
CTNNB1 cDNA ORF clone, Homo sapiens (human)

Gene Symbol CTNNB1
Entrez Gene ID 1499
Full Name catenin (cadherin-associated protein), beta 1, 88kDa
Synonyms CTNNB, MRD19, armadillo
General protein information
Preferred Names
catenin beta-1
catenin beta-1
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is part of a complex of proteins that constitute adherens junctions (AJs). AJs are necessary for the creation and maintenance of epithelial cell layers by regulating cell growth and adhesion between cells. The encoded protein also anchors the actin cytoskeleton and may be responsible for transmitting the contact inhibition signal that causes cells to stop dividing once the epithelial sheet is complete. Finally, this protein binds to the product of the APC gene, which is mutated in adenomatous polyposis of the colon. Mutations in this gene are a cause of colorectal cancer (CRC), pilomatrixoma (PTR), medulloblastoma (MDB), and ovarian cancer. Three transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Oct 2009]. lac of sum
Disorder MIM:


Disorder Html: Colorectal cancer (3); Hepatoblastoma (3); Pilomatricoma, 132600 (3);

The following CTNNB1 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the CTNNB1 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu17197 XM_005264886 PREDICTED: Homo sapiens catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu36978 XM_006712983 PREDICTED: Homo sapiens catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 Quote Price
OHu36978 XM_006712984 PREDICTED: Homo sapiens catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 Quote Price
OHu36979 XM_006712985 PREDICTED: Homo sapiens catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu17197 NM_001904 Homo sapiens catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu17197 NM_001098209 Homo sapiens catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
OHu17197 NM_001098210 Homo sapiens catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu17197
Accession Version XM_005264886.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2346bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product catenin beta-1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022517.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 3, 2014 this sequence version replaced gi:530371927. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)604..948(+)
Misc Feature(2)622..942(+)
Misc Feature(3)967..1326(+)
Misc Feature(4)1039..1320(+)
Misc Feature(5)1330..1452(+)
Misc Feature(6)1477..1836(+)
Misc Feature(7)1534..1830(+)
Misc Feature(8)1732..2151(+)
Misc Feature(9)1804..2151(+)
Misc Feature(10)2047..>2286(+)
Misc Feature(11)2116..2265(+)
Position Chain Variation Link
27 27 c, t dbSNP:766398035
38 38 c, t dbSNP:60753679
51 51 c, t dbSNP:570264776
78 78 a, t dbSNP:535661529
80 80 a, g dbSNP:759071462
102 102 c, g dbSNP:555876251
104 104 a, g dbSNP:572573932
106 106 a, g dbSNP:376101949
109 109 a, c dbSNP:190961774
135 135 g, t dbSNP:764686533
143 143 a, g dbSNP:182152387
161 161 c, t dbSNP:578055743
186 186 a, g dbSNP:149228563
191 191 -, a dbSNP:540984661
210 210 a, g dbSNP:143024072
211 211 c, t dbSNP:577377887
232 232 c, t dbSNP:186754001
238 238 a, g dbSNP:4135376
245 245 a, g dbSNP:755744390
247 247 a, g dbSNP:534465078
253 253 c, t dbSNP:751477759
271 271 a, c dbSNP:754869050
274 274 c, g dbSNP:5743390
290 290 a, c dbSNP:749331498
319 319 a, g dbSNP:121913394
322 322 a, g dbSNP:752642845
327 327 a, c dbSNP:587778221
341 341 c, t dbSNP:757325337
343 343 a, g dbSNP:121913395
346 346 -, gttagtcactggcagcaacagtcttacctggactctggaatccattct ggt dbSNP:121913416
347 347 c, g, t dbSNP:77064436
356 356 -, ggcagcaacagtcttacctggact dbSNP:121913417
363 363 a, g dbSNP:369714835
373 373 c, t dbSNP:758657130
376 376 a, c, g, t dbSNP:28931588
377 377 a, c, g, t dbSNP:121913396
380 380 a, c, g, t dbSNP:121913400
382 382 a, g dbSNP:121913399
383 383 a, g, t dbSNP:28931589
391 391 c, g, t dbSNP:121913228
392 392 a, c, g, t dbSNP:121913403
399 399 c, t dbSNP:747323395
403 403 a, c, g, t dbSNP:121913412
404 404 c, t dbSNP:121913413
407 407 c, t dbSNP:769203968
415 415 -, tct dbSNP:587776850
415 415 c, g, t dbSNP:121913407
416 416 a, c, g, t dbSNP:121913409
420 420 a, g dbSNP:777192093
432 432 c, t dbSNP:528528236
453 453 g, t dbSNP:769327358
455 455 a, g dbSNP:772550053
459 459 c, t dbSNP:762527964
467 467 -, tcc dbSNP:748083020
519 519 a, g dbSNP:113120762
526 526 a, g dbSNP:773781329
527 527 c, t dbSNP:748781625
536 536 a, c dbSNP:770494663
544 544 a, g dbSNP:773961563
552 552 a, c dbSNP:759232889
558 558 a, g dbSNP:767219370
565 565 a, c dbSNP:775104326
574 574 a, g dbSNP:760527240
592 592 a, g dbSNP:763882677
594 594 a, t dbSNP:753874922
599 599 g, t dbSNP:746139399
629 629 c, t dbSNP:770107882
651 651 c, g, t dbSNP:758551763
652 652 c, t dbSNP:751808983
653 653 a, g dbSNP:755204384
654 654 c, t dbSNP:781509994
663 663 a, c dbSNP:752945251
664 664 a, c, t dbSNP:202217100
676 676 c, t dbSNP:775491694
678 678 a, g dbSNP:778138109
699 699 a, g dbSNP:749833775
702 702 a, c, t dbSNP:3856746
734 734 a, g dbSNP:200968230
744 744 c, t dbSNP:774085540
750 750 c, g dbSNP:745411917
757 757 c, t dbSNP:771554085
765 765 c, t dbSNP:369510063
768 768 c, t dbSNP:5743392
783 783 a, g dbSNP:142472167
792 792 a, g dbSNP:760898512
799 799 a, g dbSNP:764327430
803 803 c, t dbSNP:754132704
813 813 a, g dbSNP:267599822
818 818 a, c dbSNP:77624106
821 821 a, g dbSNP:757629128
823 823 a, c dbSNP:765722646
834 834 c, t dbSNP:375776725
840 840 c, t dbSNP:373990577
848 848 c, t dbSNP:757818390
852 852 c, t dbSNP:779668005
865 865 a, c, g, t dbSNP:147382769
880 880 c, t dbSNP:139085081
887 887 c, t dbSNP:587778222
893 893 a, g dbSNP:780996852
894 894 c, t dbSNP:747895203
896 896 c, t dbSNP:769777389
900 900 c, t dbSNP:553121088
915 915 c, t dbSNP:148600849
916 916 c, t dbSNP:770795614
917 917 a, g dbSNP:200890083
924 924 c, g, t dbSNP:3856747
925 925 a, g dbSNP:369771822
926 926 c, t dbSNP:762164590
956 956 c, g dbSNP:144087793
960 960 a, g dbSNP:757499487
964 964 a, t dbSNP:755834449
987 987 -, a dbSNP:587777412
991 991 a, g dbSNP:758889881
1000 1000 c, g dbSNP:373574509
1005 1005 a, g dbSNP:483352717
1015 1015 a, g dbSNP:766827521
1059 1059 c, g dbSNP:768793451
1062 1062 c, t dbSNP:776805998
1101 1101 a, g dbSNP:530813397
1111 1111 a, g dbSNP:762074528
1122 1122 a, g dbSNP:13086686
1127 1127 c, t dbSNP:770030043
1134 1134 c, t dbSNP:773586998
1140 1140 c, t dbSNP:763232334
1141 1141 a, c dbSNP:766853534
1142 1142 a, g dbSNP:35288908
1172 1172 c, t dbSNP:759085197
1173 1173 a, g dbSNP:370662884
1188 1188 a, g dbSNP:375262741
1207 1207 c, g, t dbSNP:376393123
1213 1213 a, g dbSNP:755788748
1218 1218 a, g dbSNP:777291376
1235 1235 a, g dbSNP:752184222
1236 1236 a, t dbSNP:760272296
1252 1252 c, t dbSNP:554998963
1260 1260 c, t dbSNP:138154972
1261 1261 a, t dbSNP:753499163
1272 1272 c, g dbSNP:757047197
1281 1281 c, t dbSNP:778624338
1287 1287 a, g dbSNP:750241502
1298 1298 c, t dbSNP:758291562
