
CRYGD cDNA ORF clone, Homo sapiens (human)

Gene Symbol CRYGD
Entrez Gene ID 1421
Full Name crystallin, gamma D
Synonyms CACA, CCA3, CCP, CRYG4, CTRCT4, PCC, cry-g-D
General protein information
Preferred Names
gamma-crystallin D
gamma-crystallin D
gamma crystallin 4
gamma-crystallin 4
Gene Type protein-coding
Organism Homo sapiens (human)



Summary Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. Four gamma-crystallin genes (gamma-A through gamma-D) and three pseudogenes (gamma-E, gamma-F, gamma-G) are tandemly organized in a genomic segment as a gene cluster. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Cataracts, punctate, progressive juvenile-onset (3); Cataract,

mRNA and Protein(s)

mRNA Protein Name
NM_006891 NP_008822 gamma-crystallin D

Homo sapiens (human) CRYGD NP_008822.2
Pan troglodytes (chimpanzee) CRYGD NP_001129137.1
Macaca mulatta (Rhesus monkey) CRYGD XP_001100337.2
Canis lupus familiaris (dog) CRYGD NP_001106640.1
Mus musculus (house mouse) Crygd NP_031802.2
Rattus norvegicus (Norway rat) Crygd NP_149086.1
Danio rerio (zebrafish) crygmxl1 NP_001019594.1


ID Name Evidence
GO:0005625 soluble fraction IDA


ID Name Evidence
GO:0005212 structural constituent of eye lens NAS
GO:0005515 protein binding IPI


ID Name Evidence
GO:0007601 visual perception IMP
GO:0034614 cellular response to reactive oxygen species IDA
GO:0050896 response to stimulus IEA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following CRYGD gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the CRYGD cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu19598 NM_006891 Homo sapiens crystallin, gamma D (CRYGD), mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $99.00

