Home » Species Summary » Homo sapiens » CHRNB2 cDNA ORF clone
Email to GenScript

CHRNB2 cDNA ORF clone, Homo sapiens (human)

Gene Symbol CHRNB2
Entrez Gene ID 1141
Full Name cholinergic receptor, nicotinic, beta 2 (neuronal)
Synonyms EFNL3, nAChRB2
General protein information
Preferred Names
neuronal acetylcholine receptor subunit beta-2
neuronal acetylcholine receptor subunit beta-2
neuronal nicotinic acetylcholine receptor beta 2
acetylcholine receptor, nicotinic, beta 2 (neuronal)
cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)
Gene Type protein-coding
Organism Homo sapiens (human)



Summary Neuronal acetylcholine receptors are homo- or heteropentameric complexes composed of homologous alpha and beta subunits. They belong to a superfamily of ligand-gated ion channels which allow the flow of sodium and potassium across the plasma membrane in response to ligands such as acetylcholine and nicotine. This gene encodes one of several beta subunits. Mutations in this gene are associated with autosomal dominant nocturnal frontal lobe epilepsy. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Epilepsy, nocturnal frontal lobe, 3, 605375 (3)

mRNA and Protein(s)

mRNA Protein Name
NM_000748 NP_000739 neuronal acetylcholine receptor subunit beta-2 precursor

hsa04080 Neuroactive ligand-receptor interaction
hsa04725 Cholinergic synapse
hsa05033 Nicotine addiction
R-HSA-112316 Neuronal System
R-HSA-181431 Acetylcholine Binding And Downstream Events
R-HSA-112315 Transmission across Chemical Synapses
R-HSA-112314 Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
R-HSA-622323 Presynaptic nicotinic acetylcholine receptors
R-HSA-629597 Highly calcium permeable nicotinic acetylcholine receptors
R-HSA-622327 Postsynaptic nicotinic acetylcholine receptors
R-HSA-629602 Activation of Nicotinic Acetylcholine Receptors
R-HSA-629587 Highly sodium permeable acetylcholine nicotinic receptors
R-HSA-629594 Highly calcium permeable postsynaptic nicotinic acetylcholine receptors
WP1602 Nicotine Activity on Dopaminergic Neurons
WP706 SIDS Susceptibility Pathways

Homo sapiens (human) CHRNB2 NP_000739.1
Pan troglodytes (chimpanzee) CHRNB2 XP_001152392.1
Macaca mulatta (Rhesus monkey) CHRNB2 XP_001114439.1
Canis lupus familiaris (dog) CHRNB2 XP_547565.2
Bos taurus (cattle) CHRNB2 NP_001179403.1
Mus musculus (house mouse) Chrnb2 NP_033732.2
Rattus norvegicus (Norway rat) Chrnb2 NP_062170.1
Gallus gallus (chicken) CHRNB2 NP_990144.1
Danio rerio (zebrafish) chrnb2b XP_005169811.1
Danio rerio (zebrafish) LOC101882975 XP_005174531.1
Drosophila melanogaster (fruit fly) nAcRalpha-96Aa NP_524481.2
Xenopus (Silurana) tropicalis (western clawed frog) chrnb2 NP_001093684.1


ID Name Evidence
GO:0005886 plasma membrane EXP
GO:0005886 plasma membrane TAS
GO:0005892 nicotinic acetylcholine-gated receptor-channel complex IDA
GO:0009897 external side of plasma membrane ISS
GO:0016021 integral to membrane NAS
GO:0030054 cell junction IEA
GO:0045202 synapse IEA
GO:0045211 postsynaptic membrane IEA


ID Name Evidence
GO:0004872 receptor activity IEA
GO:0004889 nicotinic acetylcholine-activated cation-selective channel activity IDA
GO:0004889 nicotinic acetylcholine-activated cation-selective channel activity TAS
GO:0005230 extracellular ligand-gated ion channel activity IEA
GO:0015276 ligand-gated ion channel activity TAS
GO:0015464 acetylcholine receptor activity IDA
GO:0042166 acetylcholine binding IC
GO:0042166 acetylcholine binding IMP


ID Name Evidence
GO:0001661 conditioned taste aversion IEA
GO:0001666 response to hypoxia IDA
GO:0006811 ion transport NAS
GO:0006816 calcium ion transport ISS
GO:0006939 smooth muscle contraction ISS
GO:0007165 signal transduction IDA
GO:0007268 synaptic transmission TAS
GO:0007271 synaptic transmission, cholinergic ISS
GO:0007601 visual perception ISS
GO:0007605 sensory perception of sound ISS
GO:0007612 learning IMP
GO:0007613 memory IMP
GO:0007626 locomotory behavior ISS
GO:0008306 associative learning ISS
GO:0008542 visual learning IMP
GO:0014059 regulation of dopamine secretion ISS
GO:0019233 sensory perception of pain ISS
GO:0021562 vestibulocochlear nerve development ISS
GO:0021631 optic nerve morphogenesis ISS
GO:0021771 lateral geniculate nucleus development ISS
GO:0021952 central nervous system projection neuron axonogenesis ISS
GO:0030890 positive regulation of B cell proliferation ISS
GO:0032225 regulation of synaptic transmission, dopaminergic ISS
GO:0032226 positive regulation of synaptic transmission, dopaminergic IEA
GO:0033603 positive regulation of dopamine secretion ISS
GO:0035094 response to nicotine IDA
GO:0035095 behavioral response to nicotine IMP
GO:0035176 social behavior ISS
GO:0042053 regulation of dopamine metabolic process ISS
GO:0042113 B cell activation ISS
GO:0042220 response to cocaine ISS
GO:0042320 regulation of circadian sleep/wake cycle, REM sleep ISS
GO:0045188 regulation of circadian sleep/wake cycle, non-REM sleep IEA
GO:0045471 response to ethanol ISS
GO:0045759 negative regulation of action potential ISS
GO:0048814 regulation of dendrite morphogenesis ISS
GO:0050877 neurological system process IMP
GO:0050890 cognition IMP
GO:0051899 membrane depolarization ISS
GO:0051963 regulation of synaptogenesis ISS
GO:0060084 synaptic transmission involved in micturition ISS