1305 1305 c, t dbSNP:34343353
1320 1320 a, g dbSNP:367845313
1344 1344 a, g dbSNP:748172282
1346 1346 c, t dbSNP:769825609
1347 1347 a, g dbSNP:200709497
1351 1351 a, g dbSNP:575671885
1379 1379 c, t dbSNP:758207378
1395 1395 a, g dbSNP:754498236
1399 1399 c, t dbSNP:751567042
1425 1425 c, t dbSNP:756193831
1434 1434 c, t dbSNP:777662837
1437 1437 a, c, g dbSNP:74692094
1438 1438 a, c dbSNP:778731804
1455 1455 a, t dbSNP:779291769
1461 1461 c, t dbSNP:746221403
1470 1470 a, c dbSNP:751375496
1479 1479 a, g dbSNP:749010727
1486 1486 c, t dbSNP:767491256
1493 1493 c, t dbSNP:753799399
1510 1510 a, g dbSNP:757415518
1517 1517 a, t dbSNP:779273262
1527 1527 c, t dbSNP:746131235
1552 1552 a, c dbSNP:747887509
1554 1554 -, ttct dbSNP:398122907
1554 1554 c, t dbSNP:4135379
1563 1563 c, t dbSNP:780520120
1587 1587 a, g dbSNP:747432761
1591 1591 a, g dbSNP:768978318
1601 1601 a, g dbSNP:781731106
1615 1615 c, g dbSNP:747602570
1621 1621 c, t dbSNP:769363745
1624 1624 g, t dbSNP:772823421
1627 1627 c, t dbSNP:771596917
1632 1632 c, t dbSNP:543693510
1639 1639 c, t dbSNP:770598744
1665 1665 c, t dbSNP:774063140
1668 1668 a, g dbSNP:759385179
1674 1674 c, g dbSNP:141678313
1689 1689 a, t dbSNP:752745562
1698 1698 a, c dbSNP:761766557
1738 1738 c, t dbSNP:113411271
1739 1739 a, g dbSNP:750554859
1746 1746 c, t dbSNP:758655129
1748 1748 a, g dbSNP:780428505
1786 1786 c, t dbSNP:751814202
1798 1798 c, t dbSNP:3856748
1812 1812 c, t dbSNP:753045793
1825 1825 c, t dbSNP:397514554
1843 1843 c, t dbSNP:774271551
1845 1845 c, t dbSNP:370135014
1846 1846 a, g dbSNP:764576683
1850 1850 a, g dbSNP:754382114
1864 1864 c, t dbSNP:756737848
1879 1879 a, g dbSNP:587778220
1890 1890 a, g dbSNP:778435107
1907 1907 a, g dbSNP:551257843
1921 1921 a, t dbSNP:758002835
1931 1931 a, g dbSNP:779588249
1935 1935 a, g, t dbSNP:138539284
1939 1939 a, g dbSNP:199593411
1942 1942 g, t dbSNP:748148797
1946 1946 a, g dbSNP:186068630
1959 1959 a, g dbSNP:550622727
1970 1970 a, g dbSNP:745951696
1973 1973 c, t dbSNP:772081115
1975 1975 c, t dbSNP:775666001
1976 1976 a, g dbSNP:760837728
1998 1998 c, t dbSNP:768895650
2004 2004 c, t dbSNP:566776791
2024 2024 c, t dbSNP:762099762
2035 2035 c, g dbSNP:765762800
2037 2037 c, t dbSNP:750959414
2038 2038 a, g dbSNP:763836725
2042 2042 c, g dbSNP:762495207
2063 2063 a, g dbSNP:766038845
2067 2067 c, t dbSNP:587780325
2068 2068 a, g dbSNP:751139724
2074 2074 c, t dbSNP:754641056
2096 2096 c, t dbSNP:759171472
2103 2103 a, t dbSNP:767272142
2107 2107 a, g dbSNP:752328115
2112 2112 c, t dbSNP:374923885
2115 2115 a, g dbSNP:763747166
2130 2130 c, g dbSNP:753698017
2136 2136 c, t dbSNP:757118051
2170 2170 g, t dbSNP:778834508
2209 2209 c, t dbSNP:141493100
2214 2214 -, ca dbSNP:762256023
2219 2219 c, g dbSNP:755119590
2225 2225 a, g dbSNP:755534201
2244 2244 c, t dbSNP:750402920
2254 2254 g, t dbSNP:755029715
2257 2257 c, t dbSNP:781086938
2263 2263 a, c dbSNP:748294403
2264 2264 -, a dbSNP:35523547
2265 2265 a, c dbSNP:1800663
2266 2266 a, t dbSNP:778073244
2268 2268 g, t dbSNP:749661798
2270 2270 a, c, g, t dbSNP:771458640
2271 2271 a, g, t dbSNP:772736620
2272 2272 g, t dbSNP:760245475
2273 2273 a, g dbSNP:763639110
2274 2274 a, g dbSNP:776411653
2275 2275 a, c, g, t dbSNP:761565235
2277 2277 a, c, t dbSNP:77750814
2280 2280 a, g dbSNP:752665424
2281 2281 c, t dbSNP:756281365
2283 2283 a, g dbSNP:374853593
2285 2285 a, g dbSNP:754160678
2292 2292 c, t dbSNP:757572488
2307 2307 a, g dbSNP:201061014
2316 2316 c, g dbSNP:746237763
2324 2324 c, t dbSNP:772401455
2328 2328 c, g dbSNP:780668438
2340 2340 a, g dbSNP:746497207
2344 2344 c, t dbSNP:4135384
2363 2363 c, t dbSNP:769068251
2367 2367 c, t dbSNP:199856558
2373 2373 a, t dbSNP:747665477
2374 2374 c, t dbSNP:769381974
2380 2380 a, c dbSNP:772910638
2395 2395 a, g dbSNP:762655300
2401 2401 c, t dbSNP:770804258
2405 2405 g, t dbSNP:774035744
2410 2410 a, c dbSNP:748653573
2411 2411 a, g dbSNP:200308943
2424 2424 g, t dbSNP:751897557
2426 2426 c, g dbSNP:755359135
2431 2431 c, t dbSNP:768012106
2432 2432 a, g dbSNP:753246841
2435 2435 c, g dbSNP:756632297
2441 2441 a, c dbSNP:777221523
2453 2453 a, g dbSNP:748749625
2455 2455 a, g dbSNP:756875168
2457 2457 c, t dbSNP:191410018
2465 2465 c, g dbSNP:745670329
2478 2478 c, t dbSNP:772033082
2481 2481 c, t dbSNP:148654224
2492 2492 a, g dbSNP:746895877
2499 2499 a, g dbSNP:768746130
2500 2500 c, g dbSNP:773278783
2505 2505 a, c, t dbSNP:570479766
2508 2508 c, t dbSNP:201583088
2509 2509 c, t dbSNP:759866899
2523 2523 c, t dbSNP:767817216
2531 2531 c, t dbSNP:753089121
2537 2537 c, g dbSNP:373158451
2547 2547 a, t dbSNP:200991012
2580 2580 g, t dbSNP:753373060
2582 2582 c, g dbSNP:756782457
2585 2585 c, t dbSNP:377050808
2590 2590 c, g dbSNP:778596324
2596 2596 a, g dbSNP:569666187
2597 2597 a, g dbSNP:138501547
2599 2599 c, g dbSNP:779955747
2602 2602 c, t dbSNP:4135386
2619 2619 c, t dbSNP:768658175
2622 2622 c, t dbSNP:2293303
2625 2625 c, g dbSNP:568698842
2630 2630 a, t dbSNP:534929095
2648 2648 a, g dbSNP:770959242
2651 2651 c, t dbSNP:558310764
2660 2660 c, t dbSNP:116875446
2662 2662 g, t dbSNP:772282897
2705 2705 a, g dbSNP:760755242
2738 2738 a, g dbSNP:536585791
2765 2765 a, g dbSNP:757375560
2770 2770 c, t dbSNP:543891516
2794 2794 -, t dbSNP:201058354
2794 2794 -, a dbSNP:11564479
2795 2795 c, t dbSNP:146896526
2807 2807 c, t dbSNP:181927582
2809 2809 c, g dbSNP:767572148
2815 2815 a, t dbSNP:781585089
2856 2856 -, t dbSNP:528304493
2856 2856 -, g dbSNP:150533740
2857 2857 -, t dbSNP:4135244
2862 2862 -, t dbSNP:377591875
2922 2922 -, agc dbSNP:546438186
2924 2924 -, agc dbSNP:397843636
2925 2925 -, agc dbSNP:4135243
2925 2925 -, gct dbSNP:201309476
2928 2928 c, t dbSNP:764044761
2934 2934 c, t dbSNP:4135388
2938 2938 c, t dbSNP:757079403
2954 2954 -, a dbSNP:34854135
3000 3000 a, g dbSNP:4135389
3032 3032 -, ac dbSNP:143836144
3092 3092 -, t dbSNP:571568960
3107 3107 a, g dbSNP:371800780
3109 3109 a, g dbSNP:770023254
3119 3119 a, g dbSNP:375050845
3183 3183 g, t dbSNP:2953
3204 3204 -, a dbSNP:150512515
3205 3205 -, a dbSNP:768597179
3205 3205 -, a dbSNP:775453764
3207 3207 a, t dbSNP:397843698
3207 3207 -, t dbSNP:34653633
3208 3208 -, t dbSNP:570037233
3208 3208 a, t dbSNP:4135387
3226 3226 -, t dbSNP:397989315
3272 3272 c, t dbSNP:201175238
3314 3314 a, g dbSNP:564295817
3323 3323 a, g dbSNP:549926618
3336 3336 a, g dbSNP:549906289
3361 3361 -, taat dbSNP:772921930
3372 3372 a, g dbSNP:11708064
3395 3395 -, taa, taat dbSNP:16339
3396 3396 -, aatt, taat dbSNP:71623294
3399 3399 -, taat dbSNP:3834205
3401 3401 a, c dbSNP:202194019
3412 3412 -, taat dbSNP:72273140
3423 3423 -, atc dbSNP:772744702
3481 3481 a, g dbSNP:145906085
3485 3485 c, t dbSNP:1798792
3525 3525 g, t dbSNP:1722851
3533 3533 g, t dbSNP:148378295
3539 3539 g, t dbSNP:757981542
3590 3590 a, g dbSNP:1058355
3642 3642 c, t dbSNP:535458683
3668 3668 c, t dbSNP:116035162
3669 3669 c, g dbSNP:141130241
3678 3678 a, g dbSNP:535312947
3680 3680 a, c dbSNP:779688474
3689 3689 a, g dbSNP:768489723
