
CYP4F22 cDNA ORF clone, Homo sapiens (human)

Gene Symbol CYP4F22
Entrez Gene ID 126410
Full Name cytochrome P450, family 4, subfamily F, polypeptide 22
Synonyms ARCI5, INLNE, LI3
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19 and encodes an enzyme thought to play a role in the 12(R)-lipoxygenase pathway. Mutations in this gene are the cause of ichthyosis lamellar type 3. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Ichthyosis, lamellar, 3, 604777 (3)

mRNA and Protein(s)

mRNA Protein Name
XM_011527692 XP_011525994 cytochrome P450 4F22 isoform X1
XM_011527693 XP_011525995 cytochrome P450 4F22 isoform X1
NM_173483 NP_775754 cytochrome P450 4F22

R-HSA-1430728 Metabolism
R-HSA-556833 Metabolism of lipids and lipoproteins
R-HSA-2142753 Arachidonic acid metabolism
R-HSA-211935 Fatty acids
R-HSA-2142691 Synthesis of Leukotrienes (LT) and Eoxins (EX)
R-HSA-211958 Miscellaneous substrates
R-HSA-211897 Cytochrome P450 - arranged by substrate type
R-HSA-211979 Eicosanoids
R-HSA-211945 Phase 1 - Functionalization of compounds
R-HSA-211859 Biological oxidations
WP43 cytochrome P450
WP702 metapathway biotransformation

Homo sapiens (human) CYP4F22 NP_775754.2
Pan troglodytes (chimpanzee) LOC455798 XP_512456.2
Macaca mulatta (Rhesus monkey) CYP4F22 XP_001111971.1
Canis lupus familiaris (dog) CYP4F22 XP_541984.2
Bos taurus (cattle) LOC100301224 XP_005208627.1
Mus musculus (house mouse) Cyp4f39 NP_796281.1
Rattus norvegicus (Norway rat) Cyp4f39 XP_006241154.1
Arabidopsis thaliana (thale cress) CYP735A2 NP_176882.1
Arabidopsis thaliana (thale cress) CYP735A1 NP_198661.1
Xenopus (Silurana) tropicalis (western clawed frog) cyp4f22 NP_001015810.1
Xenopus (Silurana) tropicalis (western clawed frog) LOC548774 NP_001016020.1


ID Name Evidence
GO:0005783 endoplasmic reticulum IEA
GO:0005789 endoplasmic reticulum membrane IEA
GO:0005792 microsome IEA
GO:0016020 membrane IEA


ID Name Evidence
GO:0004497 monooxygenase activity IEA
GO:0009055 electron carrier activity IEA
GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen IEA
GO:0020037 heme binding IEA
GO:0046872 metal ion binding IEA

The following CYP4F22 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the CYP4F22 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
XM_011527692 PREDICTED: Homo sapiens cytochrome P450, family 4, subfamily F, polypeptide 22 (CYP4F22), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Starting from $219.50
XM_011527693 PREDICTED: Homo sapiens cytochrome P450, family 4, subfamily F, polypeptide 22 (CYP4F22), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Starting from $219.50
NM_173483 Homo sapiens cytochrome P450, family 4, subfamily F, polypeptide 22 (CYP4F22), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Starting from $219.50