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following CHRNB2 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the CHRNB2 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
NM_000748 Homo sapiens cholinergic receptor, nicotinic, beta 2 (neuronal) (CHRNB2), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu27237
Accession Version NM_000748.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1509bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product neuronal acetylcholine receptor subunit beta-2 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from U62437.1, AL592078.10 and R40506.1. This sequence is a reference standard in the RefSeqGene project. On Jul 21, 2006 this sequence version replaced gi:4502832. Summary: Neuronal acetylcholine receptors are homo- or heteropentameric complexes composed of homologous alpha and beta subunits. They belong to a superfamily of ligand-gated ion channels which allow the flow of sodium and potassium across the plasma membrane in response to ligands such as acetylcholine and nicotine. This gene encodes one of several beta subunits. Mutations in this gene are associated with autosomal dominant nocturnal frontal lobe epilepsy. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: U62437.1, X53179.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2145743, SAMEA2154665 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)112..114(+)
Misc Feature(2)349..1701(+)
Misc Feature(3)349..966(+)
Misc Feature(4)964..1038(+)
Misc Feature(5)985..1698(+)
Misc Feature(6)1060..1116(+)
Misc Feature(7)1162..1227(+)
Misc Feature(8)1639..1698(+)
Exon (1)1..328
Gene Synonym:
Exon (2)329..474
Gene Synonym:
Exon (3)475..519
Gene Synonym:
Exon (4)520..629
Gene Synonym:
Exon (5)630..1602
Gene Synonym:
Exon (6)1603..5719
Gene Synonym:
Position Chain Variation Link
10 10 a, c dbSNP:555605813
31 31 c, g dbSNP:112480976
38 38 c, g dbSNP:200772055
51 51 a, g dbSNP:12062049
52 52 a, g dbSNP:200136206
58 58 c, g dbSNP:200941077
65 65 c, t dbSNP:201787326
66 66 a, c dbSNP:199925735
80 80 a, g dbSNP:534466849
81 81 a, g dbSNP:552748907
95 95 c, t dbSNP:200933515
105 105 a, g dbSNP:138709951
109 109 c, t dbSNP:200453718
115 115 a, g dbSNP:183393371
130 130 a, g dbSNP:201327396
132 132 a, g dbSNP:111585219
135 135 g, t dbSNP:557061574
138 138 c, t dbSNP:201980297
139 139 g, t dbSNP:200436688
143 143 a, c dbSNP:56205574
146 146 c, t dbSNP:561526031
172 172 a, g dbSNP:199637367
210 210 c, t dbSNP:55799808
212 212 c, t dbSNP:2280781
213 213 a, c dbSNP:565522221
214 214 a, c, g dbSNP:111862660
216 216 c, g dbSNP:551484822
223 223 g, t dbSNP:776350897
225 225 c, t dbSNP:200611616
226 226 c, g dbSNP:761649443
231 231 a, c, g, t dbSNP:764839079
232 232 a, c, g dbSNP:765878419
234 234 g, t dbSNP:760091611
240 240 a, c dbSNP:767987485
247 247 a, g dbSNP:753041078
249 249 g, t dbSNP:756528983
257 257 c, t dbSNP:777947311
258 258 c, t dbSNP:78492812
259 259 c, t dbSNP:754108624
261 261 c, t dbSNP:757491946
262 262 a, g dbSNP:373054422
271 271 c, t dbSNP:745932234
276 276 c, t dbSNP:768764485
279 279 c, t dbSNP:781154968
283 283 c, t dbSNP:747997113
285 285 c, g dbSNP:769654213
286 286 g, t dbSNP:772815972
291 291 c, g dbSNP:762660260
298 298 c, t dbSNP:572421482
306 306 c, t dbSNP:770555906
313 313 c, t dbSNP:773898286
319 319 c, t dbSNP:759012592
329 329 a, g dbSNP:761316238
338 338 c, g dbSNP:76005585
339 339 c, t dbSNP:764498388
341 341 c, t dbSNP:71651692
342 342 a, g dbSNP:143402032
351 351 a, g dbSNP:765659821
352 352 a, g dbSNP:199919525
355 355 c, t dbSNP:145926853
356 356 a, g dbSNP:758492974
362 362 g, t dbSNP:200729328
363 363 a, g dbSNP:376396230
365 365 a, g dbSNP:200223952
367 367 c, g dbSNP:756124158
369 369 a, t dbSNP:141689121
373 373 c, t dbSNP:71651693
386 386 a, g dbSNP:199999862
387 387 a, c dbSNP:201171352
389 389 -, a dbSNP:775016001
393 393 c, g dbSNP:745520139
396 396 a, g dbSNP:771623164
402 402 c, t dbSNP:775128215
403 403 -, taa dbSNP:760313117
403 403 c, t dbSNP:746480833
404 404 a, g dbSNP:769249583
411 411 c, t dbSNP:777310261
413 413 c, t dbSNP:762363770
414 414 c, t dbSNP:149921259
416 416 a, g dbSNP:750797578
417 417 c, t dbSNP:201747045
465 465 c, t dbSNP:773706734
470 470 a, g dbSNP:763293202
477 477 g, t dbSNP:763194096
481 481 c, t dbSNP:771286419
482 482 a, g dbSNP:774455462
484 484 a, g dbSNP:759744433
486 486 c, g dbSNP:368583539
497 497 c, t dbSNP:752766336
500 500 a, c dbSNP:200382306
503 503 a, g dbSNP:201218199
528 528 a, g dbSNP:200792295
531 531 c, t dbSNP:777593694
534 534 c, t dbSNP:751365875
535 535 c, t dbSNP:754725293
536 536 a, g dbSNP:144508607
541 541 a, t dbSNP:752355994
550 550 c, t dbSNP:201948726
558 558 a, g dbSNP:367899705
561 561 c, t dbSNP:777276160
567 567 c, t dbSNP:749760405
580 580 c, t dbSNP:372273025
581 581 a, g dbSNP:779199533
585 585 c, g dbSNP:375527798
593 593 a, c dbSNP:199885651
597 597 c, t dbSNP:775725078
612 612 c, t dbSNP:78921047
623 623 -, aca dbSNP:527778064
626 626 a, g dbSNP:768736427
630 630 c, t dbSNP:748227150
636 636 c, t dbSNP:151054217
640 640 a, g dbSNP:774452558
645 645 c, t dbSNP:201024705
657 657 c, t dbSNP:759487292
