
CCR5 cDNA ORF clone, Homo sapiens (human)

Gene Symbol CCR5
Entrez Gene ID 1234
Full Name chemokine (C-C motif) receptor 5 (gene/pseudogene)
Synonyms CC-CKR-5, CCCKR5, CCR-5, CD195, CKR-5, CKR5, CMKBR5, IDDM22
General protein information
Preferred Names
C-C chemokine receptor type 5
C-C chemokine receptor type 5
HIV-1 fusion coreceptor
chemokine receptor CCR5
C-C motif chemokine receptor 5 A159A
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. The ligands of this receptor include monocyte chemoattractant protein 2 (MCP-2), macrophage inflammatory protein 1 alpha (MIP-1 alpha), macrophage inflammatory protein 1 beta (MIP-1 beta) and regulated on activation normal T expressed and secreted protein (RANTES). Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation. This gene is located at the chemokine receptor gene cluster region. An allelic polymorphism in this gene results in both functional and non-functional alleles; the reference genome represents the functional allele. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2015]. lac of sum
Disorder MIM:


Disorder Html: {HIV infection, susceptibility/resistance to} (3); {West nile virus,

The following CCR5 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the CCR5 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
NM_001100168 Homo sapiens chemokine (C-C motif) receptor 5 (gene/pseudogene) (CCR5), transcript variant B, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_000579 Homo sapiens chemokine (C-C motif) receptor 5 (gene/pseudogene) (CCR5), transcript variant A, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu20119
Accession Version NM_001100168.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1059bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 29-JUL-2015
Organism Homo sapiens (human)
Product C-C chemokine receptor type 5
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC098613.2, DA818906.1, U54994.1 and BC038398.1. Summary: This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. The ligands of this receptor include monocyte chemoattractant protein 2 (MCP-2), macrophage inflammatory protein 1 alpha (MIP-1 alpha), macrophage inflammatory protein 1 beta (MIP-1 beta) and regulated on activation normal T expressed and secreted protein (RANTES). Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation. This gene is located at the chemokine receptor gene cluster region. An allelic polymorphism in this gene results in both functional and non-functional alleles; the reference genome represents the functional allele. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2015]. Transcript Variant: This variant (B) differs in the 5' UTR compared to variant A. Both variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by published experimental evidence. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: U54994.1, BC038398.1 [ECO:0000331] ##Evidence-Data-END## ##RefSeq-Attributes-START## polymorphic pseudogene :: PMID: 17417600 ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)54..56(+)
Misc Feature(2)129..131(+)
Misc Feature(3)150..152(+)
Misc Feature(4)162..164(+)
Misc Feature(5)165..167(+)
Misc Feature(6)213..296(+)
Misc Feature(7)297..1013(+)
Misc Feature(8)327..389(+)
Misc Feature(9)429..494(+)
Misc Feature(10)546..620(+)
Misc Feature(11)717..776(+)
Misc Feature(12)828..902(+)
Misc Feature(13)954..1025(+)
Misc Feature(14)1128..1130(+)
Misc Feature(15)1131..1133(+)
Misc Feature(16)1146..1148(+)
Misc Feature(17)1167..1169(+)
Exon (1)1..57
Gene Synonym:
Exon (2)58..111
Gene Synonym:
Exon (3)112..3426
Gene Synonym:
Position Chain Variation Link
29 29 a, g dbSNP:2856758
43 43 c, t dbSNP:2856759
47 47 a, t dbSNP:542055812
49 49 a, t dbSNP:760982900
59 59 c, t dbSNP:573714896
66 66 g, t dbSNP:544455720
69 69 a, g dbSNP:767348026
86 86 c, t dbSNP:563118331
105 105 c, t dbSNP:533626678
111 111 g, t dbSNP:552107409
113 113 a, c, g dbSNP:184985767
122 122 g, t dbSNP:750682026
132 132 c, g dbSNP:748244565