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu18711
Accession Version XM_011527692.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1596bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product cytochrome P450 4F22 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011295.12) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)590..1984(+)
Position Chain Variation Link
18 18 a, g dbSNP:62115951
22 22 a, g dbSNP:577230967
23 23 c, g dbSNP:539580866
93 93 -, c dbSNP:34600208
104 104 c, t dbSNP:559444174
134 134 g, t dbSNP:73512618
220 220 c, t dbSNP:145200171
229 229 c, t dbSNP:561895946
230 230 a, g dbSNP:147610926
276 276 c, t dbSNP:73929921
289 289 -, tctggcggt dbSNP:200274654
294 294 a, c, t dbSNP:113925510
340 340 a, g dbSNP:756588174
384 384 a, g dbSNP:780571256
413 413 a, g dbSNP:147170028
416 416 c, t dbSNP:778260380
425 425 a, g dbSNP:747319915
426 426 c, t dbSNP:374502872
429 429 a, g dbSNP:779679449
430 430 c, t dbSNP:183145766
431 431 c, t dbSNP:570906384
432 432 a, g dbSNP:202066269
446 446 c, t dbSNP:199675676
448 448 c, g dbSNP:771977494
462 462 c, t dbSNP:773295754
463 463 a, g, t dbSNP:147808045
465 465 c, t dbSNP:149247930
466 466 a, g dbSNP:759848884
470 470 -, g dbSNP:531800013
470 470 c, t dbSNP:765395884
471 471 a, g, t dbSNP:752778252
478 478 c, t dbSNP:144465443
479 479 a, g dbSNP:752130618
480 480 c, t dbSNP:148402706
481 481 a, g dbSNP:372291886
494 494 -, ctc dbSNP:774046189
501 501 c, t dbSNP:750775216
507 507 -, tct dbSNP:761304848
508 508 a, c dbSNP:754619522
509 509 c, t dbSNP:778434392
511 511 c, g dbSNP:375092463
512 512 c, t dbSNP:767055256
521 521 a, c, t dbSNP:200883622
522 522 a, g, t dbSNP:746979996
532 532 a, g dbSNP:776514995
533 533 c, t dbSNP:754377557
534 534 a, g dbSNP:142720535
536 536 c, t dbSNP:770004839
544 544 a, g dbSNP:775636292
552 552 a, g dbSNP:371459332
561 561 a, t dbSNP:372984405
566 566 a, c dbSNP:752040877
572 572 c, t dbSNP:146026019
573 573 a, g dbSNP:139927884
575 575 c, t dbSNP:750733757
576 576 a, g dbSNP:756447723
580 580 a, g dbSNP:778614738
581 581 c, t dbSNP:369559047
582 582 a, g dbSNP:143346937
585 585 g, t dbSNP:201919272
589 589 c, g, t dbSNP:118091316
590 590 c, t dbSNP:770947816
592 592 c, g dbSNP:780992939
602 602 c, t dbSNP:745666110
603 603 a, g dbSNP:371945146
604 604 g, t dbSNP:752301632
605 605 c, t dbSNP:775752466
606 606 a, g dbSNP:140968002
611 611 g, t dbSNP:539182601
615 615 c, t dbSNP:774374262
641 641 c, t dbSNP:755919126
650 650 a, g dbSNP:192866147
651 651 a, c, t dbSNP:116743462
652 652 a, g dbSNP:145733350
654 654 g, t dbSNP:369811073
655 655 c, t dbSNP:374513909
656 656 c, t dbSNP:750057163
665 665 c, g dbSNP:773736322
683 683 a, c dbSNP:377611165
685 685 c, t dbSNP:766929198
687 687 c, g, t dbSNP:374714583
696 696 c, t dbSNP:148922687
697 697 a, g dbSNP:143835816
698 698 c, t dbSNP:751327927
710 710 a, t dbSNP:756800456
719 719 a, g dbSNP:766987265
726 726 c, t dbSNP:749972738
727 727 a, g dbSNP:145640942
730 730 a, g dbSNP:376599468
734 734 a, g dbSNP:749026805
762 762 c, t dbSNP:201148124
770 770 a, g dbSNP:779100501
775 775 a, c dbSNP:748409630
782 782 a, g, t dbSNP:781757068
783 783 c, t dbSNP:770450984
786 786 c, t dbSNP:775957739
787 787 c, t dbSNP:762003020
788 788 a, g dbSNP:146689227
789 789 a, c dbSNP:772977381
791 791 c, t dbSNP:147818390
793 793 c, t dbSNP:765911617
794 794 a, g dbSNP:753753497
799 799 c, t dbSNP:150739429
808 808 c, g dbSNP:376061100
810 810 a, g dbSNP:752418864
811 811 c, t dbSNP:758223584
817 817 c, t dbSNP:777842481
836 836 a, g dbSNP:137942239
846 846 c, t dbSNP:377542346
858 858 c, g, t dbSNP:751335732
859 859 c, t dbSNP:114980833
860 860 a, g dbSNP:750472966
861 861 a, g dbSNP:756321971
862 862 c, g dbSNP:780704118
865 865 a, g dbSNP:749840377
870 870 a, g dbSNP:146036982
872 872 c, t dbSNP:755273482
873 873 a, g dbSNP:779288178
875 875 c, t dbSNP:141382984
878 878 c, t dbSNP:770500550
879 879 a, g dbSNP:776275777
881 881 c, t dbSNP:761196649
882 882 a, g dbSNP:199641250
885 885 g, t dbSNP:775270460
889 889 c, g dbSNP:368813073
895 895 c, t dbSNP:374464817
896 896 a, g dbSNP:569166154
897 897 c, g dbSNP:187004457
904 904 c, t dbSNP:141755148
905 905 g, t dbSNP:750743002
912 912 a, t dbSNP:373223970
913 913 a, c dbSNP:766528561
920 920 a, c dbSNP:753883685
933 933 a, t dbSNP:755471652
944 944 a, t dbSNP:16980531
946 946 c, t dbSNP:377373101
947 947 a, g dbSNP:758816247
948 948 c, t dbSNP:780816103
951 951 a, g dbSNP:148454445
955 955 c, g, t dbSNP:571757470
966 966 a, c dbSNP:751954643
971 971 c, t dbSNP:142364533
972 972 a, g dbSNP:368781436
979 979 a, g dbSNP:748818073
981 981 c, t dbSNP:577229558
990 990 c, t dbSNP:539896338
993 993 c, t dbSNP:151269464
994 994 a, g dbSNP:11666601
997 997 a, c dbSNP:772155840
999 999 c, g dbSNP:79603814
1007 1007 a, g dbSNP:760550354
1008 1008 c, t dbSNP:771126991
1014 1014 a, g dbSNP:776771681
1015 1015 a, g dbSNP:759653194
1017 1017 a, g dbSNP:201717667
1036 1036 a, g dbSNP:753177417
1047 1047 a, c, t dbSNP:562637818
1064 1064 c, t dbSNP:147748244
1066 1066 a, c dbSNP:78418003
1069 1069 c, g dbSNP:374190832
1071 1071 a, c, g dbSNP:371097842
1076 1076 c, t dbSNP:531670218
1076 1076 -, t dbSNP:778308984
1079 1079 c, t dbSNP:199892192
1084 1084 a, g dbSNP:752196556
1086 1086 a, g dbSNP:758040339
1090 1090 g, t dbSNP:367667200
1095 1095 a, g dbSNP:777845525
1097 1097 g, t dbSNP:746956755
1103 1103 c, t dbSNP:757051294
1105 1105 c, t dbSNP:149616338
1106 1106 a, g, t dbSNP:745682521
1110 1110 g, t dbSNP:775751524
1120 1120 c, g dbSNP:374931901
1122 1122 a, g dbSNP:267605318
1123 1123 c, t dbSNP:146904240
1124 1124 a, g dbSNP:572278771
1126 1126 -, tctg dbSNP:751937099
1133 1133 c, g dbSNP:371788862
1136 1136 c, t dbSNP:376675683
1137 1137 a, g dbSNP:200712099
1139 1139 c, t dbSNP:768098854
1140 1140 a, g dbSNP:118203937
1143 1143 a, g dbSNP:761113998
1144 1144 g, t dbSNP:764969665
1146 1146 a, g dbSNP:145830520
1148 1148 c, t dbSNP:148977089
1149 1149 a, g dbSNP:184021211
1165 1165 c, t dbSNP:143506697
1166 1166 a, g dbSNP:757078629
1179 1179 a, g dbSNP:781206441
1180 1180 a, c dbSNP:750175536
1181 1181 c, t dbSNP:369811543
1182 1182 a, g, t dbSNP:200005567
1185 1185 c, t dbSNP:768889620
