Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND


CTRC chymotrypsin C (caldecrin) [Homo sapiens (human)]

Gene Symbol CTRC
Entrez Gene ID 11330
Full Name chymotrypsin C (caldecrin)
Synonyms CLCR, ELA4
General protein information
Preferred Names
chymotrypsin-C
Names
chymotrypsin-C
caldecrin
elastase 4
elastase IV
serum calcium decreasing factor
NP_009203.2
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

1

1p36.21

Summary This gene encodes a member of the peptidase S1 family. The encoded protein is a serum calcium-decreasing factor that has chymotrypsin-like protease activity. Alternatively spliced transcript variants have been observed, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:

601405

Disorder Html: {Pancreatitis, chronic, susceptibility to}, 167800 (3)
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu64923 XM_011540550 PREDICTED: Homo sapiens chymotrypsin C (caldecrin) (CTRC), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu20008 NM_007272 Homo sapiens chymotrypsin C (caldecrin) (CTRC), mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.



CloneID OHu64923D
Sequence Information ORF Nucleotide Sequence (Length: 843bp)
Protein sequence
SNP
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product chymotrypsin-C isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_032977.10) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
ATGTTGGGCA TCACTGTCCT CGCTGCGCTC TTGGCCTGTG CCTCCAGCTG TGGGGTGCCC 
AGCTTCCCGC CCAACCTATC CGCCCGAGTG GTGGGAGGAG AGGATGCCCG GCCCCACAGC
TGGCCCTGGC AGATCTCCCT CCAGTACCTC AAGAACGACA CGTGGAGGCA TACGTGTGGC
GGGACTTTGA TTGCTAGCAA CTTCGTCCTC ACTGCCGCCC ACTGCATCAG CAACACCCGG
ACCTACCGTG TGGCCGTGGG AAAGAACAAC CTGGAGGTGG AAGACGAAGA AGGATCCCTG
TTTGTGGGTG TGGACACCAT CCACGTCCAC AAGAGATGGA ATGCCCTCCT GTTGCGCAAT
GATATTGCCC TCATCAAGCT TGCAGAGCAT GTGGAGCTGA GTGACACCAT CCAGGTGGCC
TGCCTGCCAG AGAAGGACTC CCTGCTCCCC AAGGACTACC CCTGCTATGT CACCGGCTGG
GGCCGCCTCT GGAGGGGACT CCGGTGGCCC ACTGAACTGC CAGTTGGAGA ACGGTTCCTG
GGAGGTGTTT GGCATCGTCA GCTTTGGCTC CCGGCGGGGC TGCAACACCC GCAAGAAGCC
GGTAGTCTAC ACCCGGGTGT CCGCCTACAT CGACTGGATC AACGAGAAAA TGCAGCTGTG
ATTTGTTGCT GGGAGCGGCG GCAGCGAGTC CCTGCAACAG CAATAAACTT CCTTCTCCTC
GGGCCACCTG GATCCTTGAT TTGTGCAGCT TCTGTTGCTT CCCTCCTCTC TGGTGCTGCC
CCTTTCCACA CTATGGAGCC AAAGAGAGAC CCCACTCAGC CAGTTTCCCC CACCCTGCAT
TAG
The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
RefSeqXP_011538852.1
CDS24..866
Misc Feature(1)108..>512(+)
Misc Feature(2)111..>542(+)
Misc Feature(3)111..113(+)
Misc Feature(4)243..386(+)
Translation
Position Chain Variation Link
14 14 a, g dbSNP:762757220
24 24 a, g dbSNP:544668774
29 29 a, g dbSNP:774324080
34 34 c, t dbSNP:761548318
