Email to GenScript

MUC17 mucin 17, cell surface associated [Homo sapiens (human)]

Gene Symbol MUC17
Entrez Gene ID 140453
Full Name mucin 17, cell surface associated
Synonyms MUC3
General protein information
Preferred Names
membrane mucin MUC17
secreted mucin MUC17
small intestinal mucin-3
small intestinal mucin MUC3
Gene Type protein-coding
Organism Homo sapiens (human)



Summary Membrane mucins, such as MUC17, function in epithelial cells to provide cytoprotection, maintain luminal structure, provide signal transduction, and confer antiadhesive properties upon cancer cells that lose their apical/basal polarization.[supplied by OMIM, Apr 2004]. lac of sum
Disorder MIM:


Disorder Html:

The following MUC17 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the MUC17 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu75883 XM_011515803 PREDICTED: Homo sapiens mucin 17, cell surface associated (MUC17), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $199
OHu31148 NM_001040105 Homo sapiens mucin 17, cell surface associated (MUC17), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu75883
Accession Version XM_011515803.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 606bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product mucin-17 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_007933.16) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Position Chain Variation Link
12 12 a, g dbSNP:371594833
15 15 g, t dbSNP:754439121
18 18 c, g, t dbSNP:373140626
19 19 a, g dbSNP:750473006
36 36 c, t dbSNP:142156590
37 37 a, g dbSNP:780274013
48 48 c, t dbSNP:377406523
54 54 a, g dbSNP:199683730
58 58 c, g, t dbSNP:749795865
59 59 a, g dbSNP:769657075
62 62 a, g dbSNP:538349295
63 63 c, t dbSNP:550738028
75 75 a, g dbSNP:778199981
84 84 g, t dbSNP:139700605
92 92 a, g dbSNP:771488839
94 94 a, g dbSNP:778012603
101 101 a, g dbSNP:199714191
105 105 c, t dbSNP:746345335
106 106 a, g dbSNP:149949866
115 115 a, g dbSNP:775538912
118 118 c, t dbSNP:145093871
119 119 a, g dbSNP:77145638
133 133 c, t dbSNP:767025449
137 137 a, c, t dbSNP:752360913
138 138 a, g dbSNP:184289804
155 155 a, t dbSNP:200788719
161 161 a, g dbSNP:758934845
169 169 c, t dbSNP:572357520
170 170 a, g dbSNP:149074951
173 173 g, t dbSNP:768683951
176 176 a, g, t dbSNP:200874741
180 180 a, g dbSNP:769990863
181 181 c, g dbSNP:773168723
182 182 c, t dbSNP:762782740
183 183 a, g dbSNP:73168398
184 184 a, g dbSNP:147835650
185 185 a, g dbSNP:6946812
190 190 c, g dbSNP:766997074
193 193 a, g dbSNP:752197762
197 197 c, t dbSNP:200962938
212 212 c, t dbSNP:763697251
218 218 c, g dbSNP:377077190
219 219 c, t dbSNP:758813988
222 222 a, g dbSNP:780366771
236 236 -, a dbSNP:766437450
238 238 g, t dbSNP:370231328
242 242 c, t dbSNP:752062430
247 247 c, t dbSNP:755454076
248 248 c, t dbSNP:368767277
250 250 c, t dbSNP:375383681
252 252 g, t dbSNP:748214999
268 268 c, t dbSNP:769925957
278 278 c, t dbSNP:550776557
279 279 c, t dbSNP:749486888
289 289 c, t dbSNP:771925822
292 292 a, c, t dbSNP:577795174
293 293 a, g dbSNP:201025775
300 300 c, g, t dbSNP:199864047
301 301 a, g dbSNP:146965923
311 311 c, t dbSNP:774601295
319 319 c, t dbSNP:759991700
324 324 a, c dbSNP:540383829
331 331 c, t dbSNP:767739284
336 336 a, g dbSNP:371472570
339 339 g, t dbSNP:756677834
343 343 c, t dbSNP:764285068
346 346 a, g dbSNP:753906451
352 352 c, t dbSNP:757588804
353 353 c, g dbSNP:779147429
355 355 a, g dbSNP:375000750
361 361 c, t dbSNP:141631949
362 362 a, g dbSNP:758255853
363 363 a, g dbSNP:779711446
365 365 c, t dbSNP:746960052
366 366 c, t dbSNP:768513243
367 367 c, t dbSNP:73404805
368 368 a, g dbSNP:560551712
370 370 g, t dbSNP:200413820
373 373 g, t dbSNP:769267715
375 375 c, t dbSNP:772954792
382 382 c, t dbSNP:762504748
383 383 a, g dbSNP:201998602
390 390 c, t dbSNP:775662534
394 394 a, g dbSNP:138940821
396 396 c, t dbSNP:764660752
398 398 a, c dbSNP:753997575
403 403 g, t dbSNP:757461644
415 415 c, g dbSNP:765201519
422 422 a, g, t dbSNP:142295738
428 428 c, t dbSNP:370049980
429 429 a, g dbSNP:374087771
431 431 a, t dbSNP:754929687
434 434 -, aa dbSNP:758320858
434 434 -, a dbSNP:777499027
435 435 -, ag dbSNP:751389785
449 449 c, t dbSNP:200432121
450 450 a, g dbSNP:369165155
454 454 a, t dbSNP:748710549
463 463 a, g dbSNP:146358169
466 466 g, t dbSNP:200085915
467 467 c, t dbSNP:745485671
468 468 -, t dbSNP:773200583
476 476 g, t dbSNP:761301541
478 478 c, t dbSNP:769211690
479 479 a, c dbSNP:374270948
481 481 a, g dbSNP:371938101
482 482 c, t dbSNP:762397393
491 491 a, g dbSNP:770157998
494 494 g, t dbSNP:139724548
500 500 -, g dbSNP:756840018
502 502 a, g dbSNP:762991518
513 513 a, g dbSNP:766414896
516 516 a, c, t dbSNP:751842112
522 522 -, a dbSNP:548968128
528 528 a, t dbSNP:367587534
529 529 c, t dbSNP:767310516
532 532 -, c dbSNP:745569526
532 532 c, t dbSNP:752425035
542 542 -, tgcca dbSNP:769312941
557 557 a, t dbSNP:757209136
565 565 c, t dbSNP:375037610
580 580 c, t dbSNP:749888541
590 590 c, t dbSNP:142829628
599 599 c, t dbSNP:147613804
606 606 a, g dbSNP:746638824
614 614 c, t dbSNP:756498660
623 623 a, c dbSNP:199722733
629 629 c, t dbSNP:148704443
630 630 a, g dbSNP:9656065
636 636 a, g dbSNP:754600840
637 637 c, g dbSNP:778004453
638 638 a, g dbSNP:754188619
654 654 c, t dbSNP:534194993
655 655 a, g dbSNP:565881797
658 658 a, g dbSNP:746344952
668 668 c, g dbSNP:151258613
669 669 c, g dbSNP:187135134
675 675 a, g dbSNP:73404820
697 697 a, g dbSNP:768859443
707 707 c, t dbSNP:776325334
709 709 c, g, t dbSNP:373198651
710 710 a, c, g dbSNP:374588011
728 728 a, c dbSNP:377319360
752 752 a, g dbSNP:537994337
757 757 a, c dbSNP:528041558
793 793 c, t dbSNP:4729655
880 880 a, c dbSNP:150528234
897 897 a, c dbSNP:553851030
900 900 a, g dbSNP:573107763
931 931 a, g dbSNP:540493073
952 952 a, t dbSNP:4729656
961 961 c, t dbSNP:117451414
991 991 c, g dbSNP:138451649
994 994 c, g dbSNP:746031829
1009 1009 c, t dbSNP:113215808
1011 1011 c, t dbSNP:770007377
1012 1012 a, g dbSNP:775846381
1018 1018 c, t dbSNP:76767333
1023 1023 c, g dbSNP:370692314
1063 1063 a, g dbSNP:532819869
1119 1119 c, g dbSNP:551380551
1127 1127 a, g dbSNP:530904614
1157 1157 c, g dbSNP:772989105
1179 1179 c, t dbSNP:566312621
1188 1188 a, t dbSNP:76925166
1206 1206 c, g dbSNP:567619609
1215 1215 a, c dbSNP:766223558
1227 1227 g, t dbSNP:776576328
1238 1238 a, c dbSNP:549261043
1241 1241 -, t dbSNP:768735036
1242 1242 -, accc dbSNP:556602576
1248 1248 c, t dbSNP:759474729
1274 1274 c, t dbSNP:567557391
1281 1281 c, t dbSNP:538031344
1301 1301 g, t dbSNP:556409624
1327 1327 a, g dbSNP:369527683
1354 1354 c, g dbSNP:764972517
1400 1400 c, t dbSNP:55903219
1461 1461 a, c dbSNP:57645356

Target ORF information:

RefSeq Version XM_011515803
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens mucin 17, cell surface associated (MUC17), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu31148
Accession Version NM_001040105.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 13482bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product mucin-17 precursor
Comment PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AJ606307.1, AC105446.4, BM773519.1, BM768498.1 and BM987743.1. On Mar 29, 2008 this sequence version replaced gi:169171415. Summary: Membrane mucins, such as MUC17, function in epithelial cells to provide cytoprotection, maintain luminal structure, provide signal transduction, and confer antiadhesive properties upon cancer cells that lose their apical/basal polarization.[supplied by OMIM, Apr 2004]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AJ606307.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968540, SAMEA2142348 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)33..35(+)
Misc Feature(2)606..11234(+)
Misc Feature(3)12618..12878(+)
Misc Feature(4)12780..12785(+)
Misc Feature(5)13233..13295(+)
Exon (1)1..135
Gene Synonym:
Exon (2)136..237
Gene Synonym:
Exon (3)238..12456
Gene Synonym:
Exon (4)12457..12588
Gene Synonym:
Exon (5)12589..12716
Gene Synonym:
Exon (6)12717..12775
Gene Synonym:
Exon (7)12776..12927
Gene Synonym:
Exon (8)12928..12996
Gene Synonym:
Exon (9)12997..13156
Gene Synonym:
Exon (10)13157..13318
Gene Synonym:
Exon (11)13319..13416
Gene Synonym:
Exon (12)13417..13493
Gene Synonym:
Exon (13)13494..14350
Gene Synonym:
Position Chain Variation Link
4 4 c, t dbSNP:200327824
5 5 a, g dbSNP:372449714
15 15 c, g dbSNP:748046244
17 17 c, g dbSNP:769701671