3718 3718 -, ttaa dbSNP:755525886
3726 3726 a, g dbSNP:539807313
3729 3729 c, t dbSNP:150729932

Target ORF information:

RefSeq Version XM_005264886
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu36978
Accession Version XM_006712983.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2325bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product catenin beta-1 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022517.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)502..846(+)
Misc Feature(2)520..840(+)
Misc Feature(3)865..1224(+)
Misc Feature(4)937..1218(+)
Misc Feature(5)1228..1350(+)
Misc Feature(6)1375..1734(+)
Misc Feature(7)1432..1728(+)
Misc Feature(8)1630..2049(+)
Misc Feature(9)1702..2049(+)
Misc Feature(10)1945..>2184(+)
Misc Feature(11)2014..2163(+)
Position Chain Variation Link
4 4 a, g dbSNP:4135376
11 11 a, g dbSNP:755744390
13 13 a, g dbSNP:534465078
19 19 c, t dbSNP:751477759
37 37 a, c dbSNP:754869050
40 40 c, g dbSNP:5743390
56 56 a, c dbSNP:749331498
67 67 c, t dbSNP:555170114
99 99 a, t dbSNP:565735389
156 156 c, t dbSNP:534610881
157 157 c, t dbSNP:11564444
217 217 a, g dbSNP:121913394
220 220 a, g dbSNP:752642845
225 225 a, c dbSNP:587778221
239 239 c, t dbSNP:757325337
241 241 a, g dbSNP:121913395
244 244 -, gttagtcactggcagcaacagtcttacctggactctggaatccattct ggt dbSNP:121913416
245 245 c, g, t dbSNP:77064436
254 254 -, ggcagcaacagtcttacctggact dbSNP:121913417
261 261 a, g dbSNP:369714835
271 271 c, t dbSNP:758657130
274 274 a, c, g, t dbSNP:28931588
275 275 a, c, g, t dbSNP:121913396
278 278 a, c, g, t dbSNP:121913400
280 280 a, g dbSNP:121913399
281 281 a, g, t dbSNP:28931589
289 289 c, g, t dbSNP:121913228
290 290 a, c, g, t dbSNP:121913403
297 297 c, t dbSNP:747323395
301 301 a, c, g, t dbSNP:121913412
302 302 c, t dbSNP:121913413
305 305 c, t dbSNP:769203968
313 313 -, tct dbSNP:587776850
313 313 c, g, t dbSNP:121913407
314 314 a, c, g, t dbSNP:121913409
318 318 a, g dbSNP:777192093
330 330 c, t dbSNP:528528236
351 351 g, t dbSNP:769327358
353 353 a, g dbSNP:772550053
357 357 c, t dbSNP:762527964
365 365 -, tcc dbSNP:748083020
417 417 a, g dbSNP:113120762
424 424 a, g dbSNP:773781329
425 425 c, t dbSNP:748781625
434 434 a, c dbSNP:770494663
442 442 a, g dbSNP:773961563
450 450 a, c dbSNP:759232889
456 456 a, g dbSNP:767219370
463 463 a, c dbSNP:775104326
472 472 a, g dbSNP:760527240
490 490 a, g dbSNP:763882677
492 492 a, t dbSNP:753874922
497 497 g, t dbSNP:746139399
527 527 c, t dbSNP:770107882
549 549 c, g, t dbSNP:758551763
550 550 c, t dbSNP:751808983
551 551 a, g dbSNP:755204384
552 552 c, t dbSNP:781509994
561 561 a, c dbSNP:752945251
562 562 a, c, t dbSNP:202217100
574 574 c, t dbSNP:775491694
576 576 a, g dbSNP:778138109
597 597 a, g dbSNP:749833775
600 600 a, c, t dbSNP:3856746
632 632 a, g dbSNP:200968230
642 642 c, t dbSNP:774085540
648 648 c, g dbSNP:745411917
655 655 c, t dbSNP:771554085
663 663 c, t dbSNP:369510063
666 666 c, t dbSNP:5743392
681 681 a, g dbSNP:142472167
690 690 a, g dbSNP:760898512
697 697 a, g dbSNP:764327430
701 701 c, t dbSNP:754132704
711 711 a, g dbSNP:267599822
716 716 a, c dbSNP:77624106
719 719 a, g dbSNP:757629128
721 721 a, c dbSNP:765722646
732 732 c, t dbSNP:375776725
738 738 c, t dbSNP:373990577
746 746 c, t dbSNP:757818390
750 750 c, t dbSNP:779668005
763 763 a, c, g, t dbSNP:147382769
778 778 c, t dbSNP:139085081
785 785 c, t dbSNP:587778222
791 791 a, g dbSNP:780996852
792 792 c, t dbSNP:747895203
794 794 c, t dbSNP:769777389
798 798 c, t dbSNP:553121088
813 813 c, t dbSNP:148600849
814 814 c, t dbSNP:770795614
815 815 a, g dbSNP:200890083
822 822 c, g, t dbSNP:3856747
823 823 a, g dbSNP:369771822
824 824 c, t dbSNP:762164590
854 854 c, g dbSNP:144087793
858 858 a, g dbSNP:757499487
862 862 a, t dbSNP:755834449
885 885 -, a dbSNP:587777412
889 889 a, g dbSNP:758889881
898 898 c, g dbSNP:373574509
903 903 a, g dbSNP:483352717
913 913 a, g dbSNP:766827521
957 957 c, g dbSNP:768793451
960 960 c, t dbSNP:776805998
999 999 a, g dbSNP:530813397
1009 1009 a, g dbSNP:762074528
1020 1020 a, g dbSNP:13086686
1025 1025 c, t dbSNP:770030043
1032 1032 c, t dbSNP:773586998
1038 1038 c, t dbSNP:763232334
1039 1039 a, c dbSNP:766853534
1040 1040 a, g dbSNP:35288908
1070 1070 c, t dbSNP:759085197
1071 1071 a, g dbSNP:370662884
1086 1086 a, g dbSNP:375262741
1105 1105 c, g, t dbSNP:376393123
1111 1111 a, g dbSNP:755788748
1116 1116 a, g dbSNP:777291376
1133 1133 a, g dbSNP:752184222
1134 1134 a, t dbSNP:760272296
1150 1150 c, t dbSNP:554998963
1158 1158 c, t dbSNP:138154972
1159 1159 a, t dbSNP:753499163
1170 1170 c, g dbSNP:757047197
1179 1179 c, t dbSNP:778624338
1185 1185 a, g dbSNP:750241502
1196 1196 c, t dbSNP:758291562
1203 1203 c, t dbSNP:34343353
1218 1218 a, g dbSNP:367845313
1242 1242 a, g dbSNP:748172282
1244 1244 c, t dbSNP:769825609
1245 1245 a, g dbSNP:200709497
1249 1249 a, g dbSNP:575671885
1277 1277 c, t dbSNP:758207378
1293 1293 a, g dbSNP:754498236
1297 1297 c, t dbSNP:751567042
1323 1323 c, t dbSNP:756193831
1332 1332 c, t dbSNP:777662837
1335 1335 a, c, g dbSNP:74692094
1336 1336 a, c dbSNP:778731804
1353 1353 a, t dbSNP:779291769
1359 1359 c, t dbSNP:746221403
1368 1368 a, c dbSNP:751375496
1377 1377 a, g dbSNP:749010727
1384 1384 c, t dbSNP:767491256
1391 1391 c, t dbSNP:753799399
1408 1408 a, g dbSNP:757415518
1415 1415 a, t dbSNP:779273262
1425 1425 c, t dbSNP:746131235
1450 1450 a, c dbSNP:747887509
1452 1452 -, ttct dbSNP:398122907
1452 1452 c, t dbSNP:4135379
1461 1461 c, t dbSNP:780520120
1485 1485 a, g dbSNP:747432761
1489 1489 a, g dbSNP:768978318
1499 1499 a, g dbSNP:781731106
1513 1513 c, g dbSNP:747602570
1519 1519 c, t dbSNP:769363745
1522 1522 g, t dbSNP:772823421
1525 1525 c, t dbSNP:771596917
1530 1530 c, t dbSNP:543693510
1537 1537 c, t dbSNP:770598744
1563 1563 c, t dbSNP:774063140
1566 1566 a, g dbSNP:759385179
1572 1572 c, g dbSNP:141678313
1587 1587 a, t dbSNP:752745562
1596 1596 a, c dbSNP:761766557
1636 1636 c, t dbSNP:113411271
1637 1637 a, g dbSNP:750554859
1644 1644 c, t dbSNP:758655129
1646 1646 a, g dbSNP:780428505
1684 1684 c, t dbSNP:751814202
1696 1696 c, t dbSNP:3856748
1710 1710 c, t dbSNP:753045793
1723 1723 c, t dbSNP:397514554
1741 1741 c, t dbSNP:774271551
1743 1743 c, t dbSNP:370135014
1744 1744 a, g dbSNP:764576683
1748 1748 a, g dbSNP:754382114
1762 1762 c, t dbSNP:756737848
1777 1777 a, g dbSNP:587778220
1788 1788 a, g dbSNP:778435107
1805 1805 a, g dbSNP:551257843
1819 1819 a, t dbSNP:758002835
1829 1829 a, g dbSNP:779588249
1833 1833 a, g, t dbSNP:138539284
1837 1837 a, g dbSNP:199593411
1840 1840 g, t dbSNP:748148797
1844 1844 a, g dbSNP:186068630
1857 1857 a, g dbSNP:550622727
1868 1868 a, g dbSNP:745951696
1871 1871 c, t dbSNP:772081115
1873 1873 c, t dbSNP:775666001
1874 1874 a, g dbSNP:760837728
1896 1896 c, t dbSNP:768895650
1902 1902 c, t dbSNP:566776791
1922 1922 c, t dbSNP:762099762
1933 1933 c, g dbSNP:765762800
1935 1935 c, t dbSNP:750959414
1936 1936 a, g dbSNP:763836725
1940 1940 c, g dbSNP:762495207
