Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

CPT2 carnitine palmitoyltransferase 2 [Homo sapiens (human)]

Gene Symbol CPT2
Entrez Gene ID 1376
Full Name carnitine palmitoyltransferase 2
Synonyms CPT1, CPTASE, IIAE4
General protein information
Preferred Names
carnitine O-palmitoyltransferase 2, mitochondrial
carnitine O-palmitoyltransferase 2, mitochondrial
carnitine palmitoyltransferase II
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a nuclear protein which is transported to the mitochondrial inner membrane. Together with carnitine palmitoyltransferase I, the encoded protein oxidizes long-chain fatty acids in the mitochondria. Defects in this gene are associated with mitochondrial long-chain fatty-acid (LCFA) oxidation disorders. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Myopathy due to CPT II deficiency, 255110 (3); CPT deficiency,
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu33029 XM_005270484 PREDICTED: Homo sapiens carnitine palmitoyltransferase 2 (CPT2), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu17939 NM_000098 Homo sapiens carnitine palmitoyltransferase 2 (CPT2), mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu33029D
Sequence Information ORF Nucleotide Sequence (Length: 1908bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product carnitine O-palmitoyltransferase 2, mitochondrial isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_032977.10) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)325..2061(+)
Position Chain Variation Link
9 9 a, t dbSNP:377231075
64 64 -, gga dbSNP:773273244
72 72 g, t dbSNP:760556045
73 73 c, t dbSNP:766061600
74 74 c, t dbSNP:369982767
102 102 c, t dbSNP:561846692
106 106 a, c dbSNP:527634657
108 108 a, c dbSNP:547411632
143 143 c, t dbSNP:745619478
175 175 c, t dbSNP:769734759
178 178 g, t dbSNP:780082552
191 191 c, t dbSNP:749532648
205 205 c, t dbSNP:768829380
214 214 -, c dbSNP:764763293
221 221 -, g dbSNP:786204647
225 225 c, t dbSNP:570576290
228 228 g, t dbSNP:761850684
242 242 c, g dbSNP:533282672
267 267 c, t dbSNP:772541454
286 286 c, t dbSNP:2929073
290 290 -, gc dbSNP:754363068
291 291 a, g dbSNP:773734918
305 305 c, t dbSNP:760976212
311 311 c, t dbSNP:766740182
332 332 a, c dbSNP:28936375
336 336 c, g dbSNP:749098104
352 352 -, c dbSNP:758026372
360 360 c, t dbSNP:755209043
364 364 a, g dbSNP:779047870
371 371 a, g dbSNP:748182542
373 373 -, ag dbSNP:765935623
378 378 c, g dbSNP:142598568
383 383 c, g dbSNP:201966320
384 384 a, c dbSNP:747516495
385 385 c, t dbSNP:771406546
387 387 a, g dbSNP:777038982
392 392 -, ct dbSNP:751253358
393 393 c, t dbSNP:370633858
394 394 c, t dbSNP:759866235
401 401 a, g dbSNP:146159244
403 403 a, g dbSNP:773897404
405 405 -, t dbSNP:754532499
407 407 a, g dbSNP:140194675
419 419 a, c dbSNP:150888506
429 429 a, g dbSNP:761554630
432 432 c, t dbSNP:767339394
450 450 c, t dbSNP:768408574
470 470 a, g dbSNP:369596290
477 477 c, g dbSNP:760146368
485 485 c, t dbSNP:75939866
497 497 a, g dbSNP:753737707
504 504 a, g dbSNP:147846614
507 507 c, t dbSNP:764943289
508 508 a, c dbSNP:71654989
516 516 c, t dbSNP:372313619
521 521 c, t dbSNP:74315294
522 522 a, g dbSNP:778017005
524 524 a, g dbSNP:371560287
526 526 c, t dbSNP:762957225
532 532 -, tttga dbSNP:778895906
536 536 a, g dbSNP:148035648
542 542 a, g dbSNP:121918528
548 548 c, t dbSNP:192275019
551 551 c, g dbSNP:757294874
553 553 c, t dbSNP:201065226
555 555 a, g dbSNP:200301403
560 560 c, g, t dbSNP:750572726
561 561 c, t dbSNP:780743357
562 562 a, g dbSNP:199545795
565 565 a, g dbSNP:769160926
570 570 c, g dbSNP:777514571
576 576 c, g, t dbSNP:569391696
582 582 a, g dbSNP:375573986
589 589 g, t dbSNP:554813467
599 599 a, c, g dbSNP:369475478
601 601 a, g dbSNP:774522353
607 607 a, g dbSNP:762688756
616 616 a, t dbSNP:763881188
621 621 a, t dbSNP:751437363
627 627 a, g dbSNP:144686779
631 631 a, g dbSNP:141505320
632 632 c, t dbSNP:750437078
634 634 a, c, t dbSNP:200080591
635 635 a, g dbSNP:515726177
638 638 c, t dbSNP:755331246
644 644 a, g dbSNP:772269793
651 651 -, tg dbSNP:746113590
651 651 c, t dbSNP:138938770
652 652 a, g dbSNP:748607258