659 659 a, g dbSNP:141056449
661 661 c, t dbSNP:199838048
662 662 c, g dbSNP:775416120
666 666 c, t dbSNP:760458701
669 669 c, t dbSNP:777250519
670 670 a, g dbSNP:763776515
674 674 c, t dbSNP:753331644
675 675 c, t dbSNP:376567330
679 679 c, t dbSNP:200290014
686 686 a, g dbSNP:201542724
693 693 c, t dbSNP:369264665
696 696 c, t dbSNP:199536721
702 702 a, g dbSNP:758836646
704 704 c, t dbSNP:565312414
705 705 g, t dbSNP:780464481
707 707 c, g dbSNP:747362652
711 711 c, t dbSNP:755205867
717 717 c, t dbSNP:781506269
723 723 c, g, t dbSNP:538508561
724 724 a, g dbSNP:769929506
734 734 c, t dbSNP:777929650
747 747 c, t dbSNP:190967991
772 772 a, g dbSNP:201000891
788 788 c, g, t dbSNP:75760566
789 789 a, g dbSNP:775471305
799 799 a, g dbSNP:760490640
803 803 a, g dbSNP:768297928
804 804 -, ca dbSNP:758594215
810 810 g, t dbSNP:199696100
811 811 a, t dbSNP:794727707
813 813 c, g, t dbSNP:776372933
849 849 c, t dbSNP:764809084
857 857 c, t dbSNP:200583300
858 858 a, g dbSNP:749930516
863 863 c, g dbSNP:763511654
866 866 a, g dbSNP:766850552
877 877 a, g dbSNP:568750665
879 879 c, t dbSNP:202243284
884 884 c, g, t dbSNP:201622476
890 890 c, t dbSNP:766963094
891 891 a, g dbSNP:752968150
895 895 c, t dbSNP:200108220
898 898 c, t dbSNP:572595325
899 899 a, g dbSNP:749354110
903 903 c, t dbSNP:772174020
904 904 a, g dbSNP:780175030
910 910 a, c, t dbSNP:200796605
912 912 c, t dbSNP:370886747
913 913 a, g dbSNP:776225559
918 918 c, t dbSNP:761594416
922 922 a, c dbSNP:374183227
924 924 a, c, g dbSNP:539974140
927 927 c, t dbSNP:765825095
929 929 a, t dbSNP:757059194
932 932 a, g dbSNP:752118167
937 937 a, c dbSNP:759893037
938 938 a, c, t dbSNP:201952018
943 943 a, g dbSNP:199891624
955 955 c, t dbSNP:752986234
956 956 a, g dbSNP:201373530
958 958 c, t dbSNP:756406057
959 959 a, g dbSNP:79646221
966 966 a, g dbSNP:200050755
969 969 c, t dbSNP:754076877
972 972 c, t dbSNP:71628622
977 977 c, t dbSNP:757437089
983 983 a, c dbSNP:200845052
984 984 a, c dbSNP:779081556
985 985 a, c dbSNP:746974615
998 998 -, g dbSNP:780184576
998 998 g, t dbSNP:201130412
999 999 c, t dbSNP:201691696
1000 1000 a, g dbSNP:781099696
1014 1014 a, g dbSNP:200380724
1015 1015 c, g dbSNP:769478055
1023 1023 c, t dbSNP:772872592
1036 1036 c, t dbSNP:201514209
1041 1041 a, g dbSNP:770431355
1044 1044 c, t dbSNP:369234693
1052 1052 a, g dbSNP:373676452
1053 1053 c, t dbSNP:202199860
1061 1061 a, t dbSNP:113672425
1065 1065 a, g dbSNP:200331379
1081 1081 c, t dbSNP:767884809
1083 1083 c, g dbSNP:745793301
1087 1087 a, g dbSNP:775960753
1088 1088 a, c, t dbSNP:201393088
1089 1089 a, g dbSNP:140739605
1092 1092 c, t dbSNP:757491915
1107 1107 g, t dbSNP:765428561
1123 1123 a, c, g, t dbSNP:74315291
1155 1155 c, t dbSNP:750455908
1156 1156 a, g dbSNP:754992449
1165 1165 c, g dbSNP:281865069
1174 1174 a, g dbSNP:780962241
1176 1176 a, c dbSNP:748080172
1183 1183 a, c dbSNP:200720061
1186 1186 a, g dbSNP:755914666
1187 1187 c, t dbSNP:281865070
1189 1189 a, g dbSNP:777476359
1192 1192 c, t dbSNP:201366539
1197 1197 c, t dbSNP:749006431
1200 1200 c, g dbSNP:281865071
1201 1201 a, g dbSNP:770557644
1202 1202 c, t dbSNP:367833033
1209 1209 c, t dbSNP:199549612
1210 1210 a, g dbSNP:773957177
1215 1215 c, t dbSNP:374883763
1225 1225 a, g dbSNP:771568668
1227 1227 -, caccaccgctcgcccaccacgca dbSNP:751604964
1231 1231 c, g dbSNP:775885826
1232 1232 a, g dbSNP:201004255
1239 1239 a, g dbSNP:764562633
1247 1247 c, t dbSNP:145893879
1254 1254 c, t dbSNP:201825924
1260 1260 a, g dbSNP:762184252
1266 1266 c, g dbSNP:200048991
1267 1267 a, g dbSNP:200666765
1270 1270 a, g dbSNP:750558266
1272 1272 a, g dbSNP:779023843
1274 1274 a, g, t dbSNP:281865072
1275 1275 c, t dbSNP:766422414
1276 1276 g, t dbSNP:752635342
1281 1281 c, t dbSNP:756041212
1291 1291 c, t dbSNP:201328638
1293 1293 g, t dbSNP:777602905
1296 1296 c, t dbSNP:374720331
1298 1298 c, t dbSNP:141511378
1299 1299 g, t dbSNP:778458803
1301 1301 -, t dbSNP:755113686
1304 1304 c, t dbSNP:368787419
1305 1305 c, t dbSNP:372224633
1309 1309 a, g dbSNP:771498613
1310 1310 c, t dbSNP:141735618
1314 1314 a, g dbSNP:747589095
1322 1322 a, g dbSNP:200924076
1325 1325 a, c dbSNP:201793956
1326 1326 c, t dbSNP:777185375
1332 1332 c, t dbSNP:762237464
1337 1337 a, g dbSNP:770156397
1338 1338 g, t dbSNP:773331007
1340 1340 -, gcgcct dbSNP:781654245
1348 1348 c, t dbSNP:199928622
1351 1351 c, t dbSNP:201040879
1355 1355 a, g dbSNP:751625142
1358 1358 a, g dbSNP:760653937
1367 1367 g, t dbSNP:202114705
1373 1373 c, g dbSNP:200483865
1374 1374 c, g dbSNP:763983504
1378 1378 a, g dbSNP:753731408
1379 1379 a, g dbSNP:757023317
1381 1381 a, g dbSNP:778714852
1392 1392 c, t dbSNP:113116986
1397 1397 a, t dbSNP:113488072
1398 1398 c, t dbSNP:112744508
1406 1406 a, c dbSNP:758068217
1410 1410 a, c, g dbSNP:201986342
1413 1413 g, t dbSNP:779771980
1416 1416 a, c, t dbSNP:746495548
1421 1421 c, g dbSNP:542041934
1424 1424 c, g dbSNP:748619028
1435 1435 c, g dbSNP:770055798
1440 1440 c, t dbSNP:560427247
1442 1442 c, g dbSNP:527768017
1454 1454 -, a dbSNP:35834206
1454 1454 a, c dbSNP:200441832
1455 1455 c, g dbSNP:55685423