133 133 -, aa dbSNP:745912425
135 135 a, g dbSNP:763192695
136 136 g, t dbSNP:766432600
154 154 a, g dbSNP:751603911
156 156 a, g dbSNP:755442066
157 157 c, t dbSNP:781613165
159 159 a, g dbSNP:753095965
164 164 -, t dbSNP:758662716
165 165 c, t dbSNP:200209014
166 166 a, g dbSNP:777539326
172 172 a, c, g, t dbSNP:369206494
173 173 a, g dbSNP:770002247
174 174 a, g dbSNP:142904831
180 180 a, t dbSNP:145061115
182 182 a, c dbSNP:760428955
183 183 -, a dbSNP:780235820
186 186 a, t dbSNP:768398484
187 187 a, c dbSNP:776432250
191 191 a, c dbSNP:763103073
194 194 c, t dbSNP:766509880
196 196 a, t dbSNP:751650495
197 197 a, g dbSNP:759590067
199 199 a, g dbSNP:189601230
206 206 c, t dbSNP:753300247
207 207 a, g, t dbSNP:1800939
213 213 c, t dbSNP:777944058
214 214 a, g dbSNP:56340326
216 216 c, t dbSNP:374426321
225 225 c, t dbSNP:778497859
226 226 c, t dbSNP:745372153
227 227 a, g dbSNP:113471490
233 233 c, t dbSNP:768794649
238 238 c, t dbSNP:779570167
239 239 g, t dbSNP:746899041
258 258 a, g dbSNP:41425744
260 260 a, g dbSNP:776341341
263 263 a, c dbSNP:747999011
265 265 a, g dbSNP:531662647
268 268 a, t dbSNP:774482480
269 269 a, g dbSNP:759632621
271 271 -, t dbSNP:747388089
283 283 c, t dbSNP:767459001
285 285 c, t dbSNP:775737126
286 286 a, g, t dbSNP:1799863
287 287 g, t dbSNP:148106779
302 302 g, t dbSNP:1800940
309 309 a, t dbSNP:142829420
314 314 a, g dbSNP:750002181
316 316 c, t dbSNP:529010218
322 322 c, t dbSNP:199722561
324 324 a, c, t dbSNP:758090461
325 325 a, c dbSNP:768257027
327 327 c, g dbSNP:547510206
328 328 c, t dbSNP:781160743
334 334 -, acctggc dbSNP:769057798
334 334 a, g dbSNP:747951371
337 337 c, t dbSNP:769515720
338 338 a, g dbSNP:143880323
340 340 a, c, t dbSNP:56198941
344 344 c, t dbSNP:775644923
347 347 c, t dbSNP:1800941
372 372 c, t dbSNP:764687756
380 380 a, g dbSNP:777330502
381 381 c, g dbSNP:762209242
382 382 a, c dbSNP:765467514
389 389 c, t dbSNP:750809479
395 395 c, t dbSNP:757918238
396 396 a, g dbSNP:766082963
399 399 c, g dbSNP:376364792
402 402 c, g, t dbSNP:754530124
405 405 a, g dbSNP:149975182
408 408 c, t dbSNP:756101518
410 410 c, t dbSNP:777374937
416 416 c, t dbSNP:749113400
424 424 a, g dbSNP:772422768
425 425 a, t dbSNP:1800560
428 428 a, g dbSNP:747065935
430 430 c, t dbSNP:764747692
431 431 c, g dbSNP:56068070
432 432 -, tt dbSNP:776790089
438 438 a, g dbSNP:183662584
441 441 c, t dbSNP:138174483
444 444 c, t dbSNP:762167048
445 445 a, g dbSNP:770335913
449 449 g, t dbSNP:558483026
450 450 a, c dbSNP:763433060
451 451 c, t dbSNP:765993128
453 453 a, g dbSNP:751252593
458 458 c, t dbSNP:759216579
459 459 c, t dbSNP:766967187
460 460 c, t dbSNP:200815713
465 465 a, g dbSNP:752265311
469 469 -, tct dbSNP:748699284
474 474 c, t dbSNP:755938296
480 480 a, c, g dbSNP:370409212
481 481 c, t dbSNP:757171495
482 482 c, t dbSNP:200108729
484 484 g, t dbSNP:150497029
490 490 a, c dbSNP:747196580
492 492 a, g dbSNP:769009812
494 494 a, c, t dbSNP:138380934
495 495 a, g dbSNP:146209111
497 497 a, c, t dbSNP:773818071
500 500 a, g dbSNP:771244514
504 504 a, c, t dbSNP:201179081
506 506 c, g dbSNP:759132997
509 509 g, t dbSNP:767205045
510 510 a, g dbSNP:541069027
512 512 c, t dbSNP:559783442
513 513 a, g, t dbSNP:34418657
527 527 c, t dbSNP:757294302
533 533 a, t dbSNP:765063799
544 544 c, t dbSNP:371901382
545 545 a, g dbSNP:754799423
550 550 a, c dbSNP:781530599
551 551 c, t dbSNP:748154509
552 552 a, t dbSNP:756257015
579 579 g, t dbSNP:777744606
581 581 g, t dbSNP:574865763
584 584 a, g dbSNP:771443021
590 590 c, t dbSNP:542780938
598 598 a, c, t dbSNP:746300015
599 599 a, c, g dbSNP:55639502
605 605 c, t dbSNP:770539373
608 608 a, g dbSNP:763623180
613 613 c, t dbSNP:776305643
614 614 a, c, g dbSNP:1800942
616 616 c, t dbSNP:372054532
617 617 c, t dbSNP:750227516
628 628 a, c dbSNP:376687230
635 635 a, g dbSNP:767604123
637 637 a, c dbSNP:377330713
640 640 a, g dbSNP:756358652
643 643 c, t dbSNP:775880427
647 647 c, t dbSNP:756310938
