
USH1G cDNA ORF clone, Homo sapiens (human)

Gene Symbol USH1G
Entrez Gene ID 124590
Full Name Usher syndrome 1G (autosomal recessive)
Synonyms ANKS4A, SANS
General protein information
Preferred Names
Usher syndrome type-1G protein
Usher syndrome type-1G protein
scaffold protein containing ankyrin repeats and SAM domain
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a protein that contains three ankyrin domains, a class I PDZ-binding motif and a sterile alpha motif. The encoded protein interacts with harmonin, which is associated with Usher syndrome type 1C. This protein plays a role in the development and maintenance of the auditory and visual systems and functions in the cohesion of hair bundles formed by inner ear sensory cells. Mutations in this gene are associated with Usher syndrome type 1G (USH1G). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]. lac of sum
Disorder MIM:


Disorder Html: Usher syndrome, type 1G, 606943 (3)

mRNA and Protein(s)

mRNA Protein Name
XM_011524296 XP_011522598 Usher syndrome type-1G protein isoform X1
NM_001282489 NP_001269418 Usher syndrome type-1G protein isoform 2
NM_173477 NP_775748 Usher syndrome type-1G protein isoform 1

Homo sapiens (human) USH1G NP_775748.2
Pan troglodytes (chimpanzee) USH1G XP_523715.2
Canis lupus familiaris (dog) USH1G XP_852112.2
Bos taurus (cattle) USH1G NP_001179631.1
Mus musculus (house mouse) Ush1g NP_789817.1
Rattus norvegicus (Norway rat) Ush1g NP_001099320.1
Gallus gallus (chicken) USH1G XP_426242.2
Danio rerio (zebrafish) LOC100330314 XP_002661315.1
Drosophila melanogaster (fruit fly) Sans NP_788340.1
Xenopus (Silurana) tropicalis (western clawed frog) ush1g XP_002939606.1


ID Name Evidence
GO:0005737 cytoplasm IEA
GO:0015629 actin cytoskeleton ISS


ID Name Evidence
GO:0005515 protein binding IPI
GO:0042803 protein homodimerization activity IEA


ID Name Evidence
GO:0007605 sensory perception of sound IMP
GO:0042472 inner ear morphogenesis IEA
GO:0045494 photoreceptor cell maintenance IMP
GO:0050896 response to stimulus IEA
GO:0050953 sensory perception of light stimulus IMP
GO:0050957 equilibrioception IMP
GO:0060113 inner ear receptor cell differentiation IEA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following USH1G gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the USH1G cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
XM_011524296 PREDICTED: Homo sapiens Usher syndrome 1G (autosomal recessive) (USH1G), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Starting from $159.50
NM_001282489 Homo sapiens Usher syndrome 1G (autosomal recessive) (USH1G), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Starting from $159.50
NM_173477 Homo sapiens Usher syndrome 1G (autosomal recessive) (USH1G), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Starting from $189.50