1961 1961 a, g dbSNP:766038845
1965 1965 c, t dbSNP:587780325
1966 1966 a, g dbSNP:751139724
1972 1972 c, t dbSNP:754641056
1994 1994 c, t dbSNP:759171472
2001 2001 a, t dbSNP:767272142
2005 2005 a, g dbSNP:752328115
2010 2010 c, t dbSNP:374923885
2013 2013 a, g dbSNP:763747166
2028 2028 c, g dbSNP:753698017
2034 2034 c, t dbSNP:757118051
2068 2068 g, t dbSNP:778834508
2107 2107 c, t dbSNP:141493100
2112 2112 -, ca dbSNP:762256023
2117 2117 c, g dbSNP:755119590
2123 2123 a, g dbSNP:755534201
2142 2142 c, t dbSNP:750402920
2152 2152 g, t dbSNP:755029715
2155 2155 c, t dbSNP:781086938
2161 2161 a, c dbSNP:748294403
2162 2162 -, a dbSNP:35523547
2163 2163 a, c dbSNP:1800663
2164 2164 a, t dbSNP:778073244
2166 2166 g, t dbSNP:749661798
2168 2168 a, c, g, t dbSNP:771458640
2169 2169 a, g, t dbSNP:772736620
2170 2170 g, t dbSNP:760245475
2171 2171 a, g dbSNP:763639110
2172 2172 a, g dbSNP:776411653
2173 2173 a, c, g, t dbSNP:761565235
2175 2175 a, c, t dbSNP:77750814
2178 2178 a, g dbSNP:752665424
2179 2179 c, t dbSNP:756281365
2181 2181 a, g dbSNP:374853593
2183 2183 a, g dbSNP:754160678
2190 2190 c, t dbSNP:757572488
2205 2205 a, g dbSNP:201061014
2214 2214 c, g dbSNP:746237763
2222 2222 c, t dbSNP:772401455
2226 2226 c, g dbSNP:780668438
2238 2238 a, g dbSNP:746497207
2242 2242 c, t dbSNP:4135384
2261 2261 c, t dbSNP:769068251
2265 2265 c, t dbSNP:199856558
2271 2271 a, t dbSNP:747665477
2272 2272 c, t dbSNP:769381974
2278 2278 a, c dbSNP:772910638
2293 2293 a, g dbSNP:762655300
2299 2299 c, t dbSNP:770804258
2303 2303 g, t dbSNP:774035744
2308 2308 a, c dbSNP:748653573
2309 2309 a, g dbSNP:200308943
2322 2322 g, t dbSNP:751897557
2324 2324 c, g dbSNP:755359135
2329 2329 c, t dbSNP:768012106
2330 2330 a, g dbSNP:753246841
2333 2333 c, g dbSNP:756632297
2339 2339 a, c dbSNP:777221523
2351 2351 a, g dbSNP:748749625
2353 2353 a, g dbSNP:756875168
2355 2355 c, t dbSNP:191410018
2363 2363 c, g dbSNP:745670329
2376 2376 c, t dbSNP:772033082
2379 2379 c, t dbSNP:148654224
2390 2390 a, g dbSNP:746895877
2397 2397 a, g dbSNP:768746130
2398 2398 c, g dbSNP:773278783
2403 2403 a, c, t dbSNP:570479766
2406 2406 c, t dbSNP:201583088
2407 2407 c, t dbSNP:759866899
2421 2421 c, t dbSNP:767817216
2429 2429 c, t dbSNP:753089121
2435 2435 c, g dbSNP:373158451
2445 2445 a, t dbSNP:200991012
2478 2478 g, t dbSNP:753373060
2480 2480 c, g dbSNP:756782457
2483 2483 c, t dbSNP:377050808
2488 2488 c, g dbSNP:778596324
2494 2494 a, g dbSNP:569666187
2495 2495 a, g dbSNP:138501547
2497 2497 c, g dbSNP:779955747
2500 2500 c, t dbSNP:4135386
2517 2517 c, t dbSNP:768658175
2520 2520 c, t dbSNP:2293303
2523 2523 c, g dbSNP:568698842
2528 2528 a, t dbSNP:534929095
2546 2546 a, g dbSNP:770959242
2549 2549 c, t dbSNP:558310764
2558 2558 c, t dbSNP:116875446
2560 2560 g, t dbSNP:772282897
2603 2603 a, g dbSNP:760755242
2636 2636 a, g dbSNP:536585791
2663 2663 a, g dbSNP:757375560
2668 2668 c, t dbSNP:543891516
2692 2692 -, t dbSNP:201058354
2692 2692 -, a dbSNP:11564479
2693 2693 c, t dbSNP:146896526
2705 2705 c, t dbSNP:181927582
2707 2707 c, g dbSNP:767572148
2713 2713 a, t dbSNP:781585089
2754 2754 -, t dbSNP:528304493
2754 2754 -, g dbSNP:150533740
2755 2755 -, t dbSNP:4135244
2760 2760 -, t dbSNP:377591875
2820 2820 -, agc dbSNP:546438186
2822 2822 -, agc dbSNP:397843636
2823 2823 -, agc dbSNP:4135243
2823 2823 -, gct dbSNP:201309476
2826 2826 c, t dbSNP:764044761
2832 2832 c, t dbSNP:4135388
2836 2836 c, t dbSNP:757079403
2852 2852 -, a dbSNP:34854135
2898 2898 a, g dbSNP:4135389
2930 2930 -, ac dbSNP:143836144
2990 2990 -, t dbSNP:571568960
3005 3005 a, g dbSNP:371800780
3007 3007 a, g dbSNP:770023254
3017 3017 a, g dbSNP:375050845
3081 3081 g, t dbSNP:2953
3102 3102 -, a dbSNP:150512515
3103 3103 -, a dbSNP:768597179
3103 3103 -, a dbSNP:775453764
3105 3105 a, t dbSNP:397843698
3105 3105 -, t dbSNP:34653633
3106 3106 -, t dbSNP:570037233
3106 3106 a, t dbSNP:4135387
3124 3124 -, t dbSNP:397989315
3170 3170 c, t dbSNP:201175238
3212 3212 a, g dbSNP:564295817
3221 3221 a, g dbSNP:549926618
3234 3234 a, g dbSNP:549906289
3259 3259 -, taat dbSNP:772921930
3270 3270 a, g dbSNP:11708064
3293 3293 -, taa, taat dbSNP:16339
3294 3294 -, aatt, taat dbSNP:71623294
3297 3297 -, taat dbSNP:3834205
3299 3299 a, c dbSNP:202194019
3310 3310 -, taat dbSNP:72273140
3321 3321 -, atc dbSNP:772744702
3379 3379 a, g dbSNP:145906085
3383 3383 c, t dbSNP:1798792
3423 3423 g, t dbSNP:1722851
3431 3431 g, t dbSNP:148378295
3437 3437 g, t dbSNP:757981542
3488 3488 a, g dbSNP:1058355
3540 3540 c, t dbSNP:535458683
3566 3566 c, t dbSNP:116035162
3567 3567 c, g dbSNP:141130241
3576 3576 a, g dbSNP:535312947
3578 3578 a, c dbSNP:779688474
3587 3587 a, g dbSNP:768489723
3616 3616 -, ttaa dbSNP:755525886
3624 3624 a, g dbSNP:539807313
3627 3627 c, t dbSNP:150729932

Target ORF information:

RefSeq Version XM_006712983
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu36978
Accession Version XM_006712984.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2325bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product catenin beta-1 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022517.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)502..846(+)
Misc Feature(2)520..840(+)
Misc Feature(3)865..1224(+)
Misc Feature(4)937..1218(+)
Misc Feature(5)1228..1350(+)
Misc Feature(6)1375..1734(+)
Misc Feature(7)1432..1728(+)
Misc Feature(8)1630..2049(+)
Misc Feature(9)1702..2049(+)
Misc Feature(10)1945..>2184(+)
Misc Feature(11)2014..2163(+)
Position Chain Variation Link
4 4 a, g dbSNP:4135376
11 11 a, g dbSNP:755744390
13 13 a, g dbSNP:534465078
19 19 c, t dbSNP:751477759
37 37 a, c dbSNP:754869050
40 40 c, g dbSNP:5743390
56 56 a, c dbSNP:749331498
67 67 c, t dbSNP:555170114
99 99 a, t dbSNP:565735389
156 156 c, t dbSNP:534610881
157 157 c, t dbSNP:11564444
217 217 a, g dbSNP:121913394
220 220 a, g dbSNP:752642845
225 225 a, c dbSNP:587778221
239 239 c, t dbSNP:757325337
241 241 a, g dbSNP:121913395
244 244 -, gttagtcactggcagcaacagtcttacctggactctggaatccattct ggt dbSNP:121913416
245 245 c, g, t dbSNP:77064436
254 254 -, ggcagcaacagtcttacctggact dbSNP:121913417
261 261 a, g dbSNP:369714835
271 271 c, t dbSNP:758657130
274 274 a, c, g, t dbSNP:28931588
275 275 a, c, g, t dbSNP:121913396
278 278 a, c, g, t dbSNP:121913400
280 280 a, g dbSNP:121913399
281 281 a, g, t dbSNP:28931589
289 289 c, g, t dbSNP:121913228
290 290 a, c, g, t dbSNP:121913403
297 297 c, t dbSNP:747323395
301 301 a, c, g, t dbSNP:121913412
302 302 c, t dbSNP:121913413
305 305 c, t dbSNP:769203968
313 313 -, tct dbSNP:587776850
313 313 c, g, t dbSNP:121913407
314 314 a, c, g, t dbSNP:121913409
318 318 a, g dbSNP:777192093
330 330 c, t dbSNP:528528236
351 351 g, t dbSNP:769327358
353 353 a, g dbSNP:772550053
357 357 c, t dbSNP:762527964
365 365 -, tcc dbSNP:748083020
417 417 a, g dbSNP:113120762
424 424 a, g dbSNP:773781329
425 425 c, t dbSNP:748781625
434 434 a, c dbSNP:770494663
442 442 a, g dbSNP:773961563
450 450 a, c dbSNP:759232889
