Email to GenScript

MMAA methylmalonic aciduria (cobalamin deficiency) cblA type [Homo sapiens (human)]

Gene Symbol MMAA
Entrez Gene ID 166785
Full Name methylmalonic aciduria (cobalamin deficiency) cblA type
Synonyms cblA
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is involved in the translocation of cobalamin into the mitochondrion, where it is used in the final steps of adenosylcobalamin synthesis. Adenosylcobalamin is a coenzyme required for the activity of methylmalonyl-CoA mutase. Defects in this gene are a cause of methylmalonic aciduria. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Methylmalonic aciduria, vitamin B12-responsive, 251100 (3)

The following MMAA gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the MMAA gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu26306 NM_172250 Homo sapiens methylmalonic aciduria (cobalamin deficiency) cblA type (MMAA), mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $379
OHu26306 XM_011531684 PREDICTED: Homo sapiens methylmalonic aciduria (cobalamin deficiency) cblA type (MMAA), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $319
OHu26306 XM_011531685 PREDICTED: Homo sapiens methylmalonic aciduria (cobalamin deficiency) cblA type (MMAA), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $319
OHu77338 XM_011531686 PREDICTED: Homo sapiens methylmalonic aciduria (cobalamin deficiency) cblA type (MMAA), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $199

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu26306
Accession Version NM_172250.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1257bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 04-AUG-2015
Organism Homo sapiens (human)
Product methylmalonic aciduria type A protein, mitochondrial precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK126662.1 and AC093864.3. This sequence is a reference standard in the RefSeqGene project. On Apr 2, 2008 this sequence version replaced gi:26892294. Summary: The protein encoded by this gene is involved in the translocation of cobalamin into the mitochondrion, where it is used in the final steps of adenosylcobalamin synthesis. Adenosylcobalamin is a coenzyme required for the activity of methylmalonyl-CoA mutase. Defects in this gene are a cause of methylmalonic aciduria. [provided by RefSeq, Jul 2008]. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK126662.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1968540 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## gene product(s) localized to mito. :: inferred from homology ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)38..40(+)
Misc Feature(2)341..1330(+)
Misc Feature(3)518..961(+)
Misc Feature(4)533..559(+)
Exon (1)1..20
Gene Synonym:
Exon (2)21..524
Gene Synonym:
Exon (3)525..647
Gene Synonym:
Exon (4)648..818
Gene Synonym:
Exon (5)819..904
Gene Synonym:
Exon (6)905..1054
Gene Synonym:
Exon (7)1055..5943
Gene Synonym:
Position Chain Variation Link
26 26 a, t dbSNP:751609803
30 30 a, g dbSNP:4835011