664 664 c, t dbSNP:756839691
682 682 c, t dbSNP:780940242
683 683 a, g dbSNP:144760921
690 690 a, c, g dbSNP:769316736
694 694 c, t dbSNP:2229292
703 703 a, g dbSNP:28936674
707 707 c, t dbSNP:773993374
717 717 gaaccctgcaaaaagtgacactatc, t dbSNP:515726173
717 717 -, gaaccc dbSNP:772240606
724 724 -, gcaaaaagtgacactatc dbSNP:775776515
739 739 a, c, g dbSNP:377737941
744 744 c, t dbSNP:767592132
746 746 c, t dbSNP:773503132
748 748 a, g dbSNP:760775391
752 752 a, g dbSNP:766575997
758 758 c, t dbSNP:754042241
760 760 c, t dbSNP:375968699
761 761 a, g dbSNP:765824169
762 762 c, t dbSNP:752975688
770 770 a, c dbSNP:758823353
771 771 c, t dbSNP:140853350
774 774 -, ct dbSNP:760981841
786 786 a, g dbSNP:745547578
787 787 -, atg dbSNP:769115843
789 789 c, t dbSNP:755830520
794 794 -, c dbSNP:777297837
797 797 a, g dbSNP:779525393
807 807 a, t dbSNP:748844820
809 809 a, c, t dbSNP:773788921
810 810 a, g dbSNP:774374525
816 816 a, c dbSNP:201622710
817 817 c, t dbSNP:747845465
821 821 a, g dbSNP:74315300
824 824 c, t dbSNP:515726174
838 838 c, t dbSNP:367691827
840 840 g, t dbSNP:773236568
848 848 a, g dbSNP:760978599
849 849 a, c dbSNP:766770153
850 850 a, t dbSNP:776833476
852 852 -, a dbSNP:762366252
856 856 c, t dbSNP:759733220
857 857 a, g dbSNP:794727616
859 859 c, t dbSNP:147889730
860 860 c, t dbSNP:753270905
863 863 c, t dbSNP:74315298
874 874 c, t dbSNP:373638740
875 875 a, g dbSNP:369369333
876 876 a, g dbSNP:530706050
881 881 a, g dbSNP:144805101
897 897 c, t dbSNP:753303896
900 900 a, g dbSNP:759423137
904 904 a, g dbSNP:200252755
907 907 c, t dbSNP:778655162
908 908 a, g dbSNP:111896041
916 916 a, g dbSNP:748117051
930 930 a, t dbSNP:752139090
934 934 g, t dbSNP:771966581
937 937 c, t dbSNP:777614326
942 942 c, t dbSNP:746853000
946 946 c, g dbSNP:771250137
947 947 a, g dbSNP:199673903
949 949 a, g dbSNP:759640597
950 950 g, t dbSNP:373918498
955 955 g, t dbSNP:769931396
971 971 c, t dbSNP:775793760
977 977 a, g dbSNP:763502641
981 981 c, t dbSNP:764557610
983 983 c, t dbSNP:751888992
984 984 a, g dbSNP:762195160
992 992 a, t dbSNP:765964579
996 996 a, g dbSNP:561154406
1002 1002 a, g dbSNP:754375091
1004 1004 a, g dbSNP:758064377
1009 1009 a, c dbSNP:778477892
1014 1014 c, t dbSNP:752211265
1016 1016 c, t dbSNP:758337938
1026 1026 c, t dbSNP:190459228
1029 1029 c, t dbSNP:138855128
1030 1030 a, g dbSNP:770874001
1033 1033 c, t dbSNP:201163382
1035 1035 c, t dbSNP:138575554
1036 1036 a, g, t dbSNP:200906458
1053 1053 c, t dbSNP:202145705
1060 1060 a, g dbSNP:145237292
1061 1061 a, g dbSNP:774859940
1062 1062 c, t dbSNP:762105213
1065 1065 a, g dbSNP:767870817
1068 1068 c, g dbSNP:773628654
1069 1069 c, t dbSNP:727503887
1070 1070 a, g dbSNP:764849762
1074 1074 c, t dbSNP:752222424
1078 1078 -, gggcagagctc dbSNP:766004699
1079 1079 g, t dbSNP:757881397
1086 1086 a, g dbSNP:764076288
1091 1091 a, g dbSNP:751558734
1095 1095 g, t dbSNP:141553491
1102 1102 a, c, g dbSNP:763788839
1104 1104 -, gag dbSNP:751090469
1104 1104 a, g dbSNP:745698305
1107 1107 c, t dbSNP:756328565
1110 1110 a, t dbSNP:780168485
1113 1113 c, t dbSNP:371971257
1115 1115 a, g dbSNP:142790440
1116 1116 c, t dbSNP:541736685
1119 1119 a, g dbSNP:750820184
1123 1123 a, g dbSNP:748646501
1126 1126 c, g dbSNP:772621468
1134 1134 a, g dbSNP:773546947
1135 1135 a, c, g dbSNP:760989930
1136 1136 g, t dbSNP:727503888
1138 1138 c, g dbSNP:775030648
1139 1139 a, c dbSNP:762468710
1142 1142 c, t dbSNP:763703786
1143 1143 a, g dbSNP:569273347
1158 1158 c, g dbSNP:757247552
1160 1160 a, g dbSNP:767601469
1166 1166 a, g dbSNP:515726175
1168 1168 g, t dbSNP:750191719
1170 1170 c, g dbSNP:201165795
1171 1171 g, t dbSNP:755882353
1176 1176 -, a dbSNP:759086398
1186 1186 c, t dbSNP:780263768
1188 1188 c, t dbSNP:554776730
1199 1199 c, t dbSNP:375109382
1204 1204 -, a dbSNP:767119836
1205 1205 a, g, t dbSNP:778946896
1207 1207 a, g dbSNP:772541350
1208 1208 c, t dbSNP:144658100
1215 1215 c, t dbSNP:747352901
1216 1216 g, t dbSNP:771214714
1223 1223 c, g dbSNP:775144404
1230 1230 c, t dbSNP:148512862
1231 1231 c, t dbSNP:151003641
1232 1232 a, g dbSNP:773966429
1236 1236 a, g, t dbSNP:761438840