27 27 a, g dbSNP:777562830
38 38 c, t dbSNP:748850877
39 39 a, g dbSNP:185696595
46 46 a, g dbSNP:202213267
48 48 a, g dbSNP:578149293
52 52 c, t dbSNP:768917246
55 55 c, t dbSNP:776989661
57 57 a, c dbSNP:146986698
76 76 c, t dbSNP:765830366
77 77 a, g, t dbSNP:201028335
82 82 a, g dbSNP:766525162
89 89 c, g dbSNP:376343758
92 92 c, t dbSNP:755168082
96 96 c, g dbSNP:369253246
100 100 c, t dbSNP:752600376
102 102 a, t dbSNP:137964241
103 103 c, t dbSNP:143525513
104 104 a, g dbSNP:150547324
107 107 c, g, t dbSNP:749187434
108 108 c, t dbSNP:778339811
115 115 c, g dbSNP:745526150
117 117 c, g dbSNP:371754566
130 130 a, t dbSNP:771826156
132 132 c, t dbSNP:774993769
147 147 a, g dbSNP:775807508
164 164 a, t dbSNP:760752547
171 171 c, g dbSNP:763883392
181 181 c, t dbSNP:753700716
187 187 a, g dbSNP:757034409
191 191 a, c, t dbSNP:765209007
192 192 a, g dbSNP:550305993
199 199 a, g dbSNP:139454683
201 201 c, t dbSNP:201971170
202 202 a, g dbSNP:144369997
227 227 c, t dbSNP:374703099
228 228 a, g dbSNP:749724790
237 237 a, c, g dbSNP:771397257
238 238 g, t dbSNP:768691304
241 241 a, c dbSNP:776869969
244 244 c, t dbSNP:761973973
245 245 a, g dbSNP:569484493
251 251 c, t dbSNP:772814080
252 252 a, c dbSNP:79976119
254 254 c, t dbSNP:762803281
255 255 a, g dbSNP:200871012
268 268 a, c, t dbSNP:751488304
272 272 c, t dbSNP:767090327
274 274 c, t dbSNP:752415386
281 281 c, t dbSNP:755764209
282 282 a, g dbSNP:777479634
287 287 c, g dbSNP:750811978
289 289 c, t dbSNP:758769990
296 296 a, g dbSNP:780465823
300 300 g, t dbSNP:747475440
303 303 a, g dbSNP:768744520
309 309 a, g dbSNP:781190772
311 311 c, t dbSNP:139762740
314 314 a, c dbSNP:748372680
317 317 c, g, t dbSNP:769975461
318 318 c, g dbSNP:762702452
319 319 c, g dbSNP:367792915
325 325 c, t dbSNP:774457079
329 329 c, g dbSNP:759493091
331 331 c, t dbSNP:776605605
334 334 c, t dbSNP:144349602
343 343 g, t dbSNP:760222781
349 349 c, t dbSNP:146605853
355 355 a, g dbSNP:113885736
356 356 c, t dbSNP:113023465
360 360 c, t dbSNP:753499828
365 365 a, t dbSNP:758721555
379 379 a, g dbSNP:140150533
380 380 a, g dbSNP:745804040
389 389 a, g dbSNP:755409657
395 395 a, g dbSNP:372743652
400 400 g, t dbSNP:748284769
403 403 c, g dbSNP:756193485
408 408 c, t dbSNP:375199666
412 412 a, g dbSNP:749483762
415 415 c, g dbSNP:770648410
420 420 a, g dbSNP:201566918
430 430 c, t dbSNP:774224446
433 433 c, t dbSNP:745658408
438 438 c, t dbSNP:151280870
440 440 c, t dbSNP:775546915
449 449 c, t dbSNP:760144084
451 451 c, t dbSNP:763622974
456 456 g, t dbSNP:375764950
457 457 a, t dbSNP:370094020
470 470 c, t dbSNP:766732211
471 471 a, g dbSNP:751987235
472 472 a, c dbSNP:755321879
484 484 a, g dbSNP:76440115
488 488 c, t dbSNP:115500432
489 489 a, g dbSNP:371869918
490 490 a, g dbSNP:777857466
491 491 -, g dbSNP:769261570
491 491 c, t dbSNP:375249312
492 492 a, g dbSNP:567129894
496 496 c, g dbSNP:779269229
498 498 -, a dbSNP:775029580
504 504 a, g dbSNP:745709640
506 506 -, c dbSNP:763319222
508 508 c, g dbSNP:542185793
515 515 a, g dbSNP:200331855
520 520 a, g dbSNP:111227419
531 531 a, g dbSNP:199776258
534 534 a, g dbSNP:369222127
537 537 c, g dbSNP:567787391
541 541 c, t dbSNP:761222920
550 550 c, t dbSNP:764926409
552 552 a, g dbSNP:772827847
553 553 c, t dbSNP:537936932
563 563 c, t dbSNP:767825541
583 583 c, g dbSNP:372923916
594 594 a, g dbSNP:753164036
596 596 -, g dbSNP:764689052
598 598 c, t dbSNP:375655258
600 600 a, g dbSNP:761181335
605 605 a, g dbSNP:756322676
607 607 c, g dbSNP:141443818
626 626 a, t dbSNP:754012525
640 640 c, t dbSNP:147023140
645 645 c, t dbSNP:779318632
647 647 c, t dbSNP:750634422
649 649 a, c dbSNP:758292037
650 650 c, t dbSNP:779939140
652 652 c, t dbSNP:746923995
653 653 g, t dbSNP:556547867
662 662 c, t dbSNP:780978510
670 670 c, t dbSNP:747742194
676 676 a, g dbSNP:769259358
678 678 c, t dbSNP:772878703
679 679 a, c dbSNP:762540897
681 681 a, g dbSNP:371729341
688 688 g, t dbSNP:775993341
691 691 a, g dbSNP:760938068
707 707 a, g dbSNP:560663109
708 708 a, g dbSNP:763686003
710 710 a, g dbSNP:774025440
713 713 c, t dbSNP:762016528
721 721 c, t dbSNP:765359937
723 723 a, g dbSNP:116801454
730 730 c, t dbSNP:143664405
731 731 a, c, g dbSNP:143067910
732 732 a, c dbSNP:10229731
738 738 a, g dbSNP:781229156
739 739 c, t dbSNP:748035347
741 741 a, c dbSNP:769312461
746 746 a, t dbSNP:748910623
749 749 a, g dbSNP:201467055
757 757 c, t dbSNP:777204968
771 771 c, t dbSNP:748941063
774 774 c, g dbSNP:770631238
775 775 c, t dbSNP:540080829
795 795 a, t dbSNP:761144835
803 803 c, g, t dbSNP:533363722
804 804 a, g dbSNP:762353876
807 807 c, t dbSNP:368840848
817 817 c, t dbSNP:773490232
818 818 a, g dbSNP:373133725
825 825 a, g dbSNP:763109639
835 835 -, a dbSNP:762248265
837 837 a, g dbSNP:376860156
845 845 c, g dbSNP:766673543
847 847 c, t dbSNP:371532269
854 854 -, ctcag dbSNP:768049525
858 858 a, g dbSNP:754829797
859 859 c, t dbSNP:767164654
861 861 a, c dbSNP:752641866
866 866 c, g, t dbSNP:755975956
868 868 a, g dbSNP:10259584
875 875 c, t dbSNP:756694628
877 877 c, g, t dbSNP:756698274
879 879 c, g dbSNP:769078255
894 894 a, c, t dbSNP:150719489
896 896 c, t dbSNP:770479658
897 897 c, g dbSNP:773831451
903 903 a, g dbSNP:201857499
908 908 g, t dbSNP:766329313
914 914 a, g, t dbSNP:774651865
924 924 g, t dbSNP:139140935
928 928 c, t dbSNP:143051032
931 931 a, c, g dbSNP:370578064
932 932 c, t dbSNP:764062953
935 935 a, c dbSNP:753739411
943 943 a, c dbSNP:756814205
944 944 a, g dbSNP:778229932
948 948 c, g dbSNP:532968372
955 955 c, t dbSNP:758055359
957 957 a, t dbSNP:779837317
958 958 c, t dbSNP:748571880
963 963 a, g dbSNP:770251001
982 982 c, t dbSNP:551349153
987 987 a, g dbSNP:187460352
989 989 c, t dbSNP:771053418
990 990 a, c dbSNP:111839436
1001 1001 c, t dbSNP:774226134
1006 1006 a, c, t dbSNP:527980140
1007 1007 a, g dbSNP:775661782
1014 1014 c, g dbSNP:760498223
1019 1019 a, c, g dbSNP:763832080
1054 1054 c, t dbSNP:761589035
1060 1060 c, t dbSNP:765218212
1064 1064 a, g dbSNP:372425590
1068 1068 a, c, g dbSNP:549587315
1069 1069 a, c, t dbSNP:4729645
1070 1070 a, c, g dbSNP:538405099
1071 1071 a, c dbSNP:749803432
1080 1080 a, g dbSNP:550020068
1081 1081 c, t dbSNP:779051755
1083 1083 a, g dbSNP:771404776
1085 1085 a, g dbSNP:375381499
1087 1087 c, t dbSNP:571365213
1088 1088 a, g, t dbSNP:368047713
1091 1091 c, t dbSNP:775716748
1092 1092 a, g dbSNP:200732180
1099 1099 c, t dbSNP:538648034
1114 1114 a, t dbSNP:201681377
1117 1117 c, t dbSNP:150423564
1119 1119 a, g dbSNP:765134194
1124 1124 c, t dbSNP:572838572
1135 1135 a, c dbSNP:762400300
1140 1140 a, c dbSNP:765937631
1144 1144 c, t dbSNP:751266480
1145 1145 a, t dbSNP:754606683
1147 1147 a, t dbSNP:780984346
1148 1148 c, g dbSNP:754211272
1164 1164 a, c dbSNP:757612356
1168 1168 a, g dbSNP:779322113
1173 1173 c, t dbSNP:144713284
1174 1174 c, t dbSNP:758490312
1181 1181 a, c dbSNP:533826320
1183 1183 c, t dbSNP:747088651
1188 1188 a, g dbSNP:563774308
1195 1195 c, t dbSNP:768926168
1196 1196 c, t dbSNP:374369228
1214 1214 a, t dbSNP:148536035
1220 1220 g, t dbSNP:142749514
1225 1225 a, g dbSNP:769590935
1247 1247 a, g dbSNP:368614637
1256 1256 c, t dbSNP:762926065
1262 1262 a, g dbSNP:573772486
1268 1268 a, g dbSNP:774068014
1272 1272 a, g dbSNP:759101637
1273 1273 c, g dbSNP:767325289
1280 1280 a, g dbSNP:752357113
1281 1281 a, g dbSNP:757587418
1283 1283 a, t dbSNP:765584096
1284 1284 a, g dbSNP:544355810
1285 1285 c, g dbSNP:758971535
1289 1289 c, t dbSNP:202002952
1290 1290 a, g dbSNP:747142032
1296 1296 a, g dbSNP:145279256
1301 1301 g, t dbSNP:780971561
1302 1302 c, g dbSNP:748351919
1305 1305 g, t dbSNP:769489380
1307 1307 a, g, t dbSNP:772989574
1310 1310 c, t dbSNP:142373606
1315 1315 a, g, t dbSNP:201075671
1332 1332 a, g dbSNP:56103274
1333 1333 c, t dbSNP:775022503
1336 1336 c, g dbSNP:760312809
1348 1348 c, t dbSNP:763649320
1351 1351 a, c dbSNP:750847845
1356 1356 a, g dbSNP:758742736
1357 1357 a, c dbSNP:766914024
1359 1359 a, g dbSNP:752018532
1363 1363 c, t dbSNP:371965544
1367 1367 a, g dbSNP:781271905
1370 1370 c, t dbSNP:752863324
1381 1381 c, t dbSNP:756424759
1385 1385 c, t dbSNP:777842948
1386 1386 a, t dbSNP:749143280
1392 1392 c, t dbSNP:560174964
1393 1393 c, t dbSNP:113525079
1398 1398 c, g dbSNP:745744053
1402 1402 c, g dbSNP:771488253
1404 1404 a, g dbSNP:775132483
1405 1405 c, g dbSNP:760093372
1406 1406 c, g dbSNP:768407511
1410 1410 c, t dbSNP:776237305