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee that the protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu19598
Accession Version NM_006891.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 525bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product gamma-crystallin D
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC117338.1, U66583.1, EL946552.1 and CD674533.1. This sequence is a reference standard in the RefSeqGene project. On Apr 2, 2008 this sequence version replaced gi:13377001. Summary: Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. Four gamma-crystallin genes (gamma-A through gamma-D) and three pseudogenes (gamma-E, gamma-F, gamma-G) are tandemly organized in a genomic segment as a gene cluster. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC117338.1, CD676210.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968968, SAMEA2145245 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)123..362(+)
Misc Feature(2)252..254(+)
Misc Feature(3)366..377(+)
Misc Feature(4)381..626(+)
Misc Feature(5)447..449(+)
Exon (1)1..125
Gene Synonym:
Exon (2)126..368
Gene Synonym:
Exon (3)369..707
Gene Synonym:
Position Chain Variation Link
40 40 c, t dbSNP:575552206
59 59 c, t dbSNP:376246921
65 65 a, c dbSNP:559227852
66 66 -, gctcagcgccgccgccccacca dbSNP:367690346
76 76 a, g dbSNP:367703868
77 77 c, t dbSNP:113618781
78 78 a, c, t dbSNP:765407471
79 79 a, g dbSNP:567096422
86 86 c, t dbSNP:761569552
87 87 a, c dbSNP:181890669
92 92 a, g dbSNP:770050045
95 95 a, c dbSNP:759592372
98 98 a, g dbSNP:776784717
100 100 a, c dbSNP:770848542
101 101 a, g dbSNP:747575175
105 105 a, g dbSNP:778404764
106 106 c, t dbSNP:772605779
116 116 a, c dbSNP:552792722
118 118 c, t dbSNP:778768887
120 120 a, c, g dbSNP:748827251
121 121 a, g dbSNP:779649425
125 125 a, g dbSNP:755527186
127 127 g, t dbSNP:760896107
131 131 a, c dbSNP:773443012
134 134 c, g dbSNP:767642307
135 135 c, t dbSNP:762443764
137 137 c, t dbSNP:774675046
138 138 c, g dbSNP:769110735
140 140 a, g dbSNP:763193895
143 143 c, t dbSNP:775275866
146 146 c, g dbSNP:769419095
152 152 c, t dbSNP:745465545
157 157 c, g dbSNP:780685336
159 159 c, t dbSNP:121909595
160 160 a, g dbSNP:770386297
161 161 c, g dbSNP:746970104
167 167 c, t dbSNP:2242074
179 179 c, t dbSNP:150961505
180 180 c, g dbSNP:752421967
184 184 -, ac dbSNP:749386412
185 185 c, t dbSNP:778715073
186 186 a, c, t dbSNP:28931605
197 197 a, g dbSNP:372704290
215 215 c, t dbSNP:750636400
218 218 c, t dbSNP:767730220
223 223 c, t dbSNP:200234608
224 224 a, g dbSNP:200388674
225 225 a, c dbSNP:121909597
231 231 c, g dbSNP:764500407
236 236 a, c, g dbSNP:374192743
238 238 g, t dbSNP:770077407
243 243 g, t dbSNP:759214975
246 246 a, g, t dbSNP:140206746
248 248 a, g dbSNP:770469881
250 250 c, t dbSNP:786205546
253 253 a, g dbSNP:560915157
266 266 a, c dbSNP:146108791
268 268 -, a dbSNP:777999292
269 269 c, t dbSNP:771917862
271 271 c, g dbSNP:762200707
272 272 a, g dbSNP:778885136
280 280 a, g dbSNP:754775969
283 283 -, gta dbSNP:755012034
284 284 c, g dbSNP:202233735
289 289 g, t dbSNP:781530041
291 291 c, t dbSNP:757475538
292 292 a, g dbSNP:121909596
296 296 c, t dbSNP:751575392
297 297 a, g, t dbSNP:150857132
300 300 a, g dbSNP:753205493
304 304 a, g dbSNP:370450479
305 305 c, t dbSNP:200911604
308 308 a, c, g dbSNP:766003243
315 315 c, t dbSNP:760319008
325 325 c, t dbSNP:545732643
335 335 c, g dbSNP:771572996
336 336 g, t dbSNP:535665103
345 345 c, t dbSNP:375824046
354 354 c, t dbSNP:768608809
356 356 c, t dbSNP:201111017
357 357 c, g dbSNP:781619748
361 361 -, t dbSNP:751507712
366 366 c, g, t dbSNP:372878552
367 367 a, g dbSNP:777744566
368 368 a, c dbSNP:775032143
380 380 c, g dbSNP:75156162
383 383 a, g dbSNP:766679384
394 394 a, g dbSNP:138939316
398 398 a, g dbSNP:750087518
400 400 a, c, g dbSNP:761284053
401 401 a, c, g dbSNP:2305430
404 404 a, g dbSNP:763013671
414 414 c, g dbSNP:775518016
426 426 c, g dbSNP:769526065
427 427 a, g dbSNP:759342711
441 441 g, t dbSNP:773365689
450 450 c, g, t dbSNP:748305209
457 457 a, t dbSNP:778996249
459 459 c, g, t dbSNP:374584101
460 460 a, g dbSNP:774950923
465 465 c, t dbSNP:762126299
466 466 a, g, t dbSNP:781349703
472 472 a, g dbSNP:370051610
473 473 c, t dbSNP:751213595
477 477 a, g dbSNP:763718179
482 482 c, t dbSNP:762527661
483 483 c, t dbSNP:752616355
491 491 a, c dbSNP:529629277
492 492 a, g dbSNP:150318966
494 494 a, g dbSNP:550398544
506 506 c, t dbSNP:140234939
517 517 a, g dbSNP:770593386
518 518 a, c, t dbSNP:398122948
519 519 a, g dbSNP:543971587
524 524 a, g dbSNP:768766756
526 526 c, g dbSNP:143171931
535 535 a, g dbSNP:144372987
540 540 c, t dbSNP:758933523
541 541 a, g dbSNP:770342455
551 551 a, g dbSNP:746290710
561 561 a, g dbSNP:781641424
567 567 c, t dbSNP:757645815
569 569 c, t dbSNP:536740106
573 573 c, t dbSNP:751303527
584 584 a, c, t dbSNP:758048621
586 586 a, g dbSNP:121909598
589 589 c, g dbSNP:148554364
591 591 -, a, g dbSNP:764945940
594 594 a, g dbSNP:533392588
595 595 c, t dbSNP:564197072
596 596 a, c, g dbSNP:766214162
598 598 a, g dbSNP:760434926
615 615 c, t dbSNP:774626835
616 616 c, t dbSNP:764290708
622 622 g, t dbSNP:763098978
623 623 -, a dbSNP:761450406
650 650 c, g dbSNP:775639939
653 653 c, t dbSNP:2305429
654 654 c, t dbSNP:137852882
664 664 -, cttaattt dbSNP:763573226
665 665 c, t dbSNP:746406135
671 671 -, t dbSNP:776176631
672 672 a, g dbSNP:370488500
674 674 a, c dbSNP:377239415
676 676 a, g dbSNP:571962276
677 677 a, c dbSNP:373093118
680 680 a, t dbSNP:541689515
705 705 g, t dbSNP:183496209