1468 1468 a, g dbSNP:199658508
1496 1496 c, t dbSNP:763142542
1497 1497 a, g dbSNP:55857552
1498 1498 a, g dbSNP:774449832
1499 1499 a, g dbSNP:112585933
1500 1500 c, t dbSNP:767533378
1503 1503 c, t dbSNP:372757638
1521 1521 a, g dbSNP:199743038
1530 1530 g, t dbSNP:76126473
1537 1537 c, t dbSNP:77710036
1559 1559 g, t dbSNP:747248135
1563 1563 c, t dbSNP:753784853
1578 1578 a, g dbSNP:200910048
1580 1580 a, g dbSNP:771273497
1591 1591 a, g dbSNP:777049407
1602 1602 c, t dbSNP:201462348
1603 1603 a, g dbSNP:749633440
1605 1605 g, t dbSNP:771240779
1607 1607 g, t dbSNP:774575734
1609 1609 a, g dbSNP:746029810
1616 1616 a, g dbSNP:772146115
1617 1617 c, g dbSNP:201110967
1623 1623 c, t dbSNP:761717685
1624 1624 a, g dbSNP:765202298
1626 1626 c, t dbSNP:772921552
1628 1628 c, t dbSNP:762839062
1632 1632 a, g dbSNP:766229553
1636 1636 a, g dbSNP:751272610
1639 1639 a, g dbSNP:140505576
1642 1642 c, g, t dbSNP:202079239
1644 1644 c, t dbSNP:373985042
1650 1650 c, t dbSNP:756619313
1651 1651 c, t dbSNP:551094274
1656 1656 a, g dbSNP:778537596
1659 1659 c, g dbSNP:778371515
1665 1665 c, g dbSNP:749708943
1668 1668 -, tgtctg dbSNP:749637891
1668 1668 -, tgtc dbSNP:778160922
1671 1671 c, g, t dbSNP:138886952
1675 1675 c, g dbSNP:746157258
1677 1677 c, t dbSNP:772270570
1679 1679 c, t dbSNP:200855905
1686 1686 c, g dbSNP:747080974
1687 1687 a, c, g dbSNP:202135710
1689 1689 c, t dbSNP:773226966
1690 1690 a, g dbSNP:200467784
1691 1691 a, g dbSNP:766283123
1694 1694 c, t dbSNP:774272679
1696 1696 c, t dbSNP:79137415
1698 1698 a, c dbSNP:767243629
1702 1702 c, t dbSNP:752248053
1716 1716 c, g dbSNP:760253805
1720 1720 c, t dbSNP:763453906
1730 1730 c, t dbSNP:754372558
1731 1731 c, t dbSNP:757759724
1733 1733 c, t dbSNP:779309344
1746 1746 a, g dbSNP:8192486
1749 1749 c, t dbSNP:144813907
1752 1752 c, t dbSNP:200582284
1760 1760 c, t dbSNP:747154910
1761 1761 c, t dbSNP:768798015
1772 1772 a, g dbSNP:781068734
1786 1786 a, t dbSNP:749294108
1791 1791 a, g dbSNP:199567352
1792 1792 c, t dbSNP:774324111
1793 1793 c, g dbSNP:759431860
1798 1798 c, t dbSNP:374036765
1805 1805 a, t dbSNP:1126885
1814 1814 c, g dbSNP:201199916
1817 1817 c, t dbSNP:376103879
1829 1829 a, g dbSNP:199714428
1834 1834 a, g dbSNP:200519583
1842 1842 c, t dbSNP:534528174
1846 1846 c, t dbSNP:201340494
1847 1847 a, g dbSNP:199747394
1856 1856 a, g dbSNP:200913790
1867 1867 a, g dbSNP:201699993
1868 1868 a, g dbSNP:71651697
1869 1869 a, g dbSNP:201216419
1870 1870 c, t dbSNP:201869390
1873 1873 c, t dbSNP:781306131
1875 1875 c, t dbSNP:199967217
1877 1877 c, t dbSNP:200963221
1886 1886 c, g dbSNP:2072659
1898 1898 g, t dbSNP:575999490
1917 1917 c, t dbSNP:200543651
1923 1923 a, c, t dbSNP:201303449
1925 1925 c, t dbSNP:202031218
1945 1945 c, g dbSNP:573442081
1972 1972 g, t dbSNP:200252337
1983 1983 c, t dbSNP:201024155
1984 1984 c, g dbSNP:199833512
1988 1988 c, t dbSNP:200295099
1991 1991 a, g dbSNP:201141086
1992 1992 c, t dbSNP:199545188
1993 1993 a, c, t dbSNP:200917319
1997 1997 g, t dbSNP:201694281
2004 2004 a, g dbSNP:115971480
2016 2016 c, g dbSNP:200573025
2021 2021 g, t dbSNP:532932637
2040 2040 c, t dbSNP:34019399
2041 2041 c, t dbSNP:201622270
2045 2045 c, t dbSNP:111787379
2053 2053 a, c dbSNP:570036243
2063 2063 a, g dbSNP:200726730
2074 2074 c, t dbSNP:201735146
2086 2086 c, t dbSNP:2072660
2087 2087 a, g dbSNP:530692157
2105 2105 c, g dbSNP:749613312
2106 2106 g, t dbSNP:548833594
2109 2109 a, c, t dbSNP:200930444
2110 2110 a, g dbSNP:202226324
2111 2111 c, g dbSNP:185796768
2143 2143 g, t dbSNP:549167761
2145 2145 c, g dbSNP:200050649
2184 2184 c, t dbSNP:188760947
2185 2185 a, g dbSNP:78691486
2189 2189 c, t dbSNP:193194163
2190 2190 a, g dbSNP:201710469
2192 2192 a, g dbSNP:202034594
2206 2206 a, g dbSNP:185006462
2218 2218 a, t dbSNP:201303081
2232 2232 a, g dbSNP:199797230
2245 2245 a, g dbSNP:2072661
2255 2255 a, c dbSNP:201351693
2258 2258 c, t dbSNP:199579680
2261 2261 c, t dbSNP:116171514
2263 2263 c, t dbSNP:202044279
2299 2299 c, t dbSNP:199996766
2311 2311 c, t dbSNP:4292956
2312 2312 a, g dbSNP:201632996
2323 2323 a, c dbSNP:200156184
2328 2328 a, g dbSNP:200934493
2336 2336 c, t dbSNP:201796200
2337 2337 a, g, t dbSNP:199934611
2342 2342 c, t dbSNP:200933616
2353 2353 c, g dbSNP:772927236
2357 2357 c, t dbSNP:45490696
2358 2358 -, c dbSNP:35522129
2360 2360 a, g dbSNP:188551694
2368 2368 -, c dbSNP:773621716
2374 2374 a, g dbSNP:200457733
2379 2379 c, g dbSNP:201515151
2391 2391 c, t dbSNP:201972090
2423 2423 c, g dbSNP:540820659
2430 2430 c, t dbSNP:200468520
2443 2443 a, g dbSNP:201449153
2463 2463 c, t dbSNP:199691850
2476 2476 c, g dbSNP:200357779
2500 2500 g, t dbSNP:201326506
2505 2505 a, g dbSNP:199780070
2538 2538 c, t dbSNP:558929179
2542 2542 a, t dbSNP:200792380
2561 2561 c, g dbSNP:201953457
2569 2569 a, g dbSNP:199604654
2575 2575 a, g dbSNP:200718903
2577 2577 c, t dbSNP:544801588
2578 2578 a, g dbSNP:201580225
2584 2584 a, g dbSNP:759336211
2610 2610 a, g dbSNP:200038311
2614 2614 c, t dbSNP:573664967
2623 2623 a, g dbSNP:201174358
2646 2646 c, t dbSNP:145945679
2657 2657 a, g dbSNP:111608501
2667 2667 a, t dbSNP:201634297