1417 1417 a, c dbSNP:763336522
1418 1418 a, g dbSNP:766678768
1420 1420 c, g dbSNP:752071389
1433 1433 c, t dbSNP:760018281
1441 1441 -, a dbSNP:750673146
1445 1445 a, g dbSNP:760472110
1447 1447 c, t dbSNP:767905439
1458 1458 g, t dbSNP:752878563
1462 1462 c, g dbSNP:756124682
1463 1463 c, t dbSNP:778095500
1465 1465 a, c dbSNP:754066869
1466 1466 c, g, t dbSNP:150144892
1467 1467 c, t dbSNP:549432526
1472 1472 a, g dbSNP:772110201
1482 1482 c, g dbSNP:779837923
1488 1488 a, t dbSNP:746571740
1492 1492 a, g dbSNP:768013750
1493 1493 a, c dbSNP:776285977
1496 1496 a, t dbSNP:761393791
1498 1498 a, c dbSNP:771285643
1499 1499 g, t dbSNP:774759850
1500 1500 a, c, g dbSNP:759806324
1504 1504 c, g dbSNP:189351186
1505 1505 c, g dbSNP:760837383
1506 1506 a, g dbSNP:764213479
1509 1509 c, t dbSNP:138416916
1513 1513 a, c dbSNP:550300233
1517 1517 a, g dbSNP:765542659
1518 1518 a, g dbSNP:750285576
1519 1519 a, c dbSNP:148849322
1525 1525 c, g dbSNP:780074683
1526 1526 a, c dbSNP:746869180
1531 1531 c, t dbSNP:754527199
1534 1534 c, t dbSNP:780609883
1536 1536 a, t dbSNP:747649024
1540 1540 a, c, t dbSNP:769494303
1549 1549 a, g dbSNP:199702361
1551 1551 a, c dbSNP:772281754
1555 1555 a, t dbSNP:374888125
1569 1569 c, t dbSNP:776079394
1570 1570 a, c, t dbSNP:761022433
1574 1574 a, t dbSNP:776909466
1574 1574 -, t dbSNP:766549456
1582 1582 c, g dbSNP:761965644
1585 1585 c, t dbSNP:137875150
1594 1594 c, t dbSNP:750573916
1596 1596 a, c dbSNP:758237781
1599 1599 a, g dbSNP:371969946
1602 1602 a, t dbSNP:751516957
1608 1608 a, g dbSNP:754972314
1615 1615 c, t dbSNP:781090187
1617 1617 a, c dbSNP:747705890
1618 1618 c, g, t dbSNP:538733615
1619 1619 a, g dbSNP:149129669
1620 1620 a, g dbSNP:772492110
1621 1621 c, t dbSNP:775787238
1630 1630 a, c dbSNP:146143829
1654 1654 -, ctc dbSNP:753973570
1663 1663 a, g dbSNP:369461386
1673 1673 a, t dbSNP:769336551
1675 1675 a, c dbSNP:201389667
1677 1677 c, g dbSNP:762018725
1682 1682 a, c dbSNP:555384497
1684 1684 c, g dbSNP:765361914
1696 1696 c, g dbSNP:773494910
1698 1698 -, t dbSNP:758229077
1699 1699 c, g dbSNP:763015879
1703 1703 a, c dbSNP:766616326
1704 1704 a, t dbSNP:751364335
1707 1707 a, t dbSNP:759304531
1711 1711 c, t dbSNP:767482085
1713 1713 a, g dbSNP:141499371
1723 1723 g, t dbSNP:755642154
1730 1730 c, t dbSNP:150879291
1731 1731 -, t dbSNP:777771801
1732 1732 c, t dbSNP:753385285
1739 1739 a, c dbSNP:537696248
1751 1751 g, t dbSNP:778606503
1752 1752 a, g dbSNP:747421535
1754 1754 a, g dbSNP:556385232
1759 1759 a, g dbSNP:781770841
1760 1760 a, c dbSNP:62483735
1761 1761 a, c, t dbSNP:748611024
1764 1764 c, g dbSNP:748792478
1765 1765 c, t dbSNP:34834039
1770 1770 a, g dbSNP:763070411
1773 1773 a, t dbSNP:545102223
1775 1775 c, t dbSNP:115082361
1777 1777 a, c, t dbSNP:761529042
1778 1778 a, g dbSNP:752643628
1779 1779 c, g, t dbSNP:760674012
1782 1782 a, g, t dbSNP:147282404
1784 1784 c, t dbSNP:778465093
1792 1792 g, t dbSNP:199591688
1794 1794 c, t dbSNP:750051873
1796 1796 a, g dbSNP:771789815
1799 1799 a, g dbSNP:143238633
1801 1801 c, t dbSNP:144640877
1802 1802 c, g dbSNP:200628770
1804 1804 a, g dbSNP:770257999
1806 1806 c, t dbSNP:778318325
1818 1818 a, c dbSNP:185150343
1819 1819 c, g dbSNP:147632566
1821 1821 a, g, t dbSNP:200701573
1825 1825 c, t dbSNP:772278970
1831 1831 c, t dbSNP:775324458
1832 1832 c, g, t dbSNP:760441148
1835 1835 c, t dbSNP:200054646
1842 1842 c, t dbSNP:776594577
1844 1844 c, t dbSNP:761255779
1849 1849 c, t dbSNP:764748549
1850 1850 -, t dbSNP:746725859
1857 1857 a, g dbSNP:750107408
1858 1858 a, c dbSNP:565118002
1861 1861 a, c, t dbSNP:758187710
1873 1873 c, g dbSNP:753157275
1876 1876 a, g dbSNP:756465757
1886 1886 c, g, t dbSNP:778172982
1896 1896 c, g dbSNP:757295422
1903 1903 c, t dbSNP:567771570
1908 1908 a, g dbSNP:778895934
1925 1925 a, c dbSNP:745936745
1935 1935 a, c, g dbSNP:772331907
1944 1944 a, g dbSNP:746811864
1948 1948 a, c dbSNP:768452573
1950 1950 a, c, g dbSNP:776451160
1956 1956 a, c, t dbSNP:532543160
1963 1963 a, g dbSNP:547503221
1964 1964 c, t dbSNP:766165527
1965 1965 a, g dbSNP:565797278
1974 1974 c, g dbSNP:756457667
1975 1975 g, t dbSNP:530045423
1976 1976 a, g dbSNP:754303700
1986 1986 a, g dbSNP:757841353
1989 1989 g, t dbSNP:375959111
1990 1990 a, c, t dbSNP:745987132
1991 1991 c, t dbSNP:780280673
1997 1997 a, c dbSNP:747199805
2002 2002 c, g dbSNP:768342772
2017 2017 a, g dbSNP:776559459
2019 2019 a, t dbSNP:747878405
2031 2031 g, t dbSNP:769898425
2033 2033 a, g dbSNP:773248487
2039 2039 c, g, t dbSNP:151192830
2042 2042 a, t dbSNP:773888953
2044 2044 c, g dbSNP:759159991
2045 2045 c, t dbSNP:200870786
2051 2051 c, t dbSNP:767070902
2053 2053 c, g, t dbSNP:754280331
2054 2054 a, t dbSNP:567490060
2069 2069 c, g, t dbSNP:140333451
2070 2070 a, g dbSNP:780046967
2071 2071 c, t dbSNP:200376693
2072 2072 a, g, t dbSNP:200337637
2076 2076 a, g dbSNP:748010706
2083 2083 a, g dbSNP:769668303
2084 2084 c, t dbSNP:571489334
2085 2085 a, g dbSNP:749179550
2086 2086 a, t dbSNP:145324862
2087 2087 a, g dbSNP:773977336
2098 2098 c, t dbSNP:758947983
2100 2100 g, t dbSNP:771799449
2104 2104 a, c dbSNP:774965382
2109 2109 a, g dbSNP:752654958
2113 2113 a, g dbSNP:538801500
2114 2114 a, c dbSNP:765530809
2115 2115 a, t dbSNP:137946487
2118 2118 c, t dbSNP:763522190
2124 2124 a, g dbSNP:766785930
2128 2128 a, g dbSNP:751705714
2129 2129 c, t dbSNP:754977124
2130 2130 a, g dbSNP:374584694
2133 2133 c, t dbSNP:752810282
2140 2140 a, g dbSNP:755985561
2142 2142 a, g dbSNP:777643232
2143 2143 a, c dbSNP:749090338
2144 2144 a, c, t dbSNP:771049776
2147 2147 a, g dbSNP:745415167
2149 2149 c, t dbSNP:771435535
2151 2151 c, g, t dbSNP:775222459
2154 2154 a, g, t dbSNP:572058292
2158 2158 a, g dbSNP:763285731
2160 2160 c, t dbSNP:766945748
2161 2161 c, t dbSNP:774676936
2165 2165 aatc, ggct dbSNP:71517134
2165 2165 a, g dbSNP:144608211
2168 2168 g, t dbSNP:542302971
2170 2170 a, g dbSNP:71557215
2173 2173 a, c, g dbSNP:71557216
2174 2174 c, t dbSNP:756471193
2175 2175 a, c, t dbSNP:149430520
2177 2177 c, t dbSNP:757077942
2181 2181 a, g dbSNP:778933781
2184 2184 a, c dbSNP:745736940
2190 2190 a, g dbSNP:757933292
2191 2191 c, t dbSNP:71557217
2192 2192 a, t dbSNP:779500274
2194 2194 a, t dbSNP:71557218
2201 2201 c, t dbSNP:746512921
2203 2203 c, t dbSNP:750253898
2208 2208 a, g dbSNP:768351156
2213 2213 c, t dbSNP:776231169
2214 2214 a, c dbSNP:749681302
2215 2215 c, t dbSNP:771149287
2216 2216 c, t dbSNP:201992556
2218 2218 a, c dbSNP:71530303
2221 2221 a, c, t dbSNP:377637063
2227 2227 c, g, t dbSNP:543731095
2229 2229 a, c dbSNP:775769717
2234 2234 a, c dbSNP:71557219
2243 2243 a, c dbSNP:764442428
2244 2244 a, g dbSNP:754064926
2252 2252 c, t dbSNP:71557220
2254 2254 a, g dbSNP:764876002
2256 2256 a, g dbSNP:71557221
2259 2259 a, g dbSNP:758328942
2260 2260 a, g dbSNP:779949071
2261 2261 c, t dbSNP:71557222
2264 2264 a, g dbSNP:749237615
2265 2265 c, t dbSNP:754441362
2266 2266 a, c dbSNP:71557223
2269 2269 c, t dbSNP:768408286
2277 2277 cc, ta dbSNP:71517135
2277 2277 c, t dbSNP:780840820
2278 2278 a, c dbSNP:747738703
2282 2282 a, t dbSNP:141963005
2286 2286 g, t dbSNP:201342096
2296 2296 c, t dbSNP:530201412
2298 2298 c, t dbSNP:71557224
2300 2300 a, g dbSNP:267601197
2307 2307 a, g, t dbSNP:71557225
2308 2308 c, t dbSNP:760860950
2309 2309 c, g, t dbSNP:768800921
2310 2310 a, c dbSNP:762011699
2313 2313 g, t dbSNP:147264588
2315 2315 c, t dbSNP:750238811
2319 2319 a, g dbSNP:763253648
2320 2320 aaacgctgttgac, ccatgctggtggt dbSNP:71525818
2322 2322 a, g dbSNP:201850213
2323 2323 c, t dbSNP:766331025
2324 2324 a, c, g dbSNP:138994021
2328 2328 c, t dbSNP:780610007
2330 2330 c, g dbSNP:752246598
2333 2333 c, t dbSNP:142958822
2335 2335 g, t dbSNP:777459140
2336 2336 c, t dbSNP:746257827
2347 2347 a, g dbSNP:71557226
2348 2348 c, t dbSNP:565598805
2351 2351 a, c dbSNP:772433484
2358 2358 a, g dbSNP:780720612
2363 2363 ccctattgactccaaaactcaggtgaccg, tcctcttgacacaagcacacatatcacca dbSNP:71525817
2363 2363 c, t dbSNP:747455039
2372 2372 a, c, t dbSNP:147456175
2375 2375 -, a dbSNP:757040207
2377 2377 a, g dbSNP:139274622
2387 2387 c, t dbSNP:369101308
2390 2390 c, t dbSNP:773447977
2392 2392 c, t dbSNP:762675602
2393 2393 a, t dbSNP:766101372
2401 2401 a, g dbSNP:530784171
2402 2402 a, g dbSNP:751500241
2404 2404 c, g, t dbSNP:759533640
2407 2407 c, g dbSNP:752197236
2410 2410 catctacaaccgctgaaggtagcagcatga, gctctcctacaaccactgaaggtaccagcatgc dbSNP:71525816