1188 1188 c, g dbSNP:188702643
1189 1189 a, g dbSNP:113609641
1195 1195 a, g dbSNP:559473877
1196 1196 c, t dbSNP:773826320
1197 1197 a, g dbSNP:141631745
1200 1200 a, g dbSNP:771458701
1205 1205 c, t dbSNP:144569785
1206 1206 a, g dbSNP:767066474
1212 1212 c, g dbSNP:763867966
1242 1242 a, c dbSNP:750977499
1247 1247 a, c dbSNP:761445302
1248 1248 -, t dbSNP:757885232
1249 1249 c, t dbSNP:138523164
1256 1256 c, t dbSNP:767352854
1258 1258 a, g dbSNP:200761933
1259 1259 c, t dbSNP:755885838
1260 1260 a, g dbSNP:141902603
1262 1262 c, t dbSNP:199782025
1263 1263 a, g dbSNP:755129541
1266 1266 c, t dbSNP:201426377
1268 1268 c, g dbSNP:772654580
1271 1271 c, t dbSNP:779206543
1272 1272 a, c, g dbSNP:146265982
1274 1274 a, c dbSNP:549559441
1279 1279 a, g dbSNP:58142709
1285 1285 c, t dbSNP:747568295
1286 1286 a, g dbSNP:139163760
1288 1288 a, g dbSNP:777093774
1296 1296 c, t dbSNP:759994562
1298 1298 a, g dbSNP:768181440
1307 1307 c, g dbSNP:375434045
1311 1311 a, g dbSNP:761198340
1312 1312 a, g dbSNP:767108907
1316 1316 a, g dbSNP:749926972
1317 1317 a, c dbSNP:760569680
1327 1327 c, t dbSNP:766310614
1329 1329 c, t dbSNP:370734976
1330 1330 c, t dbSNP:753570515
1336 1336 a, g dbSNP:754822219
1339 1339 a, g dbSNP:765369229
1340 1340 c, t dbSNP:752999090
1350 1350 a, g dbSNP:758385025
1353 1353 a, g dbSNP:770465694
1358 1358 a, g dbSNP:776523823
1372 1372 c, g dbSNP:746794843
1378 1378 a, c, t dbSNP:368699374
1383 1383 a, g dbSNP:775288087
1388 1388 c, t dbSNP:762667660
1389 1389 a, g dbSNP:764409492
1393 1393 c, t dbSNP:377660316
1394 1394 a, g dbSNP:761963345
1401 1401 a, t dbSNP:200174659
1402 1402 c, t dbSNP:149500476
1409 1409 a, g dbSNP:756581830
1412 1412 -, t dbSNP:745852323
1423 1423 c, g, t dbSNP:762779449
1424 1424 a, g dbSNP:774309866
1427 1427 a, g, t dbSNP:762090356
1444 1444 c, t dbSNP:201956948
1476 1476 c, g dbSNP:760727576
1477 1477 a, g dbSNP:371911971
1479 1479 a, g dbSNP:374530747
1481 1481 c, t dbSNP:144743413
1488 1488 a, c, g dbSNP:779195003
1489 1489 a, g dbSNP:756835947
1495 1495 c, t dbSNP:780834713
1496 1496 c, t dbSNP:745368359
1497 1497 a, g dbSNP:769229606
1513 1513 a, g dbSNP:780021415
1518 1518 c, t dbSNP:368738530
1526 1526 c, t dbSNP:201129618
1527 1527 a, g dbSNP:207477012
1530 1530 a, c dbSNP:768745902
1552 1552 c, t dbSNP:148521416
1553 1553 a, g dbSNP:189645644
1560 1560 c, t dbSNP:768795742
1562 1562 c, t dbSNP:751985553
1567 1567 g, t dbSNP:568960604
1582 1582 a, g dbSNP:766072305
1594 1594 a, g dbSNP:753389765
1596 1596 a, g dbSNP:754604524
1598 1598 a, c dbSNP:145440178
1600 1600 a, g dbSNP:748142782
1601 1601 a, c, t dbSNP:572771583
1602 1602 a, g, t dbSNP:748463754
1611 1611 c, t dbSNP:376273710
1612 1612 a, g dbSNP:771000092
1620 1620 -, ct dbSNP:763109569
1620 1620 c, t dbSNP:776967520
1629 1629 c, t dbSNP:147680222
1631 1631 c, t dbSNP:745942843
1636 1636 a, g dbSNP:541873962
1640 1640 a, g dbSNP:775571688
1641 1641 c, t dbSNP:763409773
1642 1642 a, g dbSNP:769211003
1647 1647 a, g dbSNP:774525657
1654 1654 g, t dbSNP:762300969
1659 1659 c, t dbSNP:765946425
1663 1663 c, t dbSNP:753588073
1666 1666 -, gc dbSNP:764474903
1667 1667 c, t dbSNP:561480298
1668 1668 a, g dbSNP:368958384
1688 1688 a, g dbSNP:769033721
1715 1715 c, t dbSNP:118203935
1718 1718 c, g dbSNP:118203936
1725 1725 c, t dbSNP:762055044
1728 1728 c, t dbSNP:200732696
1729 1729 a, g dbSNP:773731320
1734 1734 a, g dbSNP:377609523
1736 1736 c, t dbSNP:759221556
1743 1743 c, g dbSNP:764981944
1746 1746 a, g dbSNP:752192760
1747 1747 a, g dbSNP:571776726
1751 1751 c, t dbSNP:762338873
1753 1753 c, t dbSNP:763708775
1755 1755 a, g dbSNP:368320642
1762 1762 c, t dbSNP:761743684
1763 1763 a, c, t dbSNP:200581968
1764 1764 a, g dbSNP:144961059
1770 1770 a, t dbSNP:766560113
1779 1779 a, g dbSNP:151317392
1783 1783 a, g dbSNP:755181302
1785 1785 a, g dbSNP:779007203
1790 1790 a, c dbSNP:748177003
1791 1791 c, g dbSNP:758915198
1792 1792 c, t dbSNP:778478483
1794 1794 c, t dbSNP:747372231
1798 1798 a, t dbSNP:140562887
1807 1807 a, t dbSNP:774983507
1822 1822 a, g dbSNP:748932202
1840 1840 c, g dbSNP:781553299
1846 1846 a, g dbSNP:556353361
1855 1855 c, t dbSNP:768342412
1861 1861 c, g dbSNP:778497895
1864 1864 c, g dbSNP:747628875
1865 1865 g, t dbSNP:150443867
1867 1867 a, g dbSNP:144951474
1871 1871 g, t dbSNP:760569775
1873 1873 a, g dbSNP:538529966
1882 1882 a, t dbSNP:776425621
1883 1883 c, g dbSNP:759304313
1889 1889 a, c dbSNP:765490114
1895 1895 a, c dbSNP:200171674
1922 1922 c, t dbSNP:572335692
1925 1925 a, c dbSNP:7256787
1933 1933 a, g dbSNP:751694486
1934 1934 c, t dbSNP:757780967
1935 1935 c, g dbSNP:781609308
1937 1937 a, c dbSNP:750797007
1943 1943 c, g dbSNP:201853168
1947 1947 g, t dbSNP:778608608
1960 1960 a, c, g dbSNP:747754795
1963 1963 g, t dbSNP:777194622
1966 1966 c, t dbSNP:746531204
1969 1969 a, g dbSNP:770885844
1976 1976 a, c dbSNP:574635980
1980 1980 a, c dbSNP:759342592
1993 1993 g, t dbSNP:769524137
2001 2001 -, g dbSNP:756694838
2011 2011 a, g dbSNP:371745242
2023 2023 c, t dbSNP:763226905
2034 2034 a, g dbSNP:146912509
2051 2051 c, t dbSNP:563508697
2056 2056 a, c dbSNP:751676180
2098 2098 a, c dbSNP:76748339
2103 2103 c, g dbSNP:148298818
2105 2105 c, t dbSNP:560031224
2109 2109 a, g dbSNP:527281824
2114 2114 a, g dbSNP:547416560
2127 2127 a, g dbSNP:550013680
2152 2152 a, g dbSNP:370294571
2158 2158 c, t dbSNP:113505294
2179 2179 a, c dbSNP:549916903
2188 2188 c, t dbSNP:758555912
2191 2191 g, t dbSNP:2280436
2199 2199 g, t dbSNP:150837991
2219 2219 g, t dbSNP:558555568
2270 2270 a, c dbSNP:2280435
2295 2295 -, tcaggccccgcccttctgga dbSNP:200448741
2308 2308 -, ttctggatcaggccccgccc dbSNP:370664748
2390 2390 a, g dbSNP:12976985
2434 2434 a, c dbSNP:534702412
2435 2435 c, g dbSNP:138230079
2438 2438 c, t dbSNP:551530110
2439 2439 -, c dbSNP:369156587
2458 2458 a, c dbSNP:2280434
2477 2477 a, g dbSNP:537122660
2529 2529 c, t dbSNP:370453904
2620 2620 a, c, t dbSNP:557062698
2651 2651 a, g dbSNP:577353169
2658 2658 c, t dbSNP:546418524
2710 2710 c, g dbSNP:374768336
2738 2738 -, tcc dbSNP:371031155
2739 2739 c, g dbSNP:559793686
2754 2754 c, g dbSNP:777161581
2755 2755 c, g dbSNP:141705762
2774 2774 c, g dbSNP:16980549
2820 2820 g, t dbSNP:746243661

