Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

PARK7 parkinson protein 7 [Homo sapiens (human)]

Gene Symbol PARK7
Entrez Gene ID 11315
Full Name parkinson protein 7
Synonyms DJ-1, DJ1, HEL-S-67p
General protein information
Preferred Names
protein DJ-1
protein DJ-1
oncogene DJ1
Parkinson disease (autosomal recessive, early onset) 7
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Parkinson disease 7, autosomal recessive early-onset, 606324 (3);
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu26877 XM_005263424 PREDICTED: Homo sapiens parkinson protein 7 (PARK7), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu26877 NM_007262 Homo sapiens parkinson protein 7 (PARK7), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu26877 NM_001123377 Homo sapiens parkinson protein 7 (PARK7), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu26877D
Sequence Information ORF Nucleotide Sequence (Length: 570bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product protein DJ-1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_032977.10) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:530360486. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)196..735(+)
Misc Feature(2)199..699(+)
Misc Feature(3)499..501(+)
Position Chain Variation Link
17 17 c, t dbSNP:774954085
26 26 c, g dbSNP:773650813
28 28 g, t dbSNP:549890716
30 30 c, t dbSNP:571699528
35 35 c, t dbSNP:760230488
53 53 c, t dbSNP:549306462
59 59 c, g dbSNP:533019831
66 66 c, t dbSNP:764574651
126 126 c, t dbSNP:551550334
143 143 c, t dbSNP:566498850
153 153 c, t dbSNP:763511622
159 159 c, t dbSNP:534088150
162 162 c, g, t dbSNP:11548933
164 164 c, t dbSNP:747578176
165 165 g, t dbSNP:757971913
171 171 -, at dbSNP:766562733
173 173 a, g dbSNP:200286981
174 174 a, t dbSNP:746902331
177 177 a, c, t dbSNP:770994769
178 178 a, g dbSNP:745735399
179 179 c, t dbSNP:768757739
181 181 a, t dbSNP:774674506
194 194 a, g dbSNP:190738218
199 199 g, t dbSNP:767539467
200 200 c, t dbSNP:773313843
223 223 a, g dbSNP:761107607
231 231 a, g dbSNP:771692484
232 232 a, c, g dbSNP:147698459
235 235 a, g dbSNP:764771957
237 237 a, g dbSNP:752342660
239 239 c, t dbSNP:758016497
240 240 a, g dbSNP:777350692
242 242 c, t dbSNP:370430693
249 249 a, t dbSNP:775184804
250 250 a, g dbSNP:757247182
256 256 a, g dbSNP:781346135
258 258 c, t dbSNP:745618719
261 261 a, g dbSNP:74315351
263 263 a, g dbSNP:769681126
265 265 a, c dbSNP:374429170
266 266 a, g dbSNP:142405016
269 269 c, g dbSNP:376428939
274 274 a, t dbSNP:749054218
284 284 c, t dbSNP:772272696
285 285 c, g, t dbSNP:374236728
286 286 -, t dbSNP:781600849
286 286 a, g dbSNP:770946447
298 298 g, t dbSNP:137853051
318 318 a, g dbSNP:776602132
325 325 c, t dbSNP:760020407
326 326 a, g dbSNP:145727915
337 337 a, g dbSNP:775909660
342 342 g, t dbSNP:763477392
344 344 a, c dbSNP:368405677
349 349 a, g dbSNP:114601558
360 360 a, c dbSNP:751305698
364 364 a, g dbSNP:761582953
365 365 -, a dbSNP:759703272
371 371 a, g dbSNP:767015117
375 375 c, g dbSNP:74315353
381 381 a, g dbSNP:201258798
385 385 c, g dbSNP:538300305
386 386 a, g dbSNP:753722802
388 388 a, g dbSNP:754937535
390 390 a, g dbSNP:764942388