36 36 a, t dbSNP:933703
45 45 a, g dbSNP:767349844
47 47 -, t dbSNP:774163002
48 48 g, t dbSNP:749888586
49 49 c, t dbSNP:772818172
50 50 a, c, g dbSNP:374821228
52 52 c, t dbSNP:758984378
55 55 a, t dbSNP:778090425
62 62 c, t dbSNP:747431847
65 65 c, t dbSNP:760194187
69 69 a, g dbSNP:765777463
71 71 c, g, t dbSNP:753438186
75 75 a, g dbSNP:200576965
78 78 g, t dbSNP:751854409
79 79 -, g dbSNP:761774161
81 81 c, t dbSNP:757630885
89 89 c, t dbSNP:781341140
91 91 c, t dbSNP:533967597
92 92 a, g dbSNP:756394210
93 93 c, t dbSNP:779971254
104 104 c, t dbSNP:749455108
105 105 a, g dbSNP:768414501
107 107 c, t dbSNP:779009847
108 108 c, t dbSNP:747905422
109 109 a, g dbSNP:772024986
113 113 a, g dbSNP:553816883
126 126 a, g dbSNP:184977421
132 132 c, t dbSNP:770675516
133 133 a, g dbSNP:145868278
157 157 a, t dbSNP:758920912
162 162 c, t dbSNP:769324644
166 166 a, g dbSNP:536812916
168 168 c, t dbSNP:78247007
170 170 c, t dbSNP:576621137
176 176 a, g dbSNP:267598094
179 179 c, t dbSNP:77373944
180 180 a, g dbSNP:761118020
184 184 c, t dbSNP:559326793
185 185 a, c, g dbSNP:756090858
187 187 a, g, t dbSNP:121909294
191 191 a, g dbSNP:758406950
196 196 c, t dbSNP:200910331
197 197 a, g dbSNP:746721892
199 199 a, g dbSNP:757098417
203 203 a, c, t dbSNP:497078
204 204 a, g dbSNP:769482036
208 208 c, g dbSNP:774966069
210 210 -, ttga dbSNP:767242562
220 220 a, g dbSNP:748861167
225 225 a, t dbSNP:772513025
227 227 c, t dbSNP:773793601
228 228 a, g dbSNP:760911831
233 233 a, c dbSNP:766739002
235 235 c, t dbSNP:560916216
239 239 c, t dbSNP:140059353
240 240 a, g dbSNP:515726209
261 261 c, t dbSNP:779643710
262 262 a, g dbSNP:753361075
269 269 a, c, t dbSNP:754640545
270 270 c, g, t dbSNP:747679121
271 271 a, g dbSNP:781768384
274 274 a, c, t dbSNP:200369419
277 277 c, t dbSNP:776037315
278 278 c, t dbSNP:763210990
279 279 a, g dbSNP:367979183
283 283 a, g dbSNP:371766512
287 287 a, g dbSNP:575397166
291 291 a, t dbSNP:767382039
299 299 g, t dbSNP:374645306
300 300 a, g dbSNP:760649717
305 305 a, g dbSNP:766144228
308 308 c, g, t dbSNP:41307798
309 309 a, g dbSNP:144286923
320 320 c, t dbSNP:539554130
324 324 c, t dbSNP:752195533
325 325 c, t dbSNP:148595354
329 329 -, g dbSNP:773119534
340 340 c, t dbSNP:367728085
344 344 a, c dbSNP:746346152
347 347 c, t dbSNP:770471626
348 348 a, g dbSNP:372127821
375 375 c, t dbSNP:557582431
378 378 c, g, t dbSNP:768853400
379 379 a, g dbSNP:748221308
384 384 a, g dbSNP:780706590
392 392 c, t dbSNP:749606141
393 393 c, t dbSNP:755318289
405 405 a, g dbSNP:779378073
428 428 c, g dbSNP:147803387
431 431 c, t dbSNP:748299851
442 442 c, t dbSNP:772342484
447 447 c, t dbSNP:11801108
459 459 a, g dbSNP:773276396