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu23504
Accession Version XM_011524296.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1077bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product Usher syndrome type-1G protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010783.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)1321..1518(+)
Misc Feature(2)1321..1509(+)
Misc Feature(3)1342..1503(+)
Position Chain Variation Link
20 20 c, t dbSNP:761731473
21 21 c, t dbSNP:776132786
24 24 g, t dbSNP:768399553
37 37 a, g dbSNP:746466465
68 68 c, t dbSNP:45562933
82 82 c, g dbSNP:111801414
107 107 a, g dbSNP:185144732
149 149 a, g dbSNP:530823038
229 229 a, g dbSNP:561798455
247 247 g, t dbSNP:541916393
272 272 a, c dbSNP:573039959
281 281 c, g dbSNP:552874333
314 314 c, g dbSNP:763809350
318 318 a, g dbSNP:546004120
326 326 g, t dbSNP:767660431
336 336 c, t dbSNP:759703993
339 339 a, c, g dbSNP:765320969
345 345 -, ca dbSNP:730880268
369 369 c, t dbSNP:761488604
388 388 c, t dbSNP:549973959
390 390 c, g dbSNP:200345990
407 407 a, t dbSNP:760325139
408 408 a, c dbSNP:775135769
410 410 c, t dbSNP:397517927
417 417 a, c dbSNP:148496763
420 420 c, t dbSNP:144686462
421 421 a, g dbSNP:368407264
423 423 a, g dbSNP:745450960
425 425 a, c dbSNP:774827536
439 439 c, t dbSNP:771517713
440 440 c, t dbSNP:749586302
451 451 g, t dbSNP:778163212
454 454 c, t dbSNP:756461951
458 458 c, t dbSNP:748325007
459 459 a, g dbSNP:374260443
469 469 a, g dbSNP:149529031
471 471 a, g dbSNP:751735275
478 478 a, g dbSNP:765050197
479 479 c, t dbSNP:757174476
490 490 a, g dbSNP:753740036
499 499 a, g dbSNP:763891710
502 502 c, t dbSNP:760465755
503 503 a, g dbSNP:775117744
519 519 c, t dbSNP:561119699
538 538 c, t dbSNP:759026779
544 544 c, t dbSNP:375077331
547 547 a, g dbSNP:111033465
548 548 a, c dbSNP:140951373
552 552 -, g dbSNP:587776546
554 554 c, t dbSNP:773610870
564 564 c, g dbSNP:370887019
568 568 a, g dbSNP:770131812
570 570 c, t dbSNP:748592728
577 577 a, t dbSNP:781540158
578 578 c, t dbSNP:755288377
580 580 c, g dbSNP:747261903
583 583 a, c, g dbSNP:111033466
592 592 a, c, g, t dbSNP:200082225
593 593 a, g dbSNP:202005955
595 595 c, g dbSNP:141791769
615 615 -, g dbSNP:773698651
618 618 a, g dbSNP:201822644
622 622 c, t dbSNP:759149374
627 627 a, g dbSNP:751196707
633 633 c, t dbSNP:765860407
637 637 c, g, t dbSNP:376527217
638 638 c, g dbSNP:770249797
639 639 c, t dbSNP:138590256
646 646 a, c, t dbSNP:769161031
648 648 g, t dbSNP:747169902
650 650 c, g dbSNP:144633924
656 656 g, t dbSNP:772186029
659 659 a, g dbSNP:745992000
660 660 -, c dbSNP:34854210
660 660 c, g dbSNP:141688757
662 662 a, g dbSNP:756087370
667 667 a, g dbSNP:574697331
668 668 c, g dbSNP:780916600
669 669 c, g dbSNP:374630813
670 670 g, t dbSNP:201866631
673 673 a, c, g, t dbSNP:199941325
674 674 a, g dbSNP:764428038
677 677 c, g dbSNP:764867252
679 679 g, t dbSNP:200786476
690 690 c, g dbSNP:147972772
698 698 c, g dbSNP:374579438
704 704 c, g dbSNP:769073148
711 711 a, c dbSNP:761010255
714 714 c, g dbSNP:558890451
722 722 a, g, t dbSNP:201123735
725 725 a, g dbSNP:201644674
740 740 c, t dbSNP:771022122
741 741 a, g, t dbSNP:373704838
743 743 g, t dbSNP:754767231
748 748 a, c dbSNP:751372463
749 749 c, g dbSNP:779722969
752 752 a, c dbSNP:202045256
753 753 c, t dbSNP:727503713
758 758 c, t dbSNP:750109903
760 760 c, t dbSNP:143458197
766 766 c, g dbSNP:727504890
777 777 a, g dbSNP:756830882
780 780 a, c dbSNP:199714230
785 785 c, t dbSNP:573510359
786 786 a, g dbSNP:754390030
794 794 -, g dbSNP:770350814
794 794 c, g dbSNP:200197601
806 806 c, t dbSNP:774403004
808 808 a, c dbSNP:775758795
809 809 a, g dbSNP:767955984
813 813 g, t dbSNP:759630941
814 814 -, aag dbSNP:762274233
814 814 a, c dbSNP:774571563
827 827 a, g dbSNP:770933979
835 835 a, g dbSNP:530264162
836 836 a, g dbSNP:776540260
837 837 a, c dbSNP:201525855
840 840 c, t dbSNP:370027457
853 853 a, c dbSNP:779660468
862 862 a, g dbSNP:140562408
864 864 a, g dbSNP:149002004
871 871 c, t dbSNP:778772947
874 874 a, c dbSNP:147967199
875 875 -, ag dbSNP:3074305
876 876 c, g dbSNP:544952984
879 879 a, c dbSNP:775371036
880 880 g, t dbSNP:756539436
883 883 c, g dbSNP:753272581
884 884 a, g dbSNP:767718565
885 885 -, ccgc dbSNP:777222355
887 887 a, c dbSNP:759953073
889 889 c, t dbSNP:774553625
890 890 g, t dbSNP:200259553
893 893 c, t dbSNP:397517928
896 896 a, g dbSNP:763002152
898 898 c, t dbSNP:201117051
901 901 c, t dbSNP:773231689
915 915 c, t dbSNP:146752863
916 916 g, t dbSNP:746860881
918 918 c, g dbSNP:375706126
921 921 a, g dbSNP:771758203
925 925 g, t dbSNP:745713548
929 929 a, g, t dbSNP:111033521
935 935 a, g dbSNP:757008876
942 942 c, t dbSNP:748980810
954 954 a, g dbSNP:777369997
955 955 c, g dbSNP:372750895
965 965 a, g dbSNP:753080270
968 968 a, c, t dbSNP:755287596
972 972 g, t dbSNP:751974726
976 976 c, t dbSNP:377680000
977 977 a, g dbSNP:763109178
980 980 a, g dbSNP:750653373
988 988 c, t dbSNP:768235452
991 991 -, tcggacgaggacagcgtctc dbSNP:397515345
996 996 c, g dbSNP:142486910
997 997 a, g dbSNP:762017352
998 998 a, g dbSNP:775274678
999 999 a, g dbSNP:772093988
1003 1003 a, g dbSNP:759374488
1004 1004 c, g dbSNP:774246535
1008 1008 c, t dbSNP:770872383
1017 1017 c, g dbSNP:748893166
1018 1018 a, g dbSNP:199782834
1025 1025 c, t dbSNP:769185090
1026 1026 a, g dbSNP:747754501
1029 1029 c, t dbSNP:781533417
1033 1033 c, g dbSNP:755521947
1039 1039 c, g dbSNP:752079552
1044 1044 c, g dbSNP:573443794
1046 1046 -, agg dbSNP:769227044
1046 1046 a, c dbSNP:758764789
1066 1066 c, t dbSNP:750635796
1067 1067 a, c dbSNP:765551737
1071 1071 c, t dbSNP:761774812
1073 1073 c, g, t dbSNP:764111098
1075 1075 -, ct dbSNP:745328900
1075 1075 c, g dbSNP:759499224
1085 1085 g, t dbSNP:774444422
1088 1088 c, t dbSNP:770784474
1089 1089 c, t dbSNP:745481022
1101 1101 a, c dbSNP:200477546
1106 1106 a, t dbSNP:769538039
1107 1107 a, g dbSNP:747584261
1111 1111 a, c dbSNP:558361799
1112 1112 a, g dbSNP:537715452
1114 1114 a, g dbSNP:780717575
1117 1117 a, g dbSNP:768163520
1118 1118 -, a dbSNP:778524987
1127 1127 c, g dbSNP:147721296
1131 1131 c, t dbSNP:773660538
1134 1134 a, g dbSNP:150000497
1134 1134 -, g dbSNP:770464252
1142 1142 g, t dbSNP:137871047
1150 1150 c, t dbSNP:373170645
1153 1153 a, g dbSNP:778970061
1155 1155 a, c, g dbSNP:754029450
1171 1171 a, g dbSNP:151242039