37 37 c, t dbSNP:749162902
41 41 a, g, t dbSNP:376276423
48 48 c, g, t dbSNP:758937804
49 49 a, g dbSNP:774967096
51 51 a, t dbSNP:150259804
57 57 c, t dbSNP:373547595
72 72 c, g, t dbSNP:138947726
77 77 a, g dbSNP:765634183
81 81 c, g dbSNP:750568846
82 82 a, g dbSNP:374109118
83 83 a, c dbSNP:766651356
92 92 a, g dbSNP:527340737
100 100 a, g dbSNP:755914586
105 105 a, g dbSNP:777599101
117 117 a, g dbSNP:749076210
118 118 c, t dbSNP:370983676
119 119 g, t dbSNP:757224297
122 122 c, g dbSNP:778693852
129 129 a, g dbSNP:371810384
130 130 a, c dbSNP:771417006
135 135 c, t dbSNP:775224246
138 138 a, g dbSNP:746718277
142 142 a, c, g dbSNP:143211378
143 143 c, g dbSNP:762251343
149 149 c, t dbSNP:765799472
150 150 a, g, t dbSNP:375682603
153 153 a, g dbSNP:370709347
161 161 c, t dbSNP:766309050
162 162 -, c dbSNP:762276953
164 164 a, c, g dbSNP:756348773
171 171 a, g, t dbSNP:367809749
172 172 -, c dbSNP:765782136
177 177 a, g dbSNP:142126209
187 187 c, t dbSNP:146372922
197 197 a, g dbSNP:139395700
201 201 a, c dbSNP:150065810
203 203 c, t dbSNP:745735153
209 209 c, g dbSNP:758345818
214 214 a, g dbSNP:779779664
217 217 a, t dbSNP:746489522
222 222 a, c dbSNP:543412068
223 223 c, t dbSNP:34702224
232 232 -, t dbSNP:750771861
236 236 c, t dbSNP:748557981
237 237 a, g dbSNP:769983308
238 238 g, t dbSNP:773779122
250 250 g, t dbSNP:763425453
260 260 c, g dbSNP:371779800
272 272 a, g dbSNP:774453661
277 277 -, att dbSNP:758827870
284 284 g, t dbSNP:759588632
287 287 c, t dbSNP:754894257
294 294 c, t dbSNP:767748129
320 320 c, t dbSNP:752876551
327 327 a, c, g dbSNP:532407633
331 331 a, g dbSNP:750230122
339 339 c, t dbSNP:372082521
345 345 a, g dbSNP:375210272
354 354 a, t dbSNP:148404005
368 368 c, t dbSNP:104893846
373 373 a, g, t dbSNP:559279147
379 379 -, ggcctgtttagcaga dbSNP:780082584
379 379 a, g dbSNP:747694093
403 403 g, t dbSNP:769472387
405 405 c, t dbSNP:201224725
416 416 a, g, t dbSNP:778062592
421 421 c, t dbSNP:771388415
427 427 c, g dbSNP:774790573
431 431 a, c dbSNP:759642126
432 432 a, g dbSNP:772082690
439 439 a, g dbSNP:369424796
445 445 a, g dbSNP:112975623
450 450 c, t dbSNP:760875006
460 460 a, g dbSNP:184069367
463 463 a, g dbSNP:750237065
467 467 c, t dbSNP:762763078
468 468 g, t dbSNP:560188002
475 475 c, t dbSNP:766454656
478 478 a, t dbSNP:371714495
482 482 c, t dbSNP:754545360
485 485 c, g dbSNP:369113922
493 493 -, a dbSNP:751832194
496 496 a, t dbSNP:752244799
518 518 c, t dbSNP:104893851
519 519 a, g dbSNP:200577967
521 521 a, g dbSNP:530814186
532 532 -, g dbSNP:754973022
542 542 a, g dbSNP:147586746
558 558 c, t dbSNP:755600003
568 568 a, c dbSNP:374352921
573 573 c, t dbSNP:753463116
575 575 -, g dbSNP:781301826
579 579 a, g dbSNP:199809221
583 583 a, g dbSNP:186933110
585 585 c, t dbSNP:34474021
588 588 c, t dbSNP:745549667
597 597 c, g dbSNP:755659791
599 599 c, t dbSNP:191727024
601 601 c, t dbSNP:780564235
627 627 -, ctt dbSNP:748291856
643 643 a, t dbSNP:201998029
670 670 c, t dbSNP:571797666
672 672 a, g dbSNP:144389160
