:767015117
355 355 c, g dbSNP:74315353
361 361 a, g dbSNP:201258798
365 365 c, g dbSNP:538300305
366 366 a, g dbSNP:753722802
368 368 a, g dbSNP:754937535
370 370 a, g dbSNP:764942388
371 371 a, g dbSNP:200113696
381 381 c, t dbSNP:367584305
389 389 a, g dbSNP:553957802
392 392 a, c dbSNP:781335529
397 397 c, t dbSNP:11548937
398 398 a, g dbSNP:45601537
409 409 a, g dbSNP:780303707
410 410 -, a dbSNP:35566631
415 415 a, g dbSNP:749774196
421 421 a, t dbSNP:758945306
424 424 c, t dbSNP:777939211
425 425 a, g dbSNP:377263767
435 435 c, t dbSNP:770564079
455 455 c, t dbSNP:182164240
456 456 a, g dbSNP:71653619
461 461 a, g dbSNP:200696147
462 462 c, g dbSNP:199529022
464 464 c, g dbSNP:199719494
472 472 c, t dbSNP:368221790
473 473 a, g dbSNP:774005786
482 482 c, g, t dbSNP:145196092
488 488 c, t dbSNP:757792657
491 491 a, g dbSNP:45577037
492 492 c, g dbSNP:750800796
507 507 a, g dbSNP:755752639
509 509 a, g dbSNP:779825454
534 534 c, g dbSNP:371246061
536 536 -, cac dbSNP:763978579
542 542 c, g, t dbSNP:373618614
545 545 c, t dbSNP:748028245
546 546 c, t dbSNP:772145589
552 552 a, c dbSNP:552097955
557 557 a, g dbSNP:200894731
559 559 a, g dbSNP:200099666
562 562 c, g dbSNP:398124657
563 563 a, g dbSNP:202097100
566 566 a, g dbSNP:201016410
576 576 a, g dbSNP:770710019
581 581 a, g dbSNP:199728189
592 592 a, g dbSNP:140517273
594 594 a, g dbSNP:749485971
596 596 c, t dbSNP:768782230
597 597 a, g dbSNP:148682310
599 599 a, g dbSNP:375023875
600 600 g, t dbSNP:761919138
607 607 a, g dbSNP:772561823
609 609 a, c dbSNP:74315352
610 610 c, t dbSNP:144764347
611 611 a, g dbSNP:368420490
616 616 c, g dbSNP:754180902
629 629 c, t dbSNP:61772692
630 630 a, g dbSNP:765024957
634 634 -, gcc dbSNP:764877312
637 637 c, t dbSNP:752253803
643 643 a, c, t dbSNP:370308517
649 649 c, t dbSNP:777440876
650 650 a, g dbSNP:74315354
652 652 a, g dbSNP:757172943
655 655 g, t dbSNP:780991489
657 657 c, t dbSNP:371514726
658 658 a, g, t dbSNP:768890106
660 660 c, t dbSNP:28938172
662 662 a, g dbSNP:748211203
664 664 a, g dbSNP:71653621
665 665 a, g dbSNP:374962638
670 670 c, g, t dbSNP:368818999
674 674 g, t dbSNP:777026628
696 696 c, t dbSNP:759888524
697 697 a, g dbSNP:149974320
698 698 a, g dbSNP:71653622
701 701 c, g dbSNP:762700748
703 703 a, g dbSNP:763658742
704 704 a, c, g dbSNP:751053636
712 712 c, t dbSNP:767393780
715 715 a, c dbSNP:3203837
721 721 c, t dbSNP:767480482
736 736 -, c dbSNP:754483095
739 739 c, t dbSNP:532144863
740 740 a, g dbSNP:750226268
740 740 -, g dbSNP:778234049
743 743 c, g dbSNP:755957845
746 746 c, g dbSNP:752679225
747 747 a, g dbSNP:779834654
749 749 c, t dbSNP:540890409
750 750 a, c, g dbSNP:758646477
755 755 c, t dbSNP:747102087
761 761 g, t dbSNP:771468418
768 768 c, g dbSNP:777064688
770 770 c, t dbSNP:199752316
771 771 a, g dbSNP:375081848
771 771 -, g dbSNP:771358968
774 774 a, t dbSNP:770218250
778 778 a, t dbSNP:776029338
780 780 c, t dbSNP:762645646
782 782 a, g dbSNP:371482698
796 796 c, t dbSNP:544344069
815 815 c, g dbSNP:753624096
817 817 a, t dbSNP:112196008
848 848 c, t dbSNP:562641550
851 851 -, ctt dbSNP:751840879
855 855 c, t dbSNP:578012560
857 857 c, t dbSNP:147437667
858 858 a, g dbSNP:779587926
883 883 -, ag dbSNP:756195290
