Home » Species Summary » Homo sapiens » ZNF714 cDNA ORF clone
Email to GenScript

ZNF714 cDNA ORF clone, Homo sapiens (human)

Gene Symbol ZNF714
Entrez Gene ID 148206
Full Name zinc finger protein 714
General protein information
Preferred Names
zinc finger protein 714
zinc finger protein 714
Gene Type protein-coding
Organism Homo sapiens (human)



Summary lac of sum
Disorder MIM:

Disorder Html:

mRNA and Protein(s)

mRNA Protein Name
NM_182515 NP_872321 zinc finger protein 714

R-HSA-74160 Gene Expression
R-HSA-212436 Generic Transcription Pathway

Homo sapiens (human) ZNF714 NP_872321.2
Pan troglodytes (chimpanzee) ZNF714 XP_003953472.1


ID Name Evidence
GO:0005622 intracellular IEA
GO:0005634 nucleus IEA


ID Name Evidence
GO:0003677 DNA binding IEA
GO:0008270 zinc ion binding IEA
GO:0046872 metal ion binding IEA


ID Name Evidence
GO:0006355 regulation of transcription, DNA-dependent IEA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following ZNF714 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the ZNF714 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu17034 NM_182515 Homo sapiens zinc finger protein 714 (ZNF714), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $459.00