Target ORF information:

RefSeq Version XM_011527692
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens cytochrome P450, family 4, subfamily F, polypeptide 22 (CYP4F22), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu18711
Accession Version XM_011527693.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1596bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product cytochrome P450 4F22 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011295.12) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)380..1774(+)
Position Chain Variation Link
6 6 -, a dbSNP:561540079
7 7 -, c dbSNP:200676271
27 27 a, g dbSNP:575557946
67 67 c, g dbSNP:770612120
80 80 a, t dbSNP:10401260
130 130 a, g dbSNP:756588174
174 174 a, g dbSNP:780571256
203 203 a, g dbSNP:147170028
206 206 c, t dbSNP:778260380
215 215 a, g dbSNP:747319915
216 216 c, t dbSNP:374502872
219 219 a, g dbSNP:779679449
220 220 c, t dbSNP:183145766
221 221 c, t dbSNP:570906384
222 222 a, g dbSNP:202066269
236 236 c, t dbSNP:199675676
238 238 c, g dbSNP:771977494
252 252 c, t dbSNP:773295754
253 253 a, g, t dbSNP:147808045
255 255 c, t dbSNP:149247930
256 256 a, g dbSNP:759848884
260 260 -, g dbSNP:531800013
260 260 c, t dbSNP:765395884
261 261 a, g, t dbSNP:752778252
268 268 c, t dbSNP:144465443
269 269 a, g dbSNP:752130618
270 270 c, t dbSNP:148402706
271 271 a, g dbSNP:372291886
284 284 -, ctc dbSNP:774046189
291 291 c, t dbSNP:750775216
297 297 -, tct dbSNP:761304848
298 298 a, c dbSNP:754619522
299 299 c, t dbSNP:778434392
301 301 c, g dbSNP:375092463
302 302 c, t dbSNP:767055256
311 311 a, c, t dbSNP:200883622
312 312 a, g, t dbSNP:746979996
322 322 a, g dbSNP:776514995
323 323 c, t dbSNP:754377557
324 324 a, g dbSNP:142720535
326 326 c, t dbSNP:770004839
334 334 a, g dbSNP:775636292
342 342 a, g dbSNP:371459332
351 351 a, t dbSNP:372984405
356 356 a, c dbSNP:752040877
362 362 c, t dbSNP:146026019
363 363 a, g dbSNP:139927884
365 365 c, t dbSNP:750733757
366 366 a, g dbSNP:756447723
370 370 a, g dbSNP:778614738
371 371 c, t dbSNP:369559047
372 372 a, g dbSNP:143346937
375 375 g, t dbSNP:201919272
379 379 c, g, t dbSNP:118091316
380 380 c, t dbSNP:770947816
382 382 c, g dbSNP:780992939
392 392 c, t dbSNP:745666110
393 393 a, g dbSNP:371945146
394 394 g, t dbSNP:752301632
395 395 c, t dbSNP:775752466
396 396 a, g dbSNP:140968002
401 401 g, t dbSNP:539182601
405 405 c, t dbSNP:774374262
431 431 c, t dbSNP:755919126
440 440 a, g dbSNP:192866147
441 441 a, c, t dbSNP:116743462
442 442 a, g dbSNP:145733350
444 444 g, t dbSNP:369811073
445 445 c, t dbSNP:374513909
446 446 c, t dbSNP:750057163
455 455 c, g dbSNP:773736322
473 473 a, c dbSNP:377611165
475 475 c, t dbSNP:766929198
477 477 c, g, t dbSNP:374714583
486 486 c, t dbSNP:148922687
487 487 a, g dbSNP:143835816
488 488 c, t dbSNP:751327927
500 500 a, t dbSNP:756800456
509 509 a, g dbSNP:766987265
516 516 c, t dbSNP:749972738
517 517 a, g dbSNP:145640942
520 520 a, g dbSNP:376599468
524 524 a, g dbSNP:749026805
552 552 c, t dbSNP:201148124
560 560 a, g dbSNP:779100501
565 565 a, c dbSNP:748409630
572 572 a, g, t dbSNP:781757068
573 573 c, t dbSNP:770450984
576 576 c, t dbSNP:775957739
577 577 c, t dbSNP:762003020
578 578 a, g dbSNP:146689227
579 579 a, c dbSNP:772977381
581 581 c, t dbSNP:147818390
583 583 c, t dbSNP:765911617
584 584 a, g dbSNP:753753497
589 589 c, t dbSNP:150739429
598 598 c, g dbSNP:376061100
600 600 a, g dbSNP:752418864
601 601 c, t dbSNP:758223584
607 607 c, t dbSNP:777842481
626 626 a, g dbSNP:137942239
636 636 c, t dbSNP:377542346
648 648 c, g, t dbSNP:751335732
649 649 c, t dbSNP:114980833
650 650 a, g dbSNP:750472966
651 651 a, g dbSNP:756321971
652 652 c, g dbSNP:780704118
655 655 a, g dbSNP:749840377
660 660 a, g dbSNP:146036982
662 662 c, t dbSNP:755273482
663 663 a, g dbSNP:779288178
665 665 c, t dbSNP:141382984
668 668 c, t dbSNP:770500550
669 669 a, g dbSNP:776275777
671 671 c, t dbSNP:761196649
672 672 a, g dbSNP:199641250
675 675 g, t dbSNP:775270460
679 679 c, g dbSNP:368813073
685 685 c, t dbSNP:374464817
686 686 a, g dbSNP:569166154
687 687 c, g dbSNP:187004457
694 694 c, t dbSNP:141755148
695 695 g, t dbSNP:750743002
702 702 a, t dbSNP:373223970
703 703 a, c dbSNP:766528561
710 710 a, c dbSNP:753883685
723 723 a, t dbSNP:755471652
734 734 a, t dbSNP:16980531
736 736 c, t dbSNP:377373101
737 737 a, g dbSNP:758816247
738 738 c, t dbSNP:780816103
741 741 a, g dbSNP:148454445
745 745 c, g, t dbSNP:571757470
756 756 a, c dbSNP:751954643
761 761 c, t dbSNP:142364533
762 762 a, g dbSNP:368781436
769 769 a, g dbSNP:748818073
771 771 c, t dbSNP:577229558
780 780 c, t dbSNP:539896338
783 783 c, t dbSNP:151269464
784 784 a, g dbSNP:11666601
787 787 a, c dbSNP:772155840
789 789 c, g dbSNP:79603814
797 797 a, g dbSNP:760550354
798 798 c, t dbSNP:771126991
804 804 a, g dbSNP:776771681
805 805 a, g dbSNP:759653194
807 807 a, g dbSNP:201717667
826 826 a, g dbSNP:753177417
837 837 a, c, t dbSNP:562637818
854 854 c, t dbSNP:147748244
856 856 a, c dbSNP:78418003
859 859 c, g dbSNP:374190832
861 861 a, c, g dbSNP:371097842
866 866 c, t dbSNP:531670218
866 866 -, t dbSNP:778308984
869 869 c, t dbSNP:199892192
874 874 a, g dbSNP:752196556
876 876 a, g dbSNP:758040339
880 880 g, t dbSNP:367667200
885 885 a, g dbSNP:777845525
887 887 g, t dbSNP:746956755
893 893 c, t dbSNP:757051294
895 895 c, t dbSNP:149616338
896 896 a, g, t dbSNP:745682521
900 900 g, t dbSNP:775751524
910 910 c, g dbSNP:374931901
912 912 a, g dbSNP:267605318
913 913 c, t dbSNP:146904240
914 914 a, g dbSNP:572278771
916 916 -, tctg dbSNP:751937099
923 923 c, g dbSNP:371788862
926 926 c, t dbSNP:376675683
927 927 a, g dbSNP:200712099
929 929 c, t dbSNP:768098854
930 930 a, g dbSNP:118203937
933 933 a, g dbSNP:761113998
934 934 g, t dbSNP:764969665
936 936 a, g dbSNP:145830520
938 938 c, t dbSNP:148977089
939 939 a, g dbSNP:184021211
955 955 c, t dbSNP:143506697
956 956 a, g dbSNP:757078629
969 969 a, g dbSNP:781206441
970 970 a, c dbSNP:750175536
971 971 c, t dbSNP:369811543
972 972 a, g, t dbSNP:200005567
975 975 c, t dbSNP:768889620
978 978 c, g dbSNP:188702643
979 979 a, g dbSNP:113609641