920 920 c, t dbSNP:1044766
944 944 a, c dbSNP:746552212

Target ORF information:

RefSeq Version NM_007262
Organism Homo sapiens (human)
Definition Homo sapiens parkinson protein 7 (PARK7), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu26877
Accession Version NM_001123377.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 570bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product protein DJ-1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BP248330.1, AK312000.1 and D61380.2. Summary: The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) represents the shorter transcript. Both variants 1 and 2 encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BM554785.1, BI092098.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)88..90(+)
Misc Feature(2)118..657(+)
Misc Feature(3)121..621(+)
Misc Feature(4)304..306(+)
Misc Feature(5)421..423(+)
Misc Feature(6)421..423(+)
Exon (1)1..82
Gene Synonym:
Exon (2)83..195
Gene Synonym:
Exon (3)196..297
Gene Synonym:
Exon (4)298..357
Gene Synonym:
Exon (5)358..427
Gene Synonym:
Exon (6)428..514
Gene Synonym:
Exon (7)515..903
Gene Synonym:
Position Chain Variation Link
3 3 a, g dbSNP:549829441
27 27 aaggccggacggcgcgcgtgcgtgctggcgtgcgttcac, gaggccggacggcgcgcgtgcgtgctggcgtgcgttcat dbSNP:386628237
27 27 a, g dbSNP:17523802
32 32 a, c dbSNP:539598498
36 36 c, t dbSNP:559287709
37 37 c, g dbSNP:557801400
41 41 c, t dbSNP:775145974
51 51 c, t dbSNP:566749983
56 56 c, g dbSNP:533597069
58 58 c, g dbSNP:555404334
65 65 c, t dbSNP:11548935
65 65 c, t dbSNP:226249
80 80 gg, tc dbSNP:367687042
80 80 g, t dbSNP:544337761
81 81 c, g dbSNP:556263350
84 84 c, g, t dbSNP:11548933
86 86 c, t dbSNP:747578176
87 87 g, t dbSNP:757971913
93 93 -, at dbSNP:766562733
95 95 a, g dbSNP:200286981
96 96 a, t dbSNP:746902331
99 99 a, c, t dbSNP:770994769
100 100 a, g dbSNP:745735399
101 101 c, t dbSNP:768757739
103 103 a, t dbSNP:774674506
116 116 a, g dbSNP:190738218
121 121 g, t dbSNP:767539467
122 122 c, t dbSNP:773313843
145 145 a, g dbSNP:761107607
153 153 a, g dbSNP:771692484
154 154 a, c, g dbSNP:147698459
157 157 a, g dbSNP:764771957
159 159 a, g dbSNP:752342660
161 161 c, t dbSNP:758016497
162 162 a, g dbSNP:777350692
164 164 c, t dbSNP:370430693
171 171 a, t dbSNP:775184804
172 172 a, g dbSNP:757247182
178 178 a, g dbSNP:781346135
180 180 c, t dbSNP:745618719
183 183 a, g dbSNP:74315351
185 185 a, g dbSNP:769681126
187 187 a, c dbSNP:374429170
188 188 a, g dbSNP:142405016
191 191 c, g dbSNP:376428939
196 196 a, t dbSNP:749054218
206 206 c, t dbSNP:772272696
207 207 c, g, t dbSNP:374236728
208 208 -, t dbSNP:781600849
208 208 a, g dbSNP:770946447
220 220 g, t dbSNP:137853051
240 240 a, g dbSNP:776602132
247 247 c, t dbSNP:760020407
248 248 a, g dbSNP:145727915
259 259 a, g dbSNP:775909660
264 264 g, t dbSNP:763477392
266 266 a, c dbSNP:368405677
271 271 a, g dbSNP:114601558
282 282 a, c dbSNP:751305698
286 286 a, g dbSNP:761582953
287 287 -, a dbSNP:759703272
293 293 a, g dbSNP:767015117
297 297 c, g dbSNP:74315353
303 303 a, g dbSNP:201258798
307 307 c, g dbSNP:538300305
308 308 a, g dbSNP:753722802
310 310 a, g dbSNP:754937535
312 312 a, g dbSNP:764942388
313 313 a, g dbSNP:200113696
323 323 c, t dbSNP:367584305