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu17034
Accession Version NM_182515.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1668bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product zinc finger protein 714
Comment VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from DB028091.1, BC050468.2, AC010620.4 and BC022527.1. On Aug 6, 2010 this sequence version replaced gi:144953912. Transcript Variant: This variant (1) represents the longest transcript and encodes the supported protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##Evidence-Data-START## Transcript exon combination :: DA026469.1, AK056006.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)382..486(+)
Misc Feature(2)748..876(+)
Misc Feature(3)748..795(+)
Misc Feature(4)781..795(+)
Misc Feature(5)817..879(+)
Misc Feature(6)817..879(+)
Misc Feature(7)817..879(+)
Misc Feature(8)817..879(+)
Misc Feature(9)832..960(+)
Misc Feature(10)889..1890(+)
Misc Feature(11)901..963(+)
Misc Feature(12)901..963(+)
Misc Feature(13)901..963(+)
Misc Feature(14)901..963(+)
Misc Feature(15)916..1128(+)
Misc Feature(16)940..1014(+)
Misc Feature(17)985..1047(+)
Misc Feature(18)985..1044(+)
Misc Feature(19)1024..1092(+)
Misc Feature(20)1069..1131(+)
Misc Feature(21)1069..1131(+)
Misc Feature(22)1069..1131(+)
Misc Feature(23)1069..1131(+)
Misc Feature(24)1084..1212(+)
Misc Feature(25)1105..1182(+)
Misc Feature(26)1153..1215(+)
Misc Feature(27)1153..1215(+)
Misc Feature(28)1237..1299(+)
Misc Feature(29)1237..1299(+)
Misc Feature(30)1252..1464(+)
Misc Feature(31)1321..1383(+)
Misc Feature(32)1321..1380(+)
Misc Feature(33)1360..1431(+)
Misc Feature(34)1405..1467(+)
Misc Feature(35)1405..1467(+)
Misc Feature(36)1405..1467(+)
Misc Feature(37)1405..1467(+)
Misc Feature(38)1420..1632(+)
Misc Feature(39)1441..1518(+)
Misc Feature(40)1489..1551(+)
Misc Feature(41)1489..1548(+)
Misc Feature(42)1528..1602(+)
Misc Feature(43)1573..1635(+)
Misc Feature(44)1573..1635(+)
Misc Feature(45)1573..1635(+)
Misc Feature(46)1573..1635(+)
Misc Feature(47)1588..1800(+)
Misc Feature(48)1609..1686(+)
Misc Feature(49)1657..1719(+)
Misc Feature(50)1657..1716(+)
Misc Feature(51)1693..1770(+)
Misc Feature(52)1741..1803(+)
Misc Feature(53)1741..1803(+)
Misc Feature(54)1741..1803(+)
Misc Feature(55)1741..1803(+)
Misc Feature(56)1756..1884(+)
Misc Feature(57)1777..1854(+)
Misc Feature(58)1825..1884(+)
Misc Feature(59)1825..1875(+)
Exon (1)1..202
Gene Synonym:
Exon (2)203..294
Gene Synonym:
Exon (3)295..421
Gene Synonym:
Exon (4)422..520
Gene Synonym:
Exon (5)521..8808
Gene Synonym:
Position Chain Variation Link
2 2 a, g dbSNP:531549318
16 16 g, t dbSNP:201585327
21 21 c, t dbSNP:565070935
22 22 g, t dbSNP:527432441
23 23 a, g dbSNP:547462819
30 30 c, t dbSNP:566972547
57 57 c, g dbSNP:113495616
79 79 a, g dbSNP:367638179
87 87 c, t dbSNP:549275557
88 88 g, t dbSNP:569175599
105 105 c, t dbSNP:538456121
157 157 a, g dbSNP:763454084
158 158 a, c, g dbSNP:61733856
162 162 c, t dbSNP:571801383
163 163 c, t dbSNP:767140705
173 173 a, g dbSNP:750122809
175 175 a, c dbSNP:755869791
176 176 a, g, t dbSNP:112345825
183 183 a, g dbSNP:754961423
184 184 c, t dbSNP:554192498
185 185 c, t dbSNP:747081936
192 192 a, g dbSNP:771194864
201 201 c, t dbSNP:200891725
205 205 c, t dbSNP:190091971
206 206 a, g dbSNP:193172197