2684 2684 c, g dbSNP:200184943
2688 2688 c, t dbSNP:201180392
2737 2737 c, t dbSNP:202070050
2745 2745 c, t dbSNP:200263890
2746 2746 a, c, g dbSNP:200839600
2751 2751 c, g dbSNP:202149047
2760 2760 c, t dbSNP:200444544
2761 2761 c, t dbSNP:201539843
2781 2781 c, g dbSNP:78080997
2787 2787 c, t dbSNP:199542459
2790 2790 a, t dbSNP:200636354
2791 2791 c, g dbSNP:201206167
2808 2808 a, g dbSNP:199725692
2823 2823 a, c dbSNP:200523765
2830 2830 -, ct dbSNP:759646361
2835 2835 c, t dbSNP:12130403
2836 2836 a, g dbSNP:139826441
2856 2856 c, g dbSNP:12125018
2859 2859 c, t dbSNP:200796860
2864 2864 a, g dbSNP:750562580
2880 2880 c, t dbSNP:181089470
2881 2881 a, g dbSNP:550762987
2886 2886 g, t dbSNP:199869460
2896 2896 a, g dbSNP:201043062
2904 2904 c, t dbSNP:201858389
2905 2905 a, g dbSNP:199997326
2923 2923 c, t dbSNP:200960069
2944 2944 c, t dbSNP:201980216
2948 2948 c, g dbSNP:200595931
2949 2949 a, g dbSNP:201184597
2950 2950 a, g dbSNP:373484084
2958 2958 c, t dbSNP:202201712
2967 2967 c, t dbSNP:200338192
2990 2990 a, g dbSNP:555050465
3007 3007 c, t dbSNP:201024958
3008 3008 a, g dbSNP:201880613
3029 3029 c, t dbSNP:200292500
3030 3030 c, t dbSNP:201140877
3031 3031 a, g dbSNP:199566035
3043 3043 a, c dbSNP:200994061
3093 3093 c, t dbSNP:201542024
3102 3102 a, g dbSNP:199666962
3107 3107 c, t dbSNP:183661862
3137 3137 c, g dbSNP:201608223
3149 3149 c, g dbSNP:200114425
3184 3184 c, t dbSNP:116773421
3186 3186 c, g dbSNP:201756422
3188 3188 g, t dbSNP:199883511
3199 3199 a, g dbSNP:201074604
3203 3203 a, g dbSNP:202116035
3208 3208 a, g dbSNP:200070990
3215 3215 c, g dbSNP:200845417
3216 3216 a, c dbSNP:71628623
3231 3231 a, g dbSNP:201693370
3244 3244 a, g dbSNP:200382952
3250 3250 c, t dbSNP:201201536
3268 3268 c, t dbSNP:202208278
3323 3323 a, t dbSNP:200322298
3338 3338 c, t dbSNP:201424151
3354 3354 a, g dbSNP:199740852
3416 3416 c, t dbSNP:200732572
3428 3428 -, ca dbSNP:75857876
3429 3429 a, g dbSNP:201350223
3430 3430 c, g dbSNP:199579240
3446 3446 c, t dbSNP:200828030
3452 3452 c, t dbSNP:188276626
3459 3459 a, t dbSNP:200046151
3481 3481 a, g dbSNP:769571155
3491 3491 c, t dbSNP:200668619
3494 3494 -, ctga dbSNP:558257328
3500 3500 a, g dbSNP:544803150
3502 3502 c, t dbSNP:201826743
3508 3508 a, t dbSNP:200156449
3511 3511 c, t dbSNP:200934414
3522 3522 a, g dbSNP:369265710
3527 3527 c, t dbSNP:545656402
3535 3535 c, g dbSNP:78614862
3536 3536 a, c, g dbSNP:199960573
3538 3538 c, t dbSNP:200738385
3549 3549 a, g dbSNP:76242649
3579 3579 a, g dbSNP:202143953
3589 3589 c, g dbSNP:200469143
3615 3615 a, g dbSNP:560589414
3625 3625 a, g dbSNP:201069070
3633 3633 a, t dbSNP:202148264
3670 3670 a, c dbSNP:200468468
3681 3681 a, g dbSNP:201452114
3707 3707 c, t dbSNP:199694457
3712 3712 c, g dbSNP:142105069
3717 3717 a, g dbSNP:201424237
3726 3726 g, t dbSNP:199748893
3738 3738 c, t dbSNP:151180783
3754 3754 g, t dbSNP:201698776
3770 3770 a, g dbSNP:199604285
3775 3775 g, t dbSNP:200757123
3778 3778 a, g dbSNP:200037268
3782 3782 c, t dbSNP:565202069
3794 3794 c, t dbSNP:201569830
3812 3812 a, g dbSNP:200050160
3828 3828 c, t dbSNP:201040578
3829 3829 a, g dbSNP:201862599
3835 3835 c, t dbSNP:200152526
3836 3836 a, g dbSNP:760738801
3849 3849 c, g dbSNP:201303323
3855 3855 c, t dbSNP:202032765
3856 3856 a, g dbSNP:200264450
3870 3870 c, g dbSNP:200846386
3877 3877 c, g dbSNP:532168074
3882 3882 a, t dbSNP:550799390
3884 3884 -, tc dbSNP:146345695
3885 3885 c, g dbSNP:569372918
3894 3894 a, g dbSNP:202151842
3904 3904 g, t dbSNP:200351372
3918 3918 c, t dbSNP:530260006
3919 3919 a, g dbSNP:548589333
3920 3920 c, g dbSNP:201431543
3968 3968 a, c, t dbSNP:199543295
3980 3980 a, g dbSNP:200585814
3983 3983 c, t dbSNP:201721712
3988 3988 a, g dbSNP:199706962
4005 4005 c, g dbSNP:755320916
4010 4010 c, g dbSNP:200552524
4028 4028 c, t dbSNP:552557905
4037 4037 a, g dbSNP:201326987
4040 4040 a, c dbSNP:199858284
4069 4069 c, g dbSNP:765668366
4082 4082 c, t dbSNP:200897511
4083 4083 a, g dbSNP:79916715
4089 4089 c, t dbSNP:6680410
4103 4103 -, tgt dbSNP:749967404
4110 4110 c, g dbSNP:200935724
4123 4123 a, g dbSNP:201859923
4124 4124 c, t dbSNP:565472158
4135 4135 c, t dbSNP:200000696
4140 4140 c, t dbSNP:200965246
4143 4143 c, t dbSNP:201988115
4146 4146 c, t dbSNP:200156045
4148 4148 -, a dbSNP:372094182
4153 4153 c, t dbSNP:201305703
4158 4158 c, t dbSNP:756777391
4199 4199 c, g dbSNP:202036250
4212 4212 a, t dbSNP:200359874
4217 4217 c, t dbSNP:201326726
4218 4218 a, g dbSNP:201875171
4236 4236 c, g dbSNP:200314406
4238 4238 c, g dbSNP:74836199
4239 4239 a, g dbSNP:201128885
4244 4244 c, g dbSNP:199601248
4267 4267 -, tt dbSNP:778046307
4277 4277 c, t dbSNP:200901346
4278 4278 a, g dbSNP:745487628
4291 4291 c, g dbSNP:368667702
4293 4293 a, c dbSNP:201722872
4300 4300 a, g dbSNP:764415902
4306 4306 g, t dbSNP:199650981
4309 4309 -, ag dbSNP:3841062
4310 4310 c, g dbSNP:200801083
4311 4311 -, ag dbSNP:397726663
4311 4311 a, c dbSNP:201609634
4313 4313 c, g dbSNP:200115533
4317 4317 c, t dbSNP:200730407
4332 4332 a, g dbSNP:535975292
4352 4352 a, g dbSNP:180857424
4369 4369 a, g dbSNP:201757620
4375 4375 c, t dbSNP:199931787