331 331 a, g dbSNP:553957802
334 334 a, c dbSNP:781335529
339 339 c, t dbSNP:11548937
340 340 a, g dbSNP:45601537
351 351 a, g dbSNP:780303707
352 352 -, a dbSNP:35566631
357 357 a, g dbSNP:749774196
363 363 a, t dbSNP:758945306
366 366 c, t dbSNP:777939211
367 367 a, g dbSNP:377263767
377 377 c, t dbSNP:770564079
397 397 c, t dbSNP:182164240
398 398 a, g dbSNP:71653619
403 403 a, g dbSNP:200696147
404 404 c, g dbSNP:199529022
406 406 c, g dbSNP:199719494
414 414 c, t dbSNP:368221790
415 415 a, g dbSNP:774005786
424 424 c, g, t dbSNP:145196092
430 430 c, t dbSNP:757792657
433 433 a, g dbSNP:45577037
434 434 c, g dbSNP:750800796
449 449 a, g dbSNP:755752639
451 451 a, g dbSNP:779825454
476 476 c, g dbSNP:371246061
478 478 -, cac dbSNP:763978579
484 484 c, g, t dbSNP:373618614
487 487 c, t dbSNP:748028245
488 488 c, t dbSNP:772145589
494 494 a, c dbSNP:552097955
499 499 a, g dbSNP:200894731
501 501 a, g dbSNP:200099666
504 504 c, g dbSNP:398124657
505 505 a, g dbSNP:202097100
508 508 a, g dbSNP:201016410
518 518 a, g dbSNP:770710019
523 523 a, g dbSNP:199728189
534 534 a, g dbSNP:140517273
536 536 a, g dbSNP:749485971
538 538 c, t dbSNP:768782230
539 539 a, g dbSNP:148682310
541 541 a, g dbSNP:375023875
542 542 g, t dbSNP:761919138
549 549 a, g dbSNP:772561823
551 551 a, c dbSNP:74315352
552 552 c, t dbSNP:144764347
553 553 a, g dbSNP:368420490
558 558 c, g dbSNP:754180902
571 571 c, t dbSNP:61772692
572 572 a, g dbSNP:765024957
576 576 -, gcc dbSNP:764877312
579 579 c, t dbSNP:752253803
585 585 a, c, t dbSNP:370308517
591 591 c, t dbSNP:777440876
592 592 a, g dbSNP:74315354
594 594 a, g dbSNP:757172943
597 597 g, t dbSNP:780991489
599 599 c, t dbSNP:371514726
600 600 a, g, t dbSNP:768890106
602 602 c, t dbSNP:28938172
604 604 a, g dbSNP:748211203
606 606 a, g dbSNP:71653621
607 607 a, g dbSNP:374962638
612 612 c, g, t dbSNP:368818999
616 616 g, t dbSNP:777026628
638 638 c, t dbSNP:759888524
639 639 a, g dbSNP:149974320
640 640 a, g dbSNP:71653622
643 643 c, g dbSNP:762700748
645 645 a, g dbSNP:763658742
646 646 a, c, g dbSNP:751053636
654 654 c, t dbSNP:767393780
657 657 a, c dbSNP:3203837
663 663 c, t dbSNP:767480482
678 678 -, c dbSNP:754483095
681 681 c, t dbSNP:532144863
682 682 a, g dbSNP:750226268
682 682 -, g dbSNP:778234049
685 685 c, g dbSNP:755957845
688 688 c, g dbSNP:752679225
689 689 a, g dbSNP:779834654
691 691 c, t dbSNP:540890409
692 692 a, c, g dbSNP:758646477
697 697 c, t dbSNP:747102087
703 703 g, t dbSNP:771468418
710 710 c, g dbSNP:777064688
712 712 c, t dbSNP:199752316
713 713 a, g dbSNP:375081848
713 713 -, g dbSNP:771358968
716 716 a, t dbSNP:770218250
720 720 a, t dbSNP:776029338
722 722 c, t dbSNP:762645646
724 724 a, g dbSNP:371482698
738 738 c, t dbSNP:544344069
757 757 c, g dbSNP:753624096
759 759 a, t dbSNP:112196008
790 790 c, t dbSNP:562641550
793 793 -, ctt dbSNP:751840879
797 797 c, t dbSNP:578012560
799 799 c, t dbSNP:147437667
800 800 a, g dbSNP:779587926
825 825 -, ag dbSNP:756195290
862 862 c, t dbSNP:1044766
886 886 a, c dbSNP:746552212

Target ORF information:

RefSeq Version NM_001123377
Organism Homo sapiens (human)
Definition Homo sapiens parkinson protein 7 (PARK7), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