2410 2410 c, g dbSNP:755618236
2411 2411 a, c dbSNP:777313845
2413 2413 a, c dbSNP:375598176
2419 2419 c, t dbSNP:758839306
2423 2423 c, t dbSNP:780634711
2424 2424 a, g dbSNP:747368046
2425 2425 c, t dbSNP:201110487
2426 2426 c, g, t dbSNP:781704522
2431 2431 a, g dbSNP:771877949
2434 2434 c, t dbSNP:773316689
2436 2436 a, g dbSNP:749457252
2437 2437 g, t dbSNP:771136131
2439 2439 a, g dbSNP:774188044
2441 2441 g, t dbSNP:370889038
2442 2442 c, g dbSNP:538844901
2443 2443 c, t dbSNP:767482113
2446 2446 c, t dbSNP:775457824
2453 2453 g, t dbSNP:149741173
2460 2460 c, g dbSNP:763594335
2462 2462 a, g dbSNP:753284645
2463 2463 a, g dbSNP:757031028
2467 2467 g, t dbSNP:764963540
2469 2469 a, c dbSNP:557250612
2472 2472 c, t dbSNP:71273407
2475 2475 c, t dbSNP:755357712
2477 2477 a, g dbSNP:781576488
2482 2482 a, g dbSNP:748625995
2483 2483 c, t dbSNP:756149193
2487 2487 a, c, t dbSNP:373676381
2489 2489 a, t dbSNP:771189572
2491 2491 a, t dbSNP:774524784
2497 2497 a, t dbSNP:745693764
2497 2497 ccacgccggtgg, tcacaccggtga dbSNP:71286281
2503 2503 c, t dbSNP:771842676
2504 2504 a, g dbSNP:200836006
2505 2505 c, g, t dbSNP:760734712
2514 2514 c, g dbSNP:575495549
2515 2515 c, t dbSNP:199572489
2516 2516 a, c, t dbSNP:776256902
2517 2517 g, t dbSNP:145653913
2519 2519 g, t dbSNP:750051960
2521 2521 c, g dbSNP:755402886
2524 2524 c, g dbSNP:200069756
2527 2527 c, t dbSNP:772968239
2528 2528 c, g dbSNP:371788333
2529 2529 a, c dbSNP:778117873
2535 2535 a, g dbSNP:753958442
2536 2536 a, c dbSNP:757285871
2539 2539 a, c dbSNP:779129045
2544 2544 c, g dbSNP:746023817
2548 2548 a, g dbSNP:142236386
2550 2550 a, t dbSNP:779958389
2551 2551 -, aag dbSNP:781004128
2553 2553 -, c dbSNP:745497259
2555 2555 c, t dbSNP:746760559
2557 2557 -, gtcc dbSNP:769457949
2559 2559 c, t dbSNP:768681546
2560 2560 c, t dbSNP:565675815
2562 2562 a, g dbSNP:761434534
2564 2564 c, g dbSNP:535851582
2566 2566 c, g, t dbSNP:79084107
2567 2567 c, g, t dbSNP:765932098
2577 2577 a, g dbSNP:146441081
2580 2580 c, g dbSNP:764691277
2581 2581 c, t dbSNP:754294223
2583 2583 a, g dbSNP:757334178
2587 2587 c, g dbSNP:779032662
2598 2598 a, c, t dbSNP:750490368
2599 2599 c, t dbSNP:201551273
2607 2607 c, g dbSNP:746855587
2610 2610 a, g dbSNP:768289803
2611 2611 c, g, t dbSNP:140905069
2612 2612 c, t dbSNP:769846928
2613 2613 a, g dbSNP:772912900
2620 2620 a, c dbSNP:762345083
2623 2623 a, c dbSNP:770655028
2624 2624 c, t dbSNP:773833941
2628 2628 a, g dbSNP:77638701
2631 2631 c, t dbSNP:761122407
2633 2633 c, t dbSNP:764384509
2635 2635 c, g dbSNP:76184171
2639 2639 a, c dbSNP:554342956
2640 2640 a, c, g dbSNP:151141256
2641 2641 a, g dbSNP:74852422
2644 2644 a, g dbSNP:766649343
2645 2645 a, c dbSNP:536611151
2649 2649 a, c dbSNP:558829231
2650 2650 c, t dbSNP:781195602
2651 2651 a, c, t dbSNP:577118280
2656 2656 a, c, t dbSNP:370076003
2658 2658 a, g dbSNP:541267676
2661 2661 a, g dbSNP:559883624
2662 2662 a, t dbSNP:574865616
2663 2663 g, t dbSNP:542330663
2664 2664 c, t dbSNP:563596506
2671 2671 a, g dbSNP:777028991
2674 2674 c, t dbSNP:762132203
2676 2676 a, t dbSNP:530937973
2677 2677 a, c dbSNP:200476400
2681 2681 g, t dbSNP:189799131
2683 2683 c, t dbSNP:763104358
2685 2685 a, g dbSNP:766298778
2689 2689 c, g dbSNP:200686630
2690 2690 c, t dbSNP:755312826
2697 2697 a, g dbSNP:767832911
2704 2704 a, c, t dbSNP:752582863
2704 2704 -, c dbSNP:774818224
2705 2705 a, c, g, t dbSNP:138339911
2714 2714 a, c dbSNP:778344562
2722 2722 c, t dbSNP:745360114
2733 2733 a, g dbSNP:771751408
2734 2734 a, c, t dbSNP:143956720
2738 2738 g, t dbSNP:770083631
2740 2740 c, t dbSNP:773770894
2742 2742 a, g dbSNP:112568908
2747 2747 g, t dbSNP:763433288
2755 2755 a, c dbSNP:771460295
2760 2760 c, t dbSNP:774347041
2761 2761 a, g dbSNP:141963257
2764 2764 c, t dbSNP:139093882
2765 2765 a, c, g dbSNP:150735476
2771 2771 c, t dbSNP:57597607
2778 2778 c, t dbSNP:753663178
2779 2779 a, c dbSNP:757190906
2780 2780 -, g dbSNP:774267349
2780 2780 c, g, t dbSNP:536028119
2783 2783 a, g dbSNP:757852060
2785 2785 a, g dbSNP:118141287
2791 2791 -, g dbSNP:768984296
2796 2796 c, t dbSNP:746594538
2800 2800 a, c, t dbSNP:768289873
2801 2801 a, c dbSNP:749645827
2808 2808 c, g, t dbSNP:771385983
2811 2811 a, g dbSNP:61075804
2812 2812 g, t dbSNP:772223146
2813 2813 g, t dbSNP:59155935
2815 2815 -, a dbSNP:774905631
2817 2817 a, g dbSNP:761045482
2818 2818 a, g dbSNP:764354817
2820 2820 a, t dbSNP:753616005
2827 2827 c, g dbSNP:149445753
2828 2828 a, g dbSNP:377519366
2829 2829 c, t dbSNP:750300750
2831 2831 a, c dbSNP:147143284
2833 2833 -, c dbSNP:762296196
2833 2833 c, t dbSNP:779603001
2836 2836 a, c, g, t dbSNP:751052402
2839 2839 c, g, t dbSNP:113609563
2841 2841 c, t dbSNP:779303602
2842 2842 c, t dbSNP:534965755
2845 2845 a, t dbSNP:772703852
2847 2847 a, t dbSNP:553361467
2848 2848 a, g dbSNP:574991022
2851 2851 a, c dbSNP:542016354
2854 2854 c, t dbSNP:768790311
2855 2855 a, g dbSNP:563806733
2857 2857 a, c, t dbSNP:140340852
2858 2858 a, g dbSNP:10267904
2864 2864 c, t dbSNP:762930902
2865 2865 a, g dbSNP:766285885
2866 2866 c, g dbSNP:751113703
2869 2869 c, t dbSNP:575803379
2870 2870 g, t dbSNP:369944845
2871 2871 a, g dbSNP:767101364
2872 2872 a, g dbSNP:58478927
2874 2874 a, g dbSNP:757568733
2875 2875 a, c, t dbSNP:148817224
2876 2876 g, t dbSNP:143454108
2878 2878 g, t dbSNP:780665707
2879 2879 a, c dbSNP:10238201
2881 2881 a, c dbSNP:768722271
2882 2882 a, c dbSNP:10238202
2897 2897 a, t dbSNP:748466386
2898 2898 a, c, g dbSNP:529905788
2904 2904 a, g dbSNP:762709537
2905 2905 c, g dbSNP:373737221
2906 2906 c, t dbSNP:376351644
2907 2907 a, g dbSNP:146914932
2911 2911 c, t dbSNP:766988423
2912 2912 a, c dbSNP:4373459
2916 2916 a, g dbSNP:755854236
2918 2918 c, g dbSNP:763816800
2928 2928 a, g dbSNP:60940057
2929 2929 c, t dbSNP:758786108
2932 2932 a, g dbSNP:780718717
2937 2937 a, c dbSNP:747479331
2938 2938 c, g dbSNP:755433038
2940 2940 g, t dbSNP:781387379
2942 2942 a, c, g dbSNP:189731103
2947 2947 c, t dbSNP:777936596
2958 2958 a, g dbSNP:749105825
2960 2960 a, g dbSNP:770658097
2962 2962 a, g dbSNP:774278006
2963 2963 a, t dbSNP:368230006
2964 2964 a, g dbSNP:771891031
2966 2966 c, t dbSNP:569773585
2974 2974 c, g dbSNP:530507177
2977 2977 a, c dbSNP:775116009
2980 2980 c, t dbSNP:760062564
2981 2981 a, g dbSNP:115078078
2983 2983 c, g dbSNP:551784528
2985 2985 c, g dbSNP:763413913
2986 2986 c, t dbSNP:78990442
2987 2987 c, t dbSNP:751853392
2991 2991 a, g dbSNP:755553445
2994 2994 a, g dbSNP:781517130
2997 2997 a, g dbSNP:144234230
2998 2998 c, t dbSNP:4729646
2999 2999 a, c, g dbSNP:777986047
3001 3001 a, c dbSNP:114262718
3003 3003 c, t dbSNP:778827594
3004 3004 c, t dbSNP:745628675
3010 3010 c, t dbSNP:772087792
3015 3015 a, t dbSNP:775241180
3016 3016 c, t dbSNP:760274671
3018 3018 a, c dbSNP:768212853
3019 3019 a, c dbSNP:776273135
3021 3021 c, g dbSNP:761613785
3026 3026 a, c, t dbSNP:568613221
3027 3027 c, g dbSNP:751991583
3030 3030 a, c dbSNP:371664795
3031 3031 c, t dbSNP:768095131
3032 3032 a, c, g, t dbSNP:146041114
3033 3033 a, c dbSNP:753903000
3034 3034 c, t dbSNP:557259977
3044 3044 c, t dbSNP:778972136
3047 3047 c, t dbSNP:745696820
3052 3052 c, t dbSNP:758069810
3055 3055 a, g dbSNP:780043914
3058 3058 a, c dbSNP:747008417
3059 3059 a, c dbSNP:768698865
3060 3060 c, t dbSNP:78330257
3064 3064 a, c dbSNP:747625949
3066 3066 a, g dbSNP:139908640
3069 3069 a, g dbSNP:575840114
3070 3070 c, t dbSNP:79432420
3075 3075 a, g dbSNP:767710522
3077 3077 c, t dbSNP:775921960
3081 3081 a, t dbSNP:113128963
3082 3082 c, g dbSNP:761230120
3083 3083 c, t dbSNP:764564445
3085 3085 a, g dbSNP:113398040
3087 3087 a, g dbSNP:753958797
3089 3089 a, c, t dbSNP:111907487
3095 3095 c, g dbSNP:765508845
3097 3097 a, c dbSNP:546296550
3098 3098 c, t dbSNP:758639589
3099 3099 a, g dbSNP:779770487
3103 3103 c, g dbSNP:746775565
3107 3107 c, t dbSNP:755001948
3108 3108 c, g dbSNP:558253936
3109 3109 a, g dbSNP:573285703
3111 3111 a, g dbSNP:747686571
3116 3116 g, t dbSNP:769131855
3120 3120 c, t dbSNP:772924373
3122 3122 c, t dbSNP:748963896
3126 3126 a, c dbSNP:770605804
3128 3128 a, c dbSNP:775884371
3131 3131 g, t dbSNP:760997015
3132 3132 a, g dbSNP:540219296
3136 3136 a, t dbSNP:777063998
3139 3139 g, t dbSNP:753809323
3149 3149 a, g dbSNP:765297886
3150 3150 c, g dbSNP:750501239
3152 3152 a, g dbSNP:758594719
3154 3154 a, c dbSNP:766589995
3157 3157 c, t dbSNP:751427881
3162 3162 c, t dbSNP:754767907
