Email to GenScript

MESP2 mesoderm posterior bHLH transcription factor 2 [Homo sapiens (human)]

Gene Symbol MESP2
Entrez Gene ID 145873
Full Name mesoderm posterior bHLH transcription factor 2
Synonyms SCDO2, bHLHc6
General protein information
Preferred Names
mesoderm posterior protein 2
mesoderm posterior protein 2
class C basic helix-loop-helix protein 6
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of the bHLH family of transcription factors and plays a key role in defining the rostrocaudal patterning of somites via interactions with multiple Notch signaling pathways. This gene is expressed in the anterior presomitic mesoderm and is downregulated immediately after the formation of segmented somites. This gene also plays a role in the formation of epithelial somitic mesoderm and cardiac mesoderm. Mutations in the MESP2 gene cause autosomal recessive spondylocostal dystosis 2 (SCD02). [provided by RefSeq, Oct 2008]. lac of sum
Disorder MIM:


Disorder Html: Spondylocostal dysostosis, autosomal recessive 2, 608681 (3)

The following MESP2 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the MESP2 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu28715 NM_001039958 Homo sapiens mesoderm posterior bHLH transcription factor 2 (MESP2), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu28715
Accession Version NM_001039958.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1194bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 18-JUN-2015
Organism Homo sapiens (human)
Product mesoderm posterior protein 2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BK000142.1 and AC079075.6. This sequence is a reference standard in the RefSeqGene project. On or before Mar 25, 2006 this sequence version replaced gi:89038660, gi:89039287. Summary: This gene encodes a member of the bHLH family of transcription factors and plays a key role in defining the rostrocaudal patterning of somites via interactions with multiple Notch signaling pathways. This gene is expressed in the anterior presomitic mesoderm and is downregulated immediately after the formation of segmented somites. This gene also plays a role in the formation of epithelial somitic mesoderm and cardiac mesoderm. Mutations in the MESP2 gene cause autosomal recessive spondylocostal dystosis 2 (SCD02). [provided by RefSeq, Oct 2008]. ##Evidence-Data-START## Transcript exon combination :: BC111413.1, BQ431918.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968540, SAMEA1968832 [ECO:0000348] ##Evidence-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)244..417(+)
Misc Feature(2)244..363(+)
Misc Feature(3)268..270(+)
Misc Feature(4)286..417(+)
Misc Feature(5)535..612(+)
Exon (1)1..924
Gene Synonym:
Exon (2)925..1614
Gene Synonym:
Position Chain Variation Link
18 18 a, t dbSNP:529998749
33 33 a, c dbSNP:747884191
55 55 a, g dbSNP:771825947
56 56 a, c dbSNP:772709646
67 67 a, g dbSNP:548112443
111 111 c, t dbSNP:765830931
134 134 a, g dbSNP:777157750
161 161 a, c dbSNP:759975280
167 167 c, t dbSNP:765646461
183 183 c, t dbSNP:753168674
185 185 a, g dbSNP:566641514
186 186 a, g dbSNP:764426166
189 189 c, g dbSNP:534821207
190 190 a, g dbSNP:757442932
195 195 a, g dbSNP:781352222
197 197 c, g dbSNP:71647809
207 207 g, t dbSNP:571669966
214 214 a, g dbSNP:755002515
215 215 a, g dbSNP:778712445
217 217 c, t dbSNP:748016431
218 218 a, g, t dbSNP:771745973
222 222 a, c, g dbSNP:746627326
223 223 c, g dbSNP:776174632
229 229 a, g, t dbSNP:538996447
235 235 a, g dbSNP:770370618
237 237 c, g, t dbSNP:775834437
241 241 g, t dbSNP:118204034
242 242 g, t dbSNP:751835161
249 249 c, g dbSNP:756764999
250 250 a, c dbSNP:762067626