462 462 g, t dbSNP:747096972
483 483 c, g dbSNP:770799055
485 485 c, t dbSNP:776457510
497 497 c, t dbSNP:759334187
507 507 c, t dbSNP:764908785
508 508 a, g dbSNP:775404479
525 525 c, t dbSNP:755130943
526 526 a, g dbSNP:202058123
546 546 c, g dbSNP:752651686
551 551 a, c dbSNP:201486613
555 555 c, t dbSNP:777608312
556 556 a, g dbSNP:567745213
557 557 a, g dbSNP:142027137
560 560 c, g dbSNP:780832496
567 567 a, g dbSNP:75971387
576 576 c, t dbSNP:769324715
579 579 c, t dbSNP:779469584
580 580 a, g dbSNP:140993290
581 581 g, t dbSNP:772523751
595 595 c, t dbSNP:367676653
596 596 a, g dbSNP:760962602
598 598 c, t dbSNP:771229796
599 599 a, g dbSNP:777436696
599 599 -, g dbSNP:781447617
608 608 a, t dbSNP:759881879
613 613 c, t dbSNP:200412314
614 614 a, g, t dbSNP:147925927
615 615 -, caagaagccggtagtctacacccg dbSNP:515726210
623 623 c, t dbSNP:142560329
624 624 a, g dbSNP:150078209
632 632 a, t dbSNP:113257816
634 634 a, g dbSNP:757062706
635 635 c, t dbSNP:780783336
637 637 c, t dbSNP:121909293
638 638 a, c, g dbSNP:755811899
639 639 g, t dbSNP:748753747
640 640 a, g dbSNP:111372278
644 644 c, g dbSNP:772573958
645 645 c, t dbSNP:778166573
646 646 a, g dbSNP:200406696
655 655 a, g dbSNP:540753875
657 657 c, g dbSNP:777187660
660 660 g, t dbSNP:759821387
663 663 -, a dbSNP:756384572
665 665 a, c, g dbSNP:769975164
666 666 c, t dbSNP:762952174
668 668 a, g dbSNP:764039167
679 679 c, t dbSNP:778529121
694 694 a, g dbSNP:747499250
695 695 g, t dbSNP:757899636
698 698 a, g dbSNP:781688694
699 699 c, t dbSNP:527638093
700 700 a, g, t dbSNP:769997070
702 702 c, t dbSNP:376292613
703 703 a, g dbSNP:199924612
708 708 c, t dbSNP:368917490
709 709 a, g dbSNP:761724706
711 711 g, t dbSNP:749433613
713 713 c, t dbSNP:372631918
715 715 c, t dbSNP:376394197
717 717 g, t dbSNP:766015324
719 719 a, t dbSNP:753401229
734 734 c, g, t dbSNP:550325827
743 743 c, t dbSNP:752325171
744 744 a, g dbSNP:757768802
757 757 c, g, t dbSNP:781767195
767 767 c, t dbSNP:75456156
770 770 a, c, g dbSNP:760937
780 780 a, g dbSNP:768979718
781 781 c, t dbSNP:774408637
785 785 c, t dbSNP:748242046
796 796 a, g dbSNP:771949826
850 850 -, c dbSNP:561215763
856 856 c, t dbSNP:780122884
919 919 a, g dbSNP:552874988
942 942 c, t dbSNP:566367169
958 958 a, g dbSNP:12730918
966 966 c, t dbSNP:759546641
998 998 a, c, t dbSNP:373476053
999 999 g, t dbSNP:568012522
1001 1001 a, t dbSNP:760430984
1016 1016 c, g dbSNP:536729694
1017 1017 a, g, t dbSNP:763801614
1018 1018 c, t dbSNP:556674214
1036 1036 a, g dbSNP:576596713
1064 1064 c, t dbSNP:761389344
1072 1072 c, t dbSNP:79281668
1098 1098 c, g dbSNP:150631671
1126 1126 g, t dbSNP:573081122
1134 1134 c, t dbSNP:576564960