985 985 a, g dbSNP:559473877
986 986 c, t dbSNP:773826320
987 987 a, g dbSNP:141631745
990 990 a, g dbSNP:771458701
995 995 c, t dbSNP:144569785
996 996 a, g dbSNP:767066474
1002 1002 c, g dbSNP:763867966
1032 1032 a, c dbSNP:750977499
1037 1037 a, c dbSNP:761445302
1038 1038 -, t dbSNP:757885232
1039 1039 c, t dbSNP:138523164
1046 1046 c, t dbSNP:767352854
1048 1048 a, g dbSNP:200761933
1049 1049 c, t dbSNP:755885838
1050 1050 a, g dbSNP:141902603
1052 1052 c, t dbSNP:199782025
1053 1053 a, g dbSNP:755129541
1056 1056 c, t dbSNP:201426377
1058 1058 c, g dbSNP:772654580
1061 1061 c, t dbSNP:779206543
1062 1062 a, c, g dbSNP:146265982
1064 1064 a, c dbSNP:549559441
1069 1069 a, g dbSNP:58142709
1075 1075 c, t dbSNP:747568295
1076 1076 a, g dbSNP:139163760
1078 1078 a, g dbSNP:777093774
1086 1086 c, t dbSNP:759994562
1088 1088 a, g dbSNP:768181440
1097 1097 c, g dbSNP:375434045
1101 1101 a, g dbSNP:761198340
1102 1102 a, g dbSNP:767108907
1106 1106 a, g dbSNP:749926972
1107 1107 a, c dbSNP:760569680
1117 1117 c, t dbSNP:766310614
1119 1119 c, t dbSNP:370734976
1120 1120 c, t dbSNP:753570515
1126 1126 a, g dbSNP:754822219
1129 1129 a, g dbSNP:765369229
1130 1130 c, t dbSNP:752999090
1140 1140 a, g dbSNP:758385025
1143 1143 a, g dbSNP:770465694
1148 1148 a, g dbSNP:776523823
1162 1162 c, g dbSNP:746794843
1168 1168 a, c, t dbSNP:368699374
1173 1173 a, g dbSNP:775288087
1178 1178 c, t dbSNP:762667660
1179 1179 a, g dbSNP:764409492
1183 1183 c, t dbSNP:377660316
1184 1184 a, g dbSNP:761963345
1191 1191 a, t dbSNP:200174659
1192 1192 c, t dbSNP:149500476
1199 1199 a, g dbSNP:756581830
1202 1202 -, t dbSNP:745852323
1213 1213 c, g, t dbSNP:762779449
1214 1214 a, g dbSNP:774309866
1217 1217 a, g, t dbSNP:762090356
1234 1234 c, t dbSNP:201956948
1266 1266 c, g dbSNP:760727576
1267 1267 a, g dbSNP:371911971
1269 1269 a, g dbSNP:374530747
1271 1271 c, t dbSNP:144743413
1278 1278 a, c, g dbSNP:779195003
1279 1279 a, g dbSNP:756835947
1285 1285 c, t dbSNP:780834713
1286 1286 c, t dbSNP:745368359
1287 1287 a, g dbSNP:769229606
1303 1303 a, g dbSNP:780021415
1308 1308 c, t dbSNP:368738530
1316 1316 c, t dbSNP:201129618
1317 1317 a, g dbSNP:207477012
1320 1320 a, c dbSNP:768745902
1342 1342 c, t dbSNP:148521416
1343 1343 a, g dbSNP:189645644
1350 1350 c, t dbSNP:768795742
1352 1352 c, t dbSNP:751985553
1357 1357 g, t dbSNP:568960604
1372 1372 a, g dbSNP:766072305
1384 1384 a, g dbSNP:753389765
1386 1386 a, g dbSNP:754604524
1388 1388 a, c dbSNP:145440178
1390 1390 a, g dbSNP:748142782
1391 1391 a, c, t dbSNP:572771583
1392 1392 a, g, t dbSNP:748463754
1401 1401 c, t dbSNP:376273710
1402 1402 a, g dbSNP:771000092
1410 1410 -, ct dbSNP:763109569
1410 1410 c, t dbSNP:776967520
1419 1419 c, t dbSNP:147680222
1421 1421 c, t dbSNP:745942843
1426 1426 a, g dbSNP:541873962
1430 1430 a, g dbSNP:775571688
1431 1431 c, t dbSNP:763409773
1432 1432 a, g dbSNP:769211003
1437 1437 a, g dbSNP:774525657
1444 1444 g, t dbSNP:762300969
1449 1449 c, t dbSNP:765946425
1453 1453 c, t dbSNP:753588073
1456 1456 -, gc dbSNP:764474903
1457 1457 c, t dbSNP:561480298
1458 1458 a, g dbSNP:368958384
1478 1478 a, g dbSNP:769033721
1505 1505 c, t dbSNP:118203935
1508 1508 c, g dbSNP:118203936
1515 1515 c, t dbSNP:762055044
1518 1518 c, t dbSNP:200732696
1519 1519 a, g dbSNP:773731320
1524 1524 a, g dbSNP:377609523
1526 1526 c, t dbSNP:759221556
1533 1533 c, g dbSNP:764981944
1536 1536 a, g dbSNP:752192760
1537 1537 a, g dbSNP:571776726
1541 1541 c, t dbSNP:762338873
1543 1543 c, t dbSNP:763708775
1545 1545 a, g dbSNP:368320642
1552 1552 c, t dbSNP:761743684
1553 1553 a, c, t dbSNP:200581968
1554 1554 a, g dbSNP:144961059
1560 1560 a, t dbSNP:766560113
1569 1569 a, g dbSNP:151317392
1573 1573 a, g dbSNP:755181302
1575 1575 a, g dbSNP:779007203
1580 1580 a, c dbSNP:748177003
1581 1581 c, g dbSNP:758915198
1582 1582 c, t dbSNP:778478483
1584 1584 c, t dbSNP:747372231
1588 1588 a, t dbSNP:140562887
1597 1597 a, t dbSNP:774983507
1612 1612 a, g dbSNP:748932202
1630 1630 c, g dbSNP:781553299
1636 1636 a, g dbSNP:556353361
1645 1645 c, t dbSNP:768342412
1651 1651 c, g dbSNP:778497895
1654 1654 c, g dbSNP:747628875
1655 1655 g, t dbSNP:150443867
1657 1657 a, g dbSNP:144951474
1661 1661 g, t dbSNP:760569775
1663 1663 a, g dbSNP:538529966
1672 1672 a, t dbSNP:776425621
1673 1673 c, g dbSNP:759304313
1679 1679 a, c dbSNP:765490114
1685 1685 a, c dbSNP:200171674
1712 1712 c, t dbSNP:572335692
1715 1715 a, c dbSNP:7256787
1723 1723 a, g dbSNP:751694486
1724 1724 c, t dbSNP:757780967
1725 1725 c, g dbSNP:781609308
1727 1727 a, c dbSNP:750797007
1733 1733 c, g dbSNP:201853168
1737 1737 g, t dbSNP:778608608
1750 1750 a, c, g dbSNP:747754795
1753 1753 g, t dbSNP:777194622
1756 1756 c, t dbSNP:746531204
1759 1759 a, g dbSNP:770885844
1766 1766 a, c dbSNP:574635980
1770 1770 a, c dbSNP:759342592
1783 1783 g, t dbSNP:769524137
1791 1791 -, g dbSNP:756694838
1801 1801 a, g dbSNP:371745242
1813 1813 c, t dbSNP:763226905
1824 1824 a, g dbSNP:146912509
1841 1841 c, t dbSNP:563508697
1846 1846 a, c dbSNP:751676180
1888 1888 a, c dbSNP:76748339
1893 1893 c, g dbSNP:148298818
1895 1895 c, t dbSNP:560031224
1899 1899 a, g dbSNP:527281824
1904 1904 a, g dbSNP:547416560
1917 1917 a, g dbSNP:550013680
1942 1942 a, g dbSNP:370294571
1948 1948 c, t dbSNP:113505294
1969 1969 a, c dbSNP:549916903
1978 1978 c, t dbSNP:758555912
1981 1981 g, t dbSNP:2280436
1989 1989 g, t dbSNP:150837991
2009 2009 g, t dbSNP:558555568
2060 2060 a, c dbSNP:2280435
2085 2085 -, tcaggccccgcccttctgga dbSNP:200448741
2098 2098 -, ttctggatcaggccccgccc dbSNP:370664748
2180 2180 a, g dbSNP:12976985
2224 2224 a, c dbSNP:534702412
2225 2225 c, g dbSNP:138230079
2228 2228 c, t dbSNP:551530110
2229 2229 -, c dbSNP:369156587
2248 2248 a, c dbSNP:2280434
2267 2267 a, g dbSNP:537122660
2319 2319 c, t dbSNP:370453904
2410 2410 a, c, t dbSNP:557062698
2441 2441 a, g dbSNP:577353169
2448 2448 c, t dbSNP:546418524
2500 2500 c, g dbSNP:374768336
2528 2528 -, tcc dbSNP:371031155
2529 2529 c, g dbSNP:559793686
2544 2544 c, g dbSNP:777161581
2545 2545 c, g dbSNP:141705762
2564 2564 c, g dbSNP:16980549
2610 2610 g, t dbSNP:746243661