675 675 -, tgac dbSNP:779859711
677 677 a, g dbSNP:781395862
682 682 a, g dbSNP:116773849
695 695 a, g dbSNP:370375675
705 705 a, g dbSNP:104893849
707 707 a, c dbSNP:773516780
712 712 a, g dbSNP:745687257
714 714 c, t dbSNP:771832448
715 715 a, g dbSNP:374347679
717 717 c, t dbSNP:760732816
731 731 a, c dbSNP:768447137
732 732 c, g dbSNP:776168690
735 735 c, t dbSNP:140356252
743 743 a, g dbSNP:150376474
758 758 a, g dbSNP:750014244
759 759 a, g, t dbSNP:763324433
780 780 a, g dbSNP:751861917
786 786 c, t dbSNP:367609164
787 787 g, t dbSNP:781525637
803 803 c, t dbSNP:752844506
806 806 a, g dbSNP:756221585
807 807 c, t dbSNP:371068331
814 814 c, t dbSNP:138111772
815 815 a, g dbSNP:771044996
827 827 c, t dbSNP:757548934
829 829 g, t dbSNP:778955528
831 831 c, t dbSNP:746853773
832 832 a, g dbSNP:11721553
841 841 c, t dbSNP:781124654
842 842 a, g dbSNP:748145761
845 845 a, g dbSNP:769722136
846 846 c, t dbSNP:145018955
852 852 c, t dbSNP:748721023
860 860 a, c dbSNP:770636513
871 871 a, g dbSNP:773833728
872 872 c, t dbSNP:759947234
880 880 a, c dbSNP:767934772
885 885 c, t dbSNP:138854691
887 887 a, g dbSNP:761331762
888 888 g, t dbSNP:764675342
890 890 a, g dbSNP:536601590
893 893 c, g dbSNP:757242348
908 908 a, g dbSNP:764728312
910 910 -, a dbSNP:774958165
915 915 a, g dbSNP:200254160
918 918 a, g dbSNP:761964238
919 919 -, ta dbSNP:760236568
921 921 c, t dbSNP:371624542
923 923 a, g dbSNP:765287661
925 925 c, t dbSNP:750509072
935 935 c, g dbSNP:758654806
943 943 a, g dbSNP:142063642
957 957 a, c dbSNP:752514914
964 964 a, g dbSNP:146352309
969 969 c, t dbSNP:777773616
981 981 c, g dbSNP:749124431
984 984 a, g dbSNP:757207009
988 988 a, g dbSNP:778354704
989 989 a, t dbSNP:369128670
996 996 c, t dbSNP:771873633
997 997 a, g dbSNP:371769807
1003 1003 c, t dbSNP:368766697
1012 1012 a, t dbSNP:769082931
1025 1025 c, g, t dbSNP:374795215
1026 1026 a, g dbSNP:148142853
1027 1027 a, c dbSNP:773218154
1031 1031 c, t dbSNP:141974563
1032 1032 a, g dbSNP:377228966
1037 1037 c, g dbSNP:751717131
1049 1049 c, g dbSNP:765080486
1051 1051 a, g dbSNP:150692463
1062 1062 a, g dbSNP:201547892
1071 1071 c, t dbSNP:753626196
1073 1073 c, t dbSNP:571038432
1074 1074 a, g dbSNP:140031911
1079 1079 a, g dbSNP:533334741
1080 1080 g, t dbSNP:750327703
1085 1085 a, g dbSNP:758394680
1088 1088 a, t dbSNP:199749473
1119 1119 -, t dbSNP:398124552
1123 1123 a, g dbSNP:751080456
1129 1129 a, g dbSNP:754630744
1137 1137 c, g dbSNP:780852556
1139 1139 a, g dbSNP:748496016
1140 1140 a, c, g dbSNP:756437003
1142 1142 a, g dbSNP:145012972
1144 1144 a, g dbSNP:552250080
1148 1148 c, g dbSNP:774455707
1157 1157 a, c dbSNP:745926548
1163 1163 c, t dbSNP:6812252
1164 1164 a, g dbSNP:147148157
1165 1165 g, t dbSNP:761525438
1168 1168 a, g dbSNP:565742386
1174 1174 c, g dbSNP:2270655
1175 1175 a, t dbSNP:763021619
1177 1177 a, g dbSNP:766393243
1181 1181 g, t dbSNP:751133516
1184 1184 a, g dbSNP:754474832
1193 1193 c, t dbSNP:767085014
1199 1199 -, c dbSNP:765726949
1200 1200 a, g dbSNP:752340522