3168 3168 g, t dbSNP:781295180
3169 3169 a, g dbSNP:752619635
3172 3172 a, g dbSNP:77671499
3175 3175 a, g dbSNP:777209617
3180 3180 a, c dbSNP:748809838
3182 3182 a, g dbSNP:770529803
3189 3189 a, c, t dbSNP:778499292
3190 3190 a, g dbSNP:111856034
3193 3193 a, c, t dbSNP:144891864
3194 3194 a, g dbSNP:559649161
3200 3200 c, g dbSNP:773201644
3203 3203 -, cac dbSNP:767965626
3206 3206 a, c dbSNP:763045910
3207 3207 a, c, g dbSNP:766727498
3210 3210 a, g dbSNP:759411637
3213 3213 a, g dbSNP:767490986
3215 3215 c, g, t dbSNP:752531675
3217 3217 c, t dbSNP:777735043
3223 3223 c, t dbSNP:141993798
3224 3224 g, t dbSNP:756744349
3227 3227 a, g dbSNP:778540194
3228 3228 a, g dbSNP:745585321
3229 3229 c, g, t dbSNP:144904263
3230 3230 a, c, g, t dbSNP:147962629
3233 3233 -, ca dbSNP:773765741
3233 3233 c, t dbSNP:368136237
3236 3236 a, c dbSNP:762952300
3238 3238 a, t dbSNP:771070485
3242 3242 a, t dbSNP:774571138
3243 3243 a, g dbSNP:759900251
3247 3247 -, ctc dbSNP:760934832
3248 3248 a, g, t dbSNP:542041812
3249 3249 a, c, g dbSNP:78263695
3250 3250 c, g dbSNP:753753023
3251 3251 c, t dbSNP:757181308
3253 3253 c, t dbSNP:764782729
3255 3255 a, g dbSNP:749912126
3257 3257 a, c, t dbSNP:551869721
3263 3263 a, c dbSNP:748479661
3267 3267 a, c dbSNP:756440826
3269 3269 a, t dbSNP:778150343
3270 3270 a, g dbSNP:749874892
3274 3274 c, g dbSNP:771555086
3277 3277 c, g dbSNP:774626283
3280 3280 a, c dbSNP:745912023
3281 3281 g, t dbSNP:772455121
3282 3282 a, g, t dbSNP:775733945
3283 3283 a, c dbSNP:570169897
3285 3285 a, c dbSNP:776274510
3288 3288 a, g dbSNP:761787989
3290 3290 c, g, t dbSNP:765127457
3291 3291 a, g dbSNP:757850001
3292 3292 c, g dbSNP:765958757
3295 3295 c, t dbSNP:751153409
3297 3297 a, t dbSNP:754585627
3298 3298 c, t dbSNP:778261228
3300 3300 c, t dbSNP:10264727
3303 3303 a, g dbSNP:528092332
3314 3314 c, t dbSNP:10249297
3315 3315 g, t dbSNP:138805365
3316 3316 a, g dbSNP:772223293
3320 3320 c, t dbSNP:775581025
3321 3321 a, c dbSNP:747312159
3324 3324 -, a dbSNP:766739622
3324 3324 a, c dbSNP:768737047
3329 3329 a, t dbSNP:546274849
3330 3330 a, g dbSNP:113876641
3331 3331 c, t dbSNP:765178505
3333 3333 c, t dbSNP:568773240
3334 3334 c, t dbSNP:773072041
3337 3337 c, t dbSNP:201494892
3339 3339 c, t dbSNP:762452745
3341 3341 c, t dbSNP:765983912
3343 3343 c, g dbSNP:371466488
3344 3344 a, g, t dbSNP:11769696
3351 3351 a, g dbSNP:149287079
3352 3352 a, g dbSNP:757647777
3353 3353 a, c dbSNP:200569400
3360 3360 c, t dbSNP:750894279
3364 3364 c, g dbSNP:758817472
3365 3365 -, a dbSNP:753795414
3365 3365 a, g dbSNP:780228760
3369 3369 a, g, t dbSNP:75312831
3371 3371 a, g dbSNP:144549886
3372 3372 c, t dbSNP:781218543
3377 3377 c, t dbSNP:148468152
3381 3381 a, c, g, t dbSNP:535755711
3385 3385 c, g dbSNP:142558659
3388 3388 c, t dbSNP:147173571
3389 3389 a, g dbSNP:773956860
3395 3395 c, t dbSNP:140266361
3402 3402 c, g dbSNP:767221636
3403 3403 a, g dbSNP:752339955
3404 3404 a, g dbSNP:569492191
3409 3409 a, g dbSNP:576996088
3412 3412 c, t dbSNP:750792145
3413 3413 c, t dbSNP:758982337
3415 3415 a, t dbSNP:780384062
3419 3419 a, c dbSNP:751681302
3431 3431 c, t dbSNP:147945988
3432 3432 a, g dbSNP:781393959
3435 3435 a, g, t dbSNP:558288813
3436 3436 c, g dbSNP:777596948
3437 3437 c, t dbSNP:573374221
3439 3439 a, g dbSNP:201324731
3442 3442 -, tacct dbSNP:755100561
3442 3442 c, g, t dbSNP:4729647
3443 3443 a, t dbSNP:574704787
3446 3446 -, gtg dbSNP:765293580
3449 3449 c, g, t dbSNP:541781259
3450 3450 a, g dbSNP:563208854
3451 3451 c, t dbSNP:575105047
3453 3453 a, g dbSNP:773743263
3454 3454 a, c, g dbSNP:369901080
3459 3459 a, g dbSNP:751941520
3466 3466 c, g dbSNP:201215592
3468 3468 -, agtt dbSNP:751480343
3468 3468 a, c dbSNP:767639608
3469 3469 a, c, g dbSNP:202090967
3472 3472 c, t dbSNP:777934835
3473 3473 a, g dbSNP:749133916
3475 3475 c, g dbSNP:756944040
3478 3478 c, t dbSNP:200607650
3480 3480 a, c dbSNP:745861621
3481 3481 c, g dbSNP:772123319
3483 3483 a, c, g dbSNP:200868593
3486 3486 a, g dbSNP:150073598
3495 3495 a, g dbSNP:776364088
3500 3500 c, t dbSNP:149201221
3501 3501 a, c dbSNP:766716372
3504 3504 c, g dbSNP:200325294
3505 3505 c, t dbSNP:760007398
3508 3508 a, c dbSNP:767983502
3513 3513 c, t dbSNP:201691077
3514 3514 c, t dbSNP:752809236
3518 3518 c, t dbSNP:373969178
3521 3521 a, t dbSNP:764314819
3523 3523 a, c dbSNP:563885022
3529 3529 c, t dbSNP:77274379
3532 3532 -, c dbSNP:757230748
3535 3535 c, t dbSNP:778632866
3536 3536 a, c, g dbSNP:138884548
3544 3544 a, g dbSNP:780089274
3551 3551 c, t dbSNP:746530305
3556 3556 a, g dbSNP:768210709
3560 3560 c, t dbSNP:776197594
3562 3562 c, t dbSNP:140475164
3563 3563 a, g dbSNP:528164402
3565 3565 c, t dbSNP:774621731
3566 3566 c, g dbSNP:759856667
3569 3569 a, g dbSNP:772594526
3570 3570 g, t dbSNP:775923188
3571 3571 c, t dbSNP:145644847
3573 3573 a, c dbSNP:764226953
3575 3575 c, t dbSNP:375502074
3582 3582 a, g dbSNP:761993298
3589 3589 a, c dbSNP:765457267
3590 3590 a, c, t dbSNP:750206263
3597 3597 a, c, g dbSNP:546606582
3598 3598 c, g dbSNP:754949058
3605 3605 c, g, t dbSNP:780612975
3608 3608 a, g dbSNP:561502076
3612 3612 c, t dbSNP:777437024
3619 3619 a, c, t dbSNP:746249043
3622 3622 a, c dbSNP:775829219
3624 3624 a, g, t dbSNP:761230035
3627 3627 c, g dbSNP:776603835
3630 3630 a, c dbSNP:149515360
3635 3635 c, t dbSNP:201072471
3636 3636 a, c dbSNP:750605983
3637 3637 a, c dbSNP:763259642
3639 3639 a, g dbSNP:766331773
3642 3642 g, t dbSNP:751374832
3643 3643 c, g, t dbSNP:755003918
3646 3646 a, g dbSNP:752172550
3649 3649 c, t dbSNP:755593735
3650 3650 a, t dbSNP:777295516
3651 3651 c, g, t dbSNP:749010750
3655 3655 c, t dbSNP:780448470
3657 3657 a, c dbSNP:747346172
3658 3658 c, t dbSNP:769064023
3659 3659 a, c dbSNP:777135014
3663 3663 g, t dbSNP:748177179
3676 3676 c, g dbSNP:769978558
3680 3680 a, g dbSNP:551310044
3681 3681 c, t dbSNP:763315334
3685 3685 c, t dbSNP:142671748
3687 3687 a, g, t dbSNP:774317611
3688 3688 c, g, t dbSNP:767371089
3692 3692 c, t dbSNP:569528123
3697 3697 a, g dbSNP:763721391
3706 3706 a, g dbSNP:753327030
3718 3718 a, c dbSNP:370304504
3721 3721 a, g dbSNP:756946354
3722 3722 c, t dbSNP:778486833
3723 3723 a, t dbSNP:747384932
3725 3725 a, g dbSNP:755300724
3726 3726 c, t dbSNP:79819548
3727 3727 c, t dbSNP:748748210
3728 3728 a, g, t dbSNP:11769823
3729 3729 g, t dbSNP:201742458
3734 3734 -, ac dbSNP:780912348
3739 3739 c, t dbSNP:771303338
3740 3740 a, g dbSNP:774659126
3744 3744 a, g dbSNP:759255119
3751 3751 a, g dbSNP:767413704
3755 3755 a, t dbSNP:775138905
3756 3756 g, t dbSNP:760718941
3759 3759 a, g dbSNP:763991392
3761 3761 c, t dbSNP:4729648
3762 3762 a, g dbSNP:756695657
3763 3763 -, caccctt dbSNP:755695713
3763 3763 a, g dbSNP:4729649
3763 3763 -, g dbSNP:745689675
3764 3764 c, t dbSNP:750152798
3767 3767 c, t dbSNP:757969489
3771 3771 -, ccc dbSNP:779768378
3771 3771 c, t dbSNP:781657274
3773 3773 -, aacatct dbSNP:748949777
3773 3773 a, c dbSNP:138486268
3774 3774 -, acat dbSNP:768205421
3774 3774 a, c, g dbSNP:149183485
3776 3776 -, atc dbSNP:200902631
3777 3777 a, t dbSNP:10265276
3778 3778 c, t dbSNP:556839568
3780 3780 -, c dbSNP:773776444
3782 3782 c, t dbSNP:4729650
3783 3783 a, g, t dbSNP:373200314
3788 3788 -, t dbSNP:748643886
3788 3788 c, g dbSNP:563920392
3789 3789 a, t dbSNP:4729651
3790 3790 a, c dbSNP:4729652
3794 3794 c, t dbSNP:369264903
3796 3796 c, t dbSNP:768591267
3797 3797 a, c dbSNP:776482232
3798 3798 c, g, t dbSNP:4729653
3803 3803 a, c, g dbSNP:749877975
3806 3806 c, g dbSNP:372499793
3813 3813 c, g dbSNP:753125708
3818 3818 a, t dbSNP:756491461
3820 3820 c, t dbSNP:74899795
3827 3827 a, c dbSNP:754463438
3836 3836 a, g dbSNP:757825887
3837 3837 a, t dbSNP:73168389
3838 3838 c, g dbSNP:561785807
3839 3839 a, c, g, t dbSNP:73168390
3840 3840 a, g dbSNP:768504451
3847 3847 a, g, t dbSNP:776393672
3849 3849 a, g dbSNP:769687768
3850 3850 c, t dbSNP:772809058
3852 3852 a, g dbSNP:762320414
3853 3853 g, t dbSNP:766068017
3854 3854 c, g dbSNP:147997310
3855 3855 g, t dbSNP:759259962
3857 3857 a, g dbSNP:764611986
3858 3858 a, c dbSNP:754232678
3860 3860 a, g dbSNP:375814328
3862 3862 a, c, t dbSNP:765624355
3863 3863 c, t dbSNP:758341283
3864 3864 a, c, t dbSNP:141712687
3866 3866 a, c dbSNP:145962817
3868 3868 c, g dbSNP:781004413
3870 3870 a, c, g dbSNP:138873624
3872 3872 c, t dbSNP:772962798
3880 3880 g, t dbSNP:748836423
3883 3883 g, t dbSNP:73402889