391 391 a, g dbSNP:200113696
401 401 c, t dbSNP:367584305
409 409 a, g dbSNP:553957802
412 412 a, c dbSNP:781335529
417 417 c, t dbSNP:11548937
418 418 a, g dbSNP:45601537
429 429 a, g dbSNP:780303707
430 430 -, a dbSNP:35566631
435 435 a, g dbSNP:749774196
441 441 a, t dbSNP:758945306
444 444 c, t dbSNP:777939211
445 445 a, g dbSNP:377263767
455 455 c, t dbSNP:770564079
475 475 c, t dbSNP:182164240
476 476 a, g dbSNP:71653619
481 481 a, g dbSNP:200696147
482 482 c, g dbSNP:199529022
484 484 c, g dbSNP:199719494
492 492 c, t dbSNP:368221790
493 493 a, g dbSNP:774005786
502 502 c, g, t dbSNP:145196092
508 508 c, t dbSNP:757792657
511 511 a, g dbSNP:45577037
512 512 c, g dbSNP:750800796
527 527 a, g dbSNP:755752639
529 529 a, g dbSNP:779825454
554 554 c, g dbSNP:371246061
556 556 -, cac dbSNP:763978579
562 562 c, g, t dbSNP:373618614
565 565 c, t dbSNP:748028245
566 566 c, t dbSNP:772145589
572 572 a, c dbSNP:552097955
577 577 a, g dbSNP:200894731
579 579 a, g dbSNP:200099666
582 582 c, g dbSNP:398124657
583 583 a, g dbSNP:202097100
586 586 a, g dbSNP:201016410
596 596 a, g dbSNP:770710019
601 601 a, g dbSNP:199728189
612 612 a, g dbSNP:140517273
614 614 a, g dbSNP:749485971
616 616 c, t dbSNP:768782230
617 617 a, g dbSNP:148682310
619 619 a, g dbSNP:375023875
620 620 g, t dbSNP:761919138
627 627 a, g dbSNP:772561823
629 629 a, c dbSNP:74315352
630 630 c, t dbSNP:144764347
631 631 a, g dbSNP:368420490
636 636 c, g dbSNP:754180902
649 649 c, t dbSNP:61772692
650 650 a, g dbSNP:765024957
654 654 -, gcc dbSNP:764877312
657 657 c, t dbSNP:752253803
663 663 a, c, t dbSNP:370308517
669 669 c, t dbSNP:777440876
670 670 a, g dbSNP:74315354
672 672 a, g dbSNP:757172943
675 675 g, t dbSNP:780991489
677 677 c, t dbSNP:371514726
678 678 a, g, t dbSNP:768890106
680 680 c, t dbSNP:28938172
682 682 a, g dbSNP:748211203
684 684 a, g dbSNP:71653621
685 685 a, g dbSNP:374962638
690 690 c, g, t dbSNP:368818999
694 694 g, t dbSNP:777026628
716 716 c, t dbSNP:759888524
717 717 a, g dbSNP:149974320
718 718 a, g dbSNP:71653622
721 721 c, g dbSNP:762700748
723 723 a, g dbSNP:763658742
724 724 a, c, g dbSNP:751053636
732 732 c, t dbSNP:767393780
735 735 a, c dbSNP:3203837
741 741 c, t dbSNP:767480482
756 756 -, c dbSNP:754483095
759 759 c, t dbSNP:532144863
760 760 a, g dbSNP:750226268
760 760 -, g dbSNP:778234049
763 763 c, g dbSNP:755957845
766 766 c, g dbSNP:752679225
767 767 a, g dbSNP:779834654
769 769 c, t dbSNP:540890409
770 770 a, c, g dbSNP:758646477
775 775 c, t dbSNP:747102087
781 781 g, t dbSNP:771468418
788 788 c, g dbSNP:777064688
790 790 c, t dbSNP:199752316
791 791 a, g dbSNP:375081848
791 791 -, g dbSNP:771358968
794 794 a, t dbSNP:770218250
798 798 a, t dbSNP:776029338
800 800 c, t dbSNP:762645646
802 802 a, g dbSNP:371482698
816 816 c, t dbSNP:544344069
835 835 c, g dbSNP:753624096
837 837 a, t dbSNP:112196008
868 868 c, t dbSNP:562641550
871 871 -, ctt dbSNP:751840879
875 875 c, t dbSNP:578012560
877 877 c, t dbSNP:147437667
878 878 a, g dbSNP:779587926
903 903 -, ag dbSNP:756195290
940 940 c, t dbSNP:1044766
964 964 a, c dbSNP:746552212

Target ORF information:

RefSeq Version XM_005263424