262 262 a, g dbSNP:767840955
267 267 a, g dbSNP:750599687
271 271 a, g dbSNP:113994156
288 288 a, g dbSNP:756116758
291 291 c, g dbSNP:778958397
296 296 g, t dbSNP:752532179
301 301 c, t dbSNP:557385775
303 303 a, g dbSNP:374649800
306 306 a, c, g dbSNP:77473319
307 307 a, c, g, t dbSNP:71647808
312 312 g, t dbSNP:769136018
314 314 g, t dbSNP:776095707
316 316 a, c, g dbSNP:144331163
317 317 a, g dbSNP:774916475
318 318 c, t dbSNP:369681915
327 327 g, t dbSNP:767892102
329 329 c, t dbSNP:750589926
330 330 c, t dbSNP:760835012
341 341 c, g dbSNP:766333578
342 342 g, t dbSNP:536931928
345 345 a, c, g dbSNP:758214625
348 348 c, t dbSNP:751393756
350 350 a, g dbSNP:757019924
354 354 c, g dbSNP:780840936
355 355 c, t dbSNP:373605220
357 357 c, g dbSNP:575410954
361 361 a, t dbSNP:779371166
364 364 a, t dbSNP:546050210
373 373 c, g dbSNP:71647806
378 378 c, t dbSNP:748816022
383 383 c, t dbSNP:769354990
384 384 c, t dbSNP:377205705
385 385 a, g, t dbSNP:113994157
397 397 c, g dbSNP:772517845
407 407 c, t dbSNP:370081453
408 408 g, t dbSNP:760746152
412 412 a, g, t dbSNP:28462216
419 419 a, g dbSNP:759578462
420 420 c, t dbSNP:764063199
428 428 a, g dbSNP:751445212
431 431 a, g dbSNP:757074956
433 433 a, g dbSNP:767232828
455 455 a, t dbSNP:750101604
458 458 c, g dbSNP:755778473
482 482 a, g dbSNP:779753904
487 487 a, c dbSNP:539962944
498 498 a, c, g dbSNP:200336355
503 503 -, accg dbSNP:113994158
509 509 a, c dbSNP:748629363
510 510 c, g, t dbSNP:772573382
517 517 a, g, t dbSNP:374604155
531 531 -, gg dbSNP:748396440
531 531 a, g dbSNP:75049807
533 533 -, aggggcaggggcaagggcaggggc dbSNP:200021459
535 535 (gggcaggggcaa(2_4)) dbSNP:397507446
537 537 g, t dbSNP:759631499
539 539 -, a dbSNP:771308949
541 541 g, t dbSNP:765258147
542 542 g, t dbSNP:774275939
547 547 -, gggcaggggcag dbSNP:199821487
549 549 a, g dbSNP:760653588
553 553 -, gggc dbSNP:774929541
554 554 c, g dbSNP:764078106
556 556 c, g dbSNP:776642665
558 558 -, ggggcaggggca dbSNP:56192595
558 558 -, ggggc dbSNP:760347135
558 558 a, g dbSNP:28546919
561 561 a, g dbSNP:767474985
573 573 a, g dbSNP:113097169
576 576 g, t dbSNP:750251201
577 577 g, t dbSNP:760488789
585 585 a, g dbSNP:113636330
590 590 a, g dbSNP:562481393
591 591 a, g dbSNP:754567634
597 597 a, g dbSNP:778503063
602 602 a, g dbSNP:377023417
603 603 g, t dbSNP:759034438
609 609 g, t dbSNP:548428487
613 613 c, g dbSNP:369591173
620 620 a, g dbSNP:778342808
623 623 c, t dbSNP:747379816
636 636 c, t dbSNP:771276158
637 637 a, g dbSNP:781296717
642 642 c, t dbSNP:746021903
645 645 c, t dbSNP:769875289
649 649 a, g dbSNP:775602487
662 662 a, g dbSNP:763014555
665 665 c, g dbSNP:771944393
668 668 c, t dbSNP:773180085
669 669 a, g dbSNP:760409825
670 670 c, t dbSNP:118204033
671 671 c, t dbSNP:71647807
672 672 a, c dbSNP:753549204
678 678 -, c dbSNP:752785175
681 681 c, t dbSNP:759211132
682 682 a, g dbSNP:764972465
685 685 g, t dbSNP:752325364
687 687 a, c dbSNP:757900381
699 699 c, g dbSNP:778162692
700 700 g, t dbSNP:118204035
702 702 c, g dbSNP:752060859
703 703 c, t dbSNP:757562856
713 713 a, g dbSNP:781561296
713 713 -, g dbSNP:756232049
717 717 c, g dbSNP:181559095
725 725 a, g dbSNP:770067168
730 730 g, t dbSNP:780217673
742 742 a, g dbSNP:749420045
745 745 -, c dbSNP:778194136
753 753 c, g dbSNP:768734682
755 755 g, t dbSNP:773054694
758 758 c, g, t dbSNP:201925785
763 763 a, g dbSNP:200065014
767 767 a, c dbSNP:373252966
769 769 c, t dbSNP:776627766
770 770 c, t dbSNP:571812381
772 772 c, t dbSNP:765025021
775 775 c, t dbSNP:375837764
777 777 a, c, g dbSNP:762396354
779 779 a, g dbSNP:752019422
782 782 c, t dbSNP:757839053
787 787 c, g dbSNP:199662104