651 651 a, t dbSNP:777849486
653 653 c, t dbSNP:369351284
654 654 c, t dbSNP:199824195
658 658 a, g dbSNP:779454060
661 661 c, t dbSNP:746214124
668 668 g, t dbSNP:772530777
672 672 c, t dbSNP:775750898
674 674 c, g dbSNP:746626584
675 675 a, c dbSNP:768195565
676 676 -, gtcagtatcaattctggaagaatttccagaca dbSNP:333
676 676 g, t dbSNP:112590754
677 677 g, t dbSNP:111718604
678 678 a, c, t dbSNP:113869679
682 682 a, g dbSNP:372782701
687 687 a, c, t dbSNP:765239542
690 690 c, g, t dbSNP:201797884
692 692 g, t dbSNP:751323475
697 697 a, t dbSNP:199827265
701 701 c, g dbSNP:56345960
704 704 g, t dbSNP:62625034
706 706 c, t dbSNP:764368335
713 713 a, g dbSNP:753901059
717 717 a, g dbSNP:778034886
719 719 c, t dbSNP:757377300
729 729 -, aga dbSNP:772879956
731 731 a, g dbSNP:779364675
734 734 c, t dbSNP:750894443
739 739 c, t dbSNP:113552054
740 740 a, g dbSNP:139737901
747 747 a, g dbSNP:747396322
752 752 c, g dbSNP:768338339
767 767 a, g dbSNP:376137306
768 768 a, g dbSNP:747625967
769 769 g, t dbSNP:371598347
781 781 c, t dbSNP:151126808
787 787 c, t dbSNP:762888354
788 788 g, t dbSNP:201290940
789 789 c, t dbSNP:200419576
790 790 a, g dbSNP:1800452
795 795 c, t dbSNP:146972949
796 796 a, g dbSNP:764278401
800 800 c, t dbSNP:373358134
802 802 -, aga dbSNP:774845977
803 803 a, g dbSNP:548727619
816 816 a, g dbSNP:765254357
822 822 c, g dbSNP:371621013
827 827 a, g, t dbSNP:147615392
828 828 a, c dbSNP:758937078
838 838 a, c dbSNP:780481847
841 841 a, c, t dbSNP:199780106
844 844 c, t dbSNP:201301850
850 850 c, t dbSNP:755334689
858 858 a, c dbSNP:781713216
859 859 c, t dbSNP:143181119
860 860 c, t dbSNP:771408105
862 862 c, t dbSNP:747754051
863 863 c, t dbSNP:141139165
864 864 c, t dbSNP:772496200
866 866 g, t dbSNP:777351934
880 880 c, t dbSNP:748818705
881 881 c, g, t dbSNP:367851873
882 882 a, g dbSNP:759344760
892 892 a, t dbSNP:142469507
895 895 a, g dbSNP:771817175
903 903 c, t dbSNP:775289875
911 911 c, t dbSNP:761967907
928 928 a, g, t dbSNP:184279915
936 936 -, tctaacagg dbSNP:766182681
936 936 c, t dbSNP:761483454
937 937 c, g dbSNP:762989437
944 944 a, g dbSNP:766874061
946 946 g, t dbSNP:112762802
950 950 c, t dbSNP:755563272
953 953 a, t dbSNP:767935035
954 954 c, g dbSNP:769404562
961 961 a, c, g dbSNP:374495269
964 964 c, t dbSNP:777349996
975 975 c, g dbSNP:748811682
977 977 c, t dbSNP:772758049
982 982 a, g, t dbSNP:55956105
984 984 a, g dbSNP:150592242
985 985 c, t dbSNP:534088482
986 986 a, g dbSNP:372879037
987 987 c, g dbSNP:746860511
989 989 c, g dbSNP:149622978
993 993 c, t dbSNP:200740810
996 996 a, g dbSNP:375777270
997 997 g, t dbSNP:773341558
1001 1001 a, c dbSNP:763264245
1001 1001 -, c dbSNP:774050135
1004 1004 c, t dbSNP:368391698
1015 1015 a, c dbSNP:559194526
1015 1015 -, c dbSNP:550385921
1022 1022 a, c, t dbSNP:537300448
1023 1023 a, g dbSNP:55916127
1024 1024 g, t dbSNP:1800943
1025 1025 a, g dbSNP:756597818
1047 1047 c, t dbSNP:763770533
1052 1052 c, t dbSNP:753392986
1067 1067 c, t dbSNP:371813238
1074 1074 a, g dbSNP:188772198
1077 1077 c, t dbSNP:374959868
1078 1078 a, g dbSNP:369373756
1079 1079 c, t dbSNP:780012517
1080 1080 g, t dbSNP:746772498
1090 1090 g, t dbSNP:534677585
1105 1105 a, g dbSNP:768291615
1106 1106 c, g dbSNP:372786661
1110 1110 -, c dbSNP:34962689
1112 1112 a, g dbSNP:35853487
1113 1113 c, g dbSNP:199846907
1115 1115 c, t dbSNP:201780857
1118 1118 c, t dbSNP:148802293
1119 1119 a, g dbSNP:759745875
1120 1120 a, c dbSNP:772685815
1122 1122 a, c, g, t dbSNP:147879075
1123 1123 a, g dbSNP:764318467
1126 1126 c, g, t dbSNP:1800944
1129 1129 g, t dbSNP:765009973
1138 1138 a, g, t dbSNP:1800945
1143 1143 c, t dbSNP:543680286
1144 1144 a, g dbSNP:751446924
1146 1146 g, t dbSNP:754955483
1153 1153 a, c, g, t dbSNP:375916464
1154 1154 a, g dbSNP:779328542
1160 1160 a, g dbSNP:2157060
1166 1166 a, c, g dbSNP:772239843
1184 1184 c, t dbSNP:191297617
1185 1185 a, g dbSNP:769213005
1186 1186 a, g, t dbSNP:776859902
1197 1197 a, g dbSNP:764761704