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens parkinson protein 7 (PARK7), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu26877D
Sequence Information ORF Nucleotide Sequence (Length: 570bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product protein DJ-1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BP248330.1, BC008188.2, AK312000.1 and D61380.2. This sequence is a reference standard in the RefSeqGene project. On Apr 16, 2008 this sequence version replaced gi:34222306. Summary: The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BQ436114.1, BI552690.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)146..148(+)
Misc Feature(2)176..715(+)
Misc Feature(3)179..679(+)
Misc Feature(4)362..364(+)
Misc Feature(5)362..364(+)
Misc Feature(6)479..481(+)
Misc Feature(7)479..481(+)
Misc Feature(8)551..553(+)
Exon (1)1..140
Gene Synonym:
Exon (2)141..253
Gene Synonym:
Exon (3)254..355
Gene Synonym:
Exon (4)356..415
Gene Synonym:
Exon (5)416..485
Gene Synonym:
Exon (6)486..572
Gene Synonym:
Exon (7)573..961
Gene Synonym:
Position Chain Variation Link
3 3 a, g dbSNP:549829441
27 27 aaggccggacggcgcgcgtgcgtgctggcgtgcgttcac, gaggccggacggcgcgcgtgcgtgctggcgtgcgttcat dbSNP:386628237
27 27 a, g dbSNP:17523802
32 32 a, c dbSNP:539598498
36 36 c, t dbSNP:559287709
37 37 c, g dbSNP:557801400
41 41 c, t dbSNP:775145974
51 51 c, t dbSNP:566749983
56 56 c, g dbSNP:533597069
58 58 c, g dbSNP:555404334
65 65 c, t dbSNP:11548935
65 65 c, t dbSNP:226249
80 80 gg, tc dbSNP:367687042
80 80 g, t dbSNP:544337761
81 81 c, g dbSNP:556263350
84 84 a, t dbSNP:140230911
85 85 a, g dbSNP:545577153
94 94 c, t dbSNP:11121064
99 99 a, g dbSNP:527992433
142 142 c, g, t dbSNP:11548933
144 144 c, t dbSNP:747578176
145 145 g, t dbSNP:757971913
151 151 -, at dbSNP:766562733
153 153 a, g dbSNP:200286981
154 154 a, t dbSNP:746902331
157 157 a, c, t dbSNP:770994769
158 158 a, g dbSNP:745735399
159 159 c, t dbSNP:768757739
161 161 a, t dbSNP:774674506
174 174 a, g dbSNP:190738218
179 179 g, t dbSNP:767539467
180 180 c, t dbSNP:773313843
203 203 a, g dbSNP:761107607
211 211 a, g dbSNP:771692484
212 212 a, c, g dbSNP:147698459
215 215 a, g dbSNP:764771957
217 217 a, g dbSNP:752342660
219 219 c, t dbSNP:758016497
220 220 a, g dbSNP:777350692
222 222 c, t dbSNP:370430693
229 229 a, t dbSNP:775184804
230 230 a, g dbSNP:757247182
236 236 a, g dbSNP:781346135
238 238 c, t dbSNP:745618719
241 241 a, g dbSNP:74315351
243 243 a, g dbSNP:769681126
245 245 a, c dbSNP:374429170
246 246 a, g dbSNP:142405016
249 249 c, g dbSNP:376428939
254 254 a, t dbSNP:749054218
264 264 c, t dbSNP:772272696
265 265 c, g, t dbSNP:374236728
266 266 -, t dbSNP:781600849
266 266 a, g dbSNP:770946447
278 278 g, t dbSNP:137853051
298 298 a, g dbSNP:776602132
305 305 c, t dbSNP:760020407
306 306 a, g dbSNP:145727915
317 317 a, g dbSNP:775909660
322 322 g, t dbSNP:763477392
324 324 a, c dbSNP:368405677
329 329 a, g dbSNP:114601558
340 340 a, c dbSNP:751305698
344 344 a, g dbSNP:761582953
345 345 -, a dbSNP:759703272
351 351 a, g dbSNP:767015117
355 355 c, g dbSNP:74315353
361 361 a, g dbSNP:201258798
365 365 c, g dbSNP:538300305
366 366 a, g dbSNP:753722802