1237 1237 c, t dbSNP:750339299
1238 1238 g, t dbSNP:2229291
1246 1246 g, t dbSNP:766080131
1251 1251 c, t dbSNP:753720446
1255 1255 c, g, t dbSNP:199894581
1262 1262 c, t dbSNP:752737849
1263 1263 a, c, t dbSNP:749833236
1264 1264 a, g dbSNP:755500312
1272 1272 c, t dbSNP:771537809
1275 1275 c, g dbSNP:781398541
1280 1280 c, g dbSNP:746284903
1285 1285 a, g dbSNP:1799821
1293 1293 c, t dbSNP:774168365
1299 1299 c, t dbSNP:761347926
1303 1303 -, g dbSNP:757979320
1304 1304 a, g dbSNP:771486286
1307 1307 g, t dbSNP:772843417
1320 1320 a, g dbSNP:760514258
1321 1321 c, g dbSNP:144875040
1326 1326 c, g dbSNP:369847007
1328 1328 a, c, g dbSNP:515726176
1331 1331 a, t dbSNP:74315295
1338 1338 c, t dbSNP:752932153
1341 1341 a, c dbSNP:758408111
1345 1345 c, t dbSNP:748181550
1351 1351 c, g dbSNP:777711968
1354 1354 a, t dbSNP:751719701
1358 1358 c, t dbSNP:757683330
1371 1371 c, t dbSNP:767826599
1372 1372 a, g dbSNP:201745292
1378 1378 c, t dbSNP:746186600
1385 1385 g, t dbSNP:146670074
1392 1392 a, c dbSNP:773474888
1397 1397 c, t dbSNP:778639977
1404 1404 -, ct dbSNP:752373512
1404 1404 c, t dbSNP:747794860
1406 1406 c, g dbSNP:771811692
1408 1408 a, g dbSNP:772572668
1411 1411 a, g dbSNP:746567260
1412 1412 c, t dbSNP:372102993
1415 1415 c, t dbSNP:375957043
1416 1416 a, c, g dbSNP:112914907
1417 1417 g, t dbSNP:575447822
1419 1419 a, g dbSNP:544400632
1421 1421 -, ag dbSNP:397509431
1422 1422 -, ga dbSNP:398123153
1425 1425 a, g dbSNP:763073192
1430 1430 a, g dbSNP:201008705
1434 1434 c, g, t dbSNP:576822710
1436 1436 a, g dbSNP:368989271
1438 1438 c, g, t dbSNP:767852112
1442 1442 a, c, g dbSNP:373420308
1446 1446 c, t dbSNP:749714778
1449 1449 -, ttt dbSNP:777506825
1457 1457 c, g dbSNP:757953266
1461 1461 c, t dbSNP:376445618
1467 1467 a, g, t dbSNP:187044944
1471 1471 a, g dbSNP:770491351
1473 1473 c, t dbSNP:776488578
1480 1480 a, c dbSNP:745804213
1485 1485 g, t dbSNP:769781310
1493 1493 c, t dbSNP:775246158
1495 1495 a, g dbSNP:374201361
1496 1496 a, t dbSNP:377616144
1510 1510 a, g dbSNP:774644103
1511 1511 a, t dbSNP:761731998
1512 1512 c, t dbSNP:767699548
1518 1518 c, t dbSNP:143075786
1519 1519 a, g dbSNP:555126720
1524 1524 g, t dbSNP:767030994
1525 1525 c, t dbSNP:74315297
1531 1531 a, t dbSNP:755395180
1532 1532 a, g dbSNP:777236101
1543 1543 g, t dbSNP:74315299
1551 1551 a, g dbSNP:746683786
1552 1552 a, g, t dbSNP:756931329
1554 1554 a, g dbSNP:745432304
1555 1555 a, c dbSNP:147276580
1566 1566 g, t dbSNP:779999942
1569 1569 c, t dbSNP:748976396
1571 1571 c, g dbSNP:560189631
1572 1572 -, g dbSNP:35237240
1575 1575 c, t dbSNP:201681645
1577 1577 -, cagttgcccagct dbSNP:753781632
1579 1579 a, g dbSNP:762081022
1580 1580 c, t dbSNP:200399018
1587 1587 a, g dbSNP:140771069
1591 1591 a, g, t dbSNP:756326862
1597 1597 c, t dbSNP:754386565
1599 1599 a, g dbSNP:761130313
1605 1605 a, c dbSNP:192779168
1611 1611 a, g dbSNP:149557870
1612 1612 c, t dbSNP:770734793
1613 1613 a, g dbSNP:780865183
1619 1619 a, t dbSNP:749895856
1620 1620 c, t dbSNP:370157946
1621 1621 a, g dbSNP:201508063
1624 1624 -, caga dbSNP:757126340
1624 1624 c, g dbSNP:749243696
1634 1634 c, g dbSNP:374183980
1641 1641 c, t dbSNP:201241649
1642 1642 a, g dbSNP:778743524
1643 1643 a, c dbSNP:368132822
1647 1647 a, c dbSNP:143486080
1650 1650 c, t dbSNP:772377335
1657 1657 -, ttatat dbSNP:778894948
1659 1659 -, cgca dbSNP:746000404
1659 1659 c, t dbSNP:548364005
1660 1660 a, g dbSNP:61731996
1665 1665 -, caagcacggccgcac dbSNP:772159469
1671 1671 c, t dbSNP:139321501
1675 1675 c, t dbSNP:374308679
1676 1676 a, g, t dbSNP:776645157
1680 1680 c, t dbSNP:766629203
1681 1681 a, g dbSNP:753074621
1682 1682 -, t dbSNP:780184554
1684 1684 a, t dbSNP:763340721
1686 1686 -, tgg dbSNP:747201636
1690 1690 -, cgcccggcctccgtctataca dbSNP:769170998
1690 1690 c, t dbSNP:74315296
1691 1691 a, g dbSNP:750079911
1694 1694 c, t dbSNP:368311455
1695 1695 a, g, t dbSNP:150953507
1701 1701 c, t dbSNP:140798841
1702 1702 a, g dbSNP:142600166
1709 1709 -, aa dbSNP:777066875
1715 1715 c, g dbSNP:747901054
1719 1719 c, t dbSNP:199573389
1721 1721 a, c, t dbSNP:372368317
1728 1728 c, t dbSNP:201663642
