
CPT2 cDNA ORF clone, Homo sapiens (human)

Gene Symbol CPT2
Entrez Gene ID 1376
Full Name carnitine palmitoyltransferase 2
Synonyms CPT1, CPTASE, IIAE4
General protein information
Preferred Names
carnitine O-palmitoyltransferase 2, mitochondrial
carnitine O-palmitoyltransferase 2, mitochondrial
carnitine palmitoyltransferase II
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a nuclear protein which is transported to the mitochondrial inner membrane. Together with carnitine palmitoyltransferase I, the encoded protein oxidizes long-chain fatty acids in the mitochondria. Defects in this gene are associated with mitochondrial long-chain fatty-acid (LCFA) oxidation disorders. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Myopathy due to CPT II deficiency, 255110 (3); CPT deficiency,

mRNA and Protein(s)

mRNA Protein Name
XM_005270484 XP_005270541 carnitine O-palmitoyltransferase 2, mitochondrial isoform X1
NM_000098 NP_000089 carnitine O-palmitoyltransferase 2, mitochondrial precursor

hsa00071 Fatty acid degradation
hsa03320 PPAR signaling pathway
hsa01212 Fatty acid metabolism
R-HSA-1430728 Metabolism
R-HSA-556833 Metabolism of lipids and lipoproteins
R-HSA-535734 Fatty acid, triacylglycerol, and ketone body metabolism
R-HSA-400206 Regulation of lipid metabolism by Peroxisome proliferator-activated receptor alpha (PPARalpha)
R-HSA-1989781 PPARA activates gene expression
R-HSA-200425 Import of palmitoyl-CoA into the mitochondrial matrix
WP368 Mitochondrial LC-Fatty Acid Beta-Oxidation
WP143 Fatty Acid Beta Oxidation
HUMAN_PWY-6111 mitochondrial L-carnitine shuttle

Homo sapiens (human) CPT2 NP_000089.1
Pan troglodytes (chimpanzee) CPT2 XP_001148628.1
Macaca mulatta (Rhesus monkey) CPT2 XP_001112489.1
Canis lupus familiaris (dog) CPT2 XP_546705.1
Bos taurus (cattle) CPT2 NP_001039354.1
Mus musculus (house mouse) Cpt2 NP_034079.2
Rattus norvegicus (Norway rat) Cpt2 NP_037062.1
Gallus gallus (chicken) CPT2 NP_001026458.2
Danio rerio (zebrafish) cpt2 NP_001007448.1
Drosophila melanogaster (fruit fly) CG2107 NP_647756.1
Caenorhabditis elegans cpt-2 NP_001040977.1
Xenopus (Silurana) tropicalis (western clawed frog) cpt2 NP_989193.1


ID Name Evidence
GO:0005739 mitochondrion IDA
GO:0005743 mitochondrial inner membrane EXP
GO:0005743 mitochondrial inner membrane NAS
GO:0016020 membrane IEA


ID Name Evidence
GO:0004095 carnitine O-palmitoyltransferase activity EXP
GO:0004095 carnitine O-palmitoyltransferase activity NAS
GO:0008415 acyltransferase activity IEA
GO:0016740 transferase activity IEA


ID Name Evidence
GO:0006631 fatty acid metabolic process IEA
GO:0006635 fatty acid beta-oxidation NAS
GO:0006810 transport IEA
GO:0006853 carnitine shuttle EXP
GO:0044255 cellular lipid metabolic process TAS
GO:0046320 regulation of fatty acid oxidation EXP

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following CPT2 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the CPT2 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu33029 XM_005270484 PREDICTED: Homo sapiens carnitine palmitoyltransferase 2 (CPT2), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $307.30
OHu17939 NM_000098 Homo sapiens carnitine palmitoyltransferase 2 (CPT2), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $69.30

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu33029
Accession Version XM_005270484.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1908bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product carnitine O-palmitoyltransferase 2, mitochondrial isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_032977.10) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)325..2061(+)
Position Chain Variation Link
9 9 a, t dbSNP:377231075
64 64 -, gga dbSNP:773273244
72 72 g, t dbSNP:760556045
73 73 c, t dbSNP:766061600
74 74 c, t dbSNP:369982767
102 102 c, t dbSNP:561846692
106 106 a, c dbSNP:527634657
108 108 a, c dbSNP:547411632
143 143 c, t dbSNP:745619478
175 175 c, t dbSNP:769734759
178 178 g, t dbSNP:780082552
191 191 c, t dbSNP:749532648
205 205 c, t dbSNP:768829380
214 214 -, c dbSNP:764763293
221 221 -, g dbSNP:786204647
225 225 c, t dbSNP:570576290
228 228 g, t dbSNP:761850684
242 242 c, g dbSNP:533282672
267 267 c, t dbSNP:772541454
286 286 c, t dbSNP:2929073
290 290 -, gc dbSNP:754363068
291 291 a, g dbSNP:773734918
305 305 c, t dbSNP:760976212
311 311 c, t dbSNP:766740182
332 332 a, c dbSNP:28936375