456 456 a, g dbSNP:767219370
463 463 a, c dbSNP:775104326
472 472 a, g dbSNP:760527240
490 490 a, g dbSNP:763882677
492 492 a, t dbSNP:753874922
497 497 g, t dbSNP:746139399
527 527 c, t dbSNP:770107882
549 549 c, g, t dbSNP:758551763
550 550 c, t dbSNP:751808983
551 551 a, g dbSNP:755204384
552 552 c, t dbSNP:781509994
561 561 a, c dbSNP:752945251
562 562 a, c, t dbSNP:202217100
574 574 c, t dbSNP:775491694
576 576 a, g dbSNP:778138109
597 597 a, g dbSNP:749833775
600 600 a, c, t dbSNP:3856746
632 632 a, g dbSNP:200968230
642 642 c, t dbSNP:774085540
648 648 c, g dbSNP:745411917
655 655 c, t dbSNP:771554085
663 663 c, t dbSNP:369510063
666 666 c, t dbSNP:5743392
681 681 a, g dbSNP:142472167
690 690 a, g dbSNP:760898512
697 697 a, g dbSNP:764327430
701 701 c, t dbSNP:754132704
711 711 a, g dbSNP:267599822
716 716 a, c dbSNP:77624106
719 719 a, g dbSNP:757629128
721 721 a, c dbSNP:765722646
732 732 c, t dbSNP:375776725
738 738 c, t dbSNP:373990577
746 746 c, t dbSNP:757818390
750 750 c, t dbSNP:779668005
763 763 a, c, g, t dbSNP:147382769
778 778 c, t dbSNP:139085081
785 785 c, t dbSNP:587778222
791 791 a, g dbSNP:780996852
792 792 c, t dbSNP:747895203
794 794 c, t dbSNP:769777389
798 798 c, t dbSNP:553121088
813 813 c, t dbSNP:148600849
814 814 c, t dbSNP:770795614
815 815 a, g dbSNP:200890083
822 822 c, g, t dbSNP:3856747
823 823 a, g dbSNP:369771822
824 824 c, t dbSNP:762164590
854 854 c, g dbSNP:144087793
858 858 a, g dbSNP:757499487
862 862 a, t dbSNP:755834449
885 885 -, a dbSNP:587777412
889 889 a, g dbSNP:758889881
898 898 c, g dbSNP:373574509
903 903 a, g dbSNP:483352717
913 913 a, g dbSNP:766827521
957 957 c, g dbSNP:768793451
960 960 c, t dbSNP:776805998
999 999 a, g dbSNP:530813397
1009 1009 a, g dbSNP:762074528
1020 1020 a, g dbSNP:13086686
1025 1025 c, t dbSNP:770030043
1032 1032 c, t dbSNP:773586998
1038 1038 c, t dbSNP:763232334
1039 1039 a, c dbSNP:766853534
1040 1040 a, g dbSNP:35288908
1070 1070 c, t dbSNP:759085197
1071 1071 a, g dbSNP:370662884
1086 1086 a, g dbSNP:375262741
1105 1105 c, g, t dbSNP:376393123
1111 1111 a, g dbSNP:755788748
1116 1116 a, g dbSNP:777291376
1133 1133 a, g dbSNP:752184222
1134 1134 a, t dbSNP:760272296
1150 1150 c, t dbSNP:554998963
1158 1158 c, t dbSNP:138154972
1159 1159 a, t dbSNP:753499163
1170 1170 c, g dbSNP:757047197
1179 1179 c, t dbSNP:778624338
1185 1185 a, g dbSNP:750241502
1196 1196 c, t dbSNP:758291562
1203 1203 c, t dbSNP:34343353
1218 1218 a, g dbSNP:367845313
1242 1242 a, g dbSNP:748172282
1244 1244 c, t dbSNP:769825609
1245 1245 a, g dbSNP:200709497
1249 1249 a, g dbSNP:575671885
1277 1277 c, t dbSNP:758207378
1293 1293 a, g dbSNP:754498236
1297 1297 c, t dbSNP:751567042
1323 1323 c, t dbSNP:756193831
1332 1332 c, t dbSNP:777662837
1335 1335 a, c, g dbSNP:74692094
1336 1336 a, c dbSNP:778731804
1353 1353 a, t dbSNP:779291769
1359 1359 c, t dbSNP:746221403
1368 1368 a, c dbSNP:751375496
1377 1377 a, g dbSNP:749010727
1384 1384 c, t dbSNP:767491256
1391 1391 c, t dbSNP:753799399
1408 1408 a, g dbSNP:757415518
1415 1415 a, t dbSNP:779273262
1425 1425 c, t dbSNP:746131235
1450 1450 a, c dbSNP:747887509
1452 1452 -, ttct dbSNP:398122907
1452 1452 c, t dbSNP:4135379
1461 1461 c, t dbSNP:780520120
1485 1485 a, g dbSNP:747432761
1489 1489 a, g dbSNP:768978318
1499 1499 a, g dbSNP:781731106
1513 1513 c, g dbSNP:747602570
1519 1519 c, t dbSNP:769363745
1522 1522 g, t dbSNP:772823421
1525 1525 c, t dbSNP:771596917
1530 1530 c, t dbSNP:543693510
1537 1537 c, t dbSNP:770598744
1563 1563 c, t dbSNP:774063140
1566 1566 a, g dbSNP:759385179
1572 1572 c, g dbSNP:141678313
1587 1587 a, t dbSNP:752745562
1596 1596 a, c dbSNP:761766557
1636 1636 c, t dbSNP:113411271
1637 1637 a, g dbSNP:750554859
1644 1644 c, t dbSNP:758655129
1646 1646 a, g dbSNP:780428505
1684 1684 c, t dbSNP:751814202
1696 1696 c, t dbSNP:3856748
1710 1710 c, t dbSNP:753045793
1723 1723 c, t dbSNP:397514554
1741 1741 c, t dbSNP:774271551
1743 1743 c, t dbSNP:370135014
1744 1744 a, g dbSNP:764576683
1748 1748 a, g dbSNP:754382114
1762 1762 c, t dbSNP:756737848
1777 1777 a, g dbSNP:587778220
1788 1788 a, g dbSNP:778435107
1805 1805 a, g dbSNP:551257843
1819 1819 a, t dbSNP:758002835
1829 1829 a, g dbSNP:779588249
1833 1833 a, g, t dbSNP:138539284
1837 1837 a, g dbSNP:199593411
1840 1840 g, t dbSNP:748148797
1844 1844 a, g dbSNP:186068630
1857 1857 a, g dbSNP:550622727
1868 1868 a, g dbSNP:745951696
1871 1871 c, t dbSNP:772081115
1873 1873 c, t dbSNP:775666001
1874 1874 a, g dbSNP:760837728
1896 1896 c, t dbSNP:768895650
1902 1902 c, t dbSNP:566776791
1922 1922 c, t dbSNP:762099762
1933 1933 c, g dbSNP:765762800
1935 1935 c, t dbSNP:750959414
1936 1936 a, g dbSNP:763836725
1940 1940 c, g dbSNP:762495207
1961 1961 a, g dbSNP:766038845
1965 1965 c, t dbSNP:587780325
1966 1966 a, g dbSNP:751139724
1972 1972 c, t dbSNP:754641056
1994 1994 c, t dbSNP:759171472
2001 2001 a, t dbSNP:767272142
2005 2005 a, g dbSNP:752328115
2010 2010 c, t dbSNP:374923885
2013 2013 a, g dbSNP:763747166
2028 2028 c, g dbSNP:753698017
2034 2034 c, t dbSNP:757118051
2068 2068 g, t dbSNP:778834508
2107 2107 c, t dbSNP:141493100
2112 2112 -, ca dbSNP:762256023
2117 2117 c, g dbSNP:755119590
2123 2123 a, g dbSNP:755534201
2142 2142 c, t dbSNP:750402920
2152 2152 g, t dbSNP:755029715
2155 2155 c, t dbSNP:781086938
2161 2161 a, c dbSNP:748294403
2162 2162 -, a dbSNP:35523547
2163 2163 a, c dbSNP:1800663
2164 2164 a, t dbSNP:778073244
2166 2166 g, t dbSNP:749661798
2168 2168 a, c, g, t dbSNP:771458640
2169 2169 a, g, t dbSNP:772736620
2170 2170 g, t dbSNP:760245475
2171 2171 a, g dbSNP:763639110
2172 2172 a, g dbSNP:776411653
2173 2173 a, c, g, t dbSNP:761565235
2175 2175 a, c, t dbSNP:77750814
2178 2178 a, g dbSNP:752665424
2179 2179 c, t dbSNP:756281365
2181 2181 a, g dbSNP:374853593
2183 2183 a, g dbSNP:754160678
2190 2190 c, t dbSNP:757572488
2205 2205 a, g dbSNP:201061014
2214 2214 c, g dbSNP:746237763
2222 2222 c, t dbSNP:772401455
2226 2226 c, g dbSNP:780668438
2238 2238 a, g dbSNP:746497207
2242 2242 c, t dbSNP:4135384
2261 2261 c, t dbSNP:769068251
2265 2265 c, t dbSNP:199856558
2271 2271 a, t dbSNP:747665477
2272 2272 c, t dbSNP:769381974
2278 2278 a, c dbSNP:772910638
2293 2293 a, g dbSNP:762655300
2299 2299 c, t dbSNP:770804258
2303 2303 g, t dbSNP:774035744
2308 2308 a, c dbSNP:748653573
2309 2309 a, g dbSNP:200308943
2322 2322 g, t dbSNP:751897557
2324 2324 c, g dbSNP:755359135
2329 2329 c, t dbSNP:768012106
2330 2330 a, g dbSNP:753246841
2333 2333 c, g dbSNP:756632297
2339 2339 a, c dbSNP:777221523
2351 2351 a, g dbSNP:748749625
2353 2353 a, g dbSNP:756875168
2355 2355 c, t dbSNP:191410018
2363 2363 c, g dbSNP:745670329
2376 2376 c, t dbSNP:772033082
2379 2379 c, t dbSNP:148654224
2390 2390 a, g dbSNP:746895877
2397 2397 a, g dbSNP:768746130
2398 2398 c, g dbSNP:773278783
2403 2403 a, c, t dbSNP:570479766
2406 2406 c, t dbSNP:201583088
2407 2407 c, t dbSNP:759866899
2421 2421 c, t dbSNP:767817216
2429 2429 c, t dbSNP:753089121
2435 2435 c, g dbSNP:373158451