1200 1200 a, g dbSNP:532474349
1202 1202 a, t dbSNP:540992448
1216 1216 g, t dbSNP:777009009
1220 1220 a, g dbSNP:750032774
1222 1222 a, g dbSNP:544907003
1227 1227 c, g dbSNP:762613473
1256 1256 a, g dbSNP:536872608
1290 1290 a, t dbSNP:529752751
1293 1293 c, g dbSNP:146080174
1366 1366 c, t dbSNP:569458865
1375 1375 a, g dbSNP:112622745
1377 1377 a, g dbSNP:752397660
1418 1418 a, g dbSNP:183840358
1456 1456 -, c dbSNP:748287465
1463 1463 c, t dbSNP:552382275
1466 1466 c, t dbSNP:570782804
1467 1467 a, g dbSNP:764395007
1471 1471 a, c, g dbSNP:41414147
1513 1513 a, t dbSNP:568368266
1538 1538 a, g dbSNP:763665714
1542 1542 c, t dbSNP:535892345
1544 1544 c, t dbSNP:143589063
1599 1599 c, t dbSNP:575840249
1611 1611 g, t dbSNP:757414418
1639 1639 g, t dbSNP:543618933
1648 1648 a, c dbSNP:574715855
1680 1680 c, t dbSNP:369515918
1706 1706 c, t dbSNP:746407806
1715 1715 a, c dbSNP:758790885
1739 1739 g, t dbSNP:577174845
1779 1779 a, g dbSNP:540976580
1801 1801 a, t dbSNP:145725153
1833 1833 c, t dbSNP:373926603
1834 1834 g, t dbSNP:541845196
1864 1864 a, g dbSNP:780507054
1874 1874 a, g dbSNP:41495153
1880 1880 a, g dbSNP:142957506
1898 1898 a, g dbSNP:151122728
1918 1918 c, t dbSNP:375306827
1931 1931 c, t dbSNP:570721731
1932 1932 a, g dbSNP:528738443
1945 1945 c, t dbSNP:17765882
1965 1965 a, g dbSNP:41418945
1968 1968 a, g dbSNP:41466044
1990 1990 a, g dbSNP:190456231
2007 2007 a, c dbSNP:528292132
2040 2040 a, g dbSNP:569344707
2041 2041 c, g dbSNP:539953254
2098 2098 a, g dbSNP:773688575
2106 2106 a, g dbSNP:759552801
2125 2125 a, g dbSNP:41345848
2127 2127 a, g dbSNP:141257116
2151 2151 c, t dbSNP:200501663
2167 2167 a, t dbSNP:201290180
2171 2171 a, g dbSNP:199648605
2179 2179 c, t dbSNP:775479176
2199 2199 g, t dbSNP:1800874
2209 2209 a, c dbSNP:200364389
2225 2225 c, g dbSNP:201423367
2237 2237 c, t dbSNP:186889269
2257 2257 a, t dbSNP:752632377
2260 2260 a, c dbSNP:554321754
2272 2272 c, g dbSNP:146926765
2291 2291 a, g dbSNP:562961861
2312 2312 a, g dbSNP:574954754
2327 2327 g, t dbSNP:137866928
2347 2347 c, t dbSNP:41535253
2368 2368 a, c dbSNP:754123884
2385 2385 c, t dbSNP:528671807
2415 2415 a, g dbSNP:41526948
2422 2422 c, t dbSNP:765388021
2427 2427 c, t dbSNP:77024144
2431 2431 c, t dbSNP:754748129
2462 2462 a, g dbSNP:750437295
2480 2480 c, t dbSNP:758992399
2481 2481 a, g dbSNP:562220468
2482 2482 c, t dbSNP:529611447
2483 2483 a, g dbSNP:780412321
2503 2503 a, g dbSNP:550958125
2537 2537 c, t dbSNP:747440437
2553 2553 c, t dbSNP:755342260
2557 2557 a, t dbSNP:546490087
2565 2565 g, t dbSNP:781480048
2579 2579 c, t dbSNP:201417500
2580 2580 a, c dbSNP:3188094
2584 2584 a, g dbSNP:190094030
2590 2590 c, t dbSNP:551901023
2608 2608 c, t dbSNP:181602248
2612 2612 c, g dbSNP:185327310
2655 2655 a, g dbSNP:534497551
2659 2659 a, g dbSNP:770453936
2680 2680 a, t dbSNP:553155294
2694 2694 g, t dbSNP:1048115
2787 2787 g, t dbSNP:141737357
2790 2790 a, g dbSNP:745351514
2798 2798 a, c dbSNP:41442546
2856 2856 c, g dbSNP:775569353
2863 2863 c, t dbSNP:760628369
2886 2886 c, g, t dbSNP:556971174
2888 2888 g, t dbSNP:776525395
2892 2892 a, g, t dbSNP:574892806
2895 2895 a, g dbSNP:190136403
2901 2901 a, g dbSNP:376306118
2902 2902 a, g dbSNP:778460868
2953 2953 c, t dbSNP:182052831
2954 2954 a, g dbSNP:750574519
2960 2960 c, g dbSNP:41512547
2983 2983 c, g dbSNP:758536268
2995 2995 g, t dbSNP:568854883
3019 3019 a, g dbSNP:529519962
3028 3028 g, t dbSNP:551297914
3041 3041 g, t dbSNP:746492
3043 3043 c, t dbSNP:200688955
3047 3047 c, t dbSNP:755432048
3055 3055 g, t dbSNP:186138215
3061 3061 c, t dbSNP:781570167
3069 3069 a, t dbSNP:192256035
3091 3091 a, g dbSNP:566824961
3206 3206 c, t dbSNP:534316499
3211 3211 a, g dbSNP:184040468
3227 3227 a, g dbSNP:370386700
3233 3233 a, c dbSNP:535314315
3238 3238 a, g dbSNP:570463527
3243 3243 a, g dbSNP:756987625
3254 3254 g, t dbSNP:188577829
3299 3299 a, g dbSNP:374785441
3405 3405 c, t dbSNP:541816244

Target ORF information:

RefSeq Version NM_001100168
Organism Homo sapiens (human)
Definition Homo sapiens chemokine (C-C motif) receptor 5 (gene/pseudogene) (CCR5), transcript variant B, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu20119
Accession Version NM_000579.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1059bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 29-JUL-2015
Organism Homo sapiens (human)
Product C-C chemokine receptor type 5
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AC098613.2, DA818906.1, U54994.1 and BC038398.1. This sequence is a reference standard in the RefSeqGene project. On or before Aug 31, 2013 this sequence version replaced gi:530371858, gi:157671960, gi:118572593. Summary: This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. The ligands of this receptor include monocyte chemoattractant protein 2 (MCP-2), macrophage inflammatory protein 1 alpha (MIP-1 alpha), macrophage inflammatory protein 1 beta (MIP-1 beta) and regulated on activation normal T expressed and secreted protein (RANTES). Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation. This gene is located at the chemokine receptor gene cluster region. An allelic polymorphism in this gene results in both functional and non-functional alleles; the reference genome represents the functional allele. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2015]. Transcript Variant: This variant (A) represents the longer transcript. Both variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by published experimental evidence. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: U54994.1, BC038398.1 [ECO:0000331] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## ##RefSeq-Attributes-START## polymorphic pseudogene :: PMID: 17417600 ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)277..279(+)
Misc Feature(2)364..366(+)
Misc Feature(3)364..366(+)
Misc Feature(4)373..375(+)
Misc Feature(5)385..387(+)
Misc Feature(6)385..387(+)
Misc Feature(7)397..399(+)
Misc Feature(8)397..399(+)
Misc Feature(9)400..402(+)
Misc Feature(10)400..402(+)
Misc Feature(11)448..531(+)
Misc Feature(12)532..1248(+)
Misc Feature(13)562..624(+)
Misc Feature(14)664..729(+)
Misc Feature(15)781..855(+)
Misc Feature(16)952..1011(+)
Misc Feature(17)1063..1137(+)
Misc Feature(18)1189..1260(+)
Misc Feature(19)1318..1320(+)
Misc Feature(20)1324..1326(+)
Misc Feature(21)1327..1329(+)
Misc Feature(22)1363..1365(+)
Misc Feature(23)1363..1365(+)
Misc Feature(24)1366..1368(+)
Misc Feature(25)1366..1368(+)
Misc Feature(26)1381..1383(+)
Misc Feature(27)1381..1383(+)
Misc Feature(28)1402..1404(+)
Misc Feature(29)1402..1404(+)
Exon (1)1..57
Gene Synonym:
Exon (2)58..346
Gene Synonym:
Exon (3)347..3661
Gene Synonym:
Position Chain Variation Link
29 29 a, g dbSNP:2856758
43 43 c, t dbSNP:2856759
47 47 a, t dbSNP:542055812
49 49 a, t dbSNP:760982900
75 75 a, g dbSNP:776723562
111 111 a, g dbSNP:147420214
115 115 c, t dbSNP:201495177
116 116 a, g dbSNP:200068037
126 126 c, t dbSNP:1799988
129 129 c, t dbSNP:41469351
134 134 c, t dbSNP:540267036
140 140 c, t dbSNP:3087249
149 149 c, t dbSNP:2856760
157 157 c, t dbSNP:546550633
175 175 a, g dbSNP:1800023
183 183 c, t dbSNP:200298802
195 195 a, c dbSNP:201042276
204 204 c, t dbSNP:111233598
211 211 c, g dbSNP:202208604
213 213 c, g dbSNP:41355345
232 232 a, c dbSNP:781134549
235 235 a, c dbSNP:3087250
294 294 c, t dbSNP:573714896
301 301 g, t dbSNP:544455720
304 304 a, g dbSNP:767348026
321 321 c, t dbSNP:563118331
340 340 c, t dbSNP:533626678
346 346 g, t dbSNP:552107409
348 348 a, c, g dbSNP:184985767
357 357 g, t dbSNP:750682026
367 367 c, g dbSNP:748244565
368 368 -, aa dbSNP:745912425
370 370 a, g dbSNP:763192695
371 371 g, t dbSNP:766432600
389 389 a, g dbSNP:751603911
391 391 a, g dbSNP:755442066
392 392 c, t dbSNP:781613165
394 394 a, g dbSNP:753095965
399 399 -, t dbSNP:758662716
400 400 c, t dbSNP:200209014
401 401 a, g dbSNP:777539326
407 407 a, c, g, t dbSNP:369206494