336 336 c, g dbSNP:749098104
352 352 -, c dbSNP:758026372
360 360 c, t dbSNP:755209043
364 364 a, g dbSNP:779047870
371 371 a, g dbSNP:748182542
373 373 -, ag dbSNP:765935623
378 378 c, g dbSNP:142598568
383 383 c, g dbSNP:201966320
384 384 a, c dbSNP:747516495
385 385 c, t dbSNP:771406546
387 387 a, g dbSNP:777038982
392 392 -, ct dbSNP:751253358
393 393 c, t dbSNP:370633858
394 394 c, t dbSNP:759866235
401 401 a, g dbSNP:146159244
403 403 a, g dbSNP:773897404
405 405 -, t dbSNP:754532499
407 407 a, g dbSNP:140194675
419 419 a, c dbSNP:150888506
429 429 a, g dbSNP:761554630
432 432 c, t dbSNP:767339394
450 450 c, t dbSNP:768408574
470 470 a, g dbSNP:369596290
477 477 c, g dbSNP:760146368
485 485 c, t dbSNP:75939866
497 497 a, g dbSNP:753737707
504 504 a, g dbSNP:147846614
507 507 c, t dbSNP:764943289
508 508 a, c dbSNP:71654989
516 516 c, t dbSNP:372313619
521 521 c, t dbSNP:74315294
522 522 a, g dbSNP:778017005
524 524 a, g dbSNP:371560287
526 526 c, t dbSNP:762957225
532 532 -, tttga dbSNP:778895906
536 536 a, g dbSNP:148035648
542 542 a, g dbSNP:121918528
548 548 c, t dbSNP:192275019
551 551 c, g dbSNP:757294874
553 553 c, t dbSNP:201065226
555 555 a, g dbSNP:200301403
560 560 c, g, t dbSNP:750572726
561 561 c, t dbSNP:780743357
562 562 a, g dbSNP:199545795
565 565 a, g dbSNP:769160926
570 570 c, g dbSNP:777514571
576 576 c, g, t dbSNP:569391696
582 582 a, g dbSNP:375573986
589 589 g, t dbSNP:554813467
599 599 a, c, g dbSNP:369475478
601 601 a, g dbSNP:774522353
607 607 a, g dbSNP:762688756
616 616 a, t dbSNP:763881188
621 621 a, t dbSNP:751437363
627 627 a, g dbSNP:144686779
631 631 a, g dbSNP:141505320
632 632 c, t dbSNP:750437078
634 634 a, c, t dbSNP:200080591
635 635 a, g dbSNP:515726177
638 638 c, t dbSNP:755331246
644 644 a, g dbSNP:772269793
651 651 -, tg dbSNP:746113590
651 651 c, t dbSNP:138938770
652 652 a, g dbSNP:748607258
664 664 c, t dbSNP:756839691
682 682 c, t dbSNP:780940242
683 683 a, g dbSNP:144760921
690 690 a, c, g dbSNP:769316736
694 694 c, t dbSNP:2229292
703 703 a, g dbSNP:28936674
707 707 c, t dbSNP:773993374
717 717 gaaccctgcaaaaagtgacactatc, t dbSNP:515726173
717 717 -, gaaccc dbSNP:772240606
724 724 -, gcaaaaagtgacactatc dbSNP:775776515
739 739 a, c, g dbSNP:377737941
744 744 c, t dbSNP:767592132
746 746 c, t dbSNP:773503132
748 748 a, g dbSNP:760775391
752 752 a, g dbSNP:766575997
758 758 c, t dbSNP:754042241
760 760 c, t dbSNP:375968699
761 761 a, g dbSNP:765824169
762 762 c, t dbSNP:752975688
770 770 a, c dbSNP:758823353
771 771 c, t dbSNP:140853350
774 774 -, ct dbSNP:760981841
786 786 a, g dbSNP:745547578
787 787 -, atg dbSNP:769115843
789 789 c, t dbSNP:755830520
794 794 -, c dbSNP:777297837
797 797 a, g dbSNP:779525393
807 807 a, t dbSNP:748844820
809 809 a, c, t dbSNP:773788921
810 810 a, g dbSNP:774374525
816 816 a, c dbSNP:201622710
817 817 c, t dbSNP:747845465
821 821 a, g dbSNP:74315300
824 824 c, t dbSNP:515726174
838 838 c, t dbSNP:367691827
840 840 g, t dbSNP:773236568
848 848 a, g dbSNP:760978599
849 849 a, c dbSNP:766770153
850 850 a, t dbSNP:776833476
852 852 -, a dbSNP:762366252
856 856 c, t dbSNP:759733220
857 857 a, g dbSNP:794727616
859 859 c, t dbSNP:147889730
860 860 c, t dbSNP:753270905
863 863 c, t dbSNP:74315298
874 874 c, t dbSNP:373638740
875 875 a, g dbSNP:369369333
876 876 a, g dbSNP:530706050
881 881 a, g dbSNP:144805101
897 897 c, t dbSNP:753303896
900 900 a, g dbSNP:759423137
904 904 a, g dbSNP:200252755
907 907 c, t dbSNP:778655162
908 908 a, g dbSNP:111896041
916 916 a, g dbSNP:748117051
930 930 a, t dbSNP:752139090
934 934 g, t dbSNP:771966581
937 937 c, t dbSNP:777614326
942 942 c, t dbSNP:746853000
946 946 c, g dbSNP:771250137
947 947 a, g dbSNP:199673903
949 949 a, g dbSNP:759640597
950 950 g, t dbSNP:373918498
955 955 g, t dbSNP:769931396
971 971 c, t dbSNP:775793760
977 977 a, g dbSNP:763502641
981 981 c, t dbSNP:764557610
983 983 c, t dbSNP:751888992
984 984 a, g dbSNP:762195160
992 992 a, t dbSNP:765964579
996 996 a, g dbSNP:561154406
1002 1002 a, g dbSNP:754375091
1004 1004 a, g dbSNP:758064377
1009 1009 a, c dbSNP:778477892
1014 1014 c, t dbSNP:752211265
1016 1016 c, t dbSNP:758337938
1026 1026 c, t dbSNP:190459228
1029 1029 c, t dbSNP:138855128
1030 1030 a, g dbSNP:770874001
1033 1033 c, t dbSNP:201163382
1035 1035 c, t dbSNP:138575554
1036 1036 a, g, t dbSNP:200906458
1053 1053 c, t dbSNP:202145705
1060 1060 a, g dbSNP:145237292