2445 2445 a, t dbSNP:200991012
2478 2478 g, t dbSNP:753373060
2480 2480 c, g dbSNP:756782457
2483 2483 c, t dbSNP:377050808
2488 2488 c, g dbSNP:778596324
2494 2494 a, g dbSNP:569666187
2495 2495 a, g dbSNP:138501547
2497 2497 c, g dbSNP:779955747
2500 2500 c, t dbSNP:4135386
2517 2517 c, t dbSNP:768658175
2520 2520 c, t dbSNP:2293303
2523 2523 c, g dbSNP:568698842
2528 2528 a, t dbSNP:534929095
2547 2547 -, a dbSNP:34854135
2593 2593 a, g dbSNP:4135389
2625 2625 -, ac dbSNP:143836144
2685 2685 -, t dbSNP:571568960
2700 2700 a, g dbSNP:371800780
2702 2702 a, g dbSNP:770023254
2712 2712 a, g dbSNP:375050845
2776 2776 g, t dbSNP:2953
2797 2797 -, a dbSNP:150512515
2798 2798 -, a dbSNP:768597179
2798 2798 -, a dbSNP:775453764
2800 2800 a, t dbSNP:397843698
2800 2800 -, t dbSNP:34653633
2801 2801 -, t dbSNP:570037233
2801 2801 a, t dbSNP:4135387
2819 2819 -, t dbSNP:397989315
2865 2865 c, t dbSNP:201175238
2907 2907 a, g dbSNP:564295817
2916 2916 a, g dbSNP:549926618
2929 2929 a, g dbSNP:549906289
2954 2954 -, taat dbSNP:772921930
2965 2965 a, g dbSNP:11708064
2988 2988 -, taa, taat dbSNP:16339
2989 2989 -, aatt, taat dbSNP:71623294
2992 2992 -, taat dbSNP:3834205
2994 2994 a, c dbSNP:202194019
3005 3005 -, taat dbSNP:72273140
3016 3016 -, atc dbSNP:772744702
3074 3074 a, g dbSNP:145906085
3078 3078 c, t dbSNP:1798792
3118 3118 g, t dbSNP:1722851
3126 3126 g, t dbSNP:148378295
3132 3132 g, t dbSNP:757981542
3183 3183 a, g dbSNP:1058355
3235 3235 c, t dbSNP:535458683
3261 3261 c, t dbSNP:116035162
3262 3262 c, g dbSNP:141130241
3271 3271 a, g dbSNP:535312947
3273 3273 a, c dbSNP:779688474
3282 3282 a, g dbSNP:768489723
3311 3311 -, ttaa dbSNP:755525886
3319 3319 a, g dbSNP:539807313
3322 3322 c, t dbSNP:150729932

Target ORF information:

RefSeq Version XM_006712984
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu36979
Accession Version XM_006712985.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2163bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product catenin beta-1 isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_022517.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)564..908(+)
Misc Feature(2)582..902(+)
Misc Feature(3)927..1286(+)
Misc Feature(4)999..1280(+)
Misc Feature(5)1290..1412(+)
Misc Feature(6)1437..1796(+)
Misc Feature(7)1494..1790(+)
Misc Feature(8)1692..2111(+)
Misc Feature(9)1764..2111(+)
Misc Feature(10)2007..>2246(+)
Misc Feature(11)2076..2225(+)
Position Chain Variation Link
5 5 a, g dbSNP:552360614
7 7 c, g dbSNP:773050988
9 9 g, t dbSNP:532530532
38 38 a, g dbSNP:537968404
55 55 c, t dbSNP:547954705
61 61 c, g dbSNP:369634833
77 77 g, t dbSNP:13067968
97 97 a, g dbSNP:533536760
100 100 a, g dbSNP:13067975
114 114 a, g dbSNP:554092246
125 125 c, g dbSNP:11564434
130 130 c, t dbSNP:577122224
160 160 a, g dbSNP:539701773
187 187 c, g dbSNP:11564435
198 198 a, g dbSNP:4135376
205 205 a, g dbSNP:755744390
207 207 a, g dbSNP:534465078
213 213 c, t dbSNP:751477759
231 231 a, c dbSNP:754869050
234 234 c, g dbSNP:5743390
250 250 a, c dbSNP:749331498
279 279 a, g dbSNP:121913394
282 282 a, g dbSNP:752642845
287 287 a, c dbSNP:587778221
301 301 c, t dbSNP:757325337
303 303 a, g dbSNP:121913395
306 306 -, gttagtcactggcagcaacagtcttacctggactctggaatccattct ggt dbSNP:121913416
307 307 c, g, t dbSNP:77064436
316 316 -, ggcagcaacagtcttacctggact dbSNP:121913417
323 323 a, g dbSNP:369714835
333 333 c, t dbSNP:758657130
336 336 a, c, g, t dbSNP:28931588
337 337 a, c, g, t dbSNP:121913396
340 340 a, c, g, t dbSNP:121913400
342 342 a, g dbSNP:121913399
343 343 a, g, t dbSNP:28931589
351 351 c, g, t dbSNP:121913228
352 352 a, c, g, t dbSNP:121913403
359 359 c, t dbSNP:747323395
363 363 a, c, g, t dbSNP:121913412
364 364 c, t dbSNP:121913413
367 367 c, t dbSNP:769203968
375 375 -, tct dbSNP:587776850
375 375 c, g, t dbSNP:121913407
376 376 a, c, g, t dbSNP:121913409
380 380 a, g dbSNP:777192093
392 392 c, t dbSNP:528528236
413 413 g, t dbSNP:769327358
415 415 a, g dbSNP:772550053
419 419 c, t dbSNP:762527964
427 427 -, tcc dbSNP:748083020
479 479 a, g dbSNP:113120762
486 486 a, g dbSNP:773781329
487 487 c, t dbSNP:748781625
496 496 a, c dbSNP:770494663
504 504 a, g dbSNP:773961563
512 512 a, c dbSNP:759232889
518 518 a, g dbSNP:767219370
525 525 a, c dbSNP:775104326
534 534 a, g dbSNP:760527240
552 552 a, g dbSNP:763882677
554 554 a, t dbSNP:753874922
559 559 g, t dbSNP:746139399
589 589 c, t dbSNP:770107882
611 611 c, g, t dbSNP:758551763
612 612 c, t dbSNP:751808983
613 613 a, g dbSNP:755204384
614 614 c, t dbSNP:781509994
623 623 a, c dbSNP:752945251
624 624 a, c, t dbSNP:202217100
636 636 c, t dbSNP:775491694
638 638 a, g dbSNP:778138109
659 659 a, g dbSNP:749833775
662 662 a, c, t dbSNP:3856746
694 694 a, g dbSNP:200968230
704 704 c, t dbSNP:774085540
710 710 c, g dbSNP:745411917
717 717 c, t dbSNP:771554085
725 725 c, t dbSNP:369510063
728 728 c, t dbSNP:5743392
743 743 a, g dbSNP:142472167
752 752 a, g dbSNP:760898512
759 759 a, g dbSNP:764327430
763 763 c, t dbSNP:754132704
773 773 a, g dbSNP:267599822
778 778 a, c dbSNP:77624106
781 781 a, g dbSNP:757629128
783 783 a, c dbSNP:765722646
794 794 c, t dbSNP:375776725
800 800 c, t dbSNP:373990577
808 808 c, t dbSNP:757818390
812 812 c, t dbSNP:779668005
825 825 a, c, g, t dbSNP:147382769
840 840 c, t dbSNP:139085081
847 847 c, t dbSNP:587778222
853 853 a, g dbSNP:780996852
854 854 c, t dbSNP:747895203
856 856 c, t dbSNP:769777389
860 860 c, t dbSNP:553121088
875 875 c, t dbSNP:148600849
876 876 c, t dbSNP:770795614
877 877 a, g dbSNP:200890083
884 884 c, g, t dbSNP:3856747
885 885 a, g dbSNP:369771822
886 886 c, t dbSNP:762164590
916 916 c, g dbSNP:144087793
920 920 a, g dbSNP:757499487
924 924 a, t dbSNP:755834449
947 947 -, a dbSNP:587777412
951 951 a, g dbSNP:758889881
960 960 c, g dbSNP:373574509
965 965 a, g dbSNP:483352717
975 975 a, g dbSNP:766827521
1019 1019 c, g dbSNP:768793451
1022 1022 c, t dbSNP:776805998
1061 1061 a, g dbSNP:530813397
1071 1071 a, g dbSNP:762074528
1082 1082 a, g dbSNP:13086686
1087 1087 c, t dbSNP:770030043
1094 1094 c, t dbSNP:773586998
1100 1100 c, t dbSNP:763232334
1101 1101 a, c dbSNP:766853534
1102 1102 a, g dbSNP:35288908
1132 1132 c, t dbSNP:759085197
1133 1133 a, g dbSNP:370662884
1148 1148 a, g dbSNP:375262741
1167 1167 c, g, t dbSNP:376393123
1173 1173 a, g dbSNP:755788748
1178 1178 a, g dbSNP:777291376
1195 1195 a, g dbSNP:752184222
1196 1196 a, t dbSNP:760272296
1212 1212 c, t dbSNP:554998963
1220 1220 c, t dbSNP:138154972
1221 1221 a, t dbSNP:753499163
1232 1232 c, g dbSNP:757047197
1241 1241 c, t dbSNP:778624338
1247 1247 a, g dbSNP:750241502
1258 1258 c, t dbSNP:758291562
1265 1265 c, t dbSNP:34343353
1280 1280 a, g dbSNP:367845313
1304 1304 a, g dbSNP:748172282
1306 1306 c, t dbSNP:769825609
1307 1307 a, g dbSNP:200709497
1311 1311 a, g dbSNP:575671885
1339 1339 c, t dbSNP:758207378
1355 1355 a, g dbSNP:754498236
1359 1359 c, t dbSNP:751567042
1385 1385 c, t dbSNP:756193831
1394 1394 c, t dbSNP:777662837
1397 1397 a, c, g dbSNP:74692094