214 214 a, g dbSNP:769666830
223 223 a, g dbSNP:554380041
230 230 c, t dbSNP:574288003
249 249 c, t dbSNP:565030938
299 299 a, c, t dbSNP:774806631
300 300 a, g dbSNP:764731320
301 301 c, t dbSNP:772725533
305 305 c, t dbSNP:760182938
312 312 c, g dbSNP:369719006
315 315 g, t dbSNP:753492956
321 321 c, t dbSNP:759354644
326 326 a, c dbSNP:147821041
331 331 c, t dbSNP:752644137
332 332 c, g dbSNP:758421208
352 352 c, t dbSNP:781352383
359 359 c, t dbSNP:750526150
369 369 a, g dbSNP:561342899
380 380 c, t dbSNP:530009467
392 392 c, t dbSNP:374922556
393 393 -, ag dbSNP:778979517
400 400 g, t dbSNP:769022688
401 401 a, g dbSNP:779270236
409 409 c, t dbSNP:772448655
412 412 c, g dbSNP:748599601
415 415 g, t dbSNP:772576238
417 417 c, g dbSNP:377697860
423 423 a, t dbSNP:565526348
428 428 c, t dbSNP:766269983
433 433 a, g dbSNP:754039566
445 445 c, g dbSNP:755171227
449 449 c, t dbSNP:374215744
450 450 a, g dbSNP:368674204
456 456 a, c dbSNP:758824424
474 474 -, ag dbSNP:756081992
478 478 c, g dbSNP:778231490
486 486 c, t dbSNP:371673567
496 496 c, t dbSNP:770436322
497 497 a, g dbSNP:776028796
499 499 -, ga dbSNP:766051198
510 510 a, t dbSNP:745456889
515 515 a, c dbSNP:769564152
516 516 c, t dbSNP:572667528
523 523 a, g dbSNP:201067883
528 528 -, ttc dbSNP:774137524
528 528 c, t dbSNP:779822604
532 532 c, t dbSNP:371085101
533 533 a, c, g dbSNP:756898064
540 540 c, t dbSNP:768521057
555 555 a, g dbSNP:774028169
575 575 c, g dbSNP:761745687
581 581 -, ctttc dbSNP:761574928
584 584 -, aagtgat dbSNP:767069771
586 586 g, t dbSNP:199675041
590 590 c, t dbSNP:371213927
591 591 -, tggcaaatgt dbSNP:772879968
595 595 a, c dbSNP:544880975
610 610 c, t dbSNP:374811110
629 629 a, g dbSNP:752880693
642 642 a, c dbSNP:148214959
645 645 c, t dbSNP:369783391
646 646 a, g dbSNP:372934750
659 659 a, c dbSNP:375524414
662 662 a, g dbSNP:781525435
664 664 a, g dbSNP:370765701
666 666 a, g dbSNP:755645761
669 669 a, g dbSNP:779732761
670 670 c, t dbSNP:748890835
673 673 a, c dbSNP:768195764
676 676 a, c, g dbSNP:778696434
679 679 a, g dbSNP:771952749
679 679 -, g dbSNP:760481721
680 680 a, g dbSNP:772993080
681 681 -, ta dbSNP:202144538
682 682 -, aat, ata dbSNP:36125838
686 686 -, aat, ata, tag dbSNP:67249728
687 687 -, aat dbSNP:57999210
688 688 a, g dbSNP:111443257
690 690 a, g dbSNP:760641443
691 691 c, t dbSNP:769819966
706 706 a, g dbSNP:775563680
710 710 c, t dbSNP:763096897
713 713 a, c dbSNP:764206279
719 719 a, g dbSNP:751852936
730 730 a, c dbSNP:762048743
738 738 c, t dbSNP:767955910
742 742 c, t dbSNP:750910491
755 755 c, t dbSNP:756701922
758 758 a, g dbSNP:779638220
765 765 g, t dbSNP:115651075
772 772 g, t dbSNP:754576308
776 776 a, g dbSNP:778409710
797 797 c, t dbSNP:533104763
801 801 a, t dbSNP:758092280
805 805 a, c dbSNP:777570478
810 810 -, t dbSNP:754795311
814 814 a, g dbSNP:746894861
827 827 a, g dbSNP:770862430
830 830 -, at dbSNP:765074382
832 832 -, ca dbSNP:752858273
848 848 a, t dbSNP:776605612
855 855 a, c dbSNP:749344302
856 856 -, ta dbSNP:758620029
859 859 a, c, t dbSNP:768818257
860 860 a, g dbSNP:762117275
865 865 c, t dbSNP:767716536
866 866 a, t dbSNP:773714946
869 869 a, g dbSNP:761186693
872 872 g, t dbSNP:766981915
879 879 c, t dbSNP:754447105
886 886 g, t dbSNP:187722159
893 893 -, c dbSNP:777786827
904 904 a, g dbSNP:764835482
909 909 a, g dbSNP:752246424