1061 1061 a, g dbSNP:774859940
1062 1062 c, t dbSNP:762105213
1065 1065 a, g dbSNP:767870817
1068 1068 c, g dbSNP:773628654
1069 1069 c, t dbSNP:727503887
1070 1070 a, g dbSNP:764849762
1074 1074 c, t dbSNP:752222424
1078 1078 -, gggcagagctc dbSNP:766004699
1079 1079 g, t dbSNP:757881397
1086 1086 a, g dbSNP:764076288
1091 1091 a, g dbSNP:751558734
1095 1095 g, t dbSNP:141553491
1102 1102 a, c, g dbSNP:763788839
1104 1104 -, gag dbSNP:751090469
1104 1104 a, g dbSNP:745698305
1107 1107 c, t dbSNP:756328565
1110 1110 a, t dbSNP:780168485
1113 1113 c, t dbSNP:371971257
1115 1115 a, g dbSNP:142790440
1116 1116 c, t dbSNP:541736685
1119 1119 a, g dbSNP:750820184
1123 1123 a, g dbSNP:748646501
1126 1126 c, g dbSNP:772621468
1134 1134 a, g dbSNP:773546947
1135 1135 a, c, g dbSNP:760989930
1136 1136 g, t dbSNP:727503888
1138 1138 c, g dbSNP:775030648
1139 1139 a, c dbSNP:762468710
1142 1142 c, t dbSNP:763703786
1143 1143 a, g dbSNP:569273347
1158 1158 c, g dbSNP:757247552
1160 1160 a, g dbSNP:767601469
1166 1166 a, g dbSNP:515726175
1168 1168 g, t dbSNP:750191719
1170 1170 c, g dbSNP:201165795
1171 1171 g, t dbSNP:755882353
1176 1176 -, a dbSNP:759086398
1186 1186 c, t dbSNP:780263768
1188 1188 c, t dbSNP:554776730
1199 1199 c, t dbSNP:375109382
1204 1204 -, a dbSNP:767119836
1205 1205 a, g, t dbSNP:778946896
1207 1207 a, g dbSNP:772541350
1208 1208 c, t dbSNP:144658100
1215 1215 c, t dbSNP:747352901
1216 1216 g, t dbSNP:771214714
1223 1223 c, g dbSNP:775144404
1230 1230 c, t dbSNP:148512862
1231 1231 c, t dbSNP:151003641
1232 1232 a, g dbSNP:773966429
1236 1236 a, g, t dbSNP:761438840
1237 1237 c, t dbSNP:750339299
1238 1238 g, t dbSNP:2229291
1246 1246 g, t dbSNP:766080131
1251 1251 c, t dbSNP:753720446
1255 1255 c, g, t dbSNP:199894581
1262 1262 c, t dbSNP:752737849
1263 1263 a, c, t dbSNP:749833236
1264 1264 a, g dbSNP:755500312
1272 1272 c, t dbSNP:771537809
1275 1275 c, g dbSNP:781398541
1280 1280 c, g dbSNP:746284903
1285 1285 a, g dbSNP:1799821
1293 1293 c, t dbSNP:774168365
1299 1299 c, t dbSNP:761347926
1303 1303 -, g dbSNP:757979320
1304 1304 a, g dbSNP:771486286
1307 1307 g, t dbSNP:772843417
1320 1320 a, g dbSNP:760514258
1321 1321 c, g dbSNP:144875040
1326 1326 c, g dbSNP:369847007
1328 1328 a, c, g dbSNP:515726176
1331 1331 a, t dbSNP:74315295
1338 1338 c, t dbSNP:752932153
1341 1341 a, c dbSNP:758408111
1345 1345 c, t dbSNP:748181550
1351 1351 c, g dbSNP:777711968
1354 1354 a, t dbSNP:751719701
1358 1358 c, t dbSNP:757683330
1371 1371 c, t dbSNP:767826599
1372 1372 a, g dbSNP:201745292
1378 1378 c, t dbSNP:746186600
1385 1385 g, t dbSNP:146670074
1392 1392 a, c dbSNP:773474888
1397 1397 c, t dbSNP:778639977
1404 1404 -, ct dbSNP:752373512
1404 1404 c, t dbSNP:747794860
1406 1406 c, g dbSNP:771811692
1408 1408 a, g dbSNP:772572668
1411 1411 a, g dbSNP:746567260
1412 1412 c, t dbSNP:372102993
1415 1415 c, t dbSNP:375957043
1416 1416 a, c, g dbSNP:112914907
1417 1417 g, t dbSNP:575447822
1419 1419 a, g dbSNP:544400632
1421 1421 -, ag dbSNP:397509431
1422 1422 -, ga dbSNP:398123153
1425 1425 a, g dbSNP:763073192
1430 1430 a, g dbSNP:201008705
1434 1434 c, g, t dbSNP:576822710
1436 1436 a, g dbSNP:368989271
1438 1438 c, g, t dbSNP:767852112
1442 1442 a, c, g dbSNP:373420308
1446 1446 c, t dbSNP:749714778
1449 1449 -, ttt dbSNP:777506825
1457 1457 c, g dbSNP:757953266
1461 1461 c, t dbSNP:376445618
1467 1467 a, g, t dbSNP:187044944
1471 1471 a, g dbSNP:770491351
1473 1473 c, t dbSNP:776488578
1480 1480 a, c dbSNP:745804213
1485 1485 g, t dbSNP:769781310
1493 1493 c, t dbSNP:775246158
1495 1495 a, g dbSNP:374201361
1496 1496 a, t dbSNP:377616144
1510 1510 a, g dbSNP:774644103
1511 1511 a, t dbSNP:761731998
1512 1512 c, t dbSNP:767699548
1518 1518 c, t dbSNP:143075786
1519 1519 a, g dbSNP:555126720
1524 1524 g, t dbSNP:767030994
1525 1525 c, t dbSNP:74315297
1531 1531 a, t dbSNP:755395180
1532 1532 a, g dbSNP:777236101
1543 1543 g, t dbSNP:74315299
1551 1551 a, g dbSNP:746683786
1552 1552 a, g, t dbSNP:756931329
1554 1554 a, g dbSNP:745432304
1555 1555 a, c dbSNP:147276580
1566 1566 g, t dbSNP:779999942
1569 1569 c, t dbSNP:748976396
1571 1571 c, g dbSNP:560189631
1572 1572 -, g dbSNP:35237240
1575 1575 c, t dbSNP:201681645
1577 1577 -, cagttgcccagct dbSNP:753781632
1579 1579 a, g dbSNP:762081022
1580 1580 c, t dbSNP:200399018
1587 1587 a, g dbSNP:140771069
1591 1591 a, g, t dbSNP:756326862
1597 1597 c, t dbSNP:754386565