1174 1174 a, g dbSNP:756268562
1178 1178 a, g dbSNP:751540523
1180 1180 a, g dbSNP:766484391
1181 1181 c, t dbSNP:762822503
1183 1183 c, t dbSNP:773103971
1184 1184 c, g dbSNP:764976687
1192 1192 c, t dbSNP:761467615
1198 1198 c, t dbSNP:776149260
1205 1205 c, t dbSNP:768147159
1207 1207 c, t dbSNP:746578014
1208 1208 c, g dbSNP:113503320
1213 1213 a, c dbSNP:142291012
1216 1216 a, g dbSNP:775952116
1222 1222 g, t dbSNP:772606877
1228 1228 c, t dbSNP:770166095
1235 1235 a, g dbSNP:746392682
1236 1236 c, t dbSNP:779288250
1238 1238 c, t dbSNP:369623755
1241 1241 a, c, g dbSNP:200613072
1244 1244 g, t dbSNP:148479646
1245 1245 c, t dbSNP:559001977
1246 1246 a, c dbSNP:375322161
1252 1252 a, g dbSNP:538983393
1277 1277 c, t dbSNP:762354629
1291 1291 c, g dbSNP:758319467
1295 1295 c, t dbSNP:267605044
1298 1298 a, c, g dbSNP:780964009
1300 1300 c, t dbSNP:371983289
1305 1305 c, t dbSNP:761576510
1307 1307 a, t dbSNP:776330616
1308 1308 a, c, g dbSNP:576500685
1311 1311 c, t dbSNP:569032124
1321 1321 a, g, t dbSNP:746328214
1323 1323 c, g dbSNP:774725935
1329 1329 c, t dbSNP:199724052
1333 1333 c, t dbSNP:369036189
1338 1338 g, t dbSNP:146287064
1350 1350 c, t dbSNP:141854343
1358 1358 a, g dbSNP:116872904
1361 1361 c, t dbSNP:748416580
1362 1362 a, g dbSNP:781376716
1365 1365 a, g dbSNP:755013643
1366 1366 a, g dbSNP:750367080
1374 1374 c, t dbSNP:778771485
1380 1380 c, g dbSNP:757051357
1384 1384 c, g, t dbSNP:117489945
1389 1389 a, g dbSNP:760271310
1390 1390 -, gag dbSNP:777537471
1391 1391 a, g dbSNP:752359635
1398 1398 c, g dbSNP:766986350
1399 1399 c, g, t dbSNP:774909603
1402 1402 a, c dbSNP:771392412
1409 1409 c, g dbSNP:763348976
1417 1417 c, g dbSNP:139897506
1418 1418 c, t dbSNP:374693956
1429 1429 c, g dbSNP:372360601
1431 1431 c, t dbSNP:748326974
1432 1432 g, t dbSNP:781625717
1438 1438 c, g, t dbSNP:368110384
1444 1444 a, g dbSNP:778876458
1445 1445 g, t dbSNP:757101131
1450 1450 a, g dbSNP:753794521
1456 1456 c, t dbSNP:777486419
1465 1465 c, g dbSNP:755908331
1466 1466 a, g dbSNP:752343151
1476 1476 a, c dbSNP:767134204
1477 1477 c, t dbSNP:759065977
1485 1485 c, g dbSNP:751073735
1494 1494 -, agg dbSNP:755838297
1495 1495 a, c dbSNP:765949002
1496 1496 a, g dbSNP:763508231
1498 1498 c, t dbSNP:773872479
1499 1499 a, g dbSNP:201359669
1501 1501 -, ggc dbSNP:752513148
1513 1513 c, t dbSNP:762322942
1514 1514 a, g dbSNP:776968656
1517 1517 c, t dbSNP:372580540
1520 1520 c, t dbSNP:747285177
1530 1530 a, g dbSNP:775382564
1532 1532 a, t dbSNP:397517925
1544 1544 a, g dbSNP:757954601
1547 1547 c, t dbSNP:146004909
1548 1548 a, c, g dbSNP:372068582
1552 1552 a, g dbSNP:754374776
1555 1555 c, t dbSNP:764308497
1558 1558 c, t dbSNP:368231718
1563 1563 a, c dbSNP:775570788
1583 1583 c, g dbSNP:767766308
1594 1594 c, t dbSNP:199648830
1596 1596 a, t dbSNP:756229183
1603 1603 g, t dbSNP:563126068
1608 1608 c, t dbSNP:113765180
1609 1609 a, g dbSNP:529630489
1620 1620 a, c dbSNP:569986070
1635 1635 a, c dbSNP:376850581
1639 1639 c, g dbSNP:527247025
1656 1656 a, g dbSNP:181973786
1726 1726 a, g dbSNP:540652275
1731 1731 g, t dbSNP:753894091
1746 1746 c, t dbSNP:578014773
1747 1747 a, g dbSNP:557845589
1755 1755 a, c dbSNP:372221620
1768 1768 c, t dbSNP:190522968
1855 1855 g, t dbSNP:575100426
1887 1887 c, g dbSNP:186770264
1888 1888 a, g dbSNP:555190258
1904 1904 c, t dbSNP:535347408
1907 1907 a, g dbSNP:566785681
1913 1913 c, t dbSNP:374435759
1928 1928 c, t dbSNP:552665867
1992 1992 g, t dbSNP:539434387
2001 2001 a, c dbSNP:752734293
2018 2018 c, t dbSNP:570408837
2027 2027 c, g, t dbSNP:75035213
2035 2035 c, g dbSNP:777858100
2043 2043 -, g dbSNP:34699124
2043 2043 a, g dbSNP:569461974
2098 2098 a, c dbSNP:111899313
2112 2112 c, g dbSNP:528602466
2116 2116 a, t dbSNP:111611253
2119 2119 c, g dbSNP:546646559
2123 2123 a, c dbSNP:533372588
2159 2159 a, c dbSNP:545091670
2187 2187 a, g dbSNP:532775278
2225 2225 c, g dbSNP:55744500
2321 2321 a, g dbSNP:55847044
2323 2323 a, g dbSNP:575376060
2337 2337 c, g dbSNP:561522683
2340 2340 -, g dbSNP:35184411
2355 2355 a, g dbSNP:747640918
2364 2364 c, g dbSNP:767040276
2377 2377 g, t dbSNP:146007618
2392 2392 c, t dbSNP:115905441
2396 2396 c, g dbSNP:553241289
2419 2419 c, g dbSNP:539014541
2432 2432 a, g dbSNP:779459863
2471 2471 a, g dbSNP:142437952
2485 2485 c, g dbSNP:112293979
2510 2510 g, t dbSNP:537126229
2527 2527 a, g dbSNP:568192417
2556 2556 c, t dbSNP:749663203
2563 2563 a, g dbSNP:780234900
2571 2571 -, gtgt dbSNP:760396641
2593 2593 a, g dbSNP:756392131
2595 2595 c, t dbSNP:549572410
2597 2597 c, t dbSNP:536064705
2598 2598 a, g dbSNP:113583471
2611 2611 -, gt dbSNP:374828527
2638 2638 a, g dbSNP:690566
2639 2639 c, t dbSNP:137943342
2643 2643 a, t dbSNP:116670727
2647 2647 -, tg dbSNP:761480955
2651 2651 c, t dbSNP:550587833
2657 2657 c, t dbSNP:114353953
2658 2658 a, g dbSNP:751686069
2659 2659 c, t dbSNP:561862648
2660 2660 a, g dbSNP:541618266
2664 2664 a, g dbSNP:182142592
2675 2675 c, t dbSNP:559327953
2677 2677 -, tg dbSNP:768758380
2695 2695 -, tg dbSNP:368387485
2698 2698 a, g dbSNP:189974618
2712 2712 -, atgt dbSNP:762950394
2712 2712 -, at dbSNP:535659863
2713 2713 -, tg dbSNP:139595400
2724 2724 -, tg dbSNP:746904393
2736 2736 g, t dbSNP:3859210
2753 2753 c, t dbSNP:577242816
2767 2767 g, t dbSNP:143429562
2769 2769 a, c dbSNP:111922548
2818 2818 c, t dbSNP:574552627
2848 2848 c, t dbSNP:1013013
2860 2860 a, g dbSNP:762299762
2873 2873 c, t dbSNP:535628922
2875 2875 a, g dbSNP:753697757
2913 2913 c, t dbSNP:541417195
2984 2984 c, t dbSNP:148825489
2992 2992 c, t dbSNP:72844517
2993 2993 a, g dbSNP:184991093
3018 3018 a, g dbSNP:772797465
3020 3020 a, c dbSNP:777055662
3029 3029 c, t dbSNP:540112420
3032 3032 -, cct dbSNP:777665444
3079 3079 c, g dbSNP:769165276
3112 3112 a, g dbSNP:760694751
3135 3135 a, g dbSNP:570830006
3137 3137 g, t dbSNP:550526184
3177 3177 -, tctgggggt dbSNP:374499352
3179 3179 -, tgggggttc dbSNP:144265564
3201 3201 c, t dbSNP:8067775
3250 3250 a, g dbSNP:138923906
3254 3254 a, c, g dbSNP:769169741
3278 3278 a, g dbSNP:554481437
3366 3366 c, g dbSNP:74943260
3370 3370 a, g dbSNP:559481575
3380 3380 c, t dbSNP:368769683
3411 3411 c, t dbSNP:545706385
3412 3412 a, g dbSNP:749721429
3445 3445 c, g dbSNP:1568448
3477 3477 a, g dbSNP:770108840
3533 3533 a, g dbSNP:746234262
3535 3535 a, g dbSNP:113905467