1201 1201 a, g dbSNP:755710950
1206 1206 a, g dbSNP:778178659
1209 1209 c, t dbSNP:749624035
1212 1212 c, t dbSNP:757810882
1215 1215 a, t dbSNP:554604284
1218 1218 a, t dbSNP:745939340
1241 1241 c, t dbSNP:374622922
1242 1242 a, c, g dbSNP:191643294
1253 1253 c, t dbSNP:267600029
1260 1260 c, t dbSNP:768964804
1261 1261 a, g dbSNP:368671164
1262 1262 a, g dbSNP:144313458
1271 1271 c, g dbSNP:766454544
1278 1278 c, t dbSNP:777459994
1305 1305 c, t dbSNP:145539291
1306 1306 a, g dbSNP:767115507
1321 1321 a, g dbSNP:184111056
1333 1333 c, t dbSNP:760417305
1335 1335 c, g dbSNP:763715364
1350 1350 c, t dbSNP:754224809
1358 1358 a, g dbSNP:576991940
1368 1368 c, t dbSNP:779405529
1371 1371 a, g dbSNP:750994850
1375 1375 a, c dbSNP:758825838
1383 1383 -, aag dbSNP:773712230
1383 1383 a, g dbSNP:780219088
1388 1388 a, g dbSNP:747034747
1390 1390 c, t dbSNP:374937807
1395 1395 a, t dbSNP:781521709
1410 1410 c, t dbSNP:545633228
1439 1439 c, g dbSNP:148424051
1441 1441 c, t dbSNP:746687923
1470 1470 a, g dbSNP:756792587
1477 1477 a, g dbSNP:780496991
1494 1494 a, g dbSNP:749564150
1519 1519 a, g dbSNP:572996882
1534 1534 a, g dbSNP:188845060
1648 1648 a, t dbSNP:74409983
1682 1682 c, t dbSNP:530774368
1722 1722 c, t dbSNP:376383308
1745 1745 c, g dbSNP:536872965
1776 1776 c, t dbSNP:72950841
1883 1883 a, g dbSNP:114729477
1912 1912 a, g dbSNP:533580327
1922 1922 c, t dbSNP:181600698
1934 1934 a, g dbSNP:565828392
1942 1942 a, g dbSNP:112882351
1949 1949 a, g dbSNP:773103545
2001 2001 c, g dbSNP:749692437
2016 2016 c, t dbSNP:374413811
2045 2045 c, t dbSNP:548243828
2074 2074 c, t dbSNP:142549499
2137 2137 c, t dbSNP:536614923
2139 2139 c, g dbSNP:78856150
2146 2146 a, t dbSNP:185541614
2153 2153 c, t dbSNP:570614939
2179 2179 a, g dbSNP:539664731
2201 2201 a, g dbSNP:760991571
2205 2205 a, g dbSNP:555681986
2232 2232 a, g dbSNP:771012374
2240 2240 c, t dbSNP:552726676
2243 2243 c, t dbSNP:768720995
2265 2265 g, t dbSNP:540215076
2282 2282 a, g dbSNP:562734754
2283 2283 c, t dbSNP:111385622
2295 2295 a, c dbSNP:535567216
2331 2331 a, g dbSNP:147593159
2449 2449 -, g dbSNP:555018325
2456 2456 -, tacaactacatctacaactacaaacctgatgacca dbSNP:562586213
2457 2457 a, g dbSNP:575595640
2458 2458 g, t dbSNP:574804780
2463 2463 c, g dbSNP:774637500
2479 2479 a, g dbSNP:544237745
2522 2522 c, t dbSNP:200764256
2552 2552 g, t dbSNP:190416172
2569 2569 a, t dbSNP:375194713
2574 2574 a, g dbSNP:573591323
2588 2588 -, tg dbSNP:761741912
2620 2620 a, c dbSNP:759292618
2626 2626 a, g dbSNP:564976817
2630 2630 a, t dbSNP:182596446
2649 2649 a, g dbSNP:752613281
2747 2747 a, g dbSNP:111561610
2767 2767 c, t dbSNP:529476650
2794 2794 a, g dbSNP:548327835
2801 2801 a, g dbSNP:772249563
2810 2810 a, g dbSNP:561582557
2813 2813 a, g dbSNP:576920922
2816 2816 c, t dbSNP:544249620
2819 2819 c, t dbSNP:776544317
2926 2926 a, g dbSNP:530538534
2952 2952 c, t dbSNP:185925141
3043 3043 a, c dbSNP:756955007
3071 3071 a, t dbSNP:780680164
3124 3124 a, g dbSNP:114134771
3159 3159 c, t dbSNP:539331555