1599 1599 a, g dbSNP:761130313
1605 1605 a, c dbSNP:192779168
1611 1611 a, g dbSNP:149557870
1612 1612 c, t dbSNP:770734793
1613 1613 a, g dbSNP:780865183
1619 1619 a, t dbSNP:749895856
1620 1620 c, t dbSNP:370157946
1621 1621 a, g dbSNP:201508063
1624 1624 -, caga dbSNP:757126340
1624 1624 c, g dbSNP:749243696
1634 1634 c, g dbSNP:374183980
1641 1641 c, t dbSNP:201241649
1642 1642 a, g dbSNP:778743524
1643 1643 a, c dbSNP:368132822
1647 1647 a, c dbSNP:143486080
1650 1650 c, t dbSNP:772377335
1657 1657 -, ttatat dbSNP:778894948
1659 1659 -, cgca dbSNP:746000404
1659 1659 c, t dbSNP:548364005
1660 1660 a, g dbSNP:61731996
1665 1665 -, caagcacggccgcac dbSNP:772159469
1671 1671 c, t dbSNP:139321501
1675 1675 c, t dbSNP:374308679
1676 1676 a, g, t dbSNP:776645157
1680 1680 c, t dbSNP:766629203
1681 1681 a, g dbSNP:753074621
1682 1682 -, t dbSNP:780184554
1684 1684 a, t dbSNP:763340721
1686 1686 -, tgg dbSNP:747201636
1690 1690 -, cgcccggcctccgtctataca dbSNP:769170998
1690 1690 c, t dbSNP:74315296
1691 1691 a, g dbSNP:750079911
1694 1694 c, t dbSNP:368311455
1695 1695 a, g, t dbSNP:150953507
1701 1701 c, t dbSNP:140798841
1702 1702 a, g dbSNP:142600166
1709 1709 -, aa dbSNP:777066875
1715 1715 c, g dbSNP:747901054
1719 1719 c, t dbSNP:199573389
1721 1721 a, c, t dbSNP:372368317
1728 1728 c, t dbSNP:201663642
1730 1730 c, t dbSNP:398123154
1742 1742 c, t dbSNP:776754218
1760 1760 a, g dbSNP:186044004
1765 1765 a, g dbSNP:749779852
1771 1771 a, g dbSNP:28936376
1774 1774 c, t dbSNP:539239516
1775 1775 a, g dbSNP:367796030
1777 1777 c, g dbSNP:766004296
1788 1788 g, t dbSNP:141814677
1792 1792 c, t dbSNP:759016933
1793 1793 a, g dbSNP:199996641
1794 1794 a, g dbSNP:267598646
1811 1811 a, g dbSNP:752317041
1813 1813 g, t dbSNP:758390723
1843 1843 a, c dbSNP:749268486
1851 1851 -, c dbSNP:515726178
1852 1852 a, g dbSNP:569609298
1854 1854 a, g, t dbSNP:371443614
1864 1864 c, t dbSNP:781418379
1865 1865 a, g dbSNP:750604350
1877 1877 c, g dbSNP:1871748
1878 1878 -, cacgagca dbSNP:759017526
1880 1880 c, t dbSNP:756414686
1881 1881 a, g dbSNP:77565483
1884 1884 c, t dbSNP:749409744
1886 1886 c, t dbSNP:769108011
1888 1888 -, ct dbSNP:767004984
1890 1890 -, ga dbSNP:752325732
1890 1890 a, g dbSNP:141146189
1893 1893 c, g, t dbSNP:748484701
1894 1894 a, g dbSNP:773695572
1896 1896 -, c dbSNP:760255368
1905 1905 a, g dbSNP:759101149
1908 1908 a, c dbSNP:769539793
1909 1909 c, g dbSNP:775113044
1914 1914 g, t dbSNP:762584123
1920 1920 c, t dbSNP:147953465
1927 1927 c, g dbSNP:751557097
1929 1929 a, g dbSNP:761604642
1930 1930 a, g dbSNP:767201522
1934 1934 c, g dbSNP:201913567
1935 1935 c, t dbSNP:756259411
1936 1936 c, g dbSNP:780286639
1937 1937 a, g dbSNP:753861985
1953 1953 c, g, t dbSNP:755060321
1956 1956 c, t dbSNP:748596204
1963 1963 c, t dbSNP:201996784
1965 1965 c, t dbSNP:540322467
1966 1966 a, g dbSNP:747444819
1971 1971 c, t dbSNP:769535056
1979 1979 a, g dbSNP:566533330
1982 1982 a, g dbSNP:762495053
1986 1986 c, t dbSNP:759970188
1989 1989 c, g dbSNP:768288294
1990 1990 g, t dbSNP:773979732
1992 1992 c, t dbSNP:761631943
1997 1997 a, c dbSNP:28936673
1998 1998 -, c dbSNP:763889116
2000 2000 c, t dbSNP:767530116
2001 2001 a, g, t dbSNP:750144923
2002 2002 g, t dbSNP:112676827
2005 2005 c, t dbSNP:74315293
2011 2011 a, g, t dbSNP:141903761
2015 2015 a, g dbSNP:375766702
2016 2016 a, g dbSNP:752874182
2027 2027 a, g dbSNP:758803512
2037 2037 -, gaaggccttagaa dbSNP:515726179
2038 2038 a, g dbSNP:778379750
2039 2039 a, c dbSNP:747287916
2045 2045 c, t dbSNP:757711106
2050 2050 a, g dbSNP:369202713
2051 2051 a, g dbSNP:748946176
2052 2052 c, t dbSNP:768470420
2053 2053 a, g dbSNP:1799822
2054 2054 c, t dbSNP:747723963
2055 2055 a, g dbSNP:78266699
2057 2057 c, t dbSNP:138125299
2060 2060 a, g dbSNP:760392144
2068 2068 a, g dbSNP:766154734
2077 2077 c, t dbSNP:138893547
2078 2078 a, c dbSNP:373714948
2084 2084 a, g dbSNP:759735713
2096 2096 a, t dbSNP:765487506
2098 2098 a, g dbSNP:377159044
2104 2104 a, t dbSNP:758532461
2105 2105 a, g dbSNP:764451386
2109 2109 a, c dbSNP:752112037
2113 2113 a, t dbSNP:115408040
2115 2115 c, g, t dbSNP:527257375
2122 2122 -, tcc dbSNP:753690164
2126 2126 c, t dbSNP:754633280
2131 2131 c, t dbSNP:778645670
2135 2135 -, aactgggaggccg dbSNP:757040620
2146 2146 c, t dbSNP:61561746
2151 2151 a, g dbSNP:374043834
2153 2153 a, c, g dbSNP:672
2166 2166 c, t dbSNP:6702020