910 910 c, g, t dbSNP:758086461
921 921 a, g dbSNP:746805082
928 928 c, t dbSNP:757089710
929 929 a, g dbSNP:61740552
942 942 c, t dbSNP:757993404
944 944 c, t dbSNP:745845699
948 948 a, t dbSNP:768569604
949 949 c, g dbSNP:373144420
952 952 a, g dbSNP:562897692
958 958 a, g dbSNP:748250691
961 961 c, g dbSNP:377506115
965 965 c, t dbSNP:202078277
970 970 a, g dbSNP:761100637
976 976 c, t dbSNP:766891771
977 977 c, g dbSNP:777238562
982 982 a, g dbSNP:375364097
983 983 a, g dbSNP:760114760
984 984 a, g dbSNP:764598434
989 989 a, g, t dbSNP:752259096
991 991 a, g dbSNP:551636385
998 998 a, g dbSNP:751250571
1003 1003 c, g dbSNP:571181803
1012 1012 c, t dbSNP:373168377
1013 1013 a, c, g dbSNP:750269746
1014 1014 c, g, t dbSNP:183881218
1018 1018 c, t dbSNP:772329515
1026 1026 -, a dbSNP:757327057
1031 1031 c, t dbSNP:527500598
1034 1034 a, g dbSNP:747266225
1035 1035 c, t dbSNP:141224149
1036 1036 a, c dbSNP:147350633
1041 1041 a, c, g dbSNP:374049841
1051 1051 a, g dbSNP:775922233
1053 1053 a, c dbSNP:112722125
1054 1054 a, g dbSNP:199888679
1061 1061 c, g, t dbSNP:751159017
1067 1067 a, g, t dbSNP:145031642
1068 1068 a, g dbSNP:750226318
1074 1074 -, ag dbSNP:781721659
1078 1078 -, t dbSNP:746423571
1093 1093 c, t dbSNP:755919653
1095 1095 c, t dbSNP:780019809
1100 1100 a, c dbSNP:753762128
1104 1104 a, t dbSNP:758513116
1105 1105 c, t dbSNP:754679614
1107 1107 a, c dbSNP:188561214
1118 1118 -, at dbSNP:770230099
1120 1120 a, c, t dbSNP:771287124
1123 1123 a, g dbSNP:374321823
1131 1131 a, t dbSNP:770092420
1133 1133 c, t dbSNP:201178018
1143 1143 a, g dbSNP:763468916
1148 1148 g, t dbSNP:569619035
1150 1150 a, g dbSNP:781018161
1152 1152 a, c dbSNP:761379322
1163 1163 a, g dbSNP:538186642
1167 1167 c, t dbSNP:750090013
1171 1171 a, g dbSNP:370476056
1179 1179 c, g, t dbSNP:766120724
1183 1183 c, t dbSNP:754979685
1185 1185 c, t dbSNP:764207057
1188 1188 a, g dbSNP:751690004
1189 1189 a, g dbSNP:757471938
1195 1195 a, g dbSNP:140003541
1215 1215 c, t dbSNP:746105402
1217 1217 a, t dbSNP:756449272
1221 1221 a, g dbSNP:780291813
1227 1227 a, g dbSNP:749724575
1240 1240 a, g dbSNP:769147014
1250 1250 a, g dbSNP:370536525
1251 1251 c, t dbSNP:554358578
1256 1256 c, t dbSNP:774894771
1264 1264 c, t dbSNP:747633096
1265 1265 a, g dbSNP:771523308
1304 1304 c, g dbSNP:772882547
1308 1308 g, t dbSNP:760268670
1309 1309 a, g dbSNP:766141631
1316 1316 a, g dbSNP:776576300
1323 1323 c, t dbSNP:759474977
1326 1326 a, g dbSNP:765255639
1327 1327 c, g dbSNP:752734129
1329 1329 a, g dbSNP:757317227
1330 1330 c, t dbSNP:767514241
1336 1336 a, g dbSNP:574232045
1340 1340 g, t dbSNP:373632532
1349 1349 g, t dbSNP:756290452
1350 1350 a, g dbSNP:780388742
1359 1359 a, c, g dbSNP:749638827
1364 1364 a, c dbSNP:779360423
1367 1367 a, c dbSNP:748687434
1371 1371 c, t dbSNP:373730153
1373 1373 a, g dbSNP:2884554
1382 1382 -, t dbSNP:776002626
1390 1390 c, g dbSNP:772611631
1392 1392 a, g dbSNP:562776022
1396 1396 a, c dbSNP:773438254
1397 1397 c, t dbSNP:776488209
1400 1400 a, g dbSNP:568608102
1411 1411 c, g dbSNP:191924584
1428 1428 c, t dbSNP:765167624
1432 1432 g, t dbSNP:775516212
1444 1444 c, t dbSNP:762809189
1452 1452 a, c dbSNP:767562921
1453 1453 c, t dbSNP:750461835
1465 1465 c, t dbSNP:760865867
1488 1488 a, c dbSNP:376612809
1490 1490 a, g dbSNP:766564222