1398 1398 a, c dbSNP:778731804
1415 1415 a, t dbSNP:779291769
1421 1421 c, t dbSNP:746221403
1430 1430 a, c dbSNP:751375496
1439 1439 a, g dbSNP:749010727
1446 1446 c, t dbSNP:767491256
1453 1453 c, t dbSNP:753799399
1470 1470 a, g dbSNP:757415518
1477 1477 a, t dbSNP:779273262
1487 1487 c, t dbSNP:746131235
1512 1512 a, c dbSNP:747887509
1514 1514 -, ttct dbSNP:398122907
1514 1514 c, t dbSNP:4135379
1523 1523 c, t dbSNP:780520120
1547 1547 a, g dbSNP:747432761
1551 1551 a, g dbSNP:768978318
1561 1561 a, g dbSNP:781731106
1575 1575 c, g dbSNP:747602570
1581 1581 c, t dbSNP:769363745
1584 1584 g, t dbSNP:772823421
1587 1587 c, t dbSNP:771596917
1592 1592 c, t dbSNP:543693510
1599 1599 c, t dbSNP:770598744
1625 1625 c, t dbSNP:774063140
1628 1628 a, g dbSNP:759385179
1634 1634 c, g dbSNP:141678313
1649 1649 a, t dbSNP:752745562
1658 1658 a, c dbSNP:761766557
1698 1698 c, t dbSNP:113411271
1699 1699 a, g dbSNP:750554859
1706 1706 c, t dbSNP:758655129
1708 1708 a, g dbSNP:780428505
1746 1746 c, t dbSNP:751814202
1758 1758 c, t dbSNP:3856748
1772 1772 c, t dbSNP:753045793
1785 1785 c, t dbSNP:397514554
1803 1803 c, t dbSNP:774271551
1805 1805 c, t dbSNP:370135014
1806 1806 a, g dbSNP:764576683
1810 1810 a, g dbSNP:754382114
1824 1824 c, t dbSNP:756737848
1839 1839 a, g dbSNP:587778220
1850 1850 a, g dbSNP:778435107
1867 1867 a, g dbSNP:551257843
1881 1881 a, t dbSNP:758002835
1891 1891 a, g dbSNP:779588249
1895 1895 a, g, t dbSNP:138539284
1899 1899 a, g dbSNP:199593411
1902 1902 g, t dbSNP:748148797
1906 1906 a, g dbSNP:186068630
1919 1919 a, g dbSNP:550622727
1930 1930 a, g dbSNP:745951696
1933 1933 c, t dbSNP:772081115
1935 1935 c, t dbSNP:775666001
1936 1936 a, g dbSNP:760837728
1958 1958 c, t dbSNP:768895650
1964 1964 c, t dbSNP:566776791
1984 1984 c, t dbSNP:762099762
1995 1995 c, g dbSNP:765762800
1997 1997 c, t dbSNP:750959414
1998 1998 a, g dbSNP:763836725
2002 2002 c, g dbSNP:762495207
2023 2023 a, g dbSNP:766038845
2027 2027 c, t dbSNP:587780325
2028 2028 a, g dbSNP:751139724
2034 2034 c, t dbSNP:754641056
2056 2056 c, t dbSNP:759171472
2063 2063 a, t dbSNP:767272142
2067 2067 a, g dbSNP:752328115
2072 2072 c, t dbSNP:374923885
2075 2075 a, g dbSNP:763747166
2090 2090 c, g dbSNP:753698017
2096 2096 c, t dbSNP:757118051
2130 2130 g, t dbSNP:778834508
2169 2169 c, t dbSNP:141493100
2174 2174 -, ca dbSNP:762256023
2179 2179 c, g dbSNP:755119590
2185 2185 a, g dbSNP:755534201
2204 2204 c, t dbSNP:750402920
2214 2214 g, t dbSNP:755029715
2217 2217 c, t dbSNP:781086938
2223 2223 a, c dbSNP:748294403
2224 2224 -, a dbSNP:35523547
2225 2225 a, c dbSNP:1800663
2226 2226 a, t dbSNP:778073244
2228 2228 g, t dbSNP:749661798
2230 2230 a, c, g, t dbSNP:771458640
2231 2231 a, g, t dbSNP:772736620
2232 2232 g, t dbSNP:760245475
2233 2233 a, g dbSNP:763639110
2234 2234 a, g dbSNP:776411653
2235 2235 a, c, g, t dbSNP:761565235
2237 2237 a, c, t dbSNP:77750814
2240 2240 a, g dbSNP:752665424
2241 2241 c, t dbSNP:756281365
2243 2243 a, g dbSNP:374853593
2245 2245 a, g dbSNP:754160678
2252 2252 c, t dbSNP:757572488
2267 2267 a, g dbSNP:201061014
2276 2276 c, g dbSNP:746237763
2284 2284 c, t dbSNP:772401455
2288 2288 c, g dbSNP:780668438
2300 2300 a, g dbSNP:746497207
2304 2304 c, t dbSNP:4135384
2327 2327 -, a dbSNP:34854135
2373 2373 a, g dbSNP:4135389
2405 2405 -, ac dbSNP:143836144
2465 2465 -, t dbSNP:571568960
2480 2480 a, g dbSNP:371800780
2482 2482 a, g dbSNP:770023254
2492 2492 a, g dbSNP:375050845
2556 2556 g, t dbSNP:2953
2577 2577 -, a dbSNP:150512515
2578 2578 -, a dbSNP:768597179
2578 2578 -, a dbSNP:775453764
2580 2580 a, t dbSNP:397843698
2580 2580 -, t dbSNP:34653633
2581 2581 -, t dbSNP:570037233
2581 2581 a, t dbSNP:4135387
2599 2599 -, t dbSNP:397989315
2645 2645 c, t dbSNP:201175238
2687 2687 a, g dbSNP:564295817
2696 2696 a, g dbSNP:549926618
2709 2709 a, g dbSNP:549906289
2734 2734 -, taat dbSNP:772921930
2745 2745 a, g dbSNP:11708064
2768 2768 -, taa, taat dbSNP:16339
2769 2769 -, aatt, taat dbSNP:71623294
2772 2772 -, taat dbSNP:3834205
2774 2774 a, c dbSNP:202194019
2785 2785 -, taat dbSNP:72273140
2796 2796 -, atc dbSNP:772744702
2854 2854 a, g dbSNP:145906085
2858 2858 c, t dbSNP:1798792
2898 2898 g, t dbSNP:1722851
2906 2906 g, t dbSNP:148378295
2912 2912 g, t dbSNP:757981542
2963 2963 a, g dbSNP:1058355
3015 3015 c, t dbSNP:535458683
3041 3041 c, t dbSNP:116035162
3042 3042 c, g dbSNP:141130241
3051 3051 a, g dbSNP:535312947
3053 3053 a, c dbSNP:779688474
3062 3062 a, g dbSNP:768489723
3091 3091 -, ttaa dbSNP:755525886
3099 3099 a, g dbSNP:539807313
3102 3102 c, t dbSNP:150729932

Target ORF information:

RefSeq Version XM_006712985
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant X4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu17197
Accession Version NM_001904.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2346bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product catenin beta-1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DA216720.1, X87838.1 and AC104307.2. This sequence is a reference standard in the RefSeqGene project. On May 23, 2007 this sequence version replaced gi:40254459. Summary: The protein encoded by this gene is part of a complex of proteins that constitute adherens junctions (AJs). AJs are necessary for the creation and maintenance of epithelial cell layers by regulating cell growth and adhesion between cells. The encoded protein also anchors the actin cytoskeleton and may be responsible for transmitting the contact inhibition signal that causes cells to stop dividing once the epithelial sheet is complete. Finally, this protein binds to the product of the APC gene, which is mutated in adenomatous polyposis of the colon. Mutations in this gene are a cause of colorectal cancer (CRC), pilomatrixoma (PTR), medulloblastoma (MDB), and ovarian cancer. Three transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Oct 2009]. Transcript Variant: This variant (1) represents the longest transcript. All three variants encode the same protein. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC058926.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)227..229(+)
Misc Feature(2)272..337(+)
Misc Feature(3)272..274(+)
Misc Feature(4)335..337(+)
Misc Feature(5)353..355(+)
Misc Feature(6)353..355(+)
Misc Feature(7)353..355(+)
Misc Feature(8)365..367(+)
Misc Feature(9)365..367(+)
Misc Feature(10)377..379(+)
Misc Feature(11)377..379(+)
Misc Feature(12)389..391(+)
Misc Feature(13)389..391(+)
Misc Feature(14)401..403(+)
Misc Feature(15)401..403(+)
Misc Feature(16)401..403(+)
Misc Feature(17)401..403(+)
Misc Feature(18)413..415(+)
Misc Feature(19)458..460(+)
Misc Feature(20)524..526(+)
Misc Feature(21)524..526(+)
Misc Feature(22)572..574(+)
Misc Feature(23)572..574(+)
Misc Feature(24)590..934(+)
Misc Feature(25)602..604(+)
Misc Feature(26)602..604(+)
Misc Feature(27)608..928(+)
Misc Feature(28)692..694(+)
Misc Feature(29)692..694(+)
Misc Feature(30)692..694(+)
Misc Feature(31)719..841(+)