2207 2207 c, t dbSNP:182988415
2254 2254 a, g dbSNP:560594256
2273 2273 a, g dbSNP:1134725
2289 2289 a, g dbSNP:753223538
2296 2296 a, g dbSNP:569468996
2314 2314 a, c dbSNP:758780739
2339 2339 c, t dbSNP:186214647
2354 2354 a, g dbSNP:372200011
2370 2370 g, t dbSNP:373212644
2380 2380 c, g dbSNP:565982553
2392 2392 a, g dbSNP:191416983
2425 2425 a, g dbSNP:1056446
2443 2443 -, c dbSNP:776115215
2452 2452 c, t dbSNP:558161718
2453 2453 a, g dbSNP:578031394
2492 2492 c, g dbSNP:537582868
2501 2501 a, g dbSNP:557500034
2502 2502 c, g dbSNP:751539798
2588 2588 c, t dbSNP:369718292
2589 2589 -, aa dbSNP:374495416
2608 2608 a, g dbSNP:574256743
2645 2645 c, g dbSNP:543259286

Target ORF information:

RefSeq Version XM_005270484
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens carnitine palmitoyltransferase 2 (CPT2), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu17939
Accession Version NM_000098.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1977bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product carnitine O-palmitoyltransferase 2, mitochondrial precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from U09648.1, AL606760.9 and BU629852.1. This sequence is a reference standard in the RefSeqGene project. On Mar 12, 2008 this sequence version replaced gi:4503022. Summary: The protein encoded by this gene is a nuclear protein which is transported to the mitochondrial inner membrane. Together with carnitine palmitoyltransferase I, the encoded protein oxidizes long-chain fatty acids in the mitochondria. Defects in this gene are associated with mitochondrial long-chain fatty-acid (LCFA) oxidation disorders. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## ##Evidence-Data-START## Transcript exon combination :: U09648.1, BC002445.2 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)417..419(+)
Misc Feature(2)657..2462(+)
Misc Feature(3)1869..1907(+)
Exon (1)1..667
Gene Synonym:
Exon (2)668..748
Gene Synonym:
Exon (3)749..855
Gene Synonym:
Exon (4)856..2160
Gene Synonym:
Exon (5)2161..3094
Gene Synonym:
Position Chain Variation Link
8 8 c, g dbSNP:574413762
39 39 c, t dbSNP:7545725
52 52 g, t dbSNP:570323518
55 55 c, t dbSNP:17848481
111 111 c, g dbSNP:761524923
158 158 -, t dbSNP:746815144
231 231 a, c dbSNP:577034240
236 236 c, t dbSNP:764839327
246 246 g, t dbSNP:546005723
263 263 c, t dbSNP:568723718
267 267 c, g dbSNP:562732877
274 274 a, c, g dbSNP:548768045
275 275 g, t dbSNP:542147940
341 341 a, t dbSNP:377231075
396 396 -, gga dbSNP:773273244
404 404 g, t dbSNP:760556045
405 405 c, t dbSNP:766061600
406 406 c, t dbSNP:369982767
434 434 c, t dbSNP:561846692
438 438 a, c dbSNP:527634657
440 440 a, c dbSNP:547411632
475 475 c, t dbSNP:745619478
507 507 c, t dbSNP:769734759
510 510 g, t dbSNP:780082552
523 523 c, t dbSNP:749532648
537 537 c, t dbSNP:768829380
546 546 -, c dbSNP:764763293
553 553 -, g dbSNP:786204647
557 557 c, t dbSNP:570576290
560 560 g, t dbSNP:761850684
574 574 c, g dbSNP:533282672
599 599 c, t dbSNP:772541454
618 618 c, t dbSNP:2929073
622 622 -, gc dbSNP:754363068
623 623 a, g dbSNP:773734918
637 637 c, t dbSNP:760976212
643 643 c, t dbSNP:766740182
664 664 a, c dbSNP:28936375
668 668 c, g dbSNP:749098104
684 684 -, c dbSNP:758026372
692 692 c, t dbSNP:755209043
696 696 a, g dbSNP:779047870
703 703 a, g dbSNP:748182542
705 705 -, ag dbSNP:765935623
710 710 c, g dbSNP:142598568
715 715 c, g dbSNP:201966320
716 716 a, c dbSNP:747516495
717 717 c, t dbSNP:771406546
719 719 a, g dbSNP:777038982
724 724 -, ct dbSNP:751253358
725 725 c, t dbSNP:370633858
726 726 c, t dbSNP:759866235
733 733 a, g dbSNP:146159244
735 735 a, g dbSNP:773897404
737 737 -, t dbSNP:754532499
739 739 a, g dbSNP:140194675
751 751 a, c dbSNP:150888506
761 761 a, g dbSNP:761554630
764 764 c, t dbSNP:767339394
782 782 c, t dbSNP:768408574
802 802 a, g dbSNP:369596290
809 809 c, g dbSNP:760146368
817 817 c, t dbSNP:75939866
829 829 a, g dbSNP:753737707
836 836 a, g dbSNP:147846614
839 839 c, t dbSNP:764943289
840 840 a, c dbSNP:71654989
848 848 c, t dbSNP:372313619
853 853 c, t dbSNP:74315294
854 854 a, g dbSNP:778017005
856 856 a, g dbSNP:371560287
858 858 c, t dbSNP:762957225
864 864 -, tttga dbSNP:778895906
868 868 a, g dbSNP:148035648
874 874 a, g dbSNP:121918528
880 880 c, t dbSNP:192275019
883 883 c, g dbSNP:757294874
885 885 c, t dbSNP:201065226
887 887 a, g dbSNP:200301403
892 892 c, g, t dbSNP:750572726