Target ORF information:

RefSeq Version XM_011527693
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens cytochrome P450, family 4, subfamily F, polypeptide 22 (CYP4F22), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu18711
Accession Version NM_173483.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1596bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product cytochrome P450 4F22
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA874258.1, BC069351.1, AC011492.8 and AI341068.1. This sequence is a reference standard in the RefSeqGene project. On Oct 11, 2007 this sequence version replaced gi:142377118. Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19 and encodes an enzyme thought to play a role in the 12(R)-lipoxygenase pathway. Mutations in this gene are the cause of ichthyosis lamellar type 3. [provided by RefSeq, Jul 2008]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##Evidence-Data-START## Transcript exon combination :: AK096820.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2144335 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)93..95(+)
Misc Feature(2)345..1739(+)
Exon (1)1..59
Gene Synonym:
Exon (2)60..166
Gene Synonym:
Exon (3)167..389
Gene Synonym:
Exon (4)390..534
Gene Synonym:
Exon (5)535..588
Gene Synonym:
Exon (6)589..716
Gene Synonym:
Exon (7)717..838
Gene Synonym:
Exon (8)839..1106
Gene Synonym:
Exon (9)1107..1173
Gene Synonym:
Exon (10)1174..1303
Gene Synonym:
Exon (11)1304..1437
Gene Synonym:
Exon (12)1438..1502
Gene Synonym:
Exon (13)1503..1585
Gene Synonym:
Exon (14)1586..2609
Gene Synonym:
Position Chain Variation Link
52 52 -, c dbSNP:34600208
95 95 a, g dbSNP:756588174
139 139 a, g dbSNP:780571256
168 168 a, g dbSNP:147170028
171 171 c, t dbSNP:778260380
180 180 a, g dbSNP:747319915
181 181 c, t dbSNP:374502872
184 184 a, g dbSNP:779679449
185 185 c, t dbSNP:183145766
186 186 c, t dbSNP:570906384
187 187 a, g dbSNP:202066269
201 201 c, t dbSNP:199675676
203 203 c, g dbSNP:771977494
217 217 c, t dbSNP:773295754
218 218 a, g, t dbSNP:147808045
220 220 c, t dbSNP:149247930
221 221 a, g dbSNP:759848884
225 225 -, g dbSNP:531800013
225 225 c, t dbSNP:765395884
226 226 a, g, t dbSNP:752778252
233 233 c, t dbSNP:144465443
234 234 a, g dbSNP:752130618
235 235 c, t dbSNP:148402706
236 236 a, g dbSNP:372291886
249 249 -, ctc dbSNP:774046189
256 256 c, t dbSNP:750775216
262 262 -, tct dbSNP:761304848
263 263 a, c dbSNP:754619522
264 264 c, t dbSNP:778434392
266 266 c, g dbSNP:375092463
267 267 c, t dbSNP:767055256
276 276 a, c, t dbSNP:200883622
277 277 a, g, t dbSNP:746979996
287 287 a, g dbSNP:776514995
288 288 c, t dbSNP:754377557
289 289 a, g dbSNP:142720535
291 291 c, t dbSNP:770004839
299 299 a, g dbSNP:775636292
307 307 a, g dbSNP:371459332
316 316 a, t dbSNP:372984405
321 321 a, c dbSNP:752040877
327 327 c, t dbSNP:146026019
328 328 a, g dbSNP:139927884
330 330 c, t dbSNP:750733757
331 331 a, g dbSNP:756447723
335 335 a, g dbSNP:778614738
336 336 c, t dbSNP:369559047
337 337 a, g dbSNP:143346937
340 340 g, t dbSNP:201919272
344 344 c, g, t dbSNP:118091316
345 345 c, t dbSNP:770947816
347 347 c, g dbSNP:780992939
357 357 c, t dbSNP:745666110
358 358 a, g dbSNP:371945146
359 359 g, t dbSNP:752301632
360 360 c, t dbSNP:775752466
361 361 a, g dbSNP:140968002
366 366 g, t dbSNP:539182601
370 370 c, t dbSNP:774374262
396 396 c, t dbSNP:755919126
405 405 a, g dbSNP:192866147
406 406 a, c, t dbSNP:116743462
407 407 a, g dbSNP:145733350
409 409 g, t dbSNP:369811073
410 410 c, t dbSNP:374513909
411 411 c, t dbSNP:750057163
420 420 c, g dbSNP:773736322
438 438 a, c dbSNP:377611165
440 440 c, t dbSNP:766929198
442 442 c, g, t dbSNP:374714583
451 451 c, t dbSNP:148922687
452 452 a, g dbSNP:143835816
453 453 c, t dbSNP:751327927
465 465 a, t dbSNP:756800456
474 474 a, g dbSNP:766987265
481 481 c, t dbSNP:749972738
482 482 a, g dbSNP:145640942
485 485 a, g dbSNP:376599468
489 489 a, g dbSNP:749026805
517 517 c, t dbSNP:201148124
525 525 a, g dbSNP:779100501
530 530 a, c dbSNP:748409630
537 537 a, g, t dbSNP:781757068
538 538 c, t dbSNP:770450984
541 541 c, t dbSNP:775957739
542 542 c, t dbSNP:762003020
543 543 a, g dbSNP:146689227
544 544 a, c dbSNP:772977381
546 546 c, t dbSNP:147818390
548 548 c, t dbSNP:765911617
549 549 a, g dbSNP:753753497
554 554 c, t dbSNP:150739429
563 563 c, g dbSNP:376061100
565 565 a, g dbSNP:752418864
566 566 c, t dbSNP:758223584
572 572 c, t dbSNP:777842481
591 591 a, g dbSNP:137942239
601 601 c, t dbSNP:377542346