3884 3884 a, t dbSNP:563219376
3889 3889 c, t dbSNP:759311513
3890 3890 a, g dbSNP:767251592
3906 3906 g, t dbSNP:777171265
3907 3907 c, t dbSNP:762222813
3913 3913 c, t dbSNP:765789494
3916 3916 a, c, t dbSNP:77199586
3917 3917 a, g dbSNP:766413428
3918 3918 c, t dbSNP:183323874
3921 3921 c, g dbSNP:755223781
3924 3924 a, t dbSNP:75492258
3930 3930 c, t dbSNP:747947864
3942 3942 a, g dbSNP:755796707
3943 3943 a, c dbSNP:777620617
3944 3944 c, t dbSNP:749243974
3948 3948 -, taacaac dbSNP:772728754
3949 3949 c, t dbSNP:147387209
3951 3951 a, g, t dbSNP:375644852
3954 3954 a, c dbSNP:377002828
3956 3956 c, t dbSNP:775229226
3960 3960 c, g dbSNP:760397026
3963 3963 a, g dbSNP:765576551
3966 3966 a, t dbSNP:78010183
3967 3967 a, c dbSNP:763406863
3968 3968 -, a dbSNP:773676098
3972 3972 a, g dbSNP:113959201
3973 3973 a, g, t dbSNP:139014940
3978 3978 a, g dbSNP:77299546
3981 3981 a, g, t dbSNP:201133427
3986 3986 c, t dbSNP:777478842
3988 3988 -, c dbSNP:761129409
3989 3989 c, t dbSNP:753639513
3990 3990 a, g dbSNP:757176929
3991 3991 a, c dbSNP:566973972
3992 3992 a, t dbSNP:745387148
3996 3996 g, t dbSNP:771644691
4003 4003 c, t dbSNP:779694206
4009 4009 c, t dbSNP:144372503
4014 4014 a, c dbSNP:148799886
4015 4015 c, t dbSNP:773476350
4017 4017 a, g dbSNP:763326857
4018 4018 -, tg dbSNP:771004015
4025 4025 c, t dbSNP:771355424
4028 4028 c, t dbSNP:774771904
4032 4032 a, t dbSNP:760030447
4034 4034 g, t dbSNP:767643648
4039 4039 c, t dbSNP:752754042
4040 4040 c, g dbSNP:371072233
4043 4043 a, t dbSNP:760848150
4049 4049 c, t dbSNP:78176991
4051 4051 a, c, g dbSNP:147179553
4052 4052 c, t dbSNP:374292311
4053 4053 a, g dbSNP:750440406
4057 4057 a, g dbSNP:758384556
4059 4059 a, t dbSNP:779747138
4060 4060 g, t dbSNP:567704420
4061 4061 a, g dbSNP:537895264
4063 4063 c, g dbSNP:192344278
4067 4067 a, t dbSNP:575189452
4070 4070 a, g dbSNP:771350868
4074 4074 a, c dbSNP:774686199
4075 4075 a, g dbSNP:760087315
4076 4076 a, c, t dbSNP:772537397
4077 4077 a, g dbSNP:539323654
4078 4078 a, c, t dbSNP:764240698
4080 4080 a, c dbSNP:761940224
4081 4081 a, c, t dbSNP:139728451
4083 4083 c, g dbSNP:758437438
4085 4085 a, c dbSNP:200539443
4087 4087 a, g dbSNP:751043472
4091 4091 a, c, t dbSNP:754444024
4096 4096 c, t dbSNP:4269454
4097 4097 a, g dbSNP:151068583
4104 4104 a, c dbSNP:779292749
4105 4105 c, g dbSNP:746191834
4108 4108 a, c dbSNP:772590752
4112 4112 -, a dbSNP:776901893
4113 4113 a, g dbSNP:776011702
4118 4118 c, t dbSNP:114028181
4119 4119 a, g dbSNP:768850944
4120 4120 c, t dbSNP:369776449
4122 4122 a, c dbSNP:762163753
4129 4129 c, t dbSNP:149773793
4132 4132 c, t dbSNP:183213646
4135 4135 c, t dbSNP:762778270
4136 4136 c, t dbSNP:374482856
4138 4138 c, t dbSNP:751762337
4144 4144 a, c dbSNP:751581004
4145 4145 c, t dbSNP:754857409
4152 4152 c, g dbSNP:767105018
4157 4157 c, g dbSNP:71273405
4166 4166 c, t dbSNP:752117542
4175 4175 c, t dbSNP:545732275
4176 4176 ca, tg dbSNP:386716198
4176 4176 c, g, t dbSNP:4367469
4177 4177 a, g, t dbSNP:146243352
4192 4192 c, t dbSNP:201626817
4194 4194 gcaaaaga, tctgaagg dbSNP:71286280
4194 4194 c, t dbSNP:769009152
4200 4200 a, g dbSNP:776799260
4209 4209 a, c dbSNP:766195356
4210 4210 c, g, t dbSNP:770150739
4211 4211 a, g dbSNP:527882807
4212 4212 c, t dbSNP:770816615
4216 4216 a, c dbSNP:773993523
4222 4222 a, c dbSNP:77700763
4227 4227 a, g dbSNP:767318047
4232 4232 a, g dbSNP:142717037
4233 4233 a, g dbSNP:760122109
4234 4234 gaaccactc, taagtactt dbSNP:71286279
4237 4237 -, c dbSNP:759715075
4237 4237 c, g dbSNP:531676705
4238 4238 c, g, t dbSNP:549788476
4242 4242 a, c dbSNP:201063970
4243 4243 c, g, t dbSNP:141608296
4244 4244 a, g dbSNP:373650163
4246 4246 c, t dbSNP:755528930
4247 4247 a, c dbSNP:376579890
4252 4252 g, t dbSNP:781490888
4256 4256 a, g dbSNP:557774925
4258 4258 c, t dbSNP:71271502
4261 4261 a, t dbSNP:566757675
4270 4270 cgccggtact, tgccagtggc dbSNP:71286278
4270 4270 c, g, t dbSNP:374939837
4271 4271 a, g dbSNP:138415845
4273 4273 c, t dbSNP:759205801
4274 4274 a, g dbSNP:200627718
4275 4275 a, g dbSNP:775342926
4277 4277 a, g, t dbSNP:76847084
4278 4278 a, c, g dbSNP:147422409
4288 4288 a, g dbSNP:114941002
4290 4290 g, t dbSNP:755228177
4291 4291 c, t dbSNP:116960680
4298 4298 a, c dbSNP:753312213
4305 4305 a, g dbSNP:144415309
4311 4311 c, t dbSNP:191195575
4313 4313 a, t dbSNP:778038950
4314 4314 a, g dbSNP:749340803
4315 4315 c, t dbSNP:185024900
4319 4319 c, t dbSNP:778947338
4321 4321 a, c dbSNP:144263818
4322 4322 c, g dbSNP:771831953
4324 4324 a, g dbSNP:775254596
4327 4327 c, t dbSNP:747002636
4328 4328 a, c dbSNP:200296064
4333 4333 g, t dbSNP:148743807
4339 4339 a, c dbSNP:761165919
4343 4343 cactggaaccagttca, tactgaagccacttcg dbSNP:71286276
4344 4344 a, g dbSNP:764944060
4351 4351 a, c dbSNP:772805651
4353 4353 a, g dbSNP:762652484
4361 4361 a, t dbSNP:556261069
4362 4362 c, t dbSNP:768043170
4368 4368 a, c dbSNP:201331981
4376 4376 a, c dbSNP:756720684
4380 4380 a, g dbSNP:151245477
4381 4381 c, t dbSNP:200248807
4383 4383 a, g dbSNP:757217935
4388 4388 a, g dbSNP:779048358
4389 4389 c, g dbSNP:746137548
4390 4390 c, g dbSNP:758628983
4391 4391 a, g dbSNP:139212028
4393 4393 c, t dbSNP:746753977
4394 4394 c, t dbSNP:144492126
4397 4397 a, g dbSNP:776482379
4398 4398 a, c dbSNP:748108793
4399 4399 a, c dbSNP:769244163
4402 4402 c, t dbSNP:762553494
4411 4411 a, g dbSNP:766089487
4413 4413 a, g dbSNP:199998261
4414 4414 a, c, g dbSNP:776020878
4415 4415 c, g dbSNP:764704098
4419 4419 a, c dbSNP:754371182
4420 4420 c, g dbSNP:757771890
4422 4422 -, t dbSNP:765334973
4424 4424 a, c dbSNP:765285288
4426 4426 a, c dbSNP:200860412
4428 4428 a, g dbSNP:758654624
4429 4429 a, g dbSNP:150352552
4433 4433 a, g dbSNP:555249856
4442 4442 c, g dbSNP:754832323
4443 4443 a, c dbSNP:781026226
4444 4444 a, c, t dbSNP:137958529
4447 4447 c, t dbSNP:560666815
4448 4448 a, g dbSNP:748783299
4449 4449 a, c dbSNP:770722737
4450 4450 c, t dbSNP:376999192
4451 4451 a, g dbSNP:527976330
4452 4452 c, g dbSNP:769203750
4456 4456 c, t dbSNP:201214728
4459 4459 a, g dbSNP:143101755
4469 4469 c, t dbSNP:777034883
4470 4470 a, g dbSNP:367797083
4471 4471 a, g dbSNP:765739979
4473 4473 a, g dbSNP:148190043
4475 4475 c, g dbSNP:371699299
4480 4480 c, t dbSNP:766439300
4481 4481 a, g dbSNP:141562866
4482 4482 a, t dbSNP:146383432
4485 4485 a, g dbSNP:780888598
4486 4486 a, c dbSNP:752496113
4488 4488 c, g dbSNP:138483731
4489 4489 c, t dbSNP:777708369
4492 4492 c, t dbSNP:7780935
4494 4494 g, t dbSNP:770633160
4498 4498 c, g dbSNP:778555889
4499 4499 c, t dbSNP:745568240
4501 4501 a, g dbSNP:200436462
4504 4504 a, g, t dbSNP:370710978
4512 4512 a, g dbSNP:770202672
4514 4514 c, g dbSNP:773832389
4517 4517 c, t dbSNP:763434086
4522 4522 c, g dbSNP:766492744
4523 4523 a, t dbSNP:751606808
4525 4525 a, c dbSNP:759784875
4528 4528 g, t dbSNP:767730368
4529 4529 c, t dbSNP:376658584
4531 4531 c, g dbSNP:201692386
4535 4535 a, c dbSNP:777426968
4540 4540 c, t dbSNP:753886175
4544 4544 a, g dbSNP:549876228
4548 4548 a, g dbSNP:778609388
4558 4558 c, g, t dbSNP:745335711
4562 4562 a, c dbSNP:375674797
4565 4565 a, g dbSNP:746633963
4566 4566 c, g dbSNP:770248415
4570 4570 a, c, t dbSNP:773540811
4573 4573 a, c, g dbSNP:369224185
4574 4574 a, c dbSNP:372926558
4576 4576 c, t dbSNP:374713003
4577 4577 a, g, t dbSNP:775850106
4579 4579 a, c dbSNP:764000377
4580 4580 c, t dbSNP:753658368
4583 4583 a, t dbSNP:746654688
4591 4591 a, c, g, t dbSNP:757294503
4591 4591 -, g dbSNP:761694272
4592 4592 a, c dbSNP:571363585
4593 4593 -, c dbSNP:767447285
4596 4596 a, c, g dbSNP:144027969
4601 4601 a, g dbSNP:368847279
4602 4602 a, t dbSNP:778139714
4603 4603 c, g dbSNP:749605656
4605 4605 a, g dbSNP:771440942
4608 4608 a, g dbSNP:774774022
4610 4610 a, g dbSNP:199808245
4614 4614 -, g dbSNP:750159838
4626 4626 a, g dbSNP:532372949
4632 4632 a, g dbSNP:775411537
4636 4636 g, t dbSNP:760999728
4637 4637 g, t dbSNP:764374702
4639 4639 c, g dbSNP:776594631
4640 4640 c, t dbSNP:761646677
4641 4641 a, g dbSNP:765116516
4645 4645 c, t dbSNP:77564441
4646 4646 a, c, g dbSNP:750440262
4650 4650 a, c dbSNP:765951259
4651 4651 a, g dbSNP:193175136
4652 4652 -, c dbSNP:779778673
4652 4652 c, g, t dbSNP:73168392
4657 4657 c, g, t dbSNP:780765012
4660 4660 c, g dbSNP:757686217
4661 4661 a, c dbSNP:139839572
4663 4663 -, ctc dbSNP:753499849
4664 4664 g, t dbSNP:757282148
4665 4665 c, t dbSNP:746436897
4667 4667 c, t dbSNP:772429982