792 792 c, g dbSNP:750826952
793 793 a, g dbSNP:201002566
797 797 c, t dbSNP:780278422
801 801 c, t dbSNP:749488032
807 807 a, g dbSNP:755019731
823 823 a, c, t dbSNP:778996877
839 839 c, g dbSNP:770971961
842 842 c, t dbSNP:776682288
843 843 a, g dbSNP:745676885
848 848 a, c, t dbSNP:372667571
850 850 c, t dbSNP:761895045
859 859 c, t dbSNP:201904631
860 860 c, t dbSNP:763639003
862 862 c, t dbSNP:369474584
885 885 c, g dbSNP:761196555
888 888 a, g dbSNP:374172103
907 907 c, g dbSNP:200440405
908 908 c, t dbSNP:185706635
921 921 c, g dbSNP:766664800
925 925 a, g dbSNP:777939697
932 932 c, g dbSNP:751673727
940 940 c, t dbSNP:756185244
941 941 c, t dbSNP:779823676
948 948 -, ct dbSNP:757634059
957 957 a, g dbSNP:752665246
966 966 c, t dbSNP:768285654
967 967 c, g dbSNP:778659855
973 973 a, c dbSNP:747732638
975 975 a, c dbSNP:771586079
976 976 c, t dbSNP:372981270
980 980 c, t dbSNP:760177391
985 985 c, t dbSNP:771471316
987 987 a, g dbSNP:776986584
1002 1002 -, aagata dbSNP:779274067
1002 1002 a, g dbSNP:376942190
1004 1004 a, c dbSNP:765449941
1005 1005 a, g dbSNP:752972579
1010 1010 a, c dbSNP:763321859
1011 1011 c, g dbSNP:764403618
1013 1013 -, c dbSNP:772586292
1017 1017 c, g, t dbSNP:370227491
1018 1018 a, g dbSNP:780062393
1027 1027 c, t dbSNP:374475842
1036 1036 a, g dbSNP:754807279
1044 1044 c, g dbSNP:199514997
1047 1047 a, g dbSNP:747926651
1050 1050 a, g dbSNP:758115773
1052 1052 a, c dbSNP:71647810
1056 1056 c, g dbSNP:201495246
1059 1059 -, ag dbSNP:775941947
1059 1059 a, c dbSNP:746574351
1063 1063 a, g dbSNP:770301033
1070 1070 c, g dbSNP:777196250
1072 1072 c, t dbSNP:546107097
1073 1073 c, g, t dbSNP:564292487
1074 1074 a, g dbSNP:763376959
1077 1077 c, t dbSNP:376465704
1078 1078 a, g dbSNP:774665542
1080 1080 c, t dbSNP:762014488
1081 1081 a, g dbSNP:767430602
1089 1089 a, g dbSNP:753827969
1104 1104 a, c dbSNP:754930000
1122 1122 a, c dbSNP:765218369
1126 1126 c, t dbSNP:752531314
1127 1127 a, g dbSNP:758170634
1140 1140 c, g dbSNP:777428484
1153 1153 a, c dbSNP:200678001
1154 1154 -, aag dbSNP:543667424
1158 1158 a, g dbSNP:746629107
1163 1163 g, t dbSNP:756801528
1166 1166 a, g dbSNP:780621098
1169 1169 a, g dbSNP:745376223
1171 1171 -, c dbSNP:768139078
1171 1171 a, g dbSNP:770241465
1174 1174 c, t dbSNP:776116878
1175 1175 a, g, t dbSNP:749691994
1178 1178 g, t dbSNP:774720315
1190 1190 a, g dbSNP:761885039
1191 1191 c, t dbSNP:375171689
1194 1194 a, g dbSNP:544384142
1199 1199 c, g dbSNP:372062720
1202 1202 c, t dbSNP:765211311
1203 1203 a, g dbSNP:187680280
1212 1212 c, t dbSNP:758225691
1219 1219 c, t dbSNP:530131979
1223 1223 g, t dbSNP:529473935
1232 1232 a, c dbSNP:751338786
1236 1236 c, t dbSNP:547275737
1240 1240 c, t dbSNP:780864633
1243 1243 g, t dbSNP:749949151
1244 1244 a, g dbSNP:755600035
1267 1267 c, t dbSNP:527993697
1277 1277 c, t dbSNP:190964237
1284 1284 a, c dbSNP:776583904
1292 1292 a, g dbSNP:182411386
1295 1295 a, c, g dbSNP:761831896
1301 1301 c, t dbSNP:187988937
1317 1317 a, c dbSNP:556469683
1324 1324 -, gaa dbSNP:3840032
1331 1331 c, g dbSNP:568196227
1363 1363 a, g dbSNP:773406154
1366 1366 a, g dbSNP:192366638
1376 1376 c, t dbSNP:553766281
1398 1398 c, t dbSNP:572039063
1420 1420 c, t dbSNP:377018192
1421 1421 a, g dbSNP:558037625
1422 1422 c, t dbSNP:576315212
1423 1423 c, t dbSNP:543644563
1483 1483 -, ggcagg dbSNP:200155251
1503 1503 c, t dbSNP:561709608
1520 1520 c, t dbSNP:76163582
1557 1557 c, t dbSNP:538628586

Target ORF information:

RefSeq Version NM_001039958
Organism Homo sapiens (human)
Definition Homo sapiens mesoderm posterior bHLH transcription factor 2 (MESP2), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.