1730 1730 c, t dbSNP:398123154
1742 1742 c, t dbSNP:776754218
1760 1760 a, g dbSNP:186044004
1765 1765 a, g dbSNP:749779852
1771 1771 a, g dbSNP:28936376
1774 1774 c, t dbSNP:539239516
1775 1775 a, g dbSNP:367796030
1777 1777 c, g dbSNP:766004296
1788 1788 g, t dbSNP:141814677
1792 1792 c, t dbSNP:759016933
1793 1793 a, g dbSNP:199996641
1794 1794 a, g dbSNP:267598646
1811 1811 a, g dbSNP:752317041
1813 1813 g, t dbSNP:758390723
1843 1843 a, c dbSNP:749268486
1851 1851 -, c dbSNP:515726178
1852 1852 a, g dbSNP:569609298
1854 1854 a, g, t dbSNP:371443614
1864 1864 c, t dbSNP:781418379
1865 1865 a, g dbSNP:750604350
1877 1877 c, g dbSNP:1871748
1878 1878 -, cacgagca dbSNP:759017526
1880 1880 c, t dbSNP:756414686
1881 1881 a, g dbSNP:77565483
1884 1884 c, t dbSNP:749409744
1886 1886 c, t dbSNP:769108011
1888 1888 -, ct dbSNP:767004984
1890 1890 -, ga dbSNP:752325732
1890 1890 a, g dbSNP:141146189
1893 1893 c, g, t dbSNP:748484701
1894 1894 a, g dbSNP:773695572
1896 1896 -, c dbSNP:760255368
1905 1905 a, g dbSNP:759101149
1908 1908 a, c dbSNP:769539793
1909 1909 c, g dbSNP:775113044
1914 1914 g, t dbSNP:762584123
1920 1920 c, t dbSNP:147953465
1927 1927 c, g dbSNP:751557097
1929 1929 a, g dbSNP:761604642
1930 1930 a, g dbSNP:767201522
1934 1934 c, g dbSNP:201913567
1935 1935 c, t dbSNP:756259411
1936 1936 c, g dbSNP:780286639
1937 1937 a, g dbSNP:753861985
1953 1953 c, g, t dbSNP:755060321
1956 1956 c, t dbSNP:748596204
1963 1963 c, t dbSNP:201996784
1965 1965 c, t dbSNP:540322467
1966 1966 a, g dbSNP:747444819
1971 1971 c, t dbSNP:769535056
1979 1979 a, g dbSNP:566533330
1982 1982 a, g dbSNP:762495053
1986 1986 c, t dbSNP:759970188
1989 1989 c, g dbSNP:768288294
1990 1990 g, t dbSNP:773979732
1992 1992 c, t dbSNP:761631943
1997 1997 a, c dbSNP:28936673
1998 1998 -, c dbSNP:763889116
2000 2000 c, t dbSNP:767530116
2001 2001 a, g, t dbSNP:750144923
2002 2002 g, t dbSNP:112676827
2005 2005 c, t dbSNP:74315293
2011 2011 a, g, t dbSNP:141903761
2015 2015 a, g dbSNP:375766702
2016 2016 a, g dbSNP:752874182
2027 2027 a, g dbSNP:758803512
2037 2037 -, gaaggccttagaa dbSNP:515726179
2038 2038 a, g dbSNP:778379750
2039 2039 a, c dbSNP:747287916
2045 2045 c, t dbSNP:757711106
2050 2050 a, g dbSNP:369202713
2051 2051 a, g dbSNP:748946176
2052 2052 c, t dbSNP:768470420
2053 2053 a, g dbSNP:1799822
2054 2054 c, t dbSNP:747723963
2055 2055 a, g dbSNP:78266699
2057 2057 c, t dbSNP:138125299
2060 2060 a, g dbSNP:760392144
2068 2068 a, g dbSNP:766154734
2077 2077 c, t dbSNP:138893547
2078 2078 a, c dbSNP:373714948
2084 2084 a, g dbSNP:759735713
2096 2096 a, t dbSNP:765487506
2098 2098 a, g dbSNP:377159044
2104 2104 a, t dbSNP:758532461
2105 2105 a, g dbSNP:764451386
2109 2109 a, c dbSNP:752112037
2113 2113 a, t dbSNP:115408040
2115 2115 c, g, t dbSNP:527257375
2122 2122 -, tcc dbSNP:753690164
2126 2126 c, t dbSNP:754633280
2131 2131 c, t dbSNP:778645670
2135 2135 -, aactgggaggccg dbSNP:757040620
2146 2146 c, t dbSNP:61561746
2151 2151 a, g dbSNP:374043834
2153 2153 a, c, g dbSNP:672
2166 2166 c, t dbSNP:6702020
2207 2207 c, t dbSNP:182988415
2254 2254 a, g dbSNP:560594256
2273 2273 a, g dbSNP:1134725
2289 2289 a, g dbSNP:753223538
2296 2296 a, g dbSNP:569468996
2314 2314 a, c dbSNP:758780739
2339 2339 c, t dbSNP:186214647
2354 2354 a, g dbSNP:372200011
2370 2370 g, t dbSNP:373212644
2380 2380 c, g dbSNP:565982553
2392 2392 a, g dbSNP:191416983
2425 2425 a, g dbSNP:1056446
2443 2443 -, c dbSNP:776115215
2452 2452 c, t dbSNP:558161718
2453 2453 a, g dbSNP:578031394
2492 2492 c, g dbSNP:537582868
2501 2501 a, g dbSNP:557500034
2502 2502 c, g dbSNP:751539798
2588 2588 c, t dbSNP:369718292
2589 2589 -, aa dbSNP:374495416
2608 2608 a, g dbSNP:574256743
2645 2645 c, g dbSNP:543259286

Target ORF information:

RefSeq Version XM_005270484
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens carnitine palmitoyltransferase 2 (CPT2), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu17939D