Target ORF information:

RefSeq Version NM_006891
Organism Homo sapiens (human)
Definition Homo sapiens crystallin, gamma D (CRYGD), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


Potential of human gammaD-crystallin for hair damage repair: insights into the mechanical properties and biocompatibility
Int J Cosmet Sci 35 (5), 458-466 (2013)
Ribeiro A, Matama T, Cruz CF, Gomes AC and Cavaco-Paulo AM.


Amyloid fiber formation in human gammaD-Crystallin induced by UV-B photodamage
Biochemistry 52 (36), 6169-6181 (2013)
Moran SD, Zhang TO, Decatur SM and Zanni MT.


Crystal structure of the cataract-causing P23T gammaD-crystallin mutant
Proteins 81 (9), 1493-1498 (2013)
Ji F, Koharudin LM, Jung J and Gronenborn AM.


The human W42R gammaD-crystallin mutant structure provides a link between congenital and age-related cataracts
J. Biol. Chem. 288 (1), 99-109 (2013)
Ji F, Jung J, Koharudin LM and Gronenborn AM.


Combinational analysis of linkage and exome sequencing identifies the causative mutation in a Chinese family with congenital cataract
BMC Med. Genet. 14, 107 (2013)
Jia X, Zhang F, Bai J, Gao L, Zhang X, Sun H, Sun D, Guan R, Sun W, Xu L, Yue Z, Yu Y and Fu S.


Human gamma-crystallin genes. A gene family on its way to extinction
J. Mol. Biol. 216 (3), 519-532 (1990)
Brakenhoff RH, Aarts HJ, Reek FH, Lubsen NH and Schoenmakers JG.


Gamma-crystallins of the human eye lens: expression analysis of five members of the gene family
Mol. Cell. Biol. 7 (8), 2671-2679 (1987)
Meakin SO, Du RP, Tsui LC and Breitman ML.


A locus for a human hereditary cataract is closely linked to the gamma-crystallin gene family
Proc. Natl. Acad. Sci. U.S.A. 84 (2), 489-492 (1987)
Lubsen,N.H., Renwick,J.H., Tsui,L.C., Breitman,M.L. and Schoenmakers,J.G.


Assignment of the human gamma-crystallin gene cluster (CRYG) to the long arm of chromosome 2, region q33-36
Hum. Genet. 73 (1), 17-19 (1986)
Shiloh,Y., Donlon,T., Bruns,G., Breitman,M.L. and Tsui,L.C.


Structural and evolutionary relationships among five members of the human gamma-crystallin gene family
Mol. Cell. Biol. 5 (6), 1408-1414 (1985)
Meakin,S.O., Breitman,M.L. and Tsui,L.C.