Target ORF information:

RefSeq Version XM_011524296
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens Usher syndrome 1G (autosomal recessive) (USH1G), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu23504
Accession Version NM_001282489.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1077bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product Usher syndrome type-1G protein isoform 2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC403891.1, AK296899.1, BC101096.2 and AC087651.19. On Mar 25, 2014 this sequence version replaced gi:542133067. Summary: This gene encodes a protein that contains three ankyrin domains, a class I PDZ-binding motif and a sterile alpha motif. The encoded protein interacts with harmonin, which is associated with Usher syndrome type 1C. This protein plays a role in the development and maintenance of the auditory and visual systems and functions in the cohesion of hair bundles formed by inner ear sensory cells. Mutations in this gene are associated with Usher syndrome type 1G (USH1G). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]. Transcript Variant: This variant (2) differs in its 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK296899.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA2148093 [ECO:0000350] ##Evidence-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)345..347(+)
Misc Feature(2)1299..1496(+)
Misc Feature(3)1299..1487(+)
Misc Feature(4)1320..1481(+)
Exon (1)1..354
Gene Synonym:
Exon (2)355..1519
Gene Synonym:
Exon (3)1520..3512
Gene Synonym:
Position Chain Variation Link
12 12 a, t dbSNP:539341563
18 18 c, g dbSNP:570755897
85 85 g, t dbSNP:376115101
131 131 c, t dbSNP:556659213
132 132 c, t dbSNP:111793996
139 139 c, t dbSNP:750831317
140 140 a, g dbSNP:568129917
146 146 a, g, t dbSNP:761982338
148 148 c, g dbSNP:776932722
154 154 c, t dbSNP:764021483
156 156 c, g, t dbSNP:373695566
158 158 a, t dbSNP:774152822
161 161 c, t dbSNP:771050233
166 166 g, t dbSNP:749070648
170 170 a, g dbSNP:773185143
175 175 a, g dbSNP:529463515
178 178 a, c, t dbSNP:567068805
183 183 c, t dbSNP:769903865
184 184 a, g dbSNP:746585611
188 188 g, t dbSNP:780511790
189 189 c, t dbSNP:758940726
190 190 c, t dbSNP:727504576
196 196 c, t dbSNP:750959973
212 212 c, g dbSNP:779198694
233 233 c, g dbSNP:757653096
255 255 a, g dbSNP:147705262
273 273 c, g, t dbSNP:145448362
274 274 -, c dbSNP:751695203
274 274 c, t dbSNP:397517929
284 284 a, g dbSNP:752872097
286 286 c, t dbSNP:766391386
303 303 a, g dbSNP:104894652
320 320 a, c dbSNP:762948482
326 326 a, c, g dbSNP:201967671
333 333 c, t dbSNP:104894651
335 335 c, t dbSNP:769657993
343 343 c, t dbSNP:777746284
353 353 a, g dbSNP:397517926
366 366 c, t dbSNP:549973959
368 368 c, g dbSNP:200345990
385 385 a, t dbSNP:760325139
386 386 a, c dbSNP:775135769
388 388 c, t dbSNP:397517927
395 395 a, c dbSNP:148496763
398 398 c, t dbSNP:144686462
399 399 a, g dbSNP:368407264
401 401 a, g dbSNP:745450960
403 403 a, c dbSNP:774827536
417 417 c, t dbSNP:771517713
418 418 c, t dbSNP:749586302
429 429 g, t dbSNP:778163212
432 432 c, t dbSNP:756461951
436 436 c, t dbSNP:748325007
437 437 a, g dbSNP:374260443
447 447 a, g dbSNP:149529031
449 449 a, g dbSNP:751735275
456 456 a, g dbSNP:765050197
457 457 c, t dbSNP:757174476
468 468 a, g dbSNP:753740036
477 477 a, g dbSNP:763891710
480 480 c, t dbSNP:760465755
481 481 a, g dbSNP:775117744
497 497 c, t dbSNP:561119699
516 516 c, t dbSNP:759026779
522 522 c, t dbSNP:375077331
525 525 a, g dbSNP:111033465
526 526 a, c dbSNP:140951373
530 530 -, g dbSNP:587776546
532 532 c, t dbSNP:773610870
542 542 c, g dbSNP:370887019
546 546 a, g dbSNP:770131812
548 548 c, t dbSNP:748592728
555 555 a, t dbSNP:781540158
556 556 c, t dbSNP:755288377
558 558 c, g dbSNP:747261903
561 561 a, c, g dbSNP:111033466
570 570 a, c, g, t dbSNP:200082225
571 571 a, g dbSNP:202005955
573 573 c, g dbSNP:141791769
593 593 -, g dbSNP:773698651
596 596 a, g dbSNP:201822644
600 600 c, t dbSNP:759149374
605 605 a, g dbSNP:751196707
611 611 c, t dbSNP:765860407
615 615 c, g, t dbSNP:376527217
616 616 c, g dbSNP:770249797
617 617 c, t dbSNP:138590256
624 624 a, c, t dbSNP:769161031
626 626 g, t dbSNP:747169902
628 628 c, g dbSNP:144633924
634 634 g, t dbSNP:772186029
637 637 a, g dbSNP:745992000
638 638 -, c dbSNP:34854210
638 638 c, g dbSNP:141688757
640 640 a, g dbSNP:756087370
645 645 a, g dbSNP:574697331
646 646 c, g dbSNP:780916600
647 647 c, g dbSNP:374630813
648 648 g, t dbSNP:201866631
651 651 a, c, g, t dbSNP:199941325
652 652 a, g dbSNP:764428038
655 655 c, g dbSNP:764867252
657 657 g, t dbSNP:200786476
668 668 c, g dbSNP:147972772
676 676 c, g dbSNP:374579438
682 682 c, g dbSNP:769073148
689 689 a, c dbSNP:761010255
692 692 c, g dbSNP:558890451
700 700 a, g, t dbSNP:201123735
703 703 a, g dbSNP:201644674
718 718 c, t dbSNP:771022122
719 719 a, g, t dbSNP:373704838
721 721 g, t dbSNP:754767231
726 726 a, c dbSNP:751372463
727 727 c, g dbSNP:779722969
730 730 a, c dbSNP:202045256
731 731 c, t dbSNP:727503713
736 736 c, t dbSNP:750109903
738 738 c, t dbSNP:143458197
744 744 c, g dbSNP:727504890
755 755 a, g dbSNP:756830882
758 758 a, c dbSNP:199714230
763 763 c, t dbSNP:573510359
764 764 a, g dbSNP:754390030
772 772 -, g dbSNP:770350814
772 772 c, g dbSNP:200197601
784 784 c, t dbSNP:774403004
786 786 a, c dbSNP:775758795
787 787 a, g dbSNP:767955984
791 791 g, t dbSNP:759630941
792 792 -, aag dbSNP:762274233
792 792 a, c dbSNP:774571563
805 805 a, g dbSNP:770933979
813 813 a, g dbSNP:530264162
814 814 a, g dbSNP:776540260
815 815 a, c dbSNP:201525855
818 818 c, t dbSNP:370027457
831 831 a, c dbSNP:779660468
840 840 a, g dbSNP:140562408
842 842 a, g dbSNP:149002004
849 849 c, t dbSNP:778772947
852 852 a, c dbSNP:147967199
853 853 -, ag dbSNP:3074305
854 854 c, g dbSNP:544952984
857 857 a, c dbSNP:775371036
858 858 g, t dbSNP:756539436
861 861 c, g dbSNP:753272581
862 862 a, g dbSNP:767718565
863 863 -, ccgc dbSNP:777222355
865 865 a, c dbSNP:759953073
867 867 c, t dbSNP:774553625
868 868 g, t dbSNP:200259553
871 871 c, t dbSNP:397517928
874 874 a, g dbSNP:763002152
876 876 c, t dbSNP:201117051
879 879 c, t dbSNP:773231689
893 893 c, t dbSNP:146752863
894 894 g, t dbSNP:746860881
896 896 c, g dbSNP:375706126
899 899 a, g dbSNP:771758203
903 903 g, t dbSNP:745713548
907 907 a, g, t dbSNP:111033521
913 913 a, g dbSNP:757008876
920 920 c, t dbSNP:748980810
932 932 a, g dbSNP:777369997
933 933 c, g dbSNP:372750895
943 943 a, g dbSNP:753080270
946 946 a, c, t dbSNP:755287596
950 950 g, t dbSNP:751974726
954 954 c, t dbSNP:377680000
955 955 a, g dbSNP:763109178
958 958 a, g dbSNP:750653373
966 966 c, t dbSNP:768235452
969 969 -, tcggacgaggacagcgtctc dbSNP:397515345
974 974 c, g dbSNP:142486910
975 975 a, g dbSNP:762017352
976 976 a, g dbSNP:775274678
977 977 a, g dbSNP:772093988
981 981 a, g dbSNP:759374488
982 982 c, g dbSNP:774246535
986 986 c, t dbSNP:770872383
995 995 c, g dbSNP:748893166
996 996 a, g dbSNP:199782834
1003 1003 c, t dbSNP:769185090
1004 1004 a, g dbSNP:747754501
1007 1007 c, t dbSNP:781533417
1011 1011 c, g dbSNP:755521947
1017 1017 c, g dbSNP:752079552
1022 1022 c, g dbSNP:573443794