3210 3210 a, g dbSNP:546453862
3237 3237 -, ttctg dbSNP:377206435
3244 3244 a, t dbSNP:566349317
3260 3260 a, g dbSNP:755382235
3285 3285 -, t dbSNP:150630369
3294 3294 c, t dbSNP:79927727
3298 3298 c, t dbSNP:555448380
3308 3308 c, t dbSNP:147742767
3320 3320 c, t dbSNP:189992747
3330 3330 a, t dbSNP:141116337
3331 3331 c, t dbSNP:528427721
3418 3418 a, t dbSNP:181194454
3423 3423 a, g dbSNP:150239306
3481 3481 a, g dbSNP:772671304
3484 3484 c, t dbSNP:72723824
3544 3544 a, g dbSNP:763600036
3550 3550 c, g, t dbSNP:138876977
3558 3558 a, g dbSNP:532931521
3607 3607 a, t dbSNP:543204236
3637 3637 a, c dbSNP:561863636
3667 3667 c, t dbSNP:530499633
3670 3670 a, c dbSNP:751286054
3691 3691 a, g dbSNP:747040589
3706 3706 a, g dbSNP:13129907
3714 3714 a, t dbSNP:74719174
3722 3722 a, t dbSNP:759380432
3743 3743 a, g dbSNP:532736675
3802 3802 c, g dbSNP:546490347
3812 3812 a, g dbSNP:185788250
3882 3882 a, g dbSNP:566386419
3904 3904 c, t dbSNP:529092235
3915 3915 a, g dbSNP:775199322
3917 3917 c, g dbSNP:762908276
3926 3926 c, g dbSNP:763886975
3928 3928 a, g dbSNP:548904365
3947 3947 g, t dbSNP:569363374
3950 3950 c, t dbSNP:7699187
3960 3960 -, ctca dbSNP:764845583
3961 3961 -, ctca dbSNP:111858031
3963 3963 c, g dbSNP:558200462
3964 3964 -, actc dbSNP:60186480
3987 3987 c, t dbSNP:568954220
3995 3995 a, g dbSNP:761226923
4000 4000 a, g dbSNP:72723825
4030 4030 a, t dbSNP:750115092
4059 4059 g, t dbSNP:190507341
4110 4110 a, t dbSNP:7699166
4149 4149 c, t dbSNP:7675466
4150 4150 a, g dbSNP:543019315
4157 4157 c, t dbSNP:779456225
4180 4180 c, t dbSNP:143687604
4208 4208 a, g dbSNP:17020500
4225 4225 g, t dbSNP:758996405
4246 4246 a, g dbSNP:755382846
4316 4316 -, atatg dbSNP:534264968
4377 4377 a, c dbSNP:576544645
4378 4378 c, t dbSNP:747177286
4389 4389 a, c dbSNP:757267017
4397 4397 c, t dbSNP:781271928
4447 4447 c, g dbSNP:183480840
4461 4461 a, c dbSNP:71614553
4478 4478 c, t dbSNP:746091108
4488 4488 c, t dbSNP:769964379
4493 4493 a, g dbSNP:775285481
4523 4523 a, g dbSNP:564158904
4546 4546 a, g dbSNP:188863865
4596 4596 a, c dbSNP:539831571
4600 4600 -, a dbSNP:33978754
4601 4601 a, c dbSNP:79354747
4613 4613 -, aaaa dbSNP:77756937
4616 4616 -, a dbSNP:397709371
4627 4627 a, g dbSNP:142885287
4667 4667 c, t dbSNP:529131828
4694 4694 -, a dbSNP:577478683
4724 4724 a, c dbSNP:768708007
4758 4758 a, g dbSNP:549196684
4781 4781 c, t dbSNP:376064234
4812 4812 a, g dbSNP:191952260
4832 4832 c, t dbSNP:551269233
4868 4868 c, t dbSNP:748468312
4872 4872 c, t dbSNP:568976783
4907 4907 c, t dbSNP:774144431
4960 4960 a, g dbSNP:761753724
4961 4961 a, g dbSNP:766941842
4963 4963 a, g dbSNP:55770806
5045 5045 c, t dbSNP:760429837
5055 5055 a, t dbSNP:544223307
5057 5057 c, t dbSNP:184209912
5089 5089 a, t dbSNP:773326191
5166 5166 a, c dbSNP:72950842
5169 5169 c, t dbSNP:766110203
5183 5183 c, t dbSNP:186607045
5237 5237 c, t dbSNP:367843412
5276 5276 c, g dbSNP:753155141
5330 5330 a, g dbSNP:567993673
5342 5342 a, g dbSNP:536558244
5382 5382 c, t dbSNP:764715869