Sequence Information ORF Nucleotide Sequence (Length: 1977bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product carnitine O-palmitoyltransferase 2, mitochondrial precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from U09648.1, AL606760.9 and BU629852.1. This sequence is a reference standard in the RefSeqGene project. On Mar 12, 2008 this sequence version replaced gi:4503022. Summary: The protein encoded by this gene is a nuclear protein which is transported to the mitochondrial inner membrane. Together with carnitine palmitoyltransferase I, the encoded protein oxidizes long-chain fatty acids in the mitochondria. Defects in this gene are associated with mitochondrial long-chain fatty-acid (LCFA) oxidation disorders. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## ##Evidence-Data-START## Transcript exon combination :: U09648.1, BC002445.2 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)417..419(+)
Misc Feature(2)657..2462(+)
Misc Feature(3)1869..1907(+)
Exon (1)1..667
Gene Synonym:
Exon (2)668..748
Gene Synonym:
Exon (3)749..855
Gene Synonym:
Exon (4)856..2160
Gene Synonym:
Exon (5)2161..3094
Gene Synonym:
Position Chain Variation Link
8 8 c, g dbSNP:574413762
39 39 c, t dbSNP:7545725
52 52 g, t dbSNP:570323518
55 55 c, t dbSNP:17848481
111 111 c, g dbSNP:761524923
158 158 -, t dbSNP:746815144
231 231 a, c dbSNP:577034240
236 236 c, t dbSNP:764839327
246 246 g, t dbSNP:546005723
263 263 c, t dbSNP:568723718
267 267 c, g dbSNP:562732877
274 274 a, c, g dbSNP:548768045
275 275 g, t dbSNP:542147940
341 341 a, t dbSNP:377231075
396 396 -, gga dbSNP:773273244
404 404 g, t dbSNP:760556045
405 405 c, t dbSNP:766061600
406 406 c, t dbSNP:369982767
434 434 c, t dbSNP:561846692
438 438 a, c dbSNP:527634657
440 440 a, c dbSNP:547411632
475 475 c, t dbSNP:745619478
507 507 c, t dbSNP:769734759
510 510 g, t dbSNP:780082552
523 523 c, t dbSNP:749532648
537 537 c, t dbSNP:768829380
546 546 -, c dbSNP:764763293
553 553 -, g dbSNP:786204647
557 557 c, t dbSNP:570576290
560 560 g, t dbSNP:761850684
574 574 c, g dbSNP:533282672
599 599 c, t dbSNP:772541454
618 618 c, t dbSNP:2929073
622 622 -, gc dbSNP:754363068
623 623 a, g dbSNP:773734918
637 637 c, t dbSNP:760976212
643 643 c, t dbSNP:766740182
664 664 a, c dbSNP:28936375
668 668 c, g dbSNP:749098104
684 684 -, c dbSNP:758026372
692 692 c, t dbSNP:755209043
696 696 a, g dbSNP:779047870
703 703 a, g dbSNP:748182542
705 705 -, ag dbSNP:765935623
710 710 c, g dbSNP:142598568
715 715 c, g dbSNP:201966320
716 716 a, c dbSNP:747516495
717 717 c, t dbSNP:771406546
719 719 a, g dbSNP:777038982
724 724 -, ct dbSNP:751253358
725 725 c, t dbSNP:370633858
726 726 c, t dbSNP:759866235
733 733 a, g dbSNP:146159244
735 735 a, g dbSNP:773897404
737 737 -, t dbSNP:754532499
739 739 a, g dbSNP:140194675
751 751 a, c dbSNP:150888506
761 761 a, g dbSNP:761554630
764 764 c, t dbSNP:767339394
782 782 c, t dbSNP:768408574
802 802 a, g dbSNP:369596290
809 809 c, g dbSNP:760146368
817 817 c, t dbSNP:75939866
829 829 a, g dbSNP:753737707
836 836 a, g dbSNP:147846614
839 839 c, t dbSNP:764943289
840 840 a, c dbSNP:71654989
848 848 c, t dbSNP:372313619
853 853 c, t dbSNP:74315294
854 854 a, g dbSNP:778017005
856 856 a, g dbSNP:371560287
858 858 c, t dbSNP:762957225
864 864 -, tttga dbSNP:778895906
868 868 a, g dbSNP:148035648
874 874 a, g dbSNP:121918528
880 880 c, t dbSNP:192275019
883 883 c, g dbSNP:757294874
885 885 c, t dbSNP:201065226
887 887 a, g dbSNP:200301403
892 892 c, g, t dbSNP:750572726
893 893 c, t dbSNP:780743357
894 894 a, g dbSNP:199545795
897 897 a, g dbSNP:769160926
902 902 c, g dbSNP:777514571
908 908 c, g, t dbSNP:569391696
914 914 a, g dbSNP:375573986
921 921 g, t dbSNP:554813467
931 931 a, c, g dbSNP:369475478
933 933 a, g dbSNP:774522353
939 939 a, g dbSNP:762688756
948 948 a, t dbSNP:763881188
953 953 a, t dbSNP:751437363
959 959 a, g dbSNP:144686779
963 963 a, g dbSNP:141505320
964 964 c, t dbSNP:750437078
966 966 a, c, t dbSNP:200080591
967 967 a, g dbSNP:515726177
970 970 c, t dbSNP:755331246
976 976 a, g dbSNP:772269793
983 983 -, tg dbSNP:746113590
983 983 c, t dbSNP:138938770
984 984 a, g dbSNP:748607258
996 996 c, t dbSNP:756839691
1014 1014 c, t dbSNP:780940242
1015 1015 a, g dbSNP:144760921
1022 1022 a, c, g dbSNP:769316736
1026 1026 c, t dbSNP:2229292