893 893 c, t dbSNP:780743357
894 894 a, g dbSNP:199545795
897 897 a, g dbSNP:769160926
902 902 c, g dbSNP:777514571
908 908 c, g, t dbSNP:569391696
914 914 a, g dbSNP:375573986
921 921 g, t dbSNP:554813467
931 931 a, c, g dbSNP:369475478
933 933 a, g dbSNP:774522353
939 939 a, g dbSNP:762688756
948 948 a, t dbSNP:763881188
953 953 a, t dbSNP:751437363
959 959 a, g dbSNP:144686779
963 963 a, g dbSNP:141505320
964 964 c, t dbSNP:750437078
966 966 a, c, t dbSNP:200080591
967 967 a, g dbSNP:515726177
970 970 c, t dbSNP:755331246
976 976 a, g dbSNP:772269793
983 983 -, tg dbSNP:746113590
983 983 c, t dbSNP:138938770
984 984 a, g dbSNP:748607258
996 996 c, t dbSNP:756839691
1014 1014 c, t dbSNP:780940242
1015 1015 a, g dbSNP:144760921
1022 1022 a, c, g dbSNP:769316736
1026 1026 c, t dbSNP:2229292
1035 1035 a, g dbSNP:28936674
1039 1039 c, t dbSNP:773993374
1049 1049 gaaccctgcaaaaagtgacactatc, t dbSNP:515726173
1049 1049 -, gaaccc dbSNP:772240606
1056 1056 -, gcaaaaagtgacactatc dbSNP:775776515
1071 1071 a, c, g dbSNP:377737941
1076 1076 c, t dbSNP:767592132
1078 1078 c, t dbSNP:773503132
1080 1080 a, g dbSNP:760775391
1084 1084 a, g dbSNP:766575997
1090 1090 c, t dbSNP:754042241
1092 1092 c, t dbSNP:375968699
1093 1093 a, g dbSNP:765824169
1094 1094 c, t dbSNP:752975688
1102 1102 a, c dbSNP:758823353
1103 1103 c, t dbSNP:140853350
1106 1106 -, ct dbSNP:760981841
1118 1118 a, g dbSNP:745547578
1119 1119 -, atg dbSNP:769115843
1121 1121 c, t dbSNP:755830520
1126 1126 -, c dbSNP:777297837
1129 1129 a, g dbSNP:779525393
1139 1139 a, t dbSNP:748844820
1141 1141 a, c, t dbSNP:773788921
1142 1142 a, g dbSNP:774374525
1148 1148 a, c dbSNP:201622710
1149 1149 c, t dbSNP:747845465
1153 1153 a, g dbSNP:74315300
1156 1156 c, t dbSNP:515726174
1170 1170 c, t dbSNP:367691827
1172 1172 g, t dbSNP:773236568
1180 1180 a, g dbSNP:760978599
1181 1181 a, c dbSNP:766770153
1182 1182 a, t dbSNP:776833476
1184 1184 -, a dbSNP:762366252
1188 1188 c, t dbSNP:759733220
1189 1189 a, g dbSNP:794727616
1191 1191 c, t dbSNP:147889730
1192 1192 c, t dbSNP:753270905
1195 1195 c, t dbSNP:74315298
1206 1206 c, t dbSNP:373638740
1207 1207 a, g dbSNP:369369333
1208 1208 a, g dbSNP:530706050
1213 1213 a, g dbSNP:144805101
1229 1229 c, t dbSNP:753303896
1232 1232 a, g dbSNP:759423137
1236 1236 a, g dbSNP:200252755
1239 1239 c, t dbSNP:778655162
1240 1240 a, g dbSNP:111896041
1248 1248 a, g dbSNP:748117051
1262 1262 a, t dbSNP:752139090
1266 1266 g, t dbSNP:771966581
1269 1269 c, t dbSNP:777614326
1274 1274 c, t dbSNP:746853000
1278 1278 c, g dbSNP:771250137
1279 1279 a, g dbSNP:199673903
1281 1281 a, g dbSNP:759640597
1282 1282 g, t dbSNP:373918498
1287 1287 g, t dbSNP:769931396
1303 1303 c, t dbSNP:775793760
1309 1309 a, g dbSNP:763502641
1313 1313 c, t dbSNP:764557610
1315 1315 c, t dbSNP:751888992
1316 1316 a, g dbSNP:762195160
1324 1324 a, t dbSNP:765964579
1328 1328 a, g dbSNP:561154406
1334 1334 a, g dbSNP:754375091
1336 1336 a, g dbSNP:758064377
1341 1341 a, c dbSNP:778477892
1346 1346 c, t dbSNP:752211265
1348 1348 c, t dbSNP:758337938
1358 1358 c, t dbSNP:190459228
1361 1361 c, t dbSNP:138855128
1362 1362 a, g dbSNP:770874001
1365 1365 c, t dbSNP:201163382
1367 1367 c, t dbSNP:138575554
1368 1368 a, g, t dbSNP:200906458
1385 1385 c, t dbSNP:202145705
1392 1392 a, g dbSNP:145237292
1393 1393 a, g dbSNP:774859940
1394 1394 c, t dbSNP:762105213
1397 1397 a, g dbSNP:767870817
1400 1400 c, g dbSNP:773628654
1401 1401 c, t dbSNP:727503887
1402 1402 a, g dbSNP:764849762
1406 1406 c, t dbSNP:752222424
1410 1410 -, gggcagagctc dbSNP:766004699
1411 1411 g, t dbSNP:757881397
1418 1418 a, g dbSNP:764076288
1423 1423 a, g dbSNP:751558734
1427 1427 g, t dbSNP:141553491
1434 1434 a, c, g dbSNP:763788839
1436 1436 -, gag dbSNP:751090469
1436 1436 a, g dbSNP:745698305
1439 1439 c, t dbSNP:756328565
1442 1442 a, t dbSNP:780168485
1445 1445 c, t dbSNP:371971257
1447 1447 a, g dbSNP:142790440
1448 1448 c, t dbSNP:541736685
1451 1451 a, g dbSNP:750820184
1455 1455 a, g dbSNP:748646501
1458 1458 c, g dbSNP:772621468
1466 1466 a, g dbSNP:773546947
1467 1467 a, c, g dbSNP:760989930
1468 1468 g, t dbSNP:727503888
1470 1470 c, g dbSNP:775030648
1471 1471 a, c dbSNP:762468710
1474 1474 c, t dbSNP:763703786
1475 1475 a, g dbSNP:569273347
1490 1490 c, g dbSNP:757247552
1492 1492 a, g dbSNP:767601469
1498 1498 a, g dbSNP:515726175
1500 1500 g, t dbSNP:750191719