5386 5386 c, t dbSNP:556788892
5425 5425 a, c dbSNP:747111288
5430 5430 a, g dbSNP:576564187
5439 5439 a, g dbSNP:545540582
5445 5445 a, g dbSNP:191381122
5461 5461 atgct, ttcc dbSNP:386680482
5461 5461 -, a dbSNP:200143270
5461 5461 a, t dbSNP:557839862
5463 5463 c, g, t dbSNP:566444096
5465 5465 c, t dbSNP:539872411
5465 5465 -, t dbSNP:368527108
5485 5485 a, g dbSNP:752017263
5510 5510 c, t dbSNP:757712219
5527 5527 c, g dbSNP:781280740
5537 5537 a, c dbSNP:559704026
5560 5560 -, t dbSNP:562822377
5570 5570 c, t dbSNP:533826043
5624 5624 c, t dbSNP:528827590
5665 5665 c, t dbSNP:542581584
5668 5668 a, t dbSNP:182426004
5678 5678 a, g dbSNP:138752110
5682 5682 c, t dbSNP:561167513
5684 5684 -, atc dbSNP:768323853
5687 5687 a, c dbSNP:141377495
5692 5692 a, g dbSNP:780216020
5715 5715 c, t dbSNP:527769815
5729 5729 a, c dbSNP:749167813
5732 5732 a, c dbSNP:187066290
5735 5735 a, g dbSNP:567685528
5766 5766 c, t dbSNP:193026523
5792 5792 a, g dbSNP:768350940
5813 5813 a, g dbSNP:550214385
5828 5828 a, c, t dbSNP:375406411
5875 5875 c, t dbSNP:114762906
5881 5881 g, t dbSNP:558703264
5904 5904 -, tctg dbSNP:747996196

Target ORF information:

RefSeq Version NM_172250
Organism Homo sapiens (human)
Definition Homo sapiens methylmalonic aciduria (cobalamin deficiency) cblA type (MMAA), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu26306
Accession Version XM_011531684.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1257bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product methylmalonic aciduria type A protein, mitochondrial isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_016354.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)397..1386(+)
Misc Feature(2)574..1017(+)
Misc Feature(3)589..615(+)
Position Chain Variation Link
27 27 g, t dbSNP:373231529
39 39 c, t dbSNP:777002776
82 82 a, t dbSNP:751609803
86 86 a, g dbSNP:4835011
93 93 c, t dbSNP:749162902
97 97 a, g, t dbSNP:376276423
104 104 c, g, t dbSNP:758937804
105 105 a, g dbSNP:774967096
107 107 a, t dbSNP:150259804
113 113 c, t dbSNP:373547595
128 128 c, g, t dbSNP:138947726
133 133 a, g dbSNP:765634183
137 137 c, g dbSNP:750568846
138 138 a, g dbSNP:374109118
139 139 a, c dbSNP:766651356
148 148 a, g dbSNP:527340737
156 156 a, g dbSNP:755914586
161 161 a, g dbSNP:777599101
173 173 a, g dbSNP:749076210
174 174 c, t dbSNP:370983676
175 175 g, t dbSNP:757224297
178 178 c, g dbSNP:778693852
185 185 a, g dbSNP:371810384
186 186 a, c dbSNP:771417006
191 191 c, t dbSNP:775224246
194 194 a, g dbSNP:746718277
198 198 a, c, g dbSNP:143211378
199 199 c, g dbSNP:762251343
205 205 c, t dbSNP:765799472
206 206 a, g, t dbSNP:375682603
209 209 a, g dbSNP:370709347
217 217 c, t dbSNP:766309050
218 218 -, c dbSNP:762276953
220 220 a, c, g dbSNP:756348773
227 227 a, g, t dbSNP:367809749
228 228 -, c dbSNP:765782136
233 233 a, g dbSNP:142126209
243 243 c, t dbSNP:146372922
253 253 a, g dbSNP:139395700
257 257 a, c dbSNP:150065810
259 259 c, t dbSNP:745735153
265 265 c, g dbSNP:758345818