1035 1035 a, g dbSNP:28936674
1039 1039 c, t dbSNP:773993374
1049 1049 gaaccctgcaaaaagtgacactatc, t dbSNP:515726173
1049 1049 -, gaaccc dbSNP:772240606
1056 1056 -, gcaaaaagtgacactatc dbSNP:775776515
1071 1071 a, c, g dbSNP:377737941
1076 1076 c, t dbSNP:767592132
1078 1078 c, t dbSNP:773503132
1080 1080 a, g dbSNP:760775391
1084 1084 a, g dbSNP:766575997
1090 1090 c, t dbSNP:754042241
1092 1092 c, t dbSNP:375968699
1093 1093 a, g dbSNP:765824169
1094 1094 c, t dbSNP:752975688
1102 1102 a, c dbSNP:758823353
1103 1103 c, t dbSNP:140853350
1106 1106 -, ct dbSNP:760981841
1118 1118 a, g dbSNP:745547578
1119 1119 -, atg dbSNP:769115843
1121 1121 c, t dbSNP:755830520
1126 1126 -, c dbSNP:777297837
1129 1129 a, g dbSNP:779525393
1139 1139 a, t dbSNP:748844820
1141 1141 a, c, t dbSNP:773788921
1142 1142 a, g dbSNP:774374525
1148 1148 a, c dbSNP:201622710
1149 1149 c, t dbSNP:747845465
1153 1153 a, g dbSNP:74315300
1156 1156 c, t dbSNP:515726174
1170 1170 c, t dbSNP:367691827
1172 1172 g, t dbSNP:773236568
1180 1180 a, g dbSNP:760978599
1181 1181 a, c dbSNP:766770153
1182 1182 a, t dbSNP:776833476
1184 1184 -, a dbSNP:762366252
1188 1188 c, t dbSNP:759733220
1189 1189 a, g dbSNP:794727616
1191 1191 c, t dbSNP:147889730
1192 1192 c, t dbSNP:753270905
1195 1195 c, t dbSNP:74315298
1206 1206 c, t dbSNP:373638740
1207 1207 a, g dbSNP:369369333
1208 1208 a, g dbSNP:530706050
1213 1213 a, g dbSNP:144805101
1229 1229 c, t dbSNP:753303896
1232 1232 a, g dbSNP:759423137
1236 1236 a, g dbSNP:200252755
1239 1239 c, t dbSNP:778655162
1240 1240 a, g dbSNP:111896041
1248 1248 a, g dbSNP:748117051
1262 1262 a, t dbSNP:752139090
1266 1266 g, t dbSNP:771966581
1269 1269 c, t dbSNP:777614326
1274 1274 c, t dbSNP:746853000
1278 1278 c, g dbSNP:771250137
1279 1279 a, g dbSNP:199673903
1281 1281 a, g dbSNP:759640597
1282 1282 g, t dbSNP:373918498
1287 1287 g, t dbSNP:769931396
1303 1303 c, t dbSNP:775793760
1309 1309 a, g dbSNP:763502641
1313 1313 c, t dbSNP:764557610
1315 1315 c, t dbSNP:751888992
1316 1316 a, g dbSNP:762195160
1324 1324 a, t dbSNP:765964579
1328 1328 a, g dbSNP:561154406
1334 1334 a, g dbSNP:754375091
1336 1336 a, g dbSNP:758064377
1341 1341 a, c dbSNP:778477892
1346 1346 c, t dbSNP:752211265
1348 1348 c, t dbSNP:758337938
1358 1358 c, t dbSNP:190459228
1361 1361 c, t dbSNP:138855128
1362 1362 a, g dbSNP:770874001
1365 1365 c, t dbSNP:201163382
1367 1367 c, t dbSNP:138575554
1368 1368 a, g, t dbSNP:200906458
1385 1385 c, t dbSNP:202145705
1392 1392 a, g dbSNP:145237292
1393 1393 a, g dbSNP:774859940
1394 1394 c, t dbSNP:762105213
1397 1397 a, g dbSNP:767870817
1400 1400 c, g dbSNP:773628654
1401 1401 c, t dbSNP:727503887
1402 1402 a, g dbSNP:764849762
1406 1406 c, t dbSNP:752222424
1410 1410 -, gggcagagctc dbSNP:766004699
1411 1411 g, t dbSNP:757881397
1418 1418 a, g dbSNP:764076288
1423 1423 a, g dbSNP:751558734
1427 1427 g, t dbSNP:141553491
1434 1434 a, c, g dbSNP:763788839
1436 1436 -, gag dbSNP:751090469
1436 1436 a, g dbSNP:745698305
1439 1439 c, t dbSNP:756328565
1442 1442 a, t dbSNP:780168485
1445 1445 c, t dbSNP:371971257
1447 1447 a, g dbSNP:142790440
1448 1448 c, t dbSNP:541736685
1451 1451 a, g dbSNP:750820184
1455 1455 a, g dbSNP:748646501
1458 1458 c, g dbSNP:772621468
1466 1466 a, g dbSNP:773546947
1467 1467 a, c, g dbSNP:760989930
1468 1468 g, t dbSNP:727503888
1470 1470 c, g dbSNP:775030648
1471 1471 a, c dbSNP:762468710
1474 1474 c, t dbSNP:763703786
1475 1475 a, g dbSNP:569273347
1490 1490 c, g dbSNP:757247552
1492 1492 a, g dbSNP:767601469
1498 1498 a, g dbSNP:515726175
1500 1500 g, t dbSNP:750191719
1502 1502 c, g dbSNP:201165795
1503 1503 g, t dbSNP:755882353
1508 1508 -, a dbSNP:759086398
1518 1518 c, t dbSNP:780263768
1520 1520 c, t dbSNP:554776730
1531 1531 c, t dbSNP:375109382
1536 1536 -, a dbSNP:767119836
1537 1537 a, g, t dbSNP:778946896
1539 1539 a, g dbSNP:772541350
1540 1540 c, t dbSNP:144658100
1547 1547 c, t dbSNP:747352901
1548 1548 g, t dbSNP:771214714
1555 1555 c, g dbSNP:775144404
1562 1562 c, t dbSNP:148512862
1563 1563 c, t dbSNP:151003641
1564 1564 a, g dbSNP:773966429
1568 1568 a, g, t dbSNP:761438840
1569 1569 c, t dbSNP:750339299