408 408 a, g dbSNP:770002247
409 409 a, g dbSNP:142904831
415 415 a, t dbSNP:145061115
417 417 a, c dbSNP:760428955
418 418 -, a dbSNP:780235820
421 421 a, t dbSNP:768398484
422 422 a, c dbSNP:776432250
426 426 a, c dbSNP:763103073
429 429 c, t dbSNP:766509880
431 431 a, t dbSNP:751650495
432 432 a, g dbSNP:759590067
434 434 a, g dbSNP:189601230
441 441 c, t dbSNP:753300247
442 442 a, g, t dbSNP:1800939
448 448 c, t dbSNP:777944058
449 449 a, g dbSNP:56340326
451 451 c, t dbSNP:374426321
460 460 c, t dbSNP:778497859
461 461 c, t dbSNP:745372153
462 462 a, g dbSNP:113471490
468 468 c, t dbSNP:768794649
473 473 c, t dbSNP:779570167
474 474 g, t dbSNP:746899041
493 493 a, g dbSNP:41425744
495 495 a, g dbSNP:776341341
498 498 a, c dbSNP:747999011
500 500 a, g dbSNP:531662647
503 503 a, t dbSNP:774482480
504 504 a, g dbSNP:759632621
506 506 -, t dbSNP:747388089
518 518 c, t dbSNP:767459001
520 520 c, t dbSNP:775737126
521 521 a, g, t dbSNP:1799863
522 522 g, t dbSNP:148106779
537 537 g, t dbSNP:1800940
544 544 a, t dbSNP:142829420
549 549 a, g dbSNP:750002181
551 551 c, t dbSNP:529010218
557 557 c, t dbSNP:199722561
559 559 a, c, t dbSNP:758090461
560 560 a, c dbSNP:768257027
562 562 c, g dbSNP:547510206
563 563 c, t dbSNP:781160743
569 569 -, acctggc dbSNP:769057798
569 569 a, g dbSNP:747951371
572 572 c, t dbSNP:769515720
573 573 a, g dbSNP:143880323
575 575 a, c, t dbSNP:56198941
579 579 c, t dbSNP:775644923
582 582 c, t dbSNP:1800941
607 607 c, t dbSNP:764687756
615 615 a, g dbSNP:777330502
616 616 c, g dbSNP:762209242
617 617 a, c dbSNP:765467514
624 624 c, t dbSNP:750809479
630 630 c, t dbSNP:757918238
631 631 a, g dbSNP:766082963
634 634 c, g dbSNP:376364792
637 637 c, g, t dbSNP:754530124
640 640 a, g dbSNP:149975182
643 643 c, t dbSNP:756101518
645 645 c, t dbSNP:777374937
651 651 c, t dbSNP:749113400
659 659 a, g dbSNP:772422768
660 660 a, t dbSNP:1800560
663 663 a, g dbSNP:747065935
665 665 c, t dbSNP:764747692
666 666 c, g dbSNP:56068070
667 667 -, tt dbSNP:776790089
673 673 a, g dbSNP:183662584
676 676 c, t dbSNP:138174483
679 679 c, t dbSNP:762167048
680 680 a, g dbSNP:770335913
684 684 g, t dbSNP:558483026
685 685 a, c dbSNP:763433060
686 686 c, t dbSNP:765993128
688 688 a, g dbSNP:751252593
693 693 c, t dbSNP:759216579
694 694 c, t dbSNP:766967187
695 695 c, t dbSNP:200815713
700 700 a, g dbSNP:752265311
704 704 -, tct dbSNP:748699284
709 709 c, t dbSNP:755938296
715 715 a, c, g dbSNP:370409212
716 716 c, t dbSNP:757171495
717 717 c, t dbSNP:200108729
719 719 g, t dbSNP:150497029
725 725 a, c dbSNP:747196580
727 727 a, g dbSNP:769009812
729 729 a, c, t dbSNP:138380934
730 730 a, g dbSNP:146209111
732 732 a, c, t dbSNP:773818071
735 735 a, g dbSNP:771244514
739 739 a, c, t dbSNP:201179081
741 741 c, g dbSNP:759132997
744 744 g, t dbSNP:767205045
745 745 a, g dbSNP:541069027
747 747 c, t dbSNP:559783442
748 748 a, g, t dbSNP:34418657
762 762 c, t dbSNP:757294302
768 768 a, t dbSNP:765063799
779 779 c, t dbSNP:371901382
780 780 a, g dbSNP:754799423
785 785 a, c dbSNP:781530599
786 786 c, t dbSNP:748154509
787 787 a, t dbSNP:756257015
814 814 g, t dbSNP:777744606
816 816 g, t dbSNP:574865763
819 819 a, g dbSNP:771443021
825 825 c, t dbSNP:542780938
833 833 a, c, t dbSNP:746300015
834 834 a, c, g dbSNP:55639502
840 840 c, t dbSNP:770539373
843 843 a, g dbSNP:763623180
848 848 c, t dbSNP:776305643
849 849 a, c, g dbSNP:1800942
851 851 c, t dbSNP:372054532
852 852 c, t dbSNP:750227516
863 863 a, c dbSNP:376687230
870 870 a, g dbSNP:767604123
872 872 a, c dbSNP:377330713
875 875 a, g dbSNP:756358652
878 878 c, t dbSNP:775880427
882 882 c, t dbSNP:756310938
886 886 a, t dbSNP:777849486
888 888 c, t dbSNP:369351284
889 889 c, t dbSNP:199824195
893 893 a, g dbSNP:779454060
896 896 c, t dbSNP:746214124
903 903 g, t dbSNP:772530777
907 907 c, t dbSNP:775750898
909 909 c, g dbSNP:746626584
910 910 a, c dbSNP:768195565
911 911 -, gtcagtatcaattctggaagaatttccagaca dbSNP:333