1490 1490 -, g dbSNP:747764015
1498 1498 -, tg dbSNP:771875724
1501 1501 a, g dbSNP:368728981
1502 1502 a, g dbSNP:754098056
1520 1520 a, c dbSNP:557283142
1524 1524 -, aa dbSNP:776617023
1528 1528 c, t dbSNP:372317502
1534 1534 at, gc dbSNP:386807749
1534 1534 a, g dbSNP:201748296
1535 1535 c, t dbSNP:185325871
1539 1539 c, t dbSNP:145827373
1543 1543 a, t dbSNP:778414556
1549 1549 c, t dbSNP:190621199
1551 1551 c, t dbSNP:770526156
1554 1554 c, t dbSNP:780963930
1558 1558 a, g dbSNP:745535586
1563 1563 a, g dbSNP:769652030
1564 1564 a, c dbSNP:775426038
1568 1568 a, t dbSNP:762869776
1569 1569 c, g dbSNP:768463451
1570 1570 a, g dbSNP:774395125
1580 1580 a, t dbSNP:760638774
1582 1582 c, t dbSNP:560742696
1583 1583 a, g, t dbSNP:376532979
1587 1587 c, t dbSNP:765518647
1602 1602 a, g dbSNP:753000509
1603 1603 c, t dbSNP:369005946
1604 1604 c, t dbSNP:758859871
1611 1611 a, c dbSNP:778123986
1617 1617 c, t dbSNP:372670175
1621 1621 c, g, t dbSNP:148951008
1622 1622 a, g dbSNP:780859538
1624 1624 -, a dbSNP:759404334
1626 1626 a, g dbSNP:377444694
1628 1628 c, t dbSNP:769563788
1629 1629 a, g dbSNP:371197928
1658 1658 a, g dbSNP:749013063
1663 1663 a, g dbSNP:768534286
1664 1664 a, c dbSNP:774115840
1673 1673 a, c dbSNP:761833660
1680 1680 -, a dbSNP:764940695
1684 1684 c, t dbSNP:770940264
1685 1685 a, g dbSNP:557613744
1692 1692 a, c dbSNP:759680821
1694 1694 a, t dbSNP:569619961
1697 1697 c, t dbSNP:765435993
1703 1703 c, t dbSNP:375124963
1706 1706 a, g, t dbSNP:775833812
1715 1715 c, t dbSNP:764555003
1718 1718 a, g dbSNP:375833603
1723 1723 -, g dbSNP:752515166
1724 1724 a, g dbSNP:538641628
1726 1726 c, g dbSNP:552158547
1732 1732 a, c, t dbSNP:182226945
1739 1739 a, c, t dbSNP:779539422
1759 1759 a, g dbSNP:373066934
1761 1761 c, t dbSNP:534492644
1764 1764 c, t dbSNP:747066791
1768 1768 c, t dbSNP:200962863
1769 1769 a, g, t dbSNP:370427342
1770 1770 a, g dbSNP:554446762
1786 1786 a, g dbSNP:186022340
1787 1787 -, aacat dbSNP:763110867
1789 1789 c, t dbSNP:745928743
1791 1791 g, t dbSNP:756065834
1792 1792 a, g dbSNP:769903905
1794 1794 c, t dbSNP:775538323
1795 1795 a, g, t dbSNP:144337339
1797 1797 a, g dbSNP:774768705
1798 1798 a, g dbSNP:10427116
1820 1820 a, g dbSNP:768112756
1821 1821 a, c dbSNP:751005635
1822 1822 a, g dbSNP:576419414
1825 1825 c, t dbSNP:775915612
1835 1835 a, g dbSNP:779906027
1844 1844 a, c dbSNP:200293321
1848 1848 c, t dbSNP:754664150
1851 1851 c, t dbSNP:778499642
1857 1857 c, t dbSNP:747926733
1862 1862 c, t dbSNP:758242139
1864 1864 c, g dbSNP:146545256
1875 1875 c, t dbSNP:111456417
1891 1891 a, g dbSNP:572051588
1903 1903 c, t dbSNP:144995791
1904 1904 a, g dbSNP:757944139
1919 1919 a, g dbSNP:200407781
1922 1922 c, t dbSNP:768906557
1924 1924 c, t dbSNP:774482386
1934 1934 g, t dbSNP:111990779
1943 1943 a, g dbSNP:772593799
1947 1947 c, t dbSNP:773806675
1948 1948 a, g, t dbSNP:199570046
1949 1949 c, t dbSNP:766011034
1950 1950 a, g dbSNP:372420809
1954 1954 a, t dbSNP:764921756
1964 1964 a, c dbSNP:534328825
1969 1969 c, t dbSNP:529924226
1973 1973 c, t dbSNP:758152355
1981 1981 c, t dbSNP:777572164
1982 1982 a, g dbSNP:200683676
1987 1987 a, g dbSNP:757211062
2061 2061 a, g dbSNP:113071148
2067 2067 -, gaggcaggagaatcatttgaacctgg dbSNP:370643299
2074 2074 -, gagaatcatttgaacctgggaggcag dbSNP:372532927