1502 1502 c, g dbSNP:201165795
1503 1503 g, t dbSNP:755882353
1508 1508 -, a dbSNP:759086398
1518 1518 c, t dbSNP:780263768
1520 1520 c, t dbSNP:554776730
1531 1531 c, t dbSNP:375109382
1536 1536 -, a dbSNP:767119836
1537 1537 a, g, t dbSNP:778946896
1539 1539 a, g dbSNP:772541350
1540 1540 c, t dbSNP:144658100
1547 1547 c, t dbSNP:747352901
1548 1548 g, t dbSNP:771214714
1555 1555 c, g dbSNP:775144404
1562 1562 c, t dbSNP:148512862
1563 1563 c, t dbSNP:151003641
1564 1564 a, g dbSNP:773966429
1568 1568 a, g, t dbSNP:761438840
1569 1569 c, t dbSNP:750339299
1570 1570 g, t dbSNP:2229291
1578 1578 g, t dbSNP:766080131
1583 1583 c, t dbSNP:753720446
1587 1587 c, g, t dbSNP:199894581
1594 1594 c, t dbSNP:752737849
1595 1595 a, c, t dbSNP:749833236
1596 1596 a, g dbSNP:755500312
1604 1604 c, t dbSNP:771537809
1607 1607 c, g dbSNP:781398541
1612 1612 c, g dbSNP:746284903
1617 1617 a, g dbSNP:1799821
1625 1625 c, t dbSNP:774168365
1631 1631 c, t dbSNP:761347926
1635 1635 -, g dbSNP:757979320
1636 1636 a, g dbSNP:771486286
1639 1639 g, t dbSNP:772843417
1652 1652 a, g dbSNP:760514258
1653 1653 c, g dbSNP:144875040
1658 1658 c, g dbSNP:369847007
1660 1660 a, c, g dbSNP:515726176
1663 1663 a, t dbSNP:74315295
1670 1670 c, t dbSNP:752932153
1673 1673 a, c dbSNP:758408111
1677 1677 c, t dbSNP:748181550
1683 1683 c, g dbSNP:777711968
1686 1686 a, t dbSNP:751719701
1690 1690 c, t dbSNP:757683330
1703 1703 c, t dbSNP:767826599
1704 1704 a, g dbSNP:201745292
1710 1710 c, t dbSNP:746186600
1717 1717 g, t dbSNP:146670074
1724 1724 a, c dbSNP:773474888
1729 1729 c, t dbSNP:778639977
1736 1736 -, ct dbSNP:752373512
1736 1736 c, t dbSNP:747794860
1738 1738 c, g dbSNP:771811692
1740 1740 a, g dbSNP:772572668
1743 1743 a, g dbSNP:746567260
1744 1744 c, t dbSNP:372102993
1747 1747 c, t dbSNP:375957043
1748 1748 a, c, g dbSNP:112914907
1749 1749 g, t dbSNP:575447822
1751 1751 a, g dbSNP:544400632
1753 1753 -, ag dbSNP:397509431
1754 1754 -, ga dbSNP:398123153
1757 1757 a, g dbSNP:763073192
1762 1762 a, g dbSNP:201008705
1766 1766 c, g, t dbSNP:576822710
1768 1768 a, g dbSNP:368989271
1770 1770 c, g, t dbSNP:767852112
1774 1774 a, c, g dbSNP:373420308
1778 1778 c, t dbSNP:749714778
1781 1781 -, ttt dbSNP:777506825
1789 1789 c, g dbSNP:757953266
1793 1793 c, t dbSNP:376445618
1799 1799 a, g, t dbSNP:187044944
1803 1803 a, g dbSNP:770491351
1805 1805 c, t dbSNP:776488578
1812 1812 a, c dbSNP:745804213
1817 1817 g, t dbSNP:769781310
1825 1825 c, t dbSNP:775246158
1827 1827 a, g dbSNP:374201361
1828 1828 a, t dbSNP:377616144
1842 1842 a, g dbSNP:774644103
1843 1843 a, t dbSNP:761731998
1844 1844 c, t dbSNP:767699548
1850 1850 c, t dbSNP:143075786
1851 1851 a, g dbSNP:555126720
1856 1856 g, t dbSNP:767030994
1857 1857 c, t dbSNP:74315297
1863 1863 a, t dbSNP:755395180
1864 1864 a, g dbSNP:777236101
1875 1875 g, t dbSNP:74315299
1883 1883 a, g dbSNP:746683786
1884 1884 a, g, t dbSNP:756931329
1886 1886 a, g dbSNP:745432304
1887 1887 a, c dbSNP:147276580
1898 1898 g, t dbSNP:779999942
1901 1901 c, t dbSNP:748976396
1903 1903 c, g dbSNP:560189631
1904 1904 -, g dbSNP:35237240
1907 1907 c, t dbSNP:201681645
1909 1909 -, cagttgcccagct dbSNP:753781632
1911 1911 a, g dbSNP:762081022
1912 1912 c, t dbSNP:200399018
1919 1919 a, g dbSNP:140771069
1923 1923 a, g, t dbSNP:756326862
1929 1929 c, t dbSNP:754386565
1931 1931 a, g dbSNP:761130313
1937 1937 a, c dbSNP:192779168
1943 1943 a, g dbSNP:149557870
1944 1944 c, t dbSNP:770734793
1945 1945 a, g dbSNP:780865183
1951 1951 a, t dbSNP:749895856
1952 1952 c, t dbSNP:370157946
1953 1953 a, g dbSNP:201508063
1956 1956 -, caga dbSNP:757126340
1956 1956 c, g dbSNP:749243696
1966 1966 c, g dbSNP:374183980
1973 1973 c, t dbSNP:201241649
1974 1974 a, g dbSNP:778743524
1975 1975 a, c dbSNP:368132822
1979 1979 a, c dbSNP:143486080
1982 1982 c, t dbSNP:772377335
1989 1989 -, ttatat dbSNP:778894948
1991 1991 -, cgca dbSNP:746000404
1991 1991 c, t dbSNP:548364005
1992 1992 a, g dbSNP:61731996
1997 1997 -, caagcacggccgcac dbSNP:772159469
2003 2003 c, t dbSNP:139321501
2007 2007 c, t dbSNP:374308679
2008 2008 a, g, t dbSNP:776645157
2012 2012 c, t dbSNP:766629203
2013 2013 a, g dbSNP:753074621
2014 2014 -, t dbSNP:780184554
2016 2016 a, t dbSNP:763340721
2018 2018 -, tgg dbSNP:747201636
2022 2022 -, cgcccggcctccgtctataca dbSNP:769170998
2022 2022 c, t dbSNP:74315296
2023 2023 a, g dbSNP:750079911
2026 2026 c, t dbSNP:368311455