1024 1024 -, agg dbSNP:769227044
1024 1024 a, c dbSNP:758764789
1044 1044 c, t dbSNP:750635796
1045 1045 a, c dbSNP:765551737
1049 1049 c, t dbSNP:761774812
1051 1051 c, g, t dbSNP:764111098
1053 1053 -, ct dbSNP:745328900
1053 1053 c, g dbSNP:759499224
1063 1063 g, t dbSNP:774444422
1066 1066 c, t dbSNP:770784474
1067 1067 c, t dbSNP:745481022
1079 1079 a, c dbSNP:200477546
1084 1084 a, t dbSNP:769538039
1085 1085 a, g dbSNP:747584261
1089 1089 a, c dbSNP:558361799
1090 1090 a, g dbSNP:537715452
1092 1092 a, g dbSNP:780717575
1095 1095 a, g dbSNP:768163520
1096 1096 -, a dbSNP:778524987
1105 1105 c, g dbSNP:147721296
1109 1109 c, t dbSNP:773660538
1112 1112 a, g dbSNP:150000497
1112 1112 -, g dbSNP:770464252
1120 1120 g, t dbSNP:137871047
1128 1128 c, t dbSNP:373170645
1131 1131 a, g dbSNP:778970061
1133 1133 a, c, g dbSNP:754029450
1149 1149 a, g dbSNP:151242039
1152 1152 a, g dbSNP:756268562
1156 1156 a, g dbSNP:751540523
1158 1158 a, g dbSNP:766484391
1159 1159 c, t dbSNP:762822503
1161 1161 c, t dbSNP:773103971
1162 1162 c, g dbSNP:764976687
1170 1170 c, t dbSNP:761467615
1176 1176 c, t dbSNP:776149260
1183 1183 c, t dbSNP:768147159
1185 1185 c, t dbSNP:746578014
1186 1186 c, g dbSNP:113503320
1191 1191 a, c dbSNP:142291012
1194 1194 a, g dbSNP:775952116
1200 1200 g, t dbSNP:772606877
1206 1206 c, t dbSNP:770166095
1213 1213 a, g dbSNP:746392682
1214 1214 c, t dbSNP:779288250
1216 1216 c, t dbSNP:369623755
1219 1219 a, c, g dbSNP:200613072
1222 1222 g, t dbSNP:148479646
1223 1223 c, t dbSNP:559001977
1224 1224 a, c dbSNP:375322161
1230 1230 a, g dbSNP:538983393
1255 1255 c, t dbSNP:762354629
1269 1269 c, g dbSNP:758319467
1273 1273 c, t dbSNP:267605044
1276 1276 a, c, g dbSNP:780964009
1278 1278 c, t dbSNP:371983289
1283 1283 c, t dbSNP:761576510
1285 1285 a, t dbSNP:776330616
1286 1286 a, c, g dbSNP:576500685
1289 1289 c, t dbSNP:569032124
1299 1299 a, g, t dbSNP:746328214
1301 1301 c, g dbSNP:774725935
1307 1307 c, t dbSNP:199724052
1311 1311 c, t dbSNP:369036189
1316 1316 g, t dbSNP:146287064
1328 1328 c, t dbSNP:141854343
1336 1336 a, g dbSNP:116872904
1339 1339 c, t dbSNP:748416580
1340 1340 a, g dbSNP:781376716
1343 1343 a, g dbSNP:755013643
1344 1344 a, g dbSNP:750367080
1352 1352 c, t dbSNP:778771485
1358 1358 c, g dbSNP:757051357
1362 1362 c, g, t dbSNP:117489945
1367 1367 a, g dbSNP:760271310
1368 1368 -, gag dbSNP:777537471
1369 1369 a, g dbSNP:752359635
1376 1376 c, g dbSNP:766986350
1377 1377 c, g, t dbSNP:774909603
1380 1380 a, c dbSNP:771392412
1387 1387 c, g dbSNP:763348976
1395 1395 c, g dbSNP:139897506
1396 1396 c, t dbSNP:374693956
1407 1407 c, g dbSNP:372360601
1409 1409 c, t dbSNP:748326974
1410 1410 g, t dbSNP:781625717
1416 1416 c, g, t dbSNP:368110384
1422 1422 a, g dbSNP:778876458
1423 1423 g, t dbSNP:757101131
1428 1428 a, g dbSNP:753794521
1434 1434 c, t dbSNP:777486419
1443 1443 c, g dbSNP:755908331
1444 1444 a, g dbSNP:752343151
1454 1454 a, c dbSNP:767134204
1455 1455 c, t dbSNP:759065977
1463 1463 c, g dbSNP:751073735
1472 1472 -, agg dbSNP:755838297
1473 1473 a, c dbSNP:765949002
1474 1474 a, g dbSNP:763508231
1476 1476 c, t dbSNP:773872479
1477 1477 a, g dbSNP:201359669
1479 1479 -, ggc dbSNP:752513148
1491 1491 c, t dbSNP:762322942
1492 1492 a, g dbSNP:776968656
1495 1495 c, t dbSNP:372580540
1498 1498 c, t dbSNP:747285177
1508 1508 a, g dbSNP:775382564
1510 1510 a, t dbSNP:397517925
1522 1522 a, g dbSNP:757954601
1525 1525 c, t dbSNP:146004909
1526 1526 a, c, g dbSNP:372068582
1530 1530 a, g dbSNP:754374776
1533 1533 c, t dbSNP:764308497
1536 1536 c, t dbSNP:368231718
1541 1541 a, c dbSNP:775570788
1561 1561 c, g dbSNP:767766308
1572 1572 c, t dbSNP:199648830
1574 1574 a, t dbSNP:756229183
1581 1581 g, t dbSNP:563126068
1586 1586 c, t dbSNP:113765180
1587 1587 a, g dbSNP:529630489
1598 1598 a, c dbSNP:569986070
1613 1613 a, c dbSNP:376850581
1617 1617 c, g dbSNP:527247025
1634 1634 a, g dbSNP:181973786
1704 1704 a, g dbSNP:540652275
1709 1709 g, t dbSNP:753894091
1724 1724 c, t dbSNP:578014773
1725 1725 a, g dbSNP:557845589
1733 1733 a, c dbSNP:372221620
1746 1746 c, t dbSNP:190522968
1833 1833 g, t dbSNP:575100426
1865 1865 c, g dbSNP:186770264
1866 1866 a, g dbSNP:555190258
1882 1882 c, t dbSNP:535347408
1885 1885 a, g dbSNP:566785681
1891 1891 c, t dbSNP:374435759
1906 1906 c, t dbSNP:552665867
1970 1970 g, t dbSNP:539434387
1979 1979 a, c dbSNP:752734293
1996 1996 c, t dbSNP:570408837
2005 2005 c, g, t dbSNP:75035213
2013 2013 c, g dbSNP:777858100
2021 2021 -, g dbSNP:34699124
2021 2021 a, g dbSNP:569461974
2076 2076 a, c dbSNP:111899313
2090 2090 c, g dbSNP:528602466
2094 2094 a, t dbSNP:111611253
2097 2097 c, g dbSNP:546646559
2101 2101 a, c dbSNP:533372588
2137 2137 a, c dbSNP:545091670
2165 2165 a, g dbSNP:532775278
2203 2203 c, g dbSNP:55744500
2299 2299 a, g dbSNP:55847044
2301 2301 a, g dbSNP:575376060
2315 2315 c, g dbSNP:561522683
2318 2318 -, g dbSNP:35184411
2333 2333 a, g dbSNP:747640918
2342 2342 c, g dbSNP:767040276
2355 2355 g, t dbSNP:146007618
2370 2370 c, t dbSNP:115905441
2374 2374 c, g dbSNP:553241289
2397 2397 c, g dbSNP:539014541
2410 2410 a, g dbSNP:779459863
2449 2449 a, g dbSNP:142437952
2463 2463 c, g dbSNP:112293979
2488 2488 g, t dbSNP:537126229
2505 2505 a, g dbSNP:568192417
2534 2534 c, t dbSNP:749663203
2541 2541 a, g dbSNP:780234900
2549 2549 -, gtgt dbSNP:760396641
2571 2571 a, g dbSNP:756392131
2573 2573 c, t dbSNP:549572410
2575 2575 c, t dbSNP:536064705
2576 2576 a, g dbSNP:113583471
2589 2589 -, gt dbSNP:374828527
2616 2616 a, g dbSNP:690566
2617 2617 c, t dbSNP:137943342
2621 2621 a, t dbSNP:116670727
2625 2625 -, tg dbSNP:761480955
2629 2629 c, t dbSNP:550587833
2635 2635 c, t dbSNP:114353953
2636 2636 a, g dbSNP:751686069
2637 2637 c, t dbSNP:561862648
2638 2638 a, g dbSNP:541618266
2642 2642 a, g dbSNP:182142592
2653 2653 c, t dbSNP:559327953
2655 2655 -, tg dbSNP:768758380
2673 2673 -, tg dbSNP:368387485
2676 2676 a, g dbSNP:189974618
2690 2690 -, atgt dbSNP:762950394
2690 2690 -, at dbSNP:535659863
2691 2691 -, tg dbSNP:139595400
2702 2702 -, tg dbSNP:746904393
2714 2714 g, t dbSNP:3859210
2731 2731 c, t dbSNP:577242816
2745 2745 g, t dbSNP:143429562
2747 2747 a, c dbSNP:111922548
2796 2796 c, t dbSNP:574552627
2826 2826 c, t dbSNP:1013013
2838 2838 a, g dbSNP:762299762
2851 2851 c, t dbSNP:535628922
2853 2853 a, g dbSNP:753697757
2891 2891 c, t dbSNP:541417195
2962 2962 c, t dbSNP:148825489
2970 2970 c, t dbSNP:72844517
2971 2971 a, g dbSNP:184991093
2996 2996 a, g dbSNP:772797465
2998 2998 a, c dbSNP:777055662
3007 3007 c, t dbSNP:540112420
3010 3010 -, cct dbSNP:777665444
3057 3057 c, g dbSNP:769165276
3090 3090 a, g dbSNP:760694751
3113 3113 a, g dbSNP:570830006
3115 3115 g, t dbSNP:550526184
3155 3155 -, tctgggggt dbSNP:374499352
3157 3157 -, tgggggttc dbSNP:144265564
3179 3179 c, t dbSNP:8067775
3228 3228 a, g dbSNP:138923906
3232 3232 a, c, g dbSNP:769169741
3256 3256 a, g dbSNP:554481437
3344 3344 c, g dbSNP:74943260
3348 3348 a, g dbSNP:559481575
3358 3358 c, t dbSNP:368769683
3389 3389 c, t dbSNP:545706385
3390 3390 a, g dbSNP:749721429
3423 3423 c, g dbSNP:1568448
3455 3455 a, g dbSNP:770108840
3511 3511 a, g dbSNP:746234262