4668 4668 g, t dbSNP:780216742
4672 4672 -, tc dbSNP:754636871
4672 4672 a, t dbSNP:199509433
4674 4674 a, c dbSNP:200823544
4676 4676 c, t dbSNP:776931891
4684 4684 c, t dbSNP:201195011
4686 4686 c, g dbSNP:769757137
4687 4687 a, c, t dbSNP:772848818
4691 4691 c, t dbSNP:766188440
4693 4693 c, t dbSNP:751085838
4698 4698 g, t dbSNP:758989741
4705 4705 -, c dbSNP:778439002
4705 4705 c, t dbSNP:767001649
4707 4707 a, g dbSNP:752412903
4711 4711 a, c dbSNP:755732013
4714 4714 c, t dbSNP:200640626
4720 4720 c, g dbSNP:377427134
4722 4722 a, g dbSNP:74209688
4730 4730 c, t dbSNP:77488581
4731 4731 a, g, t dbSNP:371133077
4741 4741 a, t dbSNP:781393286
4743 4743 c, g dbSNP:748433173
4744 4744 a, c dbSNP:142741280
4746 4746 a, g dbSNP:150982179
4756 4756 a, g dbSNP:762589913
4760 4760 c, t dbSNP:770916384
4762 4762 a, g dbSNP:774213963
4763 4763 a, t dbSNP:140849701
4767 4767 a, g dbSNP:767053011
4770 4770 a, g dbSNP:78217358
4771 4771 c, t dbSNP:760340861
4773 4773 c, t dbSNP:537999927
4783 4783 a, g dbSNP:146702080
4785 4785 a, g, t dbSNP:140211003
4787 4787 g, t dbSNP:556298113
4788 4788 c, t dbSNP:752050171
4789 4789 -, t dbSNP:772644763
4789 4789 c, g dbSNP:755524044
4801 4801 g, t dbSNP:781446503
4804 4804 c, t dbSNP:748200365
4805 4805 c, g dbSNP:756411779
4806 4806 g, t dbSNP:577808535
4808 4808 c, g dbSNP:137906776
4810 4810 c, t dbSNP:567501011
4813 4813 c, g dbSNP:777801768
4825 4825 a, g dbSNP:749514214
4826 4826 a, c, t dbSNP:200761782
4827 4827 a, g dbSNP:774164429
4828 4828 c, t dbSNP:745853209
4831 4831 c, t dbSNP:373621129
4833 4833 c, t dbSNP:143050980
4840 4840 a, c dbSNP:760108073
4840 4840 -, c dbSNP:778441557
4844 4844 -, ta dbSNP:747580593
4844 4844 -, t dbSNP:771325274
4851 4851 g, t dbSNP:553712832
4860 4860 c, g dbSNP:377667267
4864 4864 a, t dbSNP:761500320
4868 4868 c, t dbSNP:535439393
4869 4869 a, g dbSNP:148344968
4870 4870 a, c dbSNP:755575463
4871 4871 a, c, t dbSNP:141533166
4872 4872 c, t dbSNP:756206563
4875 4875 a, g dbSNP:543338104
4881 4881 a, g dbSNP:749512875
4882 4882 c, g dbSNP:757478837
4883 4883 c, t dbSNP:778593944
4888 4888 c, t dbSNP:745620246
4890 4890 c, t dbSNP:771999033
4898 4898 a, c, t dbSNP:775346739
4899 4899 a, g dbSNP:768113808
4904 4904 a, g dbSNP:139989768
4905 4905 c, g dbSNP:761398607
4906 4906 a, g dbSNP:112183311
4909 4909 a, c, g dbSNP:147244857
4916 4916 a, g dbSNP:759924831
4917 4917 a, c dbSNP:767981989
4920 4920 a, t dbSNP:753324376
4921 4921 a, c, t dbSNP:761214155
4926 4926 a, g dbSNP:753905202
4929 4929 -, c dbSNP:772410369
4934 4934 a, t dbSNP:189501078
4938 4938 a, g dbSNP:375103172
4942 4942 a, g dbSNP:779038710
4943 4943 a, g, t dbSNP:750229186
4944 4944 a, c dbSNP:779816122
4945 4945 c, t dbSNP:113443006
4948 4948 c, t dbSNP:768593476
4950 4950 c, t dbSNP:780600835
4954 4954 a, c dbSNP:543560929
4962 4962 a, c dbSNP:769346448
4965 4965 c, g dbSNP:773058252
4971 4971 a, c dbSNP:762690721
4975 4975 a, c, t dbSNP:201259809
4976 4976 a, g dbSNP:199826596
4977 4977 a, c dbSNP:764620615
4978 4978 c, t dbSNP:199590434
4979 4979 a, g dbSNP:368056044
4980 4980 g, t dbSNP:765284835
4983 4983 a, g, t dbSNP:200706043
4989 4989 c, t dbSNP:202040969
4995 4995 a, g dbSNP:145386724
4996 4996 c, t dbSNP:751333095
4998 4998 a, g dbSNP:754878022
5000 5000 c, g dbSNP:781128661
5006 5006 g, t dbSNP:146418056
5008 5008 c, t dbSNP:199771828
5009 5009 a, t dbSNP:777386526
5012 5012 -, a dbSNP:775922780
5015 5015 g, t dbSNP:748999087
5018 5018 c, t dbSNP:770657555
5021 5021 c, g, t dbSNP:370244807
5027 5027 -, caa dbSNP:769936538
5027 5027 c, t dbSNP:769054023
5030 5030 a, c dbSNP:200727248
5035 5035 c, t dbSNP:150263413
5036 5036 a, t dbSNP:765337924
5037 5037 a, g dbSNP:138951991
5038 5038 c, t dbSNP:763198772
5040 5040 a, g, t dbSNP:149393279
5041 5041 c, t dbSNP:754862369
5044 5044 -, c dbSNP:775477689
5048 5048 c, t dbSNP:767213982
5049 5049 a, g dbSNP:752720919
5050 5050 a, c dbSNP:151103416
5051 5051 g, t dbSNP:777447146
5053 5053 a, g dbSNP:748766534
5056 5056 a, c, t dbSNP:138509098
5057 5057 c, g dbSNP:200732595
5061 5061 a, t dbSNP:778568064
5062 5062 a, c, t dbSNP:145566218
5063 5063 a, g dbSNP:769129027
5064 5064 c, t dbSNP:370830745
5065 5065 -, ctc dbSNP:763033136
5065 5065 c, t dbSNP:776825020
5071 5071 c, t dbSNP:143909059
5073 5073 a, c, t dbSNP:770249294
5075 5075 a, t dbSNP:762965391
5076 5076 a, g dbSNP:140695064
5079 5079 g, t dbSNP:774703091
5082 5082 g, t dbSNP:373715243
5086 5086 a, c dbSNP:376398816
5087 5087 a, c, t dbSNP:752387118
5088 5088 a, g dbSNP:764056009
5090 5090 a, c dbSNP:753410377
5094 5094 c, t dbSNP:368432656
5095 5095 a, c dbSNP:141427486
5098 5098 a, c dbSNP:778279328
5100 5100 c, t dbSNP:201934879
5104 5104 a, c dbSNP:150580443
5105 5105 g, t dbSNP:745570084
5108 5108 c, t dbSNP:4992072
5109 5109 a, g dbSNP:371974588
5110 5110 c, g dbSNP:4992073
5115 5115 a, g dbSNP:748448650
5115 5115 -, g dbSNP:764215045
5116 5116 a, g dbSNP:73168394
5118 5118 a, g dbSNP:778313320
5119 5119 a, g dbSNP:749792111
5122 5122 c, g dbSNP:771084387
5130 5130 a, t dbSNP:774273312
5134 5134 a, g dbSNP:114662093
5138 5138 aactgtcagaacaacaccggtggccagc, gcctgtcagcaccacactggtggccact dbSNP:71525815
5138 5138 a, g dbSNP:772144437
5139 5139 a, c dbSNP:775359730
5140 5140 c, g dbSNP:760486936
5141 5141 a, t dbSNP:763966240
5143 5143 g, t dbSNP:753890225
5145 5145 -, ag dbSNP:750354142
5145 5145 a, g dbSNP:761808252
5147 5147 a, c dbSNP:764847891
5149 5149 a, c dbSNP:749851043
5150 5150 -, cc dbSNP:760567465
5150 5150 a, c dbSNP:758078294
5152 5152 a, c dbSNP:779518949
5155 5155 c, t dbSNP:751201961
5156 5156 a, g dbSNP:113242057
5157 5157 a, g dbSNP:372968513
5158 5158 g, t dbSNP:749845873
5160 5160 a, g dbSNP:771294223
5164 5164 a, c, g dbSNP:779082738
5165 5165 c, t dbSNP:4992074
5166 5166 a, t dbSNP:775910681
5170 5170 c, g dbSNP:760971538
5180 5180 c, t dbSNP:768609048
5191 5191 c, g dbSNP:375087957
5192 5192 -, c dbSNP:766176910
5195 5195 c, t dbSNP:71557227
5196 5196 a, g dbSNP:149023842
5200 5200 a, g dbSNP:749966716
5201 5201 -, a dbSNP:753599675
5203 5203 a, c dbSNP:66496833
5206 5206 a, g dbSNP:765912344
5209 5209 a, c dbSNP:202185402
5221 5221 a, c dbSNP:71557228
5226 5226 a, g dbSNP:778133438
5232 5232 a, g dbSNP:538704426
5235 5235 a, c, t dbSNP:71273404
5236 5236 a, g dbSNP:140602043
5239 5239 c, t dbSNP:267601198
5240 5240 a, c, g, t dbSNP:180799111
5242 5242 c, t dbSNP:747282104
5246 5246 c, t dbSNP:201990953
5250 5250 a, g dbSNP:377738200
5253 5253 g, t dbSNP:776595048
5258 5258 a, g dbSNP:55974941
5260 5260 a, g dbSNP:769619923
5263 5263 c, g dbSNP:535830322
5265 5265 a, g dbSNP:762920828
5267 5267 c, t dbSNP:765923572
5268 5268 a, c dbSNP:773802211
5269 5269 a, c, t dbSNP:370888430
5273 5273 a, g dbSNP:754212779
5275 5275 a, c, t dbSNP:71273403
5276 5276 c, t dbSNP:138467948
5278 5278 c, g dbSNP:750932564
5279 5279 a, t dbSNP:758911945
5280 5280 a, g dbSNP:780301544
5281 5281 a, c dbSNP:747043102
5282 5282 c, t dbSNP:755267788
5284 5284 c, g dbSNP:576323320
5288 5288 g, t dbSNP:748402831
5296 5296 c, g, t dbSNP:543646015
5297 5297 c, t dbSNP:565117879
5303 5303 a, c, g, t dbSNP:4992075
5314 5314 c, t dbSNP:766999661
5315 5315 a, g dbSNP:541533185
5316 5316 a, c dbSNP:760343469
5324 5324 c, t dbSNP:765566437
5326 5326 c, t dbSNP:750746021
5328 5328 a, g dbSNP:759001856
5329 5329 c, t dbSNP:766922764
5332 5332 c, t dbSNP:201025282
5333 5333 a, g dbSNP:149337515
5334 5334 g, t dbSNP:781393368
5335 5335 g, t dbSNP:752914671
5337 5337 c, g dbSNP:546003119
5340 5340 a, g dbSNP:777460515
5346 5346 a, g dbSNP:749046973
5348 5348 a, c, g dbSNP:148096926
5352 5352 a, g dbSNP:745799755
5353 5353 a, g dbSNP:200284218
5354 5354 c, g, t dbSNP:528518398
5356 5356 c, t dbSNP:760264655
5364 5364 a, g dbSNP:374149995
5367 5367 a, t dbSNP:768311763
5369 5369 -, t dbSNP:778434644
5376 5376 g, t dbSNP:773451455
5378 5378 c, t dbSNP:763471565
5381 5381 a, c dbSNP:766848928
5382 5382 a, g dbSNP:752155885
5383 5383 c, g dbSNP:760101017
5385 5385 a, t dbSNP:767516672
5386 5386 a, c dbSNP:112202969
5387 5387 a, c, t dbSNP:139275375
5389 5389 c, t dbSNP:754044904
5390 5390 g, t dbSNP:757108105
5392 5392 g, t dbSNP:182021493
5398 5398 a, c dbSNP:571487763
5403 5403 a, g dbSNP:771943886
5404 5404 c, t dbSNP:779457473
5409 5409 a, g dbSNP:144105018
5410 5410 c, g, t dbSNP:186034438
5411 5411 c, t dbSNP:761529840
5416 5416 c, t dbSNP:145956810
5417 5417 a, g dbSNP:139517964
5422 5422 c, t dbSNP:565589818