4397 4397 c, g, t dbSNP:3811450
4399 4399 c, g dbSNP:540234081
4402 4402 a, c dbSNP:202234764
4438 4438 a, g dbSNP:564986741
4458 4458 a, g dbSNP:200013447
4460 4460 a, c dbSNP:187654016
4464 4464 g, t dbSNP:749039328
4465 4465 a, c dbSNP:200866106
4489 4489 a, t dbSNP:201681907
4496 4496 a, g dbSNP:200399366
4509 4509 c, t dbSNP:201202710
4524 4524 a, g dbSNP:544412686
4530 4530 c, g dbSNP:202064422
4534 4534 c, t dbSNP:200371411
4539 4539 a, c dbSNP:201331027
4547 4547 a, g dbSNP:199783292
4551 4551 c, t dbSNP:200794243
4552 4552 a, g dbSNP:201357879
4556 4556 c, g dbSNP:199585594
4558 4558 c, t dbSNP:531060141
4565 4565 c, t dbSNP:200829166
4582 4582 a, c dbSNP:201869574
4590 4590 a, c, g dbSNP:200023197
4606 4606 g, t dbSNP:761717697
4608 4608 a, g dbSNP:562709884
4612 4612 a, c dbSNP:200787773
4613 4613 c, t dbSNP:201640720
4618 4618 a, c dbSNP:200183281
4629 4629 c, t dbSNP:191830859
4630 4630 c, g dbSNP:548676903
4633 4633 g, t dbSNP:201482447
4635 4635 c, t dbSNP:199962088
4636 4636 a, c dbSNP:200739937
4662 4662 a, g, t dbSNP:202236367
4663 4663 a, g dbSNP:200448469
4684 4684 a, g dbSNP:527643736
4687 4687 a, g dbSNP:552543140
4691 4691 a, g dbSNP:181938695
4697 4697 a, g dbSNP:201963457
4705 4705 c, g dbSNP:200474662
4714 4714 a, g dbSNP:566026393
4720 4720 c, t dbSNP:185988524
4723 4723 c, g dbSNP:201452330
4726 4726 c, g dbSNP:199696071
4733 4733 a, g dbSNP:4845653
4764 4764 c, g dbSNP:201252126
4771 4771 a, c dbSNP:199813635
4799 4799 a, t dbSNP:200780833
4803 4803 g, t dbSNP:754972574
4835 4835 g, t dbSNP:201972583
4844 4844 a, g dbSNP:753001771
4845 4845 c, t dbSNP:527533331
4847 4847 c, t dbSNP:199557213
4863 4863 g, t dbSNP:200450476
4875 4875 c, t dbSNP:201571371
4876 4876 a, g dbSNP:200051795
4883 4883 c, t dbSNP:200848264
4885 4885 g, t dbSNP:778805995
4892 4892 c, t dbSNP:554202704
4904 4904 c, t dbSNP:201641917
4915 4915 g, t dbSNP:1139339
4929 4929 c, t dbSNP:190311254
4946 4946 c, t dbSNP:201186494
4952 4952 a, g dbSNP:202201948
4969 4969 a, g dbSNP:533551442
4974 4974 a, g dbSNP:200264628
4976 4976 -, ctacggcagaggaagg dbSNP:371304360
4979 4979 c, t dbSNP:558565326
4980 4980 a, g dbSNP:200847877
4982 4982 c, g dbSNP:112028541
4984 4984 c, g dbSNP:202139749
4999 4999 c, t dbSNP:200372350
5000 5000 a, g dbSNP:201525800
5006 5006 c, t dbSNP:199564931
5010 5010 a, g dbSNP:200627830
5011 5011 c, t dbSNP:201542202
5021 5021 a, g dbSNP:780729841
5022 5022 c, g, t dbSNP:199707249
5023 5023 a, g dbSNP:200554162
5049 5049 a, g dbSNP:149932359
5053 5053 a, g dbSNP:562795161
5065 5065 a, t dbSNP:199860941
5082 5082 c, t dbSNP:11264221
5084 5084 c, g dbSNP:550783477
5091 5091 c, t dbSNP:747947490
5093 5093 a, c dbSNP:201973469
5114 5114 c, t dbSNP:199883720
5116 5116 c, t dbSNP:147631259
5138 5138 c, g dbSNP:201847586
5149 5149 a, g dbSNP:199981580
5150 5150 c, t dbSNP:779611230
5151 5151 c, g dbSNP:200991937
5157 5157 a, t dbSNP:201969447
5161 5161 c, t dbSNP:200133979
5179 5179 c, t dbSNP:201171705
5183 5183 c, t dbSNP:202208652
5184 5184 a, c, g dbSNP:142290757
5194 5194 c, t dbSNP:201422275
5197 5197 a, g dbSNP:201876654
5207 5207 c, g dbSNP:200320776
5210 5210 c, g dbSNP:182800795
5223 5223 a, g dbSNP:564537995
5230 5230 a, g dbSNP:201128959
5236 5236 a, c, g dbSNP:187084916
5248 5248 a, g dbSNP:190033368
5257 5257 a, t dbSNP:201548688
5259 5259 a, t dbSNP:746693135
5264 5264 c, g dbSNP:199670291
5272 5272 a, g dbSNP:200668286
5273 5273 c, t dbSNP:201858235
5282 5282 a, g dbSNP:529400654
5291 5291 c, t dbSNP:182534342
5324 5324 c, t dbSNP:200747099
5325 5325 g, t dbSNP:533923590
5326 5326 c, t dbSNP:558247263
5336 5336 a, g dbSNP:201736536
5343 5343 a, c dbSNP:773224841
5351 5351 a, g dbSNP:189086635
5352 5352 c, t dbSNP:201032420
5357 5357 c, t dbSNP:202145709
5369 5369 a, g dbSNP:200059610
5370 5370 -, c dbSNP:554349764
5373 5373 c, t dbSNP:201069736
5374 5374 c, g dbSNP:201685713
5376 5376 c, g dbSNP:200399705
5380 5380 a, g dbSNP:201204412
5385 5385 c, t dbSNP:201802600
5390 5390 a, g dbSNP:200328376
5408 5408 c, t dbSNP:201428541
5410 5410 c, t dbSNP:199772208
5413 5413 c, t dbSNP:200895915
5421 5421 c, t dbSNP:201380244
5423 5423 c, t dbSNP:199562773
5430 5430 a, g dbSNP:775798087
5448 5448 a, g dbSNP:763332100
5454 5454 c, t dbSNP:200501202
5458 5458 c, g dbSNP:147029267
5466 5466 a, g dbSNP:199697602
5468 5468 c, t dbSNP:572431019
5472 5472 a, g dbSNP:200664085
5482 5482 c, t dbSNP:147661842
5502 5502 a, g dbSNP:200154428
5506 5506 c, t dbSNP:201303793
5509 5509 a, g dbSNP:201483896
5512 5512 a, g dbSNP:199972741
5518 5518 c, t dbSNP:200745309
5521 5521 c, g dbSNP:531564115
5523 5523 c, t dbSNP:201882150
5526 5526 a, c dbSNP:61682683
5530 5530 a, g dbSNP:200473686
5567 5567 a, g dbSNP:767868570
5573 5573 c, g dbSNP:529585354
5582 5582 a, g dbSNP:185362017
5591 5591 a, g dbSNP:201065728
5592 5592 a, c dbSNP:202176027
5597 5597 a, g dbSNP:200559692
5613 5613 a, c dbSNP:201474856
5627 5627 a, c dbSNP:199675244
5662 5662 c, t dbSNP:770438748
5666 5666 c, g dbSNP:750931596
5669 5669 c, g dbSNP:200269196
5681 5681 g, t dbSNP:201253265
5710 5710 -, tg dbSNP:764358785
5717 5717 a, g dbSNP:199775959