613 613 c, g, t dbSNP:751335732
614 614 c, t dbSNP:114980833
615 615 a, g dbSNP:750472966
616 616 a, g dbSNP:756321971
617 617 c, g dbSNP:780704118
620 620 a, g dbSNP:749840377
625 625 a, g dbSNP:146036982
627 627 c, t dbSNP:755273482
628 628 a, g dbSNP:779288178
630 630 c, t dbSNP:141382984
633 633 c, t dbSNP:770500550
634 634 a, g dbSNP:776275777
636 636 c, t dbSNP:761196649
637 637 a, g dbSNP:199641250
640 640 g, t dbSNP:775270460
644 644 c, g dbSNP:368813073
650 650 c, t dbSNP:374464817
651 651 a, g dbSNP:569166154
652 652 c, g dbSNP:187004457
659 659 c, t dbSNP:141755148
660 660 g, t dbSNP:750743002
667 667 a, t dbSNP:373223970
668 668 a, c dbSNP:766528561
675 675 a, c dbSNP:753883685
688 688 a, t dbSNP:755471652
699 699 a, t dbSNP:16980531
701 701 c, t dbSNP:377373101
702 702 a, g dbSNP:758816247
703 703 c, t dbSNP:780816103
706 706 a, g dbSNP:148454445
710 710 c, g, t dbSNP:571757470
721 721 a, c dbSNP:751954643
726 726 c, t dbSNP:142364533
727 727 a, g dbSNP:368781436
734 734 a, g dbSNP:748818073
736 736 c, t dbSNP:577229558
745 745 c, t dbSNP:539896338
748 748 c, t dbSNP:151269464
749 749 a, g dbSNP:11666601
752 752 a, c dbSNP:772155840
754 754 c, g dbSNP:79603814
762 762 a, g dbSNP:760550354
763 763 c, t dbSNP:771126991
769 769 a, g dbSNP:776771681
770 770 a, g dbSNP:759653194
772 772 a, g dbSNP:201717667
791 791 a, g dbSNP:753177417
802 802 a, c, t dbSNP:562637818
819 819 c, t dbSNP:147748244
821 821 a, c dbSNP:78418003
824 824 c, g dbSNP:374190832
826 826 a, c, g dbSNP:371097842
831 831 c, t dbSNP:531670218
831 831 -, t dbSNP:778308984
834 834 c, t dbSNP:199892192
839 839 a, g dbSNP:752196556
841 841 a, g dbSNP:758040339
845 845 g, t dbSNP:367667200
850 850 a, g dbSNP:777845525
852 852 g, t dbSNP:746956755
858 858 c, t dbSNP:757051294
860 860 c, t dbSNP:149616338
861 861 a, g, t dbSNP:745682521
865 865 g, t dbSNP:775751524
875 875 c, g dbSNP:374931901
877 877 a, g dbSNP:267605318
878 878 c, t dbSNP:146904240
879 879 a, g dbSNP:572278771
881 881 -, tctg dbSNP:751937099
888 888 c, g dbSNP:371788862
891 891 c, t dbSNP:376675683
892 892 a, g dbSNP:200712099
894 894 c, t dbSNP:768098854
895 895 a, g dbSNP:118203937
898 898 a, g dbSNP:761113998
899 899 g, t dbSNP:764969665
901 901 a, g dbSNP:145830520
903 903 c, t dbSNP:148977089
904 904 a, g dbSNP:184021211
920 920 c, t dbSNP:143506697
921 921 a, g dbSNP:757078629
934 934 a, g dbSNP:781206441
935 935 a, c dbSNP:750175536
936 936 c, t dbSNP:369811543
937 937 a, g, t dbSNP:200005567
940 940 c, t dbSNP:768889620
943 943 c, g dbSNP:188702643
944 944 a, g dbSNP:113609641
950 950 a, g dbSNP:559473877
951 951 c, t dbSNP:773826320
952 952 a, g dbSNP:141631745
955 955 a, g dbSNP:771458701
960 960 c, t dbSNP:144569785
961 961 a, g dbSNP:767066474
967 967 c, g dbSNP:763867966
997 997 a, c dbSNP:750977499
1002 1002 a, c dbSNP:761445302
1003 1003 -, t dbSNP:757885232
1004 1004 c, t dbSNP:138523164
1011 1011 c, t dbSNP:767352854
1013 1013 a, g dbSNP:200761933
1014 1014 c, t dbSNP:755885838
1015 1015 a, g dbSNP:141902603
1017 1017 c, t dbSNP:199782025
1018 1018 a, g dbSNP:755129541
1021 1021 c, t dbSNP:201426377
1023 1023 c, g dbSNP:772654580
1026 1026 c, t dbSNP:779206543
1027 1027 a, c, g dbSNP:146265982
1029 1029 a, c dbSNP:549559441
1034 1034 a, g dbSNP:58142709
1040 1040 c, t dbSNP:747568295
1041 1041 a, g dbSNP:139163760
1043 1043 a, g dbSNP:777093774
1051 1051 c, t dbSNP:759994562
1053 1053 a, g dbSNP:768181440
1062 1062 c, g dbSNP:375434045
1066 1066 a, g dbSNP:761198340
1067 1067 a, g dbSNP:767108907
1071 1071 a, g dbSNP:749926972
1072 1072 a, c dbSNP:760569680
1082 1082 c, t dbSNP:766310614
1084 1084 c, t dbSNP:370734976
1085 1085 c, t dbSNP:753570515
1091 1091 a, g dbSNP:754822219
1094 1094 a, g dbSNP:765369229
1095 1095 c, t dbSNP:752999090
1105 1105 a, g dbSNP:758385025
1108 1108 a, g dbSNP:770465694
1113 1113 a, g dbSNP:776523823
1127 1127 c, g dbSNP:746794843
1133 1133 a, c, t dbSNP:368699374
1138 1138 a, g dbSNP:775288087
1143 1143 c, t dbSNP:762667660
1144 1144 a, g dbSNP:764409492
1148 1148 c, t dbSNP:377660316
1149 1149 a, g dbSNP:761963345
1156 1156 a, t dbSNP:200174659
1157 1157 c, t dbSNP:149500476
1164 1164 a, g dbSNP:756581830
1167 1167 -, t dbSNP:745852323
1178 1178 c, g, t dbSNP:762779449
1179 1179 a, g dbSNP:774309866
1182 1182 a, g, t dbSNP:762090356
1199 1199 c, t dbSNP:201956948
1231 1231 c, g dbSNP:760727576
1232 1232 a, g dbSNP:371911971
1234 1234 a, g dbSNP:374530747
1236 1236 c, t dbSNP:144743413