1155 1155 g, t dbSNP:541803590
1165 1165 c, t dbSNP:561312257
1259 1259 a, g dbSNP:2312545
1262 1262 a, g dbSNP:112254831
1284 1284 c, t dbSNP:185988352
1363 1363 c, g dbSNP:532704922
1379 1379 c, t dbSNP:139166359
1398 1398 a, t dbSNP:566182527
1436 1436 a, g dbSNP:528779329
1453 1453 g, t dbSNP:143142891
1546 1546 g, t dbSNP:568035531
1551 1551 a, t dbSNP:536666832
1598 1598 a, g dbSNP:191098441
1609 1609 a, g dbSNP:570218856
1700 1700 c, g dbSNP:781523242
1713 1713 a, t dbSNP:539185686
1715 1715 a, t dbSNP:553126955
1725 1725 a, c dbSNP:183523082
1728 1728 g, t dbSNP:111839137
1745 1745 a, g dbSNP:768881696
1749 1749 a, g dbSNP:147401392
1793 1793 c, t dbSNP:80250737
1794 1794 a, g dbSNP:555388624
1842 1842 c, t dbSNP:574857050
1850 1850 c, t dbSNP:540987747
1872 1872 a, g dbSNP:563731746
1876 1876 g, t dbSNP:78821994
2027 2027 c, t dbSNP:569997589
2061 2061 c, t dbSNP:375327916
2064 2064 a, g dbSNP:778222772
2085 2085 c, g dbSNP:77527751
2097 2097 a, g dbSNP:559877486
2122 2122 a, g dbSNP:775802621
2148 2148 a, t dbSNP:528714992
2167 2167 c, g dbSNP:548832104
2222 2222 -, ctt dbSNP:200646482
2236 2236 a, g dbSNP:112706659
2238 2238 c, t dbSNP:60051114
2255 2255 a, c dbSNP:762319010
2260 2260 -, tct dbSNP:772534579
2262 2262 c, t dbSNP:55821290
2265 2265 -, t dbSNP:761361280
2266 2266 -, ttttttt dbSNP:59422299
2267 2267 -, c dbSNP:201599742
2268 2268 c, t dbSNP:2982322
2272 2272 -, t, tt dbSNP:539398692
2285 2285 -, ttttttt dbSNP:397783562
2291 2291 a, g dbSNP:549023764
2302 2302 c, t dbSNP:55705727
2374 2374 c, t dbSNP:112660424
2435 2435 -, t dbSNP:746688766
2464 2464 c, t dbSNP:570157218
2468 2468 c, t dbSNP:539122063
2503 2503 a, g dbSNP:187807718
2519 2519 c, t dbSNP:566623860
2534 2534 c, t dbSNP:535311661
2579 2579 a, g dbSNP:555589245
2588 2588 c, t dbSNP:575618647
2600 2600 -, t dbSNP:557622458
2632 2632 a, g dbSNP:191213275
2643 2643 a, g dbSNP:773923294
2649 2649 c, g dbSNP:548019409
2681 2681 c, t dbSNP:557389998
2730 2730 c, t dbSNP:182535764
2737 2737 a, g dbSNP:188296826
2790 2790 a, c, t dbSNP:534480361
2832 2832 c, t dbSNP:573360736
2833 2833 a, g dbSNP:552909289
2882 2882 a, g dbSNP:542063349
2898 2898 a, c dbSNP:561982072
2912 2912 a, g dbSNP:144148411
2929 2929 a, g dbSNP:564579463
2939 2939 c, t dbSNP:61780994
2947 2947 c, t dbSNP:374506432
2995 2995 c, t dbSNP:760520913
3102 3102 a, c dbSNP:368584854
3121 3121 a, t dbSNP:370870154
3158 3158 a, g dbSNP:532803879
3175 3175 a, g dbSNP:768445174
3181 3181 a, g dbSNP:546645454
3219 3219 a, g dbSNP:566447840
3236 3236 c, g dbSNP:192529290
3285 3285 c, t dbSNP:776370669
3309 3309 a, t dbSNP:548896243
3313 3313 a, t dbSNP:371544041
3331 3331 c, t dbSNP:569121044