911 911 g, t dbSNP:112590754
912 912 g, t dbSNP:111718604
913 913 a, c, t dbSNP:113869679
917 917 a, g dbSNP:372782701
922 922 a, c, t dbSNP:765239542
925 925 c, g, t dbSNP:201797884
927 927 g, t dbSNP:751323475
932 932 a, t dbSNP:199827265
936 936 c, g dbSNP:56345960
939 939 g, t dbSNP:62625034
941 941 c, t dbSNP:764368335
948 948 a, g dbSNP:753901059
952 952 a, g dbSNP:778034886
954 954 c, t dbSNP:757377300
964 964 -, aga dbSNP:772879956
966 966 a, g dbSNP:779364675
969 969 c, t dbSNP:750894443
974 974 c, t dbSNP:113552054
975 975 a, g dbSNP:139737901
982 982 a, g dbSNP:747396322
987 987 c, g dbSNP:768338339
1002 1002 a, g dbSNP:376137306
1003 1003 a, g dbSNP:747625967
1004 1004 g, t dbSNP:371598347
1016 1016 c, t dbSNP:151126808
1022 1022 c, t dbSNP:762888354
1023 1023 g, t dbSNP:201290940
1024 1024 c, t dbSNP:200419576
1025 1025 a, g dbSNP:1800452
1030 1030 c, t dbSNP:146972949
1031 1031 a, g dbSNP:764278401
1035 1035 c, t dbSNP:373358134
1037 1037 -, aga dbSNP:774845977
1038 1038 a, g dbSNP:548727619
1051 1051 a, g dbSNP:765254357
1057 1057 c, g dbSNP:371621013
1062 1062 a, g, t dbSNP:147615392
1063 1063 a, c dbSNP:758937078
1073 1073 a, c dbSNP:780481847
1076 1076 a, c, t dbSNP:199780106
1079 1079 c, t dbSNP:201301850
1085 1085 c, t dbSNP:755334689
1093 1093 a, c dbSNP:781713216
1094 1094 c, t dbSNP:143181119
1095 1095 c, t dbSNP:771408105
1097 1097 c, t dbSNP:747754051
1098 1098 c, t dbSNP:141139165
1099 1099 c, t dbSNP:772496200
1101 1101 g, t dbSNP:777351934
1115 1115 c, t dbSNP:748818705
1116 1116 c, g, t dbSNP:367851873
1117 1117 a, g dbSNP:759344760
1127 1127 a, t dbSNP:142469507
1130 1130 a, g dbSNP:771817175
1138 1138 c, t dbSNP:775289875
1146 1146 c, t dbSNP:761967907
1163 1163 a, g, t dbSNP:184279915
1171 1171 -, tctaacagg dbSNP:766182681
1171 1171 c, t dbSNP:761483454
1172 1172 c, g dbSNP:762989437
1179 1179 a, g dbSNP:766874061
1181 1181 g, t dbSNP:112762802
1185 1185 c, t dbSNP:755563272
1188 1188 a, t dbSNP:767935035
1189 1189 c, g dbSNP:769404562
1196 1196 a, c, g dbSNP:374495269
1199 1199 c, t dbSNP:777349996
1210 1210 c, g dbSNP:748811682
1212 1212 c, t dbSNP:772758049
1217 1217 a, g, t dbSNP:55956105
1219 1219 a, g dbSNP:150592242
1220 1220 c, t dbSNP:534088482
1221 1221 a, g dbSNP:372879037
1222 1222 c, g dbSNP:746860511
1224 1224 c, g dbSNP:149622978
1228 1228 c, t dbSNP:200740810
1231 1231 a, g dbSNP:375777270
1232 1232 g, t dbSNP:773341558
1236 1236 a, c dbSNP:763264245
1236 1236 -, c dbSNP:774050135
1239 1239 c, t dbSNP:368391698
1250 1250 a, c dbSNP:559194526
1250 1250 -, c dbSNP:550385921
1257 1257 a, c, t dbSNP:537300448
1258 1258 a, g dbSNP:55916127
1259 1259 g, t dbSNP:1800943
1260 1260 a, g dbSNP:756597818
1282 1282 c, t dbSNP:763770533
1287 1287 c, t dbSNP:753392986
1302 1302 c, t dbSNP:371813238
1309 1309 a, g dbSNP:188772198
1312 1312 c, t dbSNP:374959868
1313 1313 a, g dbSNP:369373756
1314 1314 c, t dbSNP:780012517
1315 1315 g, t dbSNP:746772498
1325 1325 g, t dbSNP:534677585
1340 1340 a, g dbSNP:768291615
1341 1341 c, g dbSNP:372786661
1345 1345 -, c dbSNP:34962689
1347 1347 a, g dbSNP:35853487
1348 1348 c, g dbSNP:199846907
1350 1350 c, t dbSNP:201780857
1353 1353 c, t dbSNP:148802293
1354 1354 a, g dbSNP:759745875
1355 1355 a, c dbSNP:772685815
1357 1357 a, c, g, t dbSNP:147879075
1358 1358 a, g dbSNP:764318467
1361 1361 c, g, t dbSNP:1800944
1364 1364 g, t dbSNP:765009973
1373 1373 a, g, t dbSNP:1800945
1378 1378 c, t dbSNP:543680286
1379 1379 a, g dbSNP:751446924
1381 1381 g, t dbSNP:754955483
1388 1388 a, c, g, t dbSNP:375916464
1389 1389 a, g dbSNP:779328542
1395 1395 a, g dbSNP:2157060
1401 1401 a, c, g dbSNP:772239843
1419 1419 c, t dbSNP:191297617
1420 1420 a, g dbSNP:769213005
1421 1421 a, g, t dbSNP:776859902
1432 1432 a, g dbSNP:764761704
1435 1435 a, g dbSNP:532474349
1437 1437 a, t dbSNP:540992448
1451 1451 g, t dbSNP:777009009
1455 1455 a, g dbSNP:750032774
1457 1457 a, g dbSNP:544907003
1462 1462 c, g dbSNP:762613473
1491 1491 a, g dbSNP:536872608