Target ORF information:

RefSeq Version NM_001282489
Organism Homo sapiens (human)
Definition Homo sapiens Usher syndrome 1G (autosomal recessive) (USH1G), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu24077
Accession Version NM_173477.4 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1386bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product Usher syndrome type-1G protein isoform 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC403891.1, BC101096.2 and AC087651.19. On Mar 25, 2014 this sequence version replaced gi:542133066. Summary: This gene encodes a protein that contains three ankyrin domains, a class I PDZ-binding motif and a sterile alpha motif. The encoded protein interacts with harmonin, which is associated with Usher syndrome type 1C. This protein plays a role in the development and maintenance of the auditory and visual systems and functions in the cohesion of hair bundles formed by inner ear sensory cells. Mutations in this gene are associated with Usher syndrome type 1G (USH1G). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]. Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK091243.1, AK289804.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2148093 [ECO:0000348] ##Evidence-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)20..22(+)
Misc Feature(2)206..541(+)
Misc Feature(3)206..463(+)
Misc Feature(4)281..370(+)
Misc Feature(5)380..469(+)
Misc Feature(6)395..>541(+)
Misc Feature(7)479..568(+)
Misc Feature(8)1352..1549(+)
Misc Feature(9)1352..1540(+)
Misc Feature(10)1373..1534(+)
Exon (1)1..354
Gene Synonym:
Exon (2)355..1572
Gene Synonym:
Exon (3)1573..3565
Gene Synonym:
Position Chain Variation Link
12 12 a, t dbSNP:539341563
18 18 c, g dbSNP:570755897
85 85 g, t dbSNP:376115101
131 131 c, t dbSNP:556659213
132 132 c, t dbSNP:111793996
139 139 c, t dbSNP:750831317
140 140 a, g dbSNP:568129917
146 146 a, g, t dbSNP:761982338
148 148 c, g dbSNP:776932722
154 154 c, t dbSNP:764021483
156 156 c, g, t dbSNP:373695566
158 158 a, t dbSNP:774152822
161 161 c, t dbSNP:771050233
166 166 g, t dbSNP:749070648
170 170 a, g dbSNP:773185143
175 175 a, g dbSNP:529463515
178 178 a, c, t dbSNP:567068805
183 183 c, t dbSNP:769903865
184 184 a, g dbSNP:746585611
188 188 g, t dbSNP:780511790
189 189 c, t dbSNP:758940726
190 190 c, t dbSNP:727504576
196 196 c, t dbSNP:750959973
212 212 c, g dbSNP:779198694
233 233 c, g dbSNP:757653096
255 255 a, g dbSNP:147705262
273 273 c, g, t dbSNP:145448362
274 274 -, c dbSNP:751695203
274 274 c, t dbSNP:397517929
284 284 a, g dbSNP:752872097
286 286 c, t dbSNP:766391386
303 303 a, g dbSNP:104894652
320 320 a, c dbSNP:762948482
326 326 a, c, g dbSNP:201967671
333 333 c, t dbSNP:104894651
335 335 c, t dbSNP:769657993
343 343 c, t dbSNP:777746284
353 353 a, g dbSNP:397517926
357 357 g, t dbSNP:767660431
367 367 c, t dbSNP:759703993
370 370 a, c, g dbSNP:765320969
376 376 -, ca dbSNP:730880268
400 400 c, t dbSNP:761488604
419 419 c, t dbSNP:549973959
421 421 c, g dbSNP:200345990
438 438 a, t dbSNP:760325139
439 439 a, c dbSNP:775135769
441 441 c, t dbSNP:397517927
448 448 a, c dbSNP:148496763
451 451 c, t dbSNP:144686462
452 452 a, g dbSNP:368407264
454 454 a, g dbSNP:745450960
456 456 a, c dbSNP:774827536
470 470 c, t dbSNP:771517713
471 471 c, t dbSNP:749586302
482 482 g, t dbSNP:778163212
485 485 c, t dbSNP:756461951
489 489 c, t dbSNP:748325007
490 490 a, g dbSNP:374260443
500 500 a, g dbSNP:149529031
502 502 a, g dbSNP:751735275
509 509 a, g dbSNP:765050197
510 510 c, t dbSNP:757174476
521 521 a, g dbSNP:753740036
530 530 a, g dbSNP:763891710
533 533 c, t dbSNP:760465755
534 534 a, g dbSNP:775117744
550 550 c, t dbSNP:561119699
569 569 c, t dbSNP:759026779
575 575 c, t dbSNP:375077331
578 578 a, g dbSNP:111033465
579 579 a, c dbSNP:140951373
583 583 -, g dbSNP:587776546
585 585 c, t dbSNP:773610870
595 595 c, g dbSNP:370887019
599 599 a, g dbSNP:770131812
601 601 c, t dbSNP:748592728
608 608 a, t dbSNP:781540158
609 609 c, t dbSNP:755288377
611 611 c, g dbSNP:747261903
614 614 a, c, g dbSNP:111033466
623 623 a, c, g, t dbSNP:200082225
624 624 a, g dbSNP:202005955
626 626 c, g dbSNP:141791769
646 646 -, g dbSNP:773698651
649 649 a, g dbSNP:201822644
653 653 c, t dbSNP:759149374
658 658 a, g dbSNP:751196707
664 664 c, t dbSNP:765860407
668 668 c, g, t dbSNP:376527217
669 669 c, g dbSNP:770249797
670 670 c, t dbSNP:138590256
677 677 a, c, t dbSNP:769161031
679 679 g, t dbSNP:747169902
681 681 c, g dbSNP:144633924
687 687 g, t dbSNP:772186029
690 690 a, g dbSNP:745992000
691 691 -, c dbSNP:34854210
691 691 c, g dbSNP:141688757
693 693 a, g dbSNP:756087370
698 698 a, g dbSNP:574697331
699 699 c, g dbSNP:780916600
700 700 c, g dbSNP:374630813
701 701 g, t dbSNP:201866631
704 704 a, c, g, t dbSNP:199941325
705 705 a, g dbSNP:764428038
708 708 c, g dbSNP:764867252
710 710 g, t dbSNP:200786476
721 721 c, g dbSNP:147972772
729 729 c, g dbSNP:374579438
735 735 c, g dbSNP:769073148