Target ORF information:

RefSeq Version XM_011540550
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens chymotrypsin C (caldecrin) (CTRC), transcript variant X1, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK
XM_011540550

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
ATGTTGGGCA TCACTGTCCT CGCTGCGCTC TTGGCCTGTG CCTCCAGCTG TGGGGTGCCC 
AGCTTCCCGC CCAACCTATC CGCCCGAGTG GTGGGAGGAG AGGATGCCCG GCCCCACAGC
TGGCCCTGGC AGATCTCCCT CCAGTACCTC AAGAACGACA CGTGGAGGCA TACGTGTGGC
GGGACTTTGA TTGCTAGCAA CTTCGTCCTC ACTGCCGCCC ACTGCATCAG CAACACCCGG
ACCTACCGTG TGGCCGTGGG AAAGAACAAC CTGGAGGTGG AAGACGAAGA AGGATCCCTG
TTTGTGGGTG TGGACACCAT CCACGTCCAC AAGAGATGGA ATGCCCTCCT GTTGCGCAAT
GATATTGCCC TCATCAAGCT TGCAGAGCAT GTGGAGCTGA GTGACACCAT CCAGGTGGCC
TGCCTGCCAG AGAAGGACTC CCTGCTCCCC AAGGACTACC CCTGCTATGT CACCGGCTGG
GGCCGCCTCT GGAGGGGACT CCGGTGGCCC ACTGAACTGC CAGTTGGAGA ACGGTTCCTG
GGAGGTGTTT GGCATCGTCA GCTTTGGCTC CCGGCGGGGC TGCAACACCC GCAAGAAGCC
GGTAGTCTAC ACCCGGGTGT CCGCCTACAT CGACTGGATC AACGAGAAAA TGCAGCTGTG
ATTTGTTGCT GGGAGCGGCG GCAGCGAGTC CCTGCAACAG CAATAAACTT CCTTCTCCTC
GGGCCACCTG GATCCTTGAT TTGTGCAGCT TCTGTTGCTT CCCTCCTCTC TGGTGCTGCC
CCTTTCCACA CTATGGAGCC AAAGAGAGAC CCCACTCAGC CAGTTTCCCC CACCCTGCAT
TAG

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.