1525 1525 a, t dbSNP:529752751
1528 1528 c, g dbSNP:146080174
1601 1601 c, t dbSNP:569458865
1610 1610 a, g dbSNP:112622745
1612 1612 a, g dbSNP:752397660
1653 1653 a, g dbSNP:183840358
1691 1691 -, c dbSNP:748287465
1698 1698 c, t dbSNP:552382275
1701 1701 c, t dbSNP:570782804
1702 1702 a, g dbSNP:764395007
1706 1706 a, c, g dbSNP:41414147
1748 1748 a, t dbSNP:568368266
1773 1773 a, g dbSNP:763665714
1777 1777 c, t dbSNP:535892345
1779 1779 c, t dbSNP:143589063
1834 1834 c, t dbSNP:575840249
1846 1846 g, t dbSNP:757414418
1874 1874 g, t dbSNP:543618933
1883 1883 a, c dbSNP:574715855
1915 1915 c, t dbSNP:369515918
1941 1941 c, t dbSNP:746407806
1950 1950 a, c dbSNP:758790885
1974 1974 g, t dbSNP:577174845
2014 2014 a, g dbSNP:540976580
2036 2036 a, t dbSNP:145725153
2068 2068 c, t dbSNP:373926603
2069 2069 g, t dbSNP:541845196
2099 2099 a, g dbSNP:780507054
2109 2109 a, g dbSNP:41495153
2115 2115 a, g dbSNP:142957506
2133 2133 a, g dbSNP:151122728
2153 2153 c, t dbSNP:375306827
2166 2166 c, t dbSNP:570721731
2167 2167 a, g dbSNP:528738443
2180 2180 c, t dbSNP:17765882
2200 2200 a, g dbSNP:41418945
2203 2203 a, g dbSNP:41466044
2225 2225 a, g dbSNP:190456231
2242 2242 a, c dbSNP:528292132
2275 2275 a, g dbSNP:569344707
2276 2276 c, g dbSNP:539953254
2333 2333 a, g dbSNP:773688575
2341 2341 a, g dbSNP:759552801
2360 2360 a, g dbSNP:41345848
2362 2362 a, g dbSNP:141257116
2386 2386 c, t dbSNP:200501663
2402 2402 a, t dbSNP:201290180
2406 2406 a, g dbSNP:199648605
2414 2414 c, t dbSNP:775479176
2434 2434 g, t dbSNP:1800874
2444 2444 a, c dbSNP:200364389
2460 2460 c, g dbSNP:201423367
2472 2472 c, t dbSNP:186889269
2492 2492 a, t dbSNP:752632377
2495 2495 a, c dbSNP:554321754
2507 2507 c, g dbSNP:146926765
2526 2526 a, g dbSNP:562961861
2547 2547 a, g dbSNP:574954754
2562 2562 g, t dbSNP:137866928
2582 2582 c, t dbSNP:41535253
2603 2603 a, c dbSNP:754123884
2620 2620 c, t dbSNP:528671807
2650 2650 a, g dbSNP:41526948
2657 2657 c, t dbSNP:765388021
2662 2662 c, t dbSNP:77024144
2666 2666 c, t dbSNP:754748129
2697 2697 a, g dbSNP:750437295
2715 2715 c, t dbSNP:758992399
2716 2716 a, g dbSNP:562220468
2717 2717 c, t dbSNP:529611447
2718 2718 a, g dbSNP:780412321
2738 2738 a, g dbSNP:550958125
2772 2772 c, t dbSNP:747440437
2788 2788 c, t dbSNP:755342260
2792 2792 a, t dbSNP:546490087
2800 2800 g, t dbSNP:781480048
2814 2814 c, t dbSNP:201417500
2815 2815 a, c dbSNP:3188094
2819 2819 a, g dbSNP:190094030
2825 2825 c, t dbSNP:551901023
2843 2843 c, t dbSNP:181602248
2847 2847 c, g dbSNP:185327310
2890 2890 a, g dbSNP:534497551
2894 2894 a, g dbSNP:770453936
2915 2915 a, t dbSNP:553155294
2929 2929 g, t dbSNP:1048115
3022 3022 g, t dbSNP:141737357
3025 3025 a, g dbSNP:745351514
3033 3033 a, c dbSNP:41442546
3091 3091 c, g dbSNP:775569353
3098 3098 c, t dbSNP:760628369
3121 3121 c, g, t dbSNP:556971174
3123 3123 g, t dbSNP:776525395
3127 3127 a, g, t dbSNP:574892806
3130 3130 a, g dbSNP:190136403
3136 3136 a, g dbSNP:376306118
3137 3137 a, g dbSNP:778460868
3188 3188 c, t dbSNP:182052831
3189 3189 a, g dbSNP:750574519
3195 3195 c, g dbSNP:41512547
3218 3218 c, g dbSNP:758536268
3230 3230 g, t dbSNP:568854883
3254 3254 a, g dbSNP:529519962
3263 3263 g, t dbSNP:551297914
3276 3276 g, t dbSNP:746492
3278 3278 c, t dbSNP:200688955
3282 3282 c, t dbSNP:755432048
3290 3290 g, t dbSNP:186138215
3296 3296 c, t dbSNP:781570167
3304 3304 a, t dbSNP:192256035
3326 3326 a, g dbSNP:566824961
3441 3441 c, t dbSNP:534316499
3446 3446 a, g dbSNP:184040468
3462 3462 a, g dbSNP:370386700
3468 3468 a, c dbSNP:535314315
3473 3473 a, g dbSNP:570463527
3478 3478 a, g dbSNP:756987625
3489 3489 g, t dbSNP:188577829
3534 3534 a, g dbSNP:374785441
3640 3640 c, t dbSNP:541816244

Target ORF information:

RefSeq Version NM_000579
Organism Homo sapiens (human)
Definition Homo sapiens chemokine (C-C motif) receptor 5 (gene/pseudogene) (CCR5), transcript variant A, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