1570 1570 g, t dbSNP:2229291
1578 1578 g, t dbSNP:766080131
1583 1583 c, t dbSNP:753720446
1587 1587 c, g, t dbSNP:199894581
1594 1594 c, t dbSNP:752737849
1595 1595 a, c, t dbSNP:749833236
1596 1596 a, g dbSNP:755500312
1604 1604 c, t dbSNP:771537809
1607 1607 c, g dbSNP:781398541
1612 1612 c, g dbSNP:746284903
1617 1617 a, g dbSNP:1799821
1625 1625 c, t dbSNP:774168365
1631 1631 c, t dbSNP:761347926
1635 1635 -, g dbSNP:757979320
1636 1636 a, g dbSNP:771486286
1639 1639 g, t dbSNP:772843417
1652 1652 a, g dbSNP:760514258
1653 1653 c, g dbSNP:144875040
1658 1658 c, g dbSNP:369847007
1660 1660 a, c, g dbSNP:515726176
1663 1663 a, t dbSNP:74315295
1670 1670 c, t dbSNP:752932153
1673 1673 a, c dbSNP:758408111
1677 1677 c, t dbSNP:748181550
1683 1683 c, g dbSNP:777711968
1686 1686 a, t dbSNP:751719701
1690 1690 c, t dbSNP:757683330
1703 1703 c, t dbSNP:767826599
1704 1704 a, g dbSNP:201745292
1710 1710 c, t dbSNP:746186600
1717 1717 g, t dbSNP:146670074
1724 1724 a, c dbSNP:773474888
1729 1729 c, t dbSNP:778639977
1736 1736 -, ct dbSNP:752373512
1736 1736 c, t dbSNP:747794860
1738 1738 c, g dbSNP:771811692
1740 1740 a, g dbSNP:772572668
1743 1743 a, g dbSNP:746567260
1744 1744 c, t dbSNP:372102993
1747 1747 c, t dbSNP:375957043
1748 1748 a, c, g dbSNP:112914907
1749 1749 g, t dbSNP:575447822
1751 1751 a, g dbSNP:544400632
1753 1753 -, ag dbSNP:397509431
1754 1754 -, ga dbSNP:398123153
1757 1757 a, g dbSNP:763073192
1762 1762 a, g dbSNP:201008705
1766 1766 c, g, t dbSNP:576822710
1768 1768 a, g dbSNP:368989271
1770 1770 c, g, t dbSNP:767852112
1774 1774 a, c, g dbSNP:373420308
1778 1778 c, t dbSNP:749714778
1781 1781 -, ttt dbSNP:777506825
1789 1789 c, g dbSNP:757953266
1793 1793 c, t dbSNP:376445618
1799 1799 a, g, t dbSNP:187044944
1803 1803 a, g dbSNP:770491351
1805 1805 c, t dbSNP:776488578
1812 1812 a, c dbSNP:745804213
1817 1817 g, t dbSNP:769781310
1825 1825 c, t dbSNP:775246158
1827 1827 a, g dbSNP:374201361
1828 1828 a, t dbSNP:377616144
1842 1842 a, g dbSNP:774644103
1843 1843 a, t dbSNP:761731998
1844 1844 c, t dbSNP:767699548
1850 1850 c, t dbSNP:143075786
1851 1851 a, g dbSNP:555126720
1856 1856 g, t dbSNP:767030994
1857 1857 c, t dbSNP:74315297
1863 1863 a, t dbSNP:755395180
1864 1864 a, g dbSNP:777236101
1875 1875 g, t dbSNP:74315299
1883 1883 a, g dbSNP:746683786
1884 1884 a, g, t dbSNP:756931329
1886 1886 a, g dbSNP:745432304
1887 1887 a, c dbSNP:147276580
1898 1898 g, t dbSNP:779999942
1901 1901 c, t dbSNP:748976396
1903 1903 c, g dbSNP:560189631
1904 1904 -, g dbSNP:35237240
1907 1907 c, t dbSNP:201681645
1909 1909 -, cagttgcccagct dbSNP:753781632
1911 1911 a, g dbSNP:762081022
1912 1912 c, t dbSNP:200399018
1919 1919 a, g dbSNP:140771069
1923 1923 a, g, t dbSNP:756326862
1929 1929 c, t dbSNP:754386565
1931 1931 a, g dbSNP:761130313
1937 1937 a, c dbSNP:192779168
1943 1943 a, g dbSNP:149557870
1944 1944 c, t dbSNP:770734793
1945 1945 a, g dbSNP:780865183
1951 1951 a, t dbSNP:749895856
1952 1952 c, t dbSNP:370157946
1953 1953 a, g dbSNP:201508063
1956 1956 -, caga dbSNP:757126340
1956 1956 c, g dbSNP:749243696
1966 1966 c, g dbSNP:374183980
1973 1973 c, t dbSNP:201241649
1974 1974 a, g dbSNP:778743524
1975 1975 a, c dbSNP:368132822
1979 1979 a, c dbSNP:143486080
1982 1982 c, t dbSNP:772377335
1989 1989 -, ttatat dbSNP:778894948
1991 1991 -, cgca dbSNP:746000404
1991 1991 c, t dbSNP:548364005
1992 1992 a, g dbSNP:61731996
1997 1997 -, caagcacggccgcac dbSNP:772159469
2003 2003 c, t dbSNP:139321501
2007 2007 c, t dbSNP:374308679
2008 2008 a, g, t dbSNP:776645157
2012 2012 c, t dbSNP:766629203
2013 2013 a, g dbSNP:753074621
2014 2014 -, t dbSNP:780184554
2016 2016 a, t dbSNP:763340721
2018 2018 -, tgg dbSNP:747201636
2022 2022 -, cgcccggcctccgtctataca dbSNP:769170998
2022 2022 c, t dbSNP:74315296
2023 2023 a, g dbSNP:750079911
2026 2026 c, t dbSNP:368311455
2027 2027 a, g, t dbSNP:150953507
2033 2033 c, t dbSNP:140798841
2034 2034 a, g dbSNP:142600166
2041 2041 -, aa dbSNP:777066875
2047 2047 c, g dbSNP:747901054
2051 2051 c, t dbSNP:199573389
2053 2053 a, c, t dbSNP:372368317
2060 2060 c, t dbSNP:201663642
2062 2062 c, t dbSNP:398123154