CloneID OHu20008D
Sequence Information ORF Nucleotide Sequence (Length: 807bp)
Protein sequence
SNP
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product chymotrypsin-C preproprotein
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC015118.1 and S82198.1. This sequence is a reference standard in the RefSeqGene project. On Apr 12, 2005 this sequence version replaced gi:11321627. Summary: This gene encodes a member of the peptidase S1 family. The encoded protein is a serum calcium-decreasing factor that has chymotrypsin-like protease activity. Alternatively spliced transcript variants have been observed, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: S82198.1, BC015118.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968832, SAMEA2142586 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
ATGTTGGGCA TCACTGTCCT CGCTGCGCTC TTGGCCTGTG CCTCCAGCTG TGGGGTGCCC 
AGCTTCCCGC CCAACCTATC CGCCCGAGTG GTGGGAGGAG AGGATGCCCG GCCCCACAGC
TGGCCCTGGC AGATCTCCCT CCAGTACCTC AAGAACGACA CGTGGAGGCA TACGTGTGGC
GGGACTTTGA TTGCTAGCAA CTTCGTCCTC ACTGCCGCCC ACTGCATCAG CAACACCCGG
ACCTACCGTG TGGCCGTGGG AAAGAACAAC CTGGAGGTGG AAGACGAAGA AGGATCCCTG
TTTGTGGGTG TGGACACCAT CCACGTCCAC AAGAGATGGA ATGCCCTCCT GTTGCGCAAT
GATATTGCCC TCATCAAGCT TGCAGAGCAT GTGGAGCTGA GTGACACCAT CCAGGTGGCC
TGCCTGCCAG AGAAGGACTC CCTGCTCCCC AAGGACTACC CCTGCTATGT CACCGGCTGG
GGCCGCCTCT GGACCAACGG CCCCATTGCT GATAAGCTGC AGCAGGGCCT GCAGCCCGTG
GTGGATCACG CCACGTGCTC CAGGATTGAC TGGTGGGGCT TCAGGGTGAA GAAAACCATG
GTGTGCGCTG GGGGCGATGG CGTCATCTCA GCCTGCAATG GGGACTCCGG TGGCCCACTG
AACTGCCAGT TGGAGAACGG TTCCTGGGAG GTGTTTGGCA TCGTCAGCTT TGGCTCCCGG
CGGGGCTGCA ACACCCGCAA GAAGCCGGTA GTCTACACCC GGGTGTCCGC CTACATCGAC
TGGATCAACG AGAAAATGCA GCTGTGA
The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
RefSeqNP_009203.2
CDS24..830
Misc Feature(1)108..809(+)
Misc Feature(2)111..818(+)
Misc Feature(3)111..113(+)
Misc Feature(4)243..671(+)
Misc Feature(5)651..737(+)
Exon (1)1..63
Gene:CTRC
Gene Synonym:
Exon (2)64..155
Gene:CTRC
Gene Synonym:
Exon (3)156..253
Gene:CTRC
Gene Synonym:
Exon (4)254..379
Gene:CTRC
Gene Synonym:
Exon (5)380..516
Gene:CTRC
Gene Synonym:
Exon (6)517..662
Gene:CTRC
Gene Synonym:
Exon (7)663..815
Gene:CTRC
Gene Synonym:
Exon (8)816..899
Gene:CTRC
Gene Synonym:
Translation
Position Chain Variation Link
14 14 a, g dbSNP:762757220
24 24 a, g dbSNP:544668774
29 29 a, g dbSNP:774324080
34 34 c, t dbSNP:761548318
36 36 a, t dbSNP:933703
45 45 a, g dbSNP:767349844
47 47 -, t dbSNP:774163002
48 48 g, t dbSNP:749888586
49 49 c, t dbSNP:772818172
50 50 a, c, g dbSNP:374821228
52 52 c, t dbSNP:758984378
55 55 a, t dbSNP:778090425
62 62 c, t dbSNP:747431847
65 65 c, t dbSNP:760194187
69 69 a, g dbSNP:765777463
71 71 c, g, t dbSNP:753438186
75 75 a, g dbSNP:200576965
78 78 g, t dbSNP:751854409
79 79 -, g dbSNP:761774161
81 81 c, t dbSNP:757630885
89 89 c, t dbSNP:781341140
91 91 c, t dbSNP:533967597
92 92 a, g dbSNP:756394210
93 93 c, t dbSNP:779971254
104 104 c, t dbSNP:749455108
105 105 a, g dbSNP:768414501
107 107 c, t dbSNP:779009847
108 108 c, t dbSNP:747905422
109 109 a, g dbSNP:772024986
113 113 a, g dbSNP:553816883
126 126 a, g dbSNP:184977421
132 132 c, t dbSNP:770675516
133 133 a, g dbSNP:145868278
157 157 a, t dbSNP:758920912
162 162 c, t dbSNP:769324644
166 166 a, g dbSNP:536812916
168 168 c, t dbSNP:78247007
170 170 c, t dbSNP:576621137
176 176 a, g dbSNP:267598094
179 179 c, t dbSNP:77373944
180 180 a, g dbSNP:761118020
184 184 c, t dbSNP:559326793
185 185 a, c, g dbSNP:756090858
187 187 a, g, t dbSNP:121909294
191 191 a, g dbSNP:758406950
196 196 c, t dbSNP:200910331
197 197 a, g dbSNP:746721892
199 199 a, g dbSNP:757098417
203 203 a, c, t dbSNP:497078
204 204 a, g dbSNP:769482036
208 208 c, g dbSNP:774966069
210 210 -, ttga dbSNP:767242562
220 220 a, g dbSNP:748861167
225 225 a, t dbSNP:772513025
227 227 c, t dbSNP:773793601
228 228 a, g dbSNP:760911831
233 233 a, c dbSNP:766739002
235 235 c, t dbSNP:560916216
239 239 c, t dbSNP:140059353