2083 2083 c, t dbSNP:532062225
2092 2092 -, gaggca dbSNP:377217993
2105 2105 g, t dbSNP:552246498
2122 2122 c, t dbSNP:8100289
2134 2134 c, g dbSNP:534530407
2137 2137 c, g dbSNP:188139353
2159 2159 -, gac dbSNP:372040745
2161 2161 c, g dbSNP:200367614
2166 2166 -, a dbSNP:71176814
2174 2174 -, aaag dbSNP:372236589
2209 2209 a, g dbSNP:567828997
2212 2212 c, g dbSNP:755906367
2286 2286 -, a dbSNP:745538055
2291 2291 c, t dbSNP:536863618
2296 2296 c, g dbSNP:556435230
2336 2336 a, t dbSNP:570180736
2369 2369 a, g dbSNP:113437592
2379 2379 c, t dbSNP:558564331
2410 2410 a, g dbSNP:373882234
2412 2412 g, t dbSNP:777928798
2427 2427 c, t dbSNP:180942485
2436 2436 c, t dbSNP:185510818
2437 2437 a, g dbSNP:749532089
2445 2445 c, t dbSNP:369307822
2462 2462 a, g dbSNP:149271220
2470 2470 c, g dbSNP:376915807
2498 2498 c, t dbSNP:541436985
2508 2508 c, t dbSNP:543604438
2525 2525 -, att dbSNP:753820720
2529 2529 c, t dbSNP:563332715
2544 2544 -, t dbSNP:375668421
2588 2588 a, g dbSNP:532274229
2634 2634 a, g dbSNP:372238210
2654 2654 c, t dbSNP:190274274
2666 2666 -, t dbSNP:112499059
2717 2717 c, t dbSNP:147366447
2778 2778 a, c dbSNP:746006339
2844 2844 c, t dbSNP:772622883
2845 2845 a, g, t dbSNP:368755946
2852 2852 c, t dbSNP:573907285
2865 2865 a, t dbSNP:376815370
2866 2866 c, t dbSNP:772507736
2871 2871 c, g, t dbSNP:201048780
2880 2880 a, t dbSNP:761012320
2881 2881 c, g, t dbSNP:183675865
2882 2882 c, g dbSNP:759057969
2902 2902 a, g dbSNP:764687828
2923 2923 c, t dbSNP:752302211
2962 2962 c, g dbSNP:544476842
2969 2969 c, t dbSNP:373418274
2990 2990 c, t dbSNP:753032746
3114 3114 -, a dbSNP:139038996
3124 3124 -, a dbSNP:144625299
3125 3125 g, t dbSNP:530326358
3131 3131 a, g dbSNP:550390555
3138 3138 g, t dbSNP:570137260
3155 3155 g, t dbSNP:138023120
3171 3171 a, g dbSNP:756391388
3314 3314 -, gta dbSNP:199642443
3315 3315 g, t dbSNP:775877553
3386 3386 -, t dbSNP:58005745
3390 3390 c, g dbSNP:778012270
3404 3404 -, t dbSNP:61551744
3405 3405 -, a dbSNP:774620055
3417 3417 a, g dbSNP:186899325
3422 3422 -, taag dbSNP:369312141
3430 3430 -, tc dbSNP:751132091
3430 3430 a, t dbSNP:192236118
3441 3441 a, g dbSNP:534703383
3494 3494 a, g dbSNP:554617064
3503 3503 c, t dbSNP:761056060
3507 3507 c, g dbSNP:574720735
3553 3553 a, g dbSNP:376945645
3595 3595 a, g dbSNP:183717165
3604 3604 a, c dbSNP:769175379
3666 3666 g, t dbSNP:557153847
3672 3672 c, t dbSNP:577089481
3731 3731 c, t dbSNP:73024662
3764 3764 c, t dbSNP:112488004
3794 3794 c, t dbSNP:373030469
3795 3795 a, g dbSNP:189144783
3817 3817 a, g dbSNP:7253950
3825 3825 a, g dbSNP:530461705
3851 3851 g, t dbSNP:559759939
3859 3859 a, g dbSNP:7254302
3898 3898 a, g dbSNP:147145688
3900 3900 c, t dbSNP:148791020
3912 3912 c, t dbSNP:552310493
4022 4022 a, g dbSNP:113008720
4043 4043 a, t dbSNP:534788025
4175 4175 c, t dbSNP:752605869
4234 4234 -, att dbSNP:746360936
4255 4255 -, ata dbSNP:138336546
4256 4256 g, t dbSNP:146331256
4257 4257 -, ata dbSNP:71176815
4257 4257 a, t dbSNP:145100072
4258 4258 -, ata dbSNP:66490453
4258 4258 a, t dbSNP:141265094
4262 4262 c, t dbSNP:150261062
4265 4265 a, c dbSNP:142831841
4266 4266 a, c dbSNP:139646439
4288 4288 c, t dbSNP:73024665
4317 4317 a, g dbSNP:73024668
4360 4360 a, g dbSNP:537377958
4375 4375 c, t dbSNP:556996535
4394 4394 c, t dbSNP:73024670
4418 4418 a, g dbSNP:191101023