5427 5427 a, g dbSNP:760152117
5429 5429 g, t dbSNP:768001102
5434 5434 a, g dbSNP:149705635
5438 5438 c, t dbSNP:760867965
5439 5439 a, c dbSNP:764075011
5440 5440 c, g, t dbSNP:145455751
5441 5441 c, t dbSNP:765037778
5442 5442 a, g dbSNP:750175997
5443 5443 a, g dbSNP:758269679
5445 5445 a, g dbSNP:148833431
5447 5447 a, g dbSNP:540225527
5449 5449 c, g dbSNP:145641335
5455 5455 c, t dbSNP:147751797
5456 5456 a, c, g dbSNP:142682652
5460 5460 c, g dbSNP:769532658
5461 5461 c, t dbSNP:774861339
5465 5465 -, c dbSNP:752200638
5472 5472 a, g dbSNP:746178282
5473 5473 c, t dbSNP:147353603
5476 5476 a, c dbSNP:147991653
5478 5478 c, g dbSNP:761053384
5480 5480 a, g dbSNP:764283298
5487 5487 a, g dbSNP:776642400
5488 5488 a, g dbSNP:75782138
5489 5489 c, t dbSNP:752666969
5493 5493 c, t dbSNP:73712042
5495 5495 a, c, t dbSNP:138130130
5498 5498 a, c dbSNP:374329623
5506 5506 c, g, t dbSNP:766059530
5507 5507 a, g dbSNP:754826660
5509 5509 c, t dbSNP:780884303
5514 5514 a, g dbSNP:747595087
5515 5515 a, c dbSNP:367815935
5522 5522 c, t dbSNP:553480514
5527 5527 c, g, t dbSNP:777627221
5530 5530 a, c, g dbSNP:200515355
5531 5531 a, c dbSNP:747573004
5533 5533 c, t dbSNP:201493125
5534 5534 c, t dbSNP:776691655
5535 5535 c, t dbSNP:202242036
5545 5545 c, t dbSNP:765284766
5546 5546 g, t dbSNP:773466786
5548 5548 c, t dbSNP:763067080
5549 5549 c, t dbSNP:574829126
5550 5550 a, g dbSNP:751276441
5551 5551 c, t dbSNP:759522454
5553 5553 a, g dbSNP:767505261
5560 5560 a, g dbSNP:199683839
5567 5567 c, t dbSNP:146261861
5575 5575 c, t dbSNP:563649703
5576 5576 a, t dbSNP:777384582
5581 5581 c, t dbSNP:753574465
5582 5582 a, t dbSNP:200687720
5583 5583 a, g dbSNP:756810856
5584 5584 a, c dbSNP:201645131
5587 5587 g, t dbSNP:199908256
5588 5588 c, g dbSNP:780498899
5590 5590 a, c, g, t dbSNP:139561019
5590 5590 -, g dbSNP:777494379
5594 5594 a, g dbSNP:191097038
5599 5599 c, t dbSNP:202220584
5603 5603 a, g dbSNP:748646934
5604 5604 a, c, t dbSNP:146323653
5606 5606 a, t dbSNP:763270594
5607 5607 a, g dbSNP:79565573
5612 5612 a, c dbSNP:148675022
5614 5614 a, g dbSNP:774209536
5617 5617 c, g, t dbSNP:141195508
5619 5619 a, g dbSNP:752723958
5624 5624 -, a dbSNP:747493107
5624 5624 a, g dbSNP:529733229
5625 5625 c, g dbSNP:139009576
5626 5626 a, c, t dbSNP:753245932
5629 5629 c, t dbSNP:778367192
5632 5632 c, g dbSNP:750073053
5635 5635 c, t dbSNP:147735350
5636 5636 a, c, g, t dbSNP:141016213
5642 5642 g, t dbSNP:144965214
5650 5650 a, c, g dbSNP:200081448
5651 5651 -, cact dbSNP:771361578
5651 5651 a, c, g dbSNP:201207919
5652 5652 a, c dbSNP:201970250
5655 5655 c, g dbSNP:111850657
5662 5662 c, g dbSNP:772039415
5669 5669 a, g dbSNP:201138200
5671 5671 c, t dbSNP:376151819
5680 5680 c, g dbSNP:368008965
5683 5683 c, t dbSNP:542362576
5688 5688 g, t dbSNP:776214132
5692 5692 a, c, t dbSNP:74687161
5695 5695 c, g, t dbSNP:371778779
5699 5699 g, t dbSNP:767903717
5700 5700 c, g dbSNP:752997225
5702 5702 a, c dbSNP:148987719
5704 5704 c, t dbSNP:778201631
5705 5705 c, t dbSNP:546172070
5708 5708 c, t dbSNP:757322867
5710 5710 c, g, t dbSNP:201300745
5711 5711 c, g dbSNP:772377781
5718 5718 -, acaactcccg dbSNP:201762013
5722 5722 a, c dbSNP:775430087
5723 5723 -, c dbSNP:781575805
5724 5724 c, t dbSNP:746742825
5726 5726 c, t dbSNP:10257974
5727 5727 a, g dbSNP:776495346
5728 5728 c, t dbSNP:144989730
5730 5730 c, g dbSNP:764700331
5731 5731 a, t dbSNP:199586130
5733 5733 a, t dbSNP:138839109
5734 5734 c, t dbSNP:765962444
5735 5735 c, t dbSNP:529806174
5737 5737 -, gc dbSNP:746218990
5737 5737 a, g dbSNP:150176093
5738 5738 a, c, g dbSNP:199566480
5740 5740 c, g dbSNP:138577233
5741 5741 -, gt dbSNP:770000725
5741 5741 a, t dbSNP:551747810
5742 5742 c, g dbSNP:544539696
5748 5748 a, g dbSNP:201687648
5749 5749 c, t dbSNP:200046156
5751 5751 a, t dbSNP:778888418
5752 5752 c, t dbSNP:745875181
5755 5755 -, atg dbSNP:775675885
5755 5755 a, c dbSNP:201203367
5757 5757 a, g, t dbSNP:534983270
5759 5759 -, a dbSNP:749577228
5759 5759 a, t dbSNP:568574603
5760 5760 c, g dbSNP:143372682
5761 5761 -, gc dbSNP:768689169
5761 5761 a, c dbSNP:557493775
5764 5764 c, t dbSNP:200243186
5765 5765 a, c dbSNP:780477426
5770 5770 c, t dbSNP:747229251
5772 5772 a, t dbSNP:371070576
5773 5773 c, g dbSNP:768375276
5778 5778 a, g dbSNP:368895292
5785 5785 c, t dbSNP:140328586
5789 5789 c, t dbSNP:575805315
5790 5790 a, g, t dbSNP:142444596
5794 5794 a, c, g dbSNP:112926140
5797 5797 a, c, g dbSNP:377164003
5805 5805 a, g dbSNP:759207579
5806 5806 c, t dbSNP:139340434
5807 5807 a, c, t dbSNP:557850355
5810 5810 a, g dbSNP:765713724
5819 5819 a, g dbSNP:368849364
5823 5823 a, g dbSNP:758618131
5828 5828 a, c, g, t dbSNP:780248745
5829 5829 a, c dbSNP:780855970
5830 5830 c, t dbSNP:201537848
5833 5833 c, g dbSNP:769462986
5834 5834 a, g dbSNP:777758568
5837 5837 -, a dbSNP:774465389
5844 5844 a, g dbSNP:150037907
5846 5846 a, g dbSNP:199605653
5851 5851 c, t dbSNP:770480258
5854 5854 a, g dbSNP:773804353
5854 5854 -, g dbSNP:760613317
5857 5857 c, g dbSNP:759140072
5858 5858 c, t dbSNP:761756369
5860 5860 c, g dbSNP:771685225
5864 5864 a, c dbSNP:776870092
5865 5865 a, g dbSNP:762292803
5868 5868 a, g dbSNP:765692620
5871 5871 a, g, t dbSNP:751007384
5872 5872 g, t dbSNP:766586572
5877 5877 a, g dbSNP:73712043
5881 5881 c, t dbSNP:201855491
5887 5887 c, g dbSNP:141297128
5888 5888 c, g, t dbSNP:200579827
5889 5889 c, t dbSNP:777525358
5894 5894 a, c dbSNP:78512922
5897 5897 a, t dbSNP:770817593
5898 5898 a, g dbSNP:778397032
5902 5902 a, c, t dbSNP:200153409
5905 5905 a, c, t dbSNP:188270675
5909 5909 c, g dbSNP:530507602
5912 5912 c, g dbSNP:773661642
5913 5913 a, g dbSNP:763583390
5915 5915 c, g dbSNP:552176410
5917 5917 c, t dbSNP:192554688
5919 5919 c, g, t dbSNP:200456398
5920 5920 a, c dbSNP:528052503
5925 5925 a, t dbSNP:756282785
5926 5926 a, c dbSNP:763909919
5929 5929 a, c dbSNP:546984174
5934 5934 c, t dbSNP:140541211
5948 5948 a, g dbSNP:530215197
5949 5949 a, c, t dbSNP:200417391
5950 5950 c, t dbSNP:745784199
5952 5952 c, t dbSNP:568723888
5956 5956 c, g dbSNP:779407976
5957 5957 a, c dbSNP:746696014
5961 5961 g, t dbSNP:374119260
5962 5962 c, t dbSNP:377685184
5963 5963 c, t dbSNP:148277526
5964 5964 g, t dbSNP:141237907
5966 5966 c, t dbSNP:774962737
5981 5981 a, c dbSNP:369387757
5983 5983 a, c dbSNP:767661213
5985 5985 c, t dbSNP:775395192
5993 5993 c, t dbSNP:372965833
5994 5994 a, g dbSNP:764241241
5995 5995 -, g dbSNP:766259676
6010 6010 c, t dbSNP:536102720
6012 6012 a, c dbSNP:757107720
6013 6013 c, t dbSNP:764906528
6016 6016 c, t dbSNP:113710942
6021 6021 a, g dbSNP:758218938
6023 6023 a, g dbSNP:779645381
6027 6027 a, c, g dbSNP:751045652
6029 6029 c, g dbSNP:781059967
6030 6030 a, t dbSNP:747772475
6031 6031 a, g dbSNP:771472869
6037 6037 c, g, t dbSNP:377202743
6038 6038 a, g dbSNP:772395343
6040 6040 c, t dbSNP:775650095
6042 6042 a, g dbSNP:760798861
6049 6049 c, g dbSNP:768713870
6059 6059 c, t dbSNP:776873955
6060 6060 a, g, t dbSNP:762000527
6063 6063 -, ctc dbSNP:776421414
6065 6065 c, g, t dbSNP:750143032
6073 6073 a, c, t dbSNP:764935591
6076 6076 c, t dbSNP:751540482
6078 6078 c, g dbSNP:143504281
6079 6079 c, t dbSNP:780828762
6087 6087 a, g dbSNP:752423673
6092 6092 a, c, g, t dbSNP:551185542
6093 6093 a, g dbSNP:746164295
6103 6103 c, t dbSNP:772466055
6106 6106 a, c dbSNP:780601805
6117 6117 a, g dbSNP:113228337
6118 6118 c, g dbSNP:768768969
6120 6120 a, t dbSNP:776642401
6123 6123 c, t dbSNP:762053741
6137 6137 c, t dbSNP:752472551
6138 6138 g, t dbSNP:769839706
6140 6140 a, c, g dbSNP:773071492
6154 6154 a, c, t dbSNP:184841146
6155 6155 a, g dbSNP:751596352
6156 6156 c, g dbSNP:759499195
6159 6159 a, t dbSNP:767170116
6160 6160 c, t dbSNP:187673029
6165 6165 a, c dbSNP:755808241
6166 6166 c, t dbSNP:763708617
6168 6168 c, t dbSNP:573166135
6169 6169 c, g dbSNP:370125112
6170 6170 c, t dbSNP:758725701
6175 6175 a, c dbSNP:780370790
6177 6177 c, t dbSNP:747536666
6178 6178 a, g dbSNP:373744994
6181 6181 c, t dbSNP:148586601
6183 6183 a, t dbSNP:748117801
6187 6187 c, t dbSNP:769914931
6192 6192 a, c, g dbSNP:200543426
6194 6194 a, c dbSNP:770654700
6195 6195 c, g dbSNP:142999731
6196 6196 a, g dbSNP:759554749
6203 6203 g, t dbSNP:767507110
6208 6208 a, g dbSNP:146120661
6209 6209 c, g dbSNP:376357171
6214 6214 c, t dbSNP:140147544
6215 6215 a, g dbSNP:534149898
6219 6219 g, t dbSNP:753478739
6226 6226 a, g dbSNP:756881574
6227 6227 c, t