240 240 a, g dbSNP:515726209
261 261 c, t dbSNP:779643710
262 262 a, g dbSNP:753361075
269 269 a, c, t dbSNP:754640545
270 270 c, g, t dbSNP:747679121
271 271 a, g dbSNP:781768384
274 274 a, c, t dbSNP:200369419
277 277 c, t dbSNP:776037315
278 278 c, t dbSNP:763210990
279 279 a, g dbSNP:367979183
283 283 a, g dbSNP:371766512
287 287 a, g dbSNP:575397166
291 291 a, t dbSNP:767382039
299 299 g, t dbSNP:374645306
300 300 a, g dbSNP:760649717
305 305 a, g dbSNP:766144228
308 308 c, g, t dbSNP:41307798
309 309 a, g dbSNP:144286923
320 320 c, t dbSNP:539554130
324 324 c, t dbSNP:752195533
325 325 c, t dbSNP:148595354
329 329 -, g dbSNP:773119534
340 340 c, t dbSNP:367728085
344 344 a, c dbSNP:746346152
347 347 c, t dbSNP:770471626
348 348 a, g dbSNP:372127821
375 375 c, t dbSNP:557582431
378 378 c, g, t dbSNP:768853400
379 379 a, g dbSNP:748221308
384 384 a, g dbSNP:780706590
392 392 c, t dbSNP:749606141
393 393 c, t dbSNP:755318289
405 405 a, g dbSNP:779378073
428 428 c, g dbSNP:147803387
431 431 c, t dbSNP:748299851
442 442 c, t dbSNP:772342484
447 447 c, t dbSNP:11801108
459 459 a, g dbSNP:773276396
462 462 g, t dbSNP:747096972
483 483 c, g dbSNP:770799055
485 485 c, t dbSNP:776457510
497 497 c, t dbSNP:759334187
507 507 c, t dbSNP:764908785
508 508 a, g dbSNP:775404479
522 522 a, c, g dbSNP:141205711
532 532 c, t dbSNP:753003339
533 533 c, t dbSNP:758785698
536 536 c, t dbSNP:201351990
537 537 a, g dbSNP:34949635
540 540 c, t dbSNP:577782558
554 554 a, c, g dbSNP:751747891
556 556 a, g dbSNP:200678111
560 560 c, g, t dbSNP:746027125
561 561 a, g, t dbSNP:780050276
563 563 c, g, t dbSNP:371479067
572 572 c, t dbSNP:554399153
573 573 a, g dbSNP:761546594
577 577 c, t dbSNP:771828131
578 578 a, g dbSNP:113087202
580 580 c, g dbSNP:760247210
588 588 a, t dbSNP:61780993
592 592 a, g dbSNP:765613993
595 595 g, t dbSNP:753236329
601 601 a, g, t dbSNP:763493344
618 618 a, t dbSNP:751977111
621 621 a, g dbSNP:146235499
629 629 c, t dbSNP:543348635
630 630 a, g dbSNP:750408563
638 638 c, t dbSNP:756236720
639 639 a, g dbSNP:780097120
641 641 a, t dbSNP:749204330
644 644 c, t dbSNP:755026528
648 648 a, g dbSNP:778850385
654 654 a, g dbSNP:747965069
656 656 c, t dbSNP:771566299
671 671 c, t dbSNP:755130943
672 672 a, g dbSNP:202058123
692 692 c, g dbSNP:752651686
697 697 a, c dbSNP:201486613
701 701 c, t dbSNP:777608312
702 702 a, g dbSNP:567745213
703 703 a, g dbSNP:142027137
706 706 c, g dbSNP:780832496
713 713 a, g dbSNP:75971387
722 722 c, t dbSNP:769324715
725 725 c, t dbSNP:779469584
726 726 a, g dbSNP:140993290
727 727 g, t dbSNP:772523751
741 741 c, t dbSNP:367676653
742 742 a, g dbSNP:760962602
744 744 c, t dbSNP:771229796
745 745 a, g dbSNP:777436696
745 745 -, g dbSNP:781447617
754 754 a, t dbSNP:759881879
759 759 c, t dbSNP:200412314
760 760 a, g, t dbSNP:147925927
761 761 -, caagaagccggtagtctacacccg dbSNP:515726210
769 769 c, t dbSNP:142560329
770 770 a, g dbSNP:150078209
778 778 a, t dbSNP:113257816
780 780 a, g dbSNP:757062706
781 781 c, t dbSNP:780783336
783 783 c, t dbSNP:121909293
784 784 a, c, g dbSNP:755811899
785 785 g, t dbSNP:748753747
786 786 a, g dbSNP:111372278
790 790 c, g dbSNP:772573958
791 791 c, t dbSNP:778166573
792 792 a, g dbSNP:200406696
801 801 a, g dbSNP:540753875
803 803 c, g dbSNP:777187660
806 806 g, t dbSNP:759821387
809 809 -, a dbSNP:756384572
811 811 a, c, g dbSNP:769975164
812 812 c, t dbSNP:762952174
814 814 a, g dbSNP:764039167
825 825 c, t dbSNP:778529121
840 840 a, g dbSNP:747499250
841 841 g, t dbSNP:757899636
844 844 a, g dbSNP:781688694
845 845 c, t dbSNP:527638093
846 846 a, g, t dbSNP:769997070
848 848 c, t dbSNP:376292613
849 849 a, g dbSNP:199924612
854 854 c, t dbSNP:368917490
855 855 a, g dbSNP:761724706
857 857 g, t dbSNP:749433613
859 859 c, t dbSNP:372631918
861 861 c, t dbSNP:376394197
863 863 g, t dbSNP:766015324
865 865 a, t dbSNP:753401229
880 880 c, g, t dbSNP:550325827
889 889 c, t dbSNP:752325171
890 890 a, g dbSNP:757768802