Misc Feature(32)734..802(+)
Misc Feature(33)839..841(+)
Misc Feature(34)845..970(+)
Misc Feature(35)953..1312(+)
Misc Feature(36)971..1096(+)
Misc Feature(37)1004..1006(+)
Misc Feature(38)1025..1306(+)
Misc Feature(39)1097..1222(+)
Misc Feature(40)1223..1348(+)
Misc Feature(41)1259..1261(+)
Misc Feature(42)1316..1438(+)
Misc Feature(43)1349..1435(+)
Misc Feature(44)1445..1447(+)
Misc Feature(45)1463..1822(+)
Misc Feature(46)1466..1591(+)
Misc Feature(47)1520..1816(+)
Misc Feature(48)1592..1720(+)
Misc Feature(49)1718..2137(+)
Misc Feature(50)1733..1858(+)
Misc Feature(51)1790..2137(+)
Misc Feature(52)1859..1981(+)
Misc Feature(53)1919..1921(+)
Misc Feature(54)1922..1924(+)
Misc Feature(55)1922..1924(+)
Misc Feature(56)1934..1936(+)
Misc Feature(57)2033..>2272(+)
Misc Feature(58)2048..2176(+)
Misc Feature(59)2102..2251(+)
Misc Feature(60)2177..2266(+)
Misc Feature(61)2228..2230(+)
Misc Feature(62)2228..2230(+)
Misc Feature(63)2291..2293(+)
Misc Feature(64)2291..2293(+)
Misc Feature(65)2582..2611(+)
Exon (1)1..220
Gene Synonym:
Exon (2)221..281
Gene Synonym:
Exon (3)282..509
Gene Synonym:
Exon (4)510..763
Gene Synonym:
Exon (5)764..1002
Gene Synonym:
Exon (6)1003..1204
Gene Synonym:
Exon (7)1205..1349
Gene Synonym:
Exon (8)1350..1453
Gene Synonym:
Exon (9)1454..1792
Gene Synonym:
Exon (10)1793..1951
Gene Synonym:
Exon (11)1952..2071
Gene Synonym:
Exon (12)2072..2222
Gene Synonym:
Exon (13)2223..2344
Gene Synonym:
Exon (14)2345..2405
Gene Synonym:
Exon (15)2406..3720
Gene Synonym:
Position Chain Variation Link
31 31 a, g dbSNP:552360614
33 33 c, g dbSNP:773050988
35 35 g, t dbSNP:532530532
64 64 a, g dbSNP:537968404
81 81 c, t dbSNP:547954705
87 87 c, g dbSNP:369634833
103 103 g, t dbSNP:13067968
123 123 a, g dbSNP:533536760
126 126 a, g dbSNP:13067975
140 140 a, g dbSNP:554092246
151 151 c, g dbSNP:11564434
156 156 c, t dbSNP:577122224
186 186 a, g dbSNP:539701773
213 213 c, g dbSNP:11564435
224 224 a, g dbSNP:4135376
231 231 a, g dbSNP:755744390
233 233 a, g dbSNP:534465078
239 239 c, t dbSNP:751477759
257 257 a, c dbSNP:754869050
260 260 c, g dbSNP:5743390
276 276 a, c dbSNP:749331498
305 305 a, g dbSNP:121913394
308 308 a, g dbSNP:752642845
313 313 a, c dbSNP:587778221
327 327 c, t dbSNP:757325337
329 329 a, g dbSNP:121913395
332 332 -, gttagtcactggcagcaacagtcttacctggactctggaatccattct ggt dbSNP:121913416
333 333 c, g, t dbSNP:77064436
342 342 -, ggcagcaacagtcttacctggact dbSNP:121913417
349 349 a, g dbSNP:369714835
359 359 c, t dbSNP:758657130
362 362 a, c, g, t dbSNP:28931588
363 363 a, c, g, t dbSNP:121913396
366 366 a, c, g, t dbSNP:121913400
368 368 a, g dbSNP:121913399
369 369 a, g, t dbSNP:28931589
377 377 c, g, t dbSNP:121913228
378 378 a, c, g, t dbSNP:121913403
385 385 c, t dbSNP:747323395
389 389 a, c, g, t dbSNP:121913412
390 390 c, t dbSNP:121913413
393 393 c, t dbSNP:769203968
401 401 -, tct dbSNP:587776850
401 401 c, g, t dbSNP:121913407
402 402 a, c, g, t dbSNP:121913409
406 406 a, g dbSNP:777192093
418 418 c, t dbSNP:528528236
439 439 g, t dbSNP:769327358
441 441 a, g dbSNP:772550053
445 445 c, t dbSNP:762527964
453 453 -, tcc dbSNP:748083020
505 505 a, g dbSNP:113120762
512 512 a, g dbSNP:773781329
513 513 c, t dbSNP:748781625
522 522 a, c dbSNP:770494663
530 530 a, g dbSNP:773961563
538 538 a, c dbSNP:759232889
544 544 a, g dbSNP:767219370
551 551 a, c dbSNP:775104326
560 560 a, g dbSNP:760527240
578 578 a, g dbSNP:763882677
580 580 a, t dbSNP:753874922
585 585 g, t dbSNP:746139399
615 615 c, t dbSNP:770107882
637 637 c, g, t dbSNP:758551763
638 638 c, t dbSNP:751808983
639 639 a, g dbSNP:755204384
640 640 c, t dbSNP:781509994
649 649 a, c dbSNP:752945251
650 650 a, c, t dbSNP:202217100
662 662 c, t dbSNP:775491694
664 664 a, g dbSNP:778138109
685 685 a, g dbSNP:749833775
688 688 a, c, t dbSNP:3856746
720 720 a, g dbSNP:200968230
730 730 c, t dbSNP:774085540
736 736 c, g dbSNP:745411917
743 743 c, t dbSNP:771554085
751 751 c, t dbSNP:369510063
754 754 c, t dbSNP:5743392
769 769 a, g dbSNP:142472167
778 778 a, g dbSNP:760898512
785 785 a, g dbSNP:764327430
789 789 c, t dbSNP:754132704
799 799 a, g dbSNP:267599822
804 804 a, c dbSNP:77624106
807 807 a, g dbSNP:757629128
809 809 a, c dbSNP:765722646
820 820 c, t dbSNP:375776725
826 826 c, t dbSNP:373990577
834 834 c, t dbSNP:757818390
838 838 c, t dbSNP:779668005
851 851 a, c, g, t dbSNP:147382769
866 866 c, t dbSNP:139085081
873 873 c, t dbSNP:587778222
879 879 a, g dbSNP:780996852
880 880 c, t dbSNP:747895203
882 882 c, t dbSNP:769777389
886 886 c, t dbSNP:553121088
901 901 c, t dbSNP:148600849
902 902 c, t dbSNP:770795614
903 903 a, g dbSNP:200890083
910 910 c, g, t dbSNP:3856747
911 911 a, g dbSNP:369771822
912 912 c, t dbSNP:762164590
942 942 c, g dbSNP:144087793
946 946 a, g dbSNP:757499487
950 950 a, t dbSNP:755834449
973 973 -, a dbSNP:587777412
977 977 a, g dbSNP:758889881
986 986 c, g dbSNP:373574509
991 991 a, g dbSNP:483352717
1001 1001 a, g dbSNP:766827521
1045 1045 c, g dbSNP:768793451
1048 1048 c, t dbSNP:776805998
1087 1087 a, g dbSNP:530813397
1097 1097 a, g dbSNP:762074528
1108 1108 a, g dbSNP:13086686
1113 1113 c, t dbSNP:770030043
1120 1120 c, t dbSNP:773586998
1126 1126 c, t dbSNP:763232334
1127 1127 a, c dbSNP:766853534
1128 1128 a, g dbSNP:35288908
1158 1158 c, t dbSNP:759085197
1159 1159 a, g dbSNP:370662884
1174 1174 a, g dbSNP:375262741
1193 1193 c, g, t dbSNP:376393123
1199 1199 a, g dbSNP:755788748
1204 1204 a, g dbSNP:777291376
1221 1221 a, g dbSNP:752184222
1222 1222 a, t dbSNP:760272296
1238 1238 c, t dbSNP:554998963
1246 1246 c, t dbSNP:138154972
1247 1247 a, t dbSNP:753499163
1258 1258 c, g dbSNP:757047197
1267 1267 c, t dbSNP:778624338
1273 1273 a, g dbSNP:750241502
1284 1284 c, t dbSNP:758291562
1291 1291 c, t dbSNP:34343353
1306 1306 a, g dbSNP:367845313
1330 1330 a, g dbSNP:748172282
1332 1332 c, t dbSNP:769825609
1333 1333 a, g dbSNP:200709497
1337 1337 a, g dbSNP:575671885
1365 1365 c, t dbSNP:758207378
1381 1381 a, g dbSNP:754498236
1385 1385 c, t dbSNP:751567042
1411 1411 c, t dbSNP:756193831
1420 1420 c, t dbSNP:777662837
1423 1423 a, c, g dbSNP:74692094
1424 1424 a, c dbSNP:778731804
1441 1441 a, t dbSNP:779291769
1447 1447 c, t dbSNP:746221403
1456 1456 a, c dbSNP:751375496
1465 1465 a, g dbSNP:749010727
1472 1472 c, t dbSNP:767491256
1479 1479 c, t dbSNP:753799399
1496 1496 a, g dbSNP:757415518
1503 1503 a, t dbSNP:779273262
1513 1513 c, t dbSNP:746131235
1538 1538 a, c dbSNP:747887509
1540 1540 -, ttct dbSNP:398122907
1540 1540 c, t dbSNP:4135379
1549 1549 c, t dbSNP:780520120
1573 1573 a, g dbSNP:747432761
1577 1577 a, g dbSNP:768978318
1587 1587 a, g dbSNP:781731106
1601 1601 c, g dbSNP:747602570
1607 1607 c, t dbSNP:769363745
1610 1610 g, t dbSNP:772823421
1613 1613 c, t dbSNP:771596917
1618 1618 c, t dbSNP:543693510
1625 1625 c, t dbSNP:770598744
1651 1651 c, t dbSNP:774063140
1654 1654 a, g dbSNP:759385179
1660 1660 c, g dbSNP:141678313
1675 1675 a, t dbSNP:752745562
1684 1684 a, c dbSNP:761766557
1724 1724 c, t dbSNP:113411271
1725 1725 a, g