4425 4425 c, g dbSNP:73024671
4431 4431 g, t dbSNP:62124883
4439 4439 c, t dbSNP:779066099
4480 4480 a, g dbSNP:573016981
4481 4481 -, t, ttta, tttt dbSNP:11412088
4484 4484 -, a dbSNP:200383268
4512 4512 -, taagt dbSNP:765244885
4527 4527 g, t dbSNP:551107500
4542 4542 a, c dbSNP:541546341
4565 4565 c, t dbSNP:377528390
4580 4580 a, g dbSNP:575154721
4611 4611 c, g dbSNP:150875287
4654 4654 a, g dbSNP:8111827
4672 4672 a, g dbSNP:549273906
4723 4723 c, t dbSNP:182236454
4725 4725 c, t dbSNP:552398476
4746 4746 g, t dbSNP:559510502
4758 4758 c, g dbSNP:540134747
4772 4772 a, g dbSNP:528596025
4783 4783 c, g dbSNP:548370136
4789 4789 c, t dbSNP:186967589
4791 4791 a, g dbSNP:191865951
4810 4810 a, g dbSNP:562725357
4822 4822 c, t dbSNP:550911522
4827 4827 a, g dbSNP:144400836
4835 4835 c, t dbSNP:368383750
4837 4837 a, c dbSNP:747542109
4846 4846 c, t dbSNP:539736233
4852 4852 c, t dbSNP:368540433
4862 4862 c, t dbSNP:769336688
4870 4870 a, c dbSNP:751340390
4890 4890 c, t dbSNP:372050632
4891 4891 a, g dbSNP:372851080
4914 4914 a, t dbSNP:112082522
4959 4959 a, t dbSNP:546840781
4983 4983 a, g dbSNP:531812191
4993 4993 c, t dbSNP:551789989
4994 4994 c, g dbSNP:762325376
5054 5054 a, g dbSNP:770558881
5061 5061 c, t dbSNP:146564646
5062 5062 a, g dbSNP:773878781
5067 5067 c, t dbSNP:555188740
5085 5085 c, t dbSNP:374891645
5154 5154 g, t dbSNP:140084466
5239 5239 a, g dbSNP:566918147
5272 5272 c, t dbSNP:766956306
5317 5317 a, g dbSNP:113665008
5385 5385 a, c dbSNP:145728091
5386 5386 a, g dbSNP:577157005
5392 5392 a, g dbSNP:185194198
5441 5441 a, g dbSNP:559547686
5444 5444 c, t dbSNP:188512257
5454 5454 a, g dbSNP:760571796
5481 5481 a, g dbSNP:193167226
5486 5486 c, t dbSNP:562050002
5494 5494 a, g dbSNP:368238872
5574 5574 c, t dbSNP:149110191
5589 5589 a, g dbSNP:73024674
5600 5600 a, g dbSNP:185433863
5624 5624 -, g dbSNP:757327038
5660 5660 -, aa dbSNP:747151571
5685 5685 a, g dbSNP:533295260
5750 5750 a, g dbSNP:779023406
5762 5762 -, ttttc dbSNP:776755932
5803 5803 c, t dbSNP:546940011
5813 5813 a, g dbSNP:143211742
5831 5831 a, t dbSNP:535301683
5839 5839 c, t dbSNP:757647540
5861 5861 a, g dbSNP:189470705
6028 6028 c, t dbSNP:73024675
6048 6048 c, t dbSNP:537933897
6056 6056 a, c dbSNP:201709144
6058 6058 a, t dbSNP:151223039
6082 6082 a, g dbSNP:574878623
6097 6097 a, g dbSNP:758457084
6129 6129 c, g dbSNP:141291586
6149 6149 c, t dbSNP:556323354
6170 6170 a, t dbSNP:780413570
6174 6174 a, c, t dbSNP:577854004
6181 6181 c, g dbSNP:146988138
6201 6201 a, g dbSNP:137984849
6247 6247 ca, tg dbSNP:386807750
6247 6247 c, t dbSNP:143553695
6248 6248 a, g dbSNP:10405406
6255 6255 a, g dbSNP:530942913
6264 6264 c, g dbSNP:769283218
6280 6280 a, g dbSNP:544697778
6325 6325 a, t dbSNP:564545676
6338 6338 c, g dbSNP:781767960
6341 6341 g, t dbSNP:533383152
6358 6358 a, c dbSNP:180696421
6370 6370 c, g dbSNP:566659789
6393 6393 -, tatg dbSNP:533920378
6393 6393 c, t dbSNP:115527685
6407 6407 a, g dbSNP:548943488
6462 6462 g, t dbSNP:569015527
6471 6471 a, g dbSNP:9304982
6477 6477 c, t dbSNP:774004964
6516 6516 a, c dbSNP:540461026
6547 6547 a, g dbSNP:369618616
6555 6555 -, at dbSNP:772811872
6595 6595 -, gtg dbSNP:766091048
6607 6607 a, g dbSNP:150083388
6608 6608 a, c dbSNP:111768785
6610 6610 a, t dbSNP:533552031
6622 6622 a, g dbSNP:551455055