Target ORF information:

RefSeq Version NM_000748
Organism Homo sapiens (human)
Definition Homo sapiens cholinergic receptor, nicotinic, beta 2 (neuronal) (CHRNB2), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


Chemistry, pharmacology, and behavioral studies identify chiral cyclopropanes as selective alpha4beta2-nicotinic acetylcholine receptor partial agonists exhibiting an antidepressant profile. Part II
J. Med. Chem. 56 (13), 5495-5504 (2013)
Zhang HK, Yu LF, Eaton JB, Whiteaker P, Onajole OK, Hanania T, Brunner D, Lukas RJ and Kozikowski AP.


Treatment for tobacco dependence: effect on brain nicotinic acetylcholine receptor density
Neuropsychopharmacology 38 (8), 1548-1556 (2013)
Brody AL, Mukhin AG, Stephanie Shulenberger, Mamoun MS, Kozman M, Phuong J, Neary M, Luu T and Mandelkern MA.


Possible association of nicotinic acetylcholine receptor gene (CHRNA4 and CHRNB2) polymorphisms with nicotine dependence in Japanese males: an exploratory study
Pharmacopsychiatry 46 (2), 77-82 (2013)
Chen HI, Shinkai T, Utsunomiya K, Yamada K, Sakata S, Fukunaka Y, Hwang R, De Luca V, Ohmori O, Kennedy JL, Chuang HY and Nakamura J.