368 368 a, g dbSNP:754937535
370 370 a, g dbSNP:764942388
371 371 a, g dbSNP:200113696
381 381 c, t dbSNP:367584305
389 389 a, g dbSNP:553957802
392 392 a, c dbSNP:781335529
397 397 c, t dbSNP:11548937
398 398 a, g dbSNP:45601537
409 409 a, g dbSNP:780303707
410 410 -, a dbSNP:35566631
415 415 a, g dbSNP:749774196
421 421 a, t dbSNP:758945306
424 424 c, t dbSNP:777939211
425 425 a, g dbSNP:377263767
435 435 c, t dbSNP:770564079
455 455 c, t dbSNP:182164240
456 456 a, g dbSNP:71653619
461 461 a, g dbSNP:200696147
462 462 c, g dbSNP:199529022
464 464 c, g dbSNP:199719494
472 472 c, t dbSNP:368221790
473 473 a, g dbSNP:774005786
482 482 c, g, t dbSNP:145196092
488 488 c, t dbSNP:757792657
491 491 a, g dbSNP:45577037
492 492 c, g dbSNP:750800796
507 507 a, g dbSNP:755752639
509 509 a, g dbSNP:779825454
534 534 c, g dbSNP:371246061
536 536 -, cac dbSNP:763978579
542 542 c, g, t dbSNP:373618614
545 545 c, t dbSNP:748028245
546 546 c, t dbSNP:772145589
552 552 a, c dbSNP:552097955
557 557 a, g dbSNP:200894731
559 559 a, g dbSNP:200099666
562 562 c, g dbSNP:398124657
563 563 a, g dbSNP:202097100
566 566 a, g dbSNP:201016410
576 576 a, g dbSNP:770710019
581 581 a, g dbSNP:199728189
592 592 a, g dbSNP:140517273
594 594 a, g dbSNP:749485971
596 596 c, t dbSNP:768782230
597 597 a, g dbSNP:148682310
599 599 a, g dbSNP:375023875
600 600 g, t dbSNP:761919138
607 607 a, g dbSNP:772561823
609 609 a, c dbSNP:74315352
610 610 c, t dbSNP:144764347
611 611 a, g dbSNP:368420490
616 616 c, g dbSNP:754180902
629 629 c, t dbSNP:61772692
630 630 a, g dbSNP:765024957
634 634 -, gcc dbSNP:764877312
637 637 c, t dbSNP:752253803
643 643 a, c, t dbSNP:370308517
649 649 c, t dbSNP:777440876
650 650 a, g dbSNP:74315354
652 652 a, g dbSNP:757172943
655 655 g, t dbSNP:780991489
657 657 c, t dbSNP:371514726
658 658 a, g, t dbSNP:768890106
660 660 c, t dbSNP:28938172
662 662 a, g dbSNP:748211203
664 664 a, g dbSNP:71653621
665 665 a, g dbSNP:374962638
670 670 c, g, t dbSNP:368818999
674 674 g, t dbSNP:777026628
696 696 c, t dbSNP:759888524
697 697 a, g dbSNP:149974320
698 698 a, g dbSNP:71653622
701 701 c, g dbSNP:762700748
703 703 a, g dbSNP:763658742
704 704 a, c, g dbSNP:751053636
712 712 c, t dbSNP:767393780
715 715 a, c dbSNP:3203837
721 721 c, t dbSNP:767480482
736 736 -, c dbSNP:754483095
739 739 c, t dbSNP:532144863
740 740 a, g dbSNP:750226268
740 740 -, g dbSNP:778234049
743 743 c, g dbSNP:755957845
746 746 c, g dbSNP:752679225
747 747 a, g dbSNP:779834654
749 749 c, t dbSNP:540890409
750 750 a, c, g dbSNP:758646477
755 755 c, t dbSNP:747102087
761 761 g, t dbSNP:771468418
768 768 c, g dbSNP:777064688
770 770 c, t dbSNP:199752316
771 771 a, g dbSNP:375081848
771 771 -, g dbSNP:771358968
774 774 a, t dbSNP:770218250
778 778 a, t dbSNP:776029338
780 780 c, t dbSNP:762645646
782 782 a, g dbSNP:371482698
796 796 c, t dbSNP:544344069
815 815 c, g dbSNP:753624096
817 817 a, t dbSNP:112196008
848 848 c, t dbSNP:562641550
851 851 -, ctt dbSNP:751840879
855 855 c, t dbSNP:578012560
857 857 c, t dbSNP:147437667
858 858 a, g dbSNP:779587926
883 883 -, ag dbSNP:756195290
920 920 c, t dbSNP:1044766
944 944 a, c dbSNP:746552212

Target ORF information:

RefSeq Version NM_007262
Organism Homo sapiens (human)
Definition Homo sapiens parkinson protein 7 (PARK7), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu26877D
Sequence Information ORF Nucleotide Sequence (Length: 570bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product protein DJ-1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BP248330.1, AK312000.1 and D61380.2. Summary: The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) represents the shorter transcript. Both variants 1 and 2 encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BM554785.1, BI092098.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)88..90(+)
Misc Feature(2)118..657(+)
Misc Feature(3)121..621(+)
Misc Feature(4)304..306(+)
Misc Feature(5)421..423(+)
Misc Feature(6)421..423(+)
Exon (1)1..82
Gene Synonym:
Exon (2)83..195
Gene Synonym:
Exon (3)196..297
Gene Synonym:
Exon (4)298..357
Gene Synonym:
Exon (5)358..427
Gene Synonym:
Exon (6)428..514
Gene Synonym:
Exon (7)515..903
Gene Synonym:
Position Chain Variation Link
3 3 a, g dbSNP:549829441
27 27 aaggccggacggcgcgcgtgcgtgctggcgtgcgttcac, gaggccggacggcgcgcgtgcgtgctggcgtgcgttcat dbSNP:386628237
27 27 a, g dbSNP:17523802
32 32 a, c dbSNP:539598498
36 36 c, t dbSNP:559287709
37 37 c, g dbSNP:557801400
41 41 c, t dbSNP:775145974
51 51 c, t dbSNP:566749983
56 56 c, g dbSNP:533597069
58 58 c, g dbSNP:555404334
65 65 c, t dbSNP:11548935
65 65 c, t dbSNP:226249
80 80 gg, tc dbSNP:367687042
80 80 g, t dbSNP:544337761
81 81 c, g dbSNP:556263350
84 84 c, g, t dbSNP:11548933
86 86 c, t dbSNP:747578176
87 87 g, t dbSNP:757971913
93 93 -, at dbSNP:766562733
95 95 a, g dbSNP:200286981
96 96 a, t dbSNP:746902331
99 99 a, c, t dbSNP:770994769
100 100 a, g dbSNP:745735399
101 101 c, t dbSNP:768757739
103 103 a, t dbSNP:774674506
116 116 a, g dbSNP:190738218
121 121 g, t dbSNP:767539467
122 122 c, t dbSNP:773313843
145 145 a, g dbSNP:761107607
153 153 a, g dbSNP:771692484
154 154 a, c, g dbSNP:147698459
157 157 a, g dbSNP:764771957
159 159 a, g dbSNP:752342660
161 161 c, t dbSNP:758016497
162 162 a, g dbSNP:777350692
164 164 c, t dbSNP:370430693
171 171 a, t dbSNP:775184804
172 172 a, g dbSNP:757247182
178 178 a, g dbSNP:781346135
180 180 c, t dbSNP:745618719
183 183 a, g dbSNP:74315351
185 185 a, g dbSNP:769681126
187 187 a, c dbSNP:374429170
188 188 a, g dbSNP:142405016
191 191 c, g dbSNP:376428939
196 196 a, t dbSNP:749054218
206 206 c, t dbSNP:772272696
207 207 c, g, t dbSNP:374236728
208 208 -, t dbSNP:781600849
208 208 a, g dbSNP:770946447
220 220 g, t dbSNP:137853051
240 240 a, g dbSNP:776602132
247 247 c, t dbSNP:760020407
248 248 a, g dbSNP:145727915
259 259 a, g dbSNP:775909660
264 264 g, t dbSNP:763477392
266 266 a, c dbSNP:368405677
271 271 a, g dbSNP:114601558
282 282 a, c dbSNP:751305698
286 286 a, g dbSNP:761582953
287 287 -, a dbSNP:759703272
293 293 a, g dbSNP:767015117
297 297 c, g dbSNP:74315353
303 303 a, g dbSNP:201258798
307 307 c, g dbSNP:538300305
308 308 a, g dbSNP:753722802
310 310 a, g dbSNP:754937535
312 312 a, g dbSNP:764942388
313 313 a, g dbSNP:200113696
323 323 c, t dbSNP:367584305
331 331 a, g dbSNP:553957802
334 334 a, c dbSNP:781335529