Target ORF information:

RefSeq Version NM_007272
Organism Homo sapiens (human)
Definition Homo sapiens chymotrypsin C (caldecrin) (CTRC), mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK
NM_007272

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
ATGTTGGGCA TCACTGTCCT CGCTGCGCTC TTGGCCTGTG CCTCCAGCTG TGGGGTGCCC 
AGCTTCCCGC CCAACCTATC CGCCCGAGTG GTGGGAGGAG AGGATGCCCG GCCCCACAGC
TGGCCCTGGC AGATCTCCCT CCAGTACCTC AAGAACGACA CGTGGAGGCA TACGTGTGGC
GGGACTTTGA TTGCTAGCAA CTTCGTCCTC ACTGCCGCCC ACTGCATCAG CAACACCCGG
ACCTACCGTG TGGCCGTGGG AAAGAACAAC CTGGAGGTGG AAGACGAAGA AGGATCCCTG
TTTGTGGGTG TGGACACCAT CCACGTCCAC AAGAGATGGA ATGCCCTCCT GTTGCGCAAT
GATATTGCCC TCATCAAGCT TGCAGAGCAT GTGGAGCTGA GTGACACCAT CCAGGTGGCC
TGCCTGCCAG AGAAGGACTC CCTGCTCCCC AAGGACTACC CCTGCTATGT CACCGGCTGG
GGCCGCCTCT GGACCAACGG CCCCATTGCT GATAAGCTGC AGCAGGGCCT GCAGCCCGTG
GTGGATCACG CCACGTGCTC CAGGATTGAC TGGTGGGGCT TCAGGGTGAA GAAAACCATG
GTGTGCGCTG GGGGCGATGG CGTCATCTCA GCCTGCAATG GGGACTCCGG TGGCCCACTG
AACTGCCAGT TGGAGAACGG TTCCTGGGAG GTGTTTGGCA TCGTCAGCTT TGGCTCCCGG
CGGGGCTGCA ACACCCGCAA GAAGCCGGTA GTCTACACCC GGGTGTCCGC CTACATCGAC
TGGATCAACG AGAAAATGCA GCTGTGA

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.