1243 1243 a, c, g dbSNP:779195003
1244 1244 a, g dbSNP:756835947
1250 1250 c, t dbSNP:780834713
1251 1251 c, t dbSNP:745368359
1252 1252 a, g dbSNP:769229606
1268 1268 a, g dbSNP:780021415
1273 1273 c, t dbSNP:368738530
1281 1281 c, t dbSNP:201129618
1282 1282 a, g dbSNP:207477012
1285 1285 a, c dbSNP:768745902
1307 1307 c, t dbSNP:148521416
1308 1308 a, g dbSNP:189645644
1315 1315 c, t dbSNP:768795742
1317 1317 c, t dbSNP:751985553
1322 1322 g, t dbSNP:568960604
1337 1337 a, g dbSNP:766072305
1349 1349 a, g dbSNP:753389765
1351 1351 a, g dbSNP:754604524
1353 1353 a, c dbSNP:145440178
1355 1355 a, g dbSNP:748142782
1356 1356 a, c, t dbSNP:572771583
1357 1357 a, g, t dbSNP:748463754
1366 1366 c, t dbSNP:376273710
1367 1367 a, g dbSNP:771000092
1375 1375 -, ct dbSNP:763109569
1375 1375 c, t dbSNP:776967520
1384 1384 c, t dbSNP:147680222
1386 1386 c, t dbSNP:745942843
1391 1391 a, g dbSNP:541873962
1395 1395 a, g dbSNP:775571688
1396 1396 c, t dbSNP:763409773
1397 1397 a, g dbSNP:769211003
1402 1402 a, g dbSNP:774525657
1409 1409 g, t dbSNP:762300969
1414 1414 c, t dbSNP:765946425
1418 1418 c, t dbSNP:753588073
1421 1421 -, gc dbSNP:764474903
1422 1422 c, t dbSNP:561480298
1423 1423 a, g dbSNP:368958384
1443 1443 a, g dbSNP:769033721
1470 1470 c, t dbSNP:118203935
1473 1473 c, g dbSNP:118203936
1480 1480 c, t dbSNP:762055044
1483 1483 c, t dbSNP:200732696
1484 1484 a, g dbSNP:773731320
1489 1489 a, g dbSNP:377609523
1491 1491 c, t dbSNP:759221556
1498 1498 c, g dbSNP:764981944
1501 1501 a, g dbSNP:752192760
1502 1502 a, g dbSNP:571776726
1506 1506 c, t dbSNP:762338873
1508 1508 c, t dbSNP:763708775
1510 1510 a, g dbSNP:368320642
1517 1517 c, t dbSNP:761743684
1518 1518 a, c, t dbSNP:200581968
1519 1519 a, g dbSNP:144961059
1525 1525 a, t dbSNP:766560113
1534 1534 a, g dbSNP:151317392
1538 1538 a, g dbSNP:755181302
1540 1540 a, g dbSNP:779007203
1545 1545 a, c dbSNP:748177003
1546 1546 c, g dbSNP:758915198
1547 1547 c, t dbSNP:778478483
1549 1549 c, t dbSNP:747372231
1553 1553 a, t dbSNP:140562887
1562 1562 a, t dbSNP:774983507
1577 1577 a, g dbSNP:748932202
1595 1595 c, g dbSNP:781553299
1601 1601 a, g dbSNP:556353361
1610 1610 c, t dbSNP:768342412
1616 1616 c, g dbSNP:778497895
1619 1619 c, g dbSNP:747628875
1620 1620 g, t dbSNP:150443867
1622 1622 a, g dbSNP:144951474
1626 1626 g, t dbSNP:760569775
1628 1628 a, g dbSNP:538529966
1637 1637 a, t dbSNP:776425621
1638 1638 c, g dbSNP:759304313
1644 1644 a, c dbSNP:765490114
1650 1650 a, c dbSNP:200171674
1677 1677 c, t dbSNP:572335692
1680 1680 a, c dbSNP:7256787
1688 1688 a, g dbSNP:751694486
1689 1689 c, t dbSNP:757780967
1690 1690 c, g dbSNP:781609308
1692 1692 a, c dbSNP:750797007
1698 1698 c, g dbSNP:201853168
1702 1702 g, t dbSNP:778608608
1715 1715 a, c, g dbSNP:747754795
1718 1718 g, t dbSNP:777194622
1721 1721 c, t dbSNP:746531204
1724 1724 a, g dbSNP:770885844
1731 1731 a, c dbSNP:574635980
1735 1735 a, c dbSNP:759342592
1748 1748 g, t dbSNP:769524137
1756 1756 -, g dbSNP:756694838
1766 1766 a, g dbSNP:371745242
1778 1778 c, t dbSNP:763226905
1789 1789 a, g dbSNP:146912509
1806 1806 c, t dbSNP:563508697
1811 1811 a, c dbSNP:751676180
1853 1853 a, c dbSNP:76748339
1858 1858 c, g dbSNP:148298818
1860 1860 c, t dbSNP:560031224
1864 1864 a, g dbSNP:527281824
1869 1869 a, g dbSNP:547416560
1882 1882 a, g dbSNP:550013680
1907 1907 a, g dbSNP:370294571
1913 1913 c, t dbSNP:113505294
1934 1934 a, c dbSNP:549916903
1943 1943 c, t dbSNP:758555912
1946 1946 g, t dbSNP:2280436
1954 1954 g, t dbSNP:150837991
1974 1974 g, t dbSNP:558555568
2025 2025 a, c dbSNP:2280435
2050 2050 -, tcaggccccgcccttctgga dbSNP:200448741
2063 2063 -, ttctggatcaggccccgccc dbSNP:370664748
2145 2145 a, g dbSNP:12976985
2189 2189 a, c dbSNP:534702412
2190 2190 c, g dbSNP:138230079
2193 2193 c, t dbSNP:551530110
2194 2194 -, c dbSNP:369156587
2213 2213 a, c dbSNP:2280434
2232 2232 a, g dbSNP:537122660
2284 2284 c, t dbSNP:370453904
2375 2375 a, c, t dbSNP:557062698
2406 2406 a, g dbSNP:577353169
2413 2413 c, t dbSNP:546418524
2465 2465 c, g dbSNP:374768336
2493 2493 -, tcc dbSNP:371031155
2494 2494 c, g dbSNP:559793686
2509 2509 c, g dbSNP:777161581
2510 2510 c, g dbSNP:141705762
2529 2529 c, g dbSNP:16980549
2575 2575 g, t dbSNP:746243661

Target ORF information:

RefSeq Version NM_173483
Organism Homo sapiens (human)
Definition Homo sapiens cytochrome P450, family 4, subfamily F, polypeptide 22 (CYP4F22), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