2074 2074 c, t dbSNP:776754218
2093 2093 c, t dbSNP:113493395
2113 2113 c, t dbSNP:144703247
2117 2117 a, g dbSNP:148110518
2119 2119 a, g dbSNP:755304451
2126 2126 a, g dbSNP:764435641
2148 2148 a, g dbSNP:774755571
2149 2149 a, c dbSNP:17848485
2161 2161 a, g dbSNP:186044004
2166 2166 a, g dbSNP:749779852
2172 2172 a, g dbSNP:28936376
2175 2175 c, t dbSNP:539239516
2176 2176 a, g dbSNP:367796030
2178 2178 c, g dbSNP:766004296
2189 2189 g, t dbSNP:141814677
2193 2193 c, t dbSNP:759016933
2194 2194 a, g dbSNP:199996641
2195 2195 a, g dbSNP:267598646
2212 2212 a, g dbSNP:752317041
2214 2214 g, t dbSNP:758390723
2244 2244 a, c dbSNP:749268486
2252 2252 -, c dbSNP:515726178
2253 2253 a, g dbSNP:569609298
2255 2255 a, g, t dbSNP:371443614
2265 2265 c, t dbSNP:781418379
2266 2266 a, g dbSNP:750604350
2278 2278 c, g dbSNP:1871748
2279 2279 -, cacgagca dbSNP:759017526
2281 2281 c, t dbSNP:756414686
2282 2282 a, g dbSNP:77565483
2285 2285 c, t dbSNP:749409744
2287 2287 c, t dbSNP:769108011
2289 2289 -, ct dbSNP:767004984
2291 2291 -, ga dbSNP:752325732
2291 2291 a, g dbSNP:141146189
2294 2294 c, g, t dbSNP:748484701
2295 2295 a, g dbSNP:773695572
2297 2297 -, c dbSNP:760255368
2306 2306 a, g dbSNP:759101149
2309 2309 a, c dbSNP:769539793
2310 2310 c, g dbSNP:775113044
2315 2315 g, t dbSNP:762584123
2321 2321 c, t dbSNP:147953465
2328 2328 c, g dbSNP:751557097
2330 2330 a, g dbSNP:761604642
2331 2331 a, g dbSNP:767201522
2335 2335 c, g dbSNP:201913567
2336 2336 c, t dbSNP:756259411
2337 2337 c, g dbSNP:780286639
2338 2338 a, g dbSNP:753861985
2354 2354 c, g, t dbSNP:755060321
2357 2357 c, t dbSNP:748596204
2364 2364 c, t dbSNP:201996784
2366 2366 c, t dbSNP:540322467
2367 2367 a, g dbSNP:747444819
2372 2372 c, t dbSNP:769535056
2380 2380 a, g dbSNP:566533330
2383 2383 a, g dbSNP:762495053
2387 2387 c, t dbSNP:759970188
2390 2390 c, g dbSNP:768288294
2391 2391 g, t dbSNP:773979732
2393 2393 c, t dbSNP:761631943
2398 2398 a, c dbSNP:28936673
2399 2399 -, c dbSNP:763889116
2401 2401 c, t dbSNP:767530116
2402 2402 a, g, t dbSNP:750144923
2403 2403 g, t dbSNP:112676827
2406 2406 c, t dbSNP:74315293
2412 2412 a, g, t dbSNP:141903761
2416 2416 a, g dbSNP:375766702
2417 2417 a, g dbSNP:752874182
2428 2428 a, g dbSNP:758803512
2438 2438 -, gaaggccttagaa dbSNP:515726179
2439 2439 a, g dbSNP:778379750
2440 2440 a, c dbSNP:747287916
2446 2446 c, t dbSNP:757711106
2451 2451 a, g dbSNP:369202713
2452 2452 a, g dbSNP:748946176
2453 2453 c, t dbSNP:768470420
2454 2454 a, g dbSNP:1799822
2455 2455 c, t dbSNP:747723963
2456 2456 a, g dbSNP:78266699
2458 2458 c, t dbSNP:138125299
2461 2461 a, g dbSNP:760392144
2469 2469 a, g dbSNP:766154734
2478 2478 c, t dbSNP:138893547
2479 2479 a, c dbSNP:373714948
2485 2485 a, g dbSNP:759735713
2497 2497 a, t dbSNP:765487506
2499 2499 a, g dbSNP:377159044
2505 2505 a, t dbSNP:758532461
2506 2506 a, g dbSNP:764451386
2510 2510 a, c dbSNP:752112037
2514 2514 a, t dbSNP:115408040
2516 2516 c, g, t dbSNP:527257375
2523 2523 -, tcc dbSNP:753690164
2527 2527 c, t dbSNP:754633280
2532 2532 c, t dbSNP:778645670
2536 2536 -, aactgggaggccg dbSNP:757040620
2547 2547 c, t dbSNP:61561746
2552 2552 a, g dbSNP:374043834
2554 2554 a, c, g dbSNP:672
2567 2567 c, t dbSNP:6702020
2608 2608 c, t dbSNP:182988415
2655 2655 a, g dbSNP:560594256
2674 2674 a, g dbSNP:1134725
2690 2690 a, g dbSNP:753223538
2697 2697 a, g dbSNP:569468996
2715 2715 a, c dbSNP:758780739
2740 2740 c, t dbSNP:186214647
2755 2755 a, g dbSNP:372200011
2771 2771 g, t dbSNP:373212644
2781 2781 c, g dbSNP:565982553
2793 2793 a, g dbSNP:191416983
2826 2826 a, g dbSNP:1056446
2844 2844 -, c dbSNP:776115215
2853 2853 c, t dbSNP:558161718
2854 2854 a, g dbSNP:578031394
2893 2893 c, g dbSNP:537582868
2902 2902 a, g dbSNP:557500034
2903 2903 c, g dbSNP:751539798
2989 2989 c, t dbSNP:369718292
2990 2990 -, aa dbSNP:374495416
3009 3009 a, g dbSNP:574256743
3046 3046 c, g dbSNP:543259286

Target ORF information:

RefSeq Version NM_000098
Organism Homo sapiens (human)
Definition Homo sapiens carnitine palmitoyltransferase 2 (CPT2), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.