742 742 a, c dbSNP:761010255
745 745 c, g dbSNP:558890451
753 753 a, g, t dbSNP:201123735
756 756 a, g dbSNP:201644674
771 771 c, t dbSNP:771022122
772 772 a, g, t dbSNP:373704838
774 774 g, t dbSNP:754767231
779 779 a, c dbSNP:751372463
780 780 c, g dbSNP:779722969
783 783 a, c dbSNP:202045256
784 784 c, t dbSNP:727503713
789 789 c, t dbSNP:750109903
791 791 c, t dbSNP:143458197
797 797 c, g dbSNP:727504890
808 808 a, g dbSNP:756830882
811 811 a, c dbSNP:199714230
816 816 c, t dbSNP:573510359
817 817 a, g dbSNP:754390030
825 825 -, g dbSNP:770350814
825 825 c, g dbSNP:200197601
837 837 c, t dbSNP:774403004
839 839 a, c dbSNP:775758795
840 840 a, g dbSNP:767955984
844 844 g, t dbSNP:759630941
845 845 -, aag dbSNP:762274233
845 845 a, c dbSNP:774571563
858 858 a, g dbSNP:770933979
866 866 a, g dbSNP:530264162
867 867 a, g dbSNP:776540260
868 868 a, c dbSNP:201525855
871 871 c, t dbSNP:370027457
884 884 a, c dbSNP:779660468
893 893 a, g dbSNP:140562408
895 895 a, g dbSNP:149002004
902 902 c, t dbSNP:778772947
905 905 a, c dbSNP:147967199
906 906 -, ag dbSNP:3074305
907 907 c, g dbSNP:544952984
910 910 a, c dbSNP:775371036
911 911 g, t dbSNP:756539436
914 914 c, g dbSNP:753272581
915 915 a, g dbSNP:767718565
916 916 -, ccgc dbSNP:777222355
918 918 a, c dbSNP:759953073
920 920 c, t dbSNP:774553625
921 921 g, t dbSNP:200259553
924 924 c, t dbSNP:397517928
927 927 a, g dbSNP:763002152
929 929 c, t dbSNP:201117051
932 932 c, t dbSNP:773231689
946 946 c, t dbSNP:146752863
947 947 g, t dbSNP:746860881
949 949 c, g dbSNP:375706126
952 952 a, g dbSNP:771758203
956 956 g, t dbSNP:745713548
960 960 a, g, t dbSNP:111033521
966 966 a, g dbSNP:757008876
973 973 c, t dbSNP:748980810
985 985 a, g dbSNP:777369997
986 986 c, g dbSNP:372750895
996 996 a, g dbSNP:753080270
999 999 a, c, t dbSNP:755287596
1003 1003 g, t dbSNP:751974726
1007 1007 c, t dbSNP:377680000
1008 1008 a, g dbSNP:763109178
1011 1011 a, g dbSNP:750653373
1019 1019 c, t dbSNP:768235452
1022 1022 -, tcggacgaggacagcgtctc dbSNP:397515345
1027 1027 c, g dbSNP:142486910
1028 1028 a, g dbSNP:762017352
1029 1029 a, g dbSNP:775274678
1030 1030 a, g dbSNP:772093988
1034 1034 a, g dbSNP:759374488
1035 1035 c, g dbSNP:774246535
1039 1039 c, t dbSNP:770872383
1048 1048 c, g dbSNP:748893166
1049 1049 a, g dbSNP:199782834
1056 1056 c, t dbSNP:769185090
1057 1057 a, g dbSNP:747754501
1060 1060 c, t dbSNP:781533417
1064 1064 c, g dbSNP:755521947
1070 1070 c, g dbSNP:752079552
1075 1075 c, g dbSNP:573443794
1077 1077 -, agg dbSNP:769227044
1077 1077 a, c dbSNP:758764789
1097 1097 c, t dbSNP:750635796
1098 1098 a, c dbSNP:765551737
1102 1102 c, t dbSNP:761774812
1104 1104 c, g, t dbSNP:764111098
1106 1106 -, ct dbSNP:745328900
1106 1106 c, g dbSNP:759499224
1116 1116 g, t dbSNP:774444422
1119 1119 c, t dbSNP:770784474
1120 1120 c, t dbSNP:745481022
1132 1132 a, c dbSNP:200477546
1137 1137 a, t dbSNP:769538039
1138 1138 a, g dbSNP:747584261
1142 1142 a, c dbSNP:558361799
1143 1143 a, g dbSNP:537715452
1145 1145 a, g dbSNP:780717575
1148 1148 a, g dbSNP:768163520
1149 1149 -, a dbSNP:778524987
1158 1158 c, g dbSNP:147721296
1162 1162 c, t dbSNP:773660538
1165 1165 a, g dbSNP:150000497
1165 1165 -, g dbSNP:770464252
1173 1173 g, t dbSNP:137871047
1181 1181 c, t dbSNP:373170645
1184 1184 a, g dbSNP:778970061
1186 1186 a, c, g dbSNP:754029450
1202 1202 a, g dbSNP:151242039
1205 1205 a, g dbSNP:756268562
1209 1209 a, g dbSNP:751540523
1211 1211 a, g dbSNP:766484391
1212 1212 c, t dbSNP:762822503
1214 1214 c, t dbSNP:773103971
1215 1215 c, g dbSNP:764976687
1223 1223 c, t dbSNP:761467615
1229 1229 c, t dbSNP:776149260
1236 1236 c, t dbSNP:768147159
1238 1238 c, t dbSNP:746578014
1239 1239 c, g dbSNP:113503320
1244 1244 a, c dbSNP:142291012
1247 1247 a, g dbSNP:775952116
1253 1253 g, t dbSNP:772606877
1259 1259 c, t dbSNP:770166095
1266 1266 a, g dbSNP:746392682
1267 1267 c, t dbSNP:779288250
1269 1269 c, t dbSNP:369623755
1272 1272 a, c, g dbSNP:200613072
1275 1275 g, t dbSNP:148479646
1276 1276 c, t dbSNP:559001977
1277 1277 a, c dbSNP:375322161
1283 1283 a, g dbSNP:538983393
1308 1308 c, t dbSNP:762354629
1322 1322 c, g dbSNP:758319467
1326 1326 c, t dbSNP:267605044
1329 1329 a, c, g dbSNP:780964009
1331 1331 c, t dbSNP:371983289
1336 1336 c, t dbSNP:761576510
1338 1338 a, t dbSNP:776330616
1339 1339 a, c, g dbSNP:576500685
1342 1342 c, t dbSNP:569032124
1352 1352 a, g, t dbSNP:746328214
1354 1354 c, g dbSNP:774725935
1360 1360 c, t dbSNP:199724052
1364 1364 c, t dbSNP:369036189
1369 1369 g, t dbSNP:146287064
1381 1381 c, t dbSNP:141854343
1389 1389 a, g dbSNP:116872904
1392 1392 c, t dbSNP:748416580
1393 1393 a, g dbSNP:781376716
1396 1396 a, g dbSNP:755013643
1397 1397 a, g dbSNP:750367080
1405 1405 c, t dbSNP:778771485
1411 1411 c, g dbSNP:757051357
1415 1415 c, g, t dbSNP:117489945
1420 1420 a, g dbSNP:760271310
1421 1421 -, gag dbSNP:777537471
1422 1422 a, g dbSNP:752359635
1429 1429 c, g dbSNP:766986350