NMR resolved multiple anesthetic binding sites in the TM domains of the alpha4beta2 nAChR
Biochim. Biophys. Acta 1828 (2), 398-404 (2013)
Bondarenko V, Mowrey D, Liu LT, Xu Y and Tang P.


Human alpha4beta2 nicotinic acetylcholine receptor as a novel target of oligomeric alpha-synuclein
PLoS ONE 8 (2), E55886 (2013)
Liu Q, Emadi S, Shen JX, Sierks MR and Wu J.


Human alpha4beta2 neuronal nicotinic acetylcholine receptor in HEK 293 cells: A patch-clamp study
J. Neurosci. 16 (24), 7880-7891 (1996)
Buisson B, Gopalakrishnan M, Arneric SP, Sullivan JP and Bertrand D.


Comparative structure of human neuronal alpha 2-alpha 7 and beta 2-beta 4 nicotinic acetylcholine receptor subunits and functional expression of the alpha 2, alpha 3, alpha 4, alpha 7, beta 2, and beta 4 subunits
J. Mol. Neurosci. 7 (3), 217-228 (1996)
Elliott KJ, Ellis SB, Berckhan KJ, Urrutia A, Chavez-Noriega LE, Johnson EC, Velicelebi G and Harpold MM.


Autosomal Dominant Nocturnal Frontal Lobe Epilepsy
(in) Pagon RA, Adam MP, Ardinger HH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K (Eds.); GENEREVIEWS(R); (1993)
Kurahashi,H. and Hirose,S.


Chromosomal localization of seven neuronal nicotinic acetylcholine receptor subunit genes in humans
Genomics 13 (4), 962-967 (1992)
Anand R and Lindstrom J.


Nucleotide sequence of the human nicotinic acetylcholine receptor beta 2 subunit gene
Nucleic Acids Res. 18 (14), 4272 (1990)
Anand R and Lindstrom J.