2027 2027 a, g, t dbSNP:150953507
2033 2033 c, t dbSNP:140798841
2034 2034 a, g dbSNP:142600166
2041 2041 -, aa dbSNP:777066875
2047 2047 c, g dbSNP:747901054
2051 2051 c, t dbSNP:199573389
2053 2053 a, c, t dbSNP:372368317
2060 2060 c, t dbSNP:201663642
2062 2062 c, t dbSNP:398123154
2074 2074 c, t dbSNP:776754218
2093 2093 c, t dbSNP:113493395
2113 2113 c, t dbSNP:144703247
2117 2117 a, g dbSNP:148110518
2119 2119 a, g dbSNP:755304451
2126 2126 a, g dbSNP:764435641
2148 2148 a, g dbSNP:774755571
2149 2149 a, c dbSNP:17848485
2161 2161 a, g dbSNP:186044004
2166 2166 a, g dbSNP:749779852
2172 2172 a, g dbSNP:28936376
2175 2175 c, t dbSNP:539239516
2176 2176 a, g dbSNP:367796030
2178 2178 c, g dbSNP:766004296
2189 2189 g, t dbSNP:141814677
2193 2193 c, t dbSNP:759016933
2194 2194 a, g dbSNP:199996641
2195 2195 a, g dbSNP:267598646
2212 2212 a, g dbSNP:752317041
2214 2214 g, t dbSNP:758390723
2244 2244 a, c dbSNP:749268486
2252 2252 -, c dbSNP:515726178
2253 2253 a, g dbSNP:569609298
2255 2255 a, g, t dbSNP:371443614
2265 2265 c, t dbSNP:781418379
2266 2266 a, g dbSNP:750604350
2278 2278 c, g dbSNP:1871748
2279 2279 -, cacgagca dbSNP:759017526
2281 2281 c, t dbSNP:756414686
2282 2282 a, g dbSNP:77565483
2285 2285 c, t dbSNP:749409744
2287 2287 c, t dbSNP:769108011
2289 2289 -, ct dbSNP:767004984
2291 2291 -, ga dbSNP:752325732
2291 2291 a, g dbSNP:141146189
2294 2294 c, g, t dbSNP:748484701
2295 2295 a, g dbSNP:773695572
2297 2297 -, c dbSNP:760255368
2306 2306 a, g dbSNP:759101149
2309 2309 a, c dbSNP:769539793
2310 2310 c, g dbSNP:775113044
2315 2315 g, t dbSNP:762584123
2321 2321 c, t dbSNP:147953465
2328 2328 c, g dbSNP:751557097
2330 2330 a, g dbSNP:761604642
2331 2331 a, g dbSNP:767201522
2335 2335 c, g dbSNP:201913567
2336 2336 c, t dbSNP:756259411
2337 2337 c, g dbSNP:780286639
2338 2338 a, g dbSNP:753861985
2354 2354 c, g, t dbSNP:755060321
2357 2357 c, t dbSNP:748596204
2364 2364 c, t dbSNP:201996784
2366 2366 c, t dbSNP:540322467
2367 2367 a, g dbSNP:747444819
2372 2372 c, t dbSNP:769535056
2380 2380 a, g dbSNP:566533330
2383 2383 a, g dbSNP:762495053
2387 2387 c, t dbSNP:759970188
2390 2390 c, g dbSNP:768288294
2391 2391 g, t dbSNP:773979732
2393 2393 c, t dbSNP:761631943
2398 2398 a, c dbSNP:28936673
2399 2399 -, c dbSNP:763889116
2401 2401 c, t dbSNP:767530116
2402 2402 a, g, t dbSNP:750144923
2403 2403 g, t dbSNP:112676827
2406 2406 c, t dbSNP:74315293
2412 2412 a, g, t dbSNP:141903761
2416 2416 a, g dbSNP:375766702
2417 2417 a, g dbSNP:752874182
2428 2428 a, g dbSNP:758803512
2438 2438 -, gaaggccttagaa dbSNP:515726179
2439 2439 a, g dbSNP:778379750
2440 2440 a, c dbSNP:747287916
2446 2446 c, t dbSNP:757711106
2451 2451 a, g dbSNP:369202713
2452 2452 a, g dbSNP:748946176
2453 2453 c, t dbSNP:768470420
2454 2454 a, g dbSNP:1799822
2455 2455 c, t dbSNP:747723963
2456 2456 a, g dbSNP:78266699
2458 2458 c, t dbSNP:138125299
2461 2461 a, g dbSNP:760392144
2469 2469 a, g dbSNP:766154734
2478 2478 c, t dbSNP:138893547
2479 2479 a, c dbSNP:373714948
2485 2485 a, g dbSNP:759735713
2497 2497 a, t dbSNP:765487506
2499 2499 a, g dbSNP:377159044
2505 2505 a, t dbSNP:758532461
2506 2506 a, g dbSNP:764451386
2510 2510 a, c dbSNP:752112037
2514 2514 a, t dbSNP:115408040
2516 2516 c, g, t dbSNP:527257375
2523 2523 -, tcc dbSNP:753690164
2527 2527 c, t dbSNP:754633280
2532 2532 c, t dbSNP:778645670
2536 2536 -, aactgggaggccg dbSNP:757040620
2547 2547 c, t dbSNP:61561746
2552 2552 a, g dbSNP:374043834
2554 2554 a, c, g dbSNP:672
2567 2567 c, t dbSNP:6702020
2608 2608 c, t dbSNP:182988415
2655 2655 a, g dbSNP:560594256
2674 2674 a, g dbSNP:1134725
2690 2690 a, g dbSNP:753223538
2697 2697 a, g dbSNP:569468996
2715 2715 a, c dbSNP:758780739
2740 2740 c, t dbSNP:186214647
2755 2755 a, g dbSNP:372200011
2771 2771 g, t dbSNP:373212644
2781 2781 c, g dbSNP:565982553
2793 2793 a, g dbSNP:191416983
2826 2826 a, g dbSNP:1056446
2844 2844 -, c dbSNP:776115215
2853 2853 c, t dbSNP:558161718
2854 2854 a, g dbSNP:578031394
2893 2893 c, g dbSNP:537582868
2902 2902 a, g dbSNP:557500034
2903 2903 c, g dbSNP:751539798
2989 2989 c, t dbSNP:369718292
2990 2990 -, aa dbSNP:374495416
3009 3009 a, g dbSNP:574256743
3046 3046 c, g dbSNP:543259286

Target ORF information:

RefSeq Version NM_000098
Organism Homo sapiens (human)
Definition Homo sapiens carnitine palmitoyltransferase 2 (CPT2), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