339 339 c, t dbSNP:11548937
340 340 a, g dbSNP:45601537
351 351 a, g dbSNP:780303707
352 352 -, a dbSNP:35566631
357 357 a, g dbSNP:749774196
363 363 a, t dbSNP:758945306
366 366 c, t dbSNP:777939211
367 367 a, g dbSNP:377263767
377 377 c, t dbSNP:770564079
397 397 c, t dbSNP:182164240
398 398 a, g dbSNP:71653619
403 403 a, g dbSNP:200696147
404 404 c, g dbSNP:199529022
406 406 c, g dbSNP:199719494
414 414 c, t dbSNP:368221790
415 415 a, g dbSNP:774005786
424 424 c, g, t dbSNP:145196092
430 430 c, t dbSNP:757792657
433 433 a, g dbSNP:45577037
434 434 c, g dbSNP:750800796
449 449 a, g dbSNP:755752639
451 451 a, g dbSNP:779825454
476 476 c, g dbSNP:371246061
478 478 -, cac dbSNP:763978579
484 484 c, g, t dbSNP:373618614
487 487 c, t dbSNP:748028245
488 488 c, t dbSNP:772145589
494 494 a, c dbSNP:552097955
499 499 a, g dbSNP:200894731
501 501 a, g dbSNP:200099666
504 504 c, g dbSNP:398124657
505 505 a, g dbSNP:202097100
508 508 a, g dbSNP:201016410
518 518 a, g dbSNP:770710019
523 523 a, g dbSNP:199728189
534 534 a, g dbSNP:140517273
536 536 a, g dbSNP:749485971
538 538 c, t dbSNP:768782230
539 539 a, g dbSNP:148682310
541 541 a, g dbSNP:375023875
542 542 g, t dbSNP:761919138
549 549 a, g dbSNP:772561823
551 551 a, c dbSNP:74315352
552 552 c, t dbSNP:144764347
553 553 a, g dbSNP:368420490
558 558 c, g dbSNP:754180902
571 571 c, t dbSNP:61772692
572 572 a, g dbSNP:765024957
576 576 -, gcc dbSNP:764877312
579 579 c, t dbSNP:752253803
585 585 a, c, t dbSNP:370308517
591 591 c, t dbSNP:777440876
592 592 a, g dbSNP:74315354
594 594 a, g dbSNP:757172943
597 597 g, t dbSNP:780991489
599 599 c, t dbSNP:371514726
600 600 a, g, t dbSNP:768890106
602 602 c, t dbSNP:28938172
604 604 a, g dbSNP:748211203
606 606 a, g dbSNP:71653621
607 607 a, g dbSNP:374962638
612 612 c, g, t dbSNP:368818999
616 616 g, t dbSNP:777026628
638 638 c, t dbSNP:759888524
639 639 a, g dbSNP:149974320
640 640 a, g dbSNP:71653622
643 643 c, g dbSNP:762700748
645 645 a, g dbSNP:763658742
646 646 a, c, g dbSNP:751053636
654 654 c, t dbSNP:767393780
657 657 a, c dbSNP:3203837
663 663 c, t dbSNP:767480482
678 678 -, c dbSNP:754483095
681 681 c, t dbSNP:532144863
682 682 a, g dbSNP:750226268
682 682 -, g dbSNP:778234049
685 685 c, g dbSNP:755957845
688 688 c, g dbSNP:752679225
689 689 a, g dbSNP:779834654
691 691 c, t dbSNP:540890409
692 692 a, c, g dbSNP:758646477
697 697 c, t dbSNP:747102087
703 703 g, t dbSNP:771468418
710 710 c, g dbSNP:777064688
712 712 c, t dbSNP:199752316
713 713 a, g dbSNP:375081848
713 713 -, g dbSNP:771358968
716 716 a, t dbSNP:770218250
720 720 a, t dbSNP:776029338
722 722 c, t dbSNP:762645646
724 724 a, g dbSNP:371482698
738 738 c, t dbSNP:544344069
757 757 c, g dbSNP:753624096
759 759 a, t dbSNP:112196008
790 790 c, t dbSNP:562641550
793 793 -, ctt dbSNP:751840879
797 797 c, t dbSNP:578012560
799 799 c, t dbSNP:147437667
800 800 a, g dbSNP:779587926
825 825 -, ag dbSNP:756195290
862 862 c, t dbSNP:1044766
886 886 a, c dbSNP:746552212

Target ORF information:

RefSeq Version NM_001123377
Organism Homo sapiens (human)
Definition Homo sapiens parkinson protein 7 (PARK7), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.