1430 1430 c, g, t dbSNP:774909603
1433 1433 a, c dbSNP:771392412
1440 1440 c, g dbSNP:763348976
1448 1448 c, g dbSNP:139897506
1449 1449 c, t dbSNP:374693956
1460 1460 c, g dbSNP:372360601
1462 1462 c, t dbSNP:748326974
1463 1463 g, t dbSNP:781625717
1469 1469 c, g, t dbSNP:368110384
1475 1475 a, g dbSNP:778876458
1476 1476 g, t dbSNP:757101131
1481 1481 a, g dbSNP:753794521
1487 1487 c, t dbSNP:777486419
1496 1496 c, g dbSNP:755908331
1497 1497 a, g dbSNP:752343151
1507 1507 a, c dbSNP:767134204
1508 1508 c, t dbSNP:759065977
1516 1516 c, g dbSNP:751073735
1525 1525 -, agg dbSNP:755838297
1526 1526 a, c dbSNP:765949002
1527 1527 a, g dbSNP:763508231
1529 1529 c, t dbSNP:773872479
1530 1530 a, g dbSNP:201359669
1532 1532 -, ggc dbSNP:752513148
1544 1544 c, t dbSNP:762322942
1545 1545 a, g dbSNP:776968656
1548 1548 c, t dbSNP:372580540
1551 1551 c, t dbSNP:747285177
1561 1561 a, g dbSNP:775382564
1563 1563 a, t dbSNP:397517925
1575 1575 a, g dbSNP:757954601
1578 1578 c, t dbSNP:146004909
1579 1579 a, c, g dbSNP:372068582
1583 1583 a, g dbSNP:754374776
1586 1586 c, t dbSNP:764308497
1589 1589 c, t dbSNP:368231718
1594 1594 a, c dbSNP:775570788
1614 1614 c, g dbSNP:767766308
1625 1625 c, t dbSNP:199648830
1627 1627 a, t dbSNP:756229183
1634 1634 g, t dbSNP:563126068
1639 1639 c, t dbSNP:113765180
1640 1640 a, g dbSNP:529630489
1651 1651 a, c dbSNP:569986070
1666 1666 a, c dbSNP:376850581
1670 1670 c, g dbSNP:527247025
1687 1687 a, g dbSNP:181973786
1757 1757 a, g dbSNP:540652275
1762 1762 g, t dbSNP:753894091
1777 1777 c, t dbSNP:578014773
1778 1778 a, g dbSNP:557845589
1786 1786 a, c dbSNP:372221620
1799 1799 c, t dbSNP:190522968
1886 1886 g, t dbSNP:575100426
1918 1918 c, g dbSNP:186770264
1919 1919 a, g dbSNP:555190258
1935 1935 c, t dbSNP:535347408
1938 1938 a, g dbSNP:566785681
1944 1944 c, t dbSNP:374435759
1959 1959 c, t dbSNP:552665867
2023 2023 g, t dbSNP:539434387
2032 2032 a, c dbSNP:752734293
2049 2049 c, t dbSNP:570408837
2058 2058 c, g, t dbSNP:75035213
2066 2066 c, g dbSNP:777858100
2074 2074 -, g dbSNP:34699124
2074 2074 a, g dbSNP:569461974
2129 2129 a, c dbSNP:111899313
2143 2143 c, g dbSNP:528602466
2147 2147 a, t dbSNP:111611253
2150 2150 c, g dbSNP:546646559
2154 2154 a, c dbSNP:533372588
2190 2190 a, c dbSNP:545091670
2218 2218 a, g dbSNP:532775278
2256 2256 c, g dbSNP:55744500
2352 2352 a, g dbSNP:55847044
2354 2354 a, g dbSNP:575376060
2368 2368 c, g dbSNP:561522683
2371 2371 -, g dbSNP:35184411
2386 2386 a, g dbSNP:747640918
2395 2395 c, g dbSNP:767040276
2408 2408 g, t dbSNP:146007618
2423 2423 c, t dbSNP:115905441
2427 2427 c, g dbSNP:553241289
2450 2450 c, g dbSNP:539014541
2463 2463 a, g dbSNP:779459863
2502 2502 a, g dbSNP:142437952
2516 2516 c, g dbSNP:112293979
2541 2541 g, t dbSNP:537126229
2558 2558 a, g dbSNP:568192417
2587 2587 c, t dbSNP:749663203
2594 2594 a, g dbSNP:780234900
2602 2602 -, gtgt dbSNP:760396641
2624 2624 a, g dbSNP:756392131
2626 2626 c, t dbSNP:549572410
2628 2628 c, t dbSNP:536064705
2629 2629 a, g dbSNP:113583471
2642 2642 -, gt dbSNP:374828527
2669 2669 a, g dbSNP:690566
2670 2670 c, t dbSNP:137943342
2674 2674 a, t dbSNP:116670727
2678 2678 -, tg dbSNP:761480955
2682 2682 c, t dbSNP:550587833
2688 2688 c, t dbSNP:114353953
2689 2689 a, g dbSNP:751686069
2690 2690 c, t dbSNP:561862648
2691 2691 a, g dbSNP:541618266
2695 2695 a, g dbSNP:182142592
2706 2706 c, t dbSNP:559327953
2708 2708 -, tg dbSNP:768758380
2726 2726 -, tg dbSNP:368387485
2729 2729 a, g dbSNP:189974618
2743 2743 -, atgt dbSNP:762950394
2743 2743 -, at dbSNP:535659863
2744 2744 -, tg dbSNP:139595400
2755 2755 -, tg dbSNP:746904393
2767 2767 g, t dbSNP:3859210
2784 2784 c, t dbSNP:577242816
2798 2798 g, t dbSNP:143429562
2800 2800 a, c dbSNP:111922548
2849 2849 c, t dbSNP:574552627
2879 2879 c, t dbSNP:1013013
2891 2891 a, g dbSNP:762299762
2904 2904 c, t dbSNP:535628922
2906 2906 a, g dbSNP:753697757
2944 2944 c, t dbSNP:541417195
3015 3015 c, t dbSNP:148825489
3023 3023 c, t dbSNP:72844517
3024 3024 a, g dbSNP:184991093
3049 3049 a, g dbSNP:772797465
3051 3051 a, c dbSNP:777055662
3060 3060 c, t dbSNP:540112420
3063 3063 -, cct dbSNP:777665444
3110 3110 c, g dbSNP:769165276
3143 3143 a, g dbSNP:760694751
3166 3166 a, g dbSNP:570830006
3168 3168 g, t dbSNP:550526184
3208 3208 -, tctgggggt dbSNP:374499352
3210 3210 -, tgggggttc dbSNP:144265564
3232 3232 c, t dbSNP:8067775
3281 3281 a, g dbSNP:138923906
3285 3285 a, c, g dbSNP:769169741
3309 3309 a, g dbSNP:554481437
3397 3397 c, g dbSNP:74943260
3401 3401 a, g dbSNP:559481575
3411 3411 c, t dbSNP:368769683
3442 3442 c, t dbSNP:545706385
3443 3443 a, g dbSNP:749721429
3476 3476 c, g dbSNP:1568448
3508 3508 a, g dbSNP:770108840
3564 3564 a, g dbSNP:746234262

Target ORF information:

RefSeq Version NM_173477
Organism Homo sapiens (human)
Definition Homo sapiens Usher syndrome 1G (autosomal recessive) (USH1G), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