6634 6634 c, g, t dbSNP:183967326
6637 6637 a, g dbSNP:560086097
6657 6657 c, t dbSNP:372790838
6734 6734 a, g dbSNP:575818564
6746 6746 a, t dbSNP:10413492
6772 6772 a, g dbSNP:763966819
6784 6784 c, t dbSNP:533904308
6792 6792 c, t dbSNP:564582514
6837 6837 c, t dbSNP:533421434
6864 6864 -, aa dbSNP:758429239
6865 6865 -, caaaaaaa dbSNP:754534033
6865 6865 -, a dbSNP:34326769
6865 6865 a, c dbSNP:375583286
6866 6866 -, aaaaaaaa dbSNP:779349594
6873 6873 -, aa, aaa dbSNP:572019388
6882 6882 -, aaa dbSNP:386388719
6884 6884 -, aaa dbSNP:59343762
6903 6903 c, t dbSNP:574012235
6909 6909 g, t dbSNP:540680047
6946 6946 c, t dbSNP:761631452
6955 6955 -, aaatc dbSNP:556098848
6960 6960 c, t dbSNP:188599119
6965 6965 a, c dbSNP:529205411
7009 7009 c, t dbSNP:544439130
7059 7059 -, tttt dbSNP:542251450
7059 7059 c, t dbSNP:542925098
7096 7096 -, a dbSNP:773785471
7137 7137 c, t dbSNP:562734764
7162 7162 a, g dbSNP:10413226
7214 7214 g, t dbSNP:762997261
7223 7223 c, t dbSNP:113967228
7235 7235 -, t dbSNP:561947935
7244 7244 a, t dbSNP:181423327
7258 7258 a, g dbSNP:759352122
7259 7259 a, c dbSNP:551119214
7291 7291 a, c dbSNP:533260671
7311 7311 c, g dbSNP:571012679
7355 7355 c, g dbSNP:373076409
7415 7415 c, t dbSNP:148587495
7477 7477 a, g dbSNP:547221187
7485 7485 -, c dbSNP:36044558
7517 7517 a, g dbSNP:376865342
7576 7576 a, g dbSNP:12462878
7585 7585 a, t dbSNP:547112625
7639 7639 c, t dbSNP:547774974
7654 7654 a, g dbSNP:766774495
7685 7685 a, c, g dbSNP:199881991
7719 7719 a, g dbSNP:113771154
7751 7751 a, t dbSNP:755112415
7758 7758 c, t dbSNP:535845026
7781 7781 c, t dbSNP:748684681
7782 7782 -, ag dbSNP:564025332
7824 7824 c, t dbSNP:11085431
7827 7827 a, g dbSNP:575809960
7883 7883 c, t dbSNP:538446839
7897 7897 c, g dbSNP:376354245
7913 7913 a, g dbSNP:535780754
7949 7949 c, t dbSNP:373986590
7953 7953 a, g dbSNP:115013501
7996 7996 a, c dbSNP:777965842
8051 8051 -, ata dbSNP:562962607
8078 8078 g, t dbSNP:749725733
8101 8101 a, t dbSNP:578171478
8115 8115 c, t dbSNP:73024685
8143 8143 a, g dbSNP:560311414
8144 8144 c, g dbSNP:746453411
8146 8146 a, g dbSNP:186628226
8159 8159 a, t dbSNP:142920024
8177 8177 c, t dbSNP:73024688
8199 8199 a, t dbSNP:537452486
8228 8228 a, g dbSNP:531454720
8229 8229 c, g dbSNP:10423541
8257 8257 a, g dbSNP:73926925
8336 8336 a, g dbSNP:747812648
8342 8342 c, t dbSNP:765261370
8362 8362 c, t dbSNP:772879381
8388 8388 c, t dbSNP:527413720
8449 8449 a, g dbSNP:547491682
8461 8461 a, c dbSNP:191469039
8466 8466 a, c dbSNP:533629593
8492 8492 c, t dbSNP:181935439
8494 8494 a, t dbSNP:762863940
8624 8624 c, t dbSNP:2115493
8653 8653 -, c dbSNP:376471757
8654 8654 -, ttt dbSNP:747210678
8654 8654 -, tt dbSNP:139973065
8654 8654 -, t dbSNP:370954124
8655 8655 -, tt dbSNP:768598278
8656 8656 -, g dbSNP:201534832
8670 8670 -, tt dbSNP:58610412
8785 8785 a, g dbSNP:375836578
8793 8793 -, aa dbSNP:751798153
8793 8793 -, a dbSNP:561262047

Target ORF information:

RefSeq Version NM_182515
Organism Homo sapiens (human)
Definition Homo sapiens zinc finger protein 714 (ZNF714), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


Transcriptome analysis of human gastric cancer
Mamm. Genome 16 (12), 942-954 (2005)
Oh JH, Yang JO, Hahn Y, Kim MR, Byun SS, Jeon YJ, Kim JM, Song KS, Noh SM, Kim S, Yoo HS, Kim YS and Kim NS.