270 270 a, g dbSNP:779779664
273 273 a, t dbSNP:746489522
278 278 a, c dbSNP:543412068
279 279 c, t dbSNP:34702224
288 288 -, t dbSNP:750771861
292 292 c, t dbSNP:748557981
293 293 a, g dbSNP:769983308
294 294 g, t dbSNP:773779122
306 306 g, t dbSNP:763425453
316 316 c, g dbSNP:371779800
328 328 a, g dbSNP:774453661
333 333 -, att dbSNP:758827870
340 340 g, t dbSNP:759588632
343 343 c, t dbSNP:754894257
350 350 c, t dbSNP:767748129
376 376 c, t dbSNP:752876551
383 383 a, c, g dbSNP:532407633
387 387 a, g dbSNP:750230122
395 395 c, t dbSNP:372082521
401 401 a, g dbSNP:375210272
410 410 a, t dbSNP:148404005
424 424 c, t dbSNP:104893846
429 429 a, g, t dbSNP:559279147
435 435 -, ggcctgtttagcaga dbSNP:780082584
435 435 a, g dbSNP:747694093
459 459 g, t dbSNP:769472387
461 461 c, t dbSNP:201224725
472 472 a, g, t dbSNP:778062592
477 477 c, t dbSNP:771388415
483 483 c, g dbSNP:774790573
487 487 a, c dbSNP:759642126
488 488 a, g dbSNP:772082690
495 495 a, g dbSNP:369424796
501 501 a, g dbSNP:112975623
506 506 c, t dbSNP:760875006
516 516 a, g dbSNP:184069367
519 519 a, g dbSNP:750237065
523 523 c, t dbSNP:762763078
524 524 g, t dbSNP:560188002
531 531 c, t dbSNP:766454656
534 534 a, t dbSNP:371714495
538 538 c, t dbSNP:754545360
541 541 c, g dbSNP:369113922
549 549 -, a dbSNP:751832194
552 552 a, t dbSNP:752244799
574 574 c, t dbSNP:104893851
575 575 a, g dbSNP:200577967
577 577 a, g dbSNP:530814186
588 588 -, g dbSNP:754973022
598 598 a, g dbSNP:147586746
614 614 c, t dbSNP:755600003
624 624 a, c dbSNP:374352921
629 629 c, t dbSNP:753463116
631 631 -, g dbSNP:781301826
635 635 a, g dbSNP:199809221
639 639 a, g dbSNP:186933110
641 641 c, t dbSNP:34474021
644 644 c, t dbSNP:745549667
653 653 c, g dbSNP:755659791
655 655 c, t dbSNP:191727024
657 657 c, t dbSNP:780564235
683 683 -, ctt dbSNP:748291856
699 699 a, t dbSNP:201998029
726 726 c, t dbSNP:571797666
728 728 a, g dbSNP:144389160
731 731 -, tgac dbSNP:779859711
733 733 a, g dbSNP:781395862
738 738 a, g dbSNP:116773849
751 751 a, g dbSNP:370375675
761 761 a, g dbSNP:104893849
763 763 a, c dbSNP:773516780
768 768 a, g dbSNP:745687257
770 770 c, t dbSNP:771832448
771 771 a, g dbSNP:374347679
773 773 c, t dbSNP:760732816
787 787 a, c dbSNP:768447137
788 788 c, g dbSNP:776168690
791 791 c, t dbSNP:140356252
799 799 a, g dbSNP:150376474
814 814 a, g dbSNP:750014244
815 815 a, g, t dbSNP:763324433
836 836 a, g dbSNP:751861917
842 842 c, t dbSNP:367609164
843 843 g, t dbSNP:781525637
859 859 c, t dbSNP:752844506
862 862 a, g dbSNP:756221585
863 863 c, t dbSNP:371068331
870 870 c, t dbSNP:138111772
871 871 a, g dbSNP:771044996
883 883 c, t dbSNP:757548934
885 885 g, t dbSNP:778955528
887 887 c, t dbSNP:746853773
888 888 a, g dbSNP:11721553
897 897 c, t dbSNP:781124654
898 898 a, g dbSNP:748145761
901 901 a, g dbSNP:769722136
902 902 c, t dbSNP:145018955
908 908 c, t dbSNP:748721023
916 916 a, c dbSNP:770636513
927 927 a, g dbSNP:773833728
928 928 c, t dbSNP:759947234
936 936 a, c dbSNP:767934772
941 941 c, t dbSNP:138854691
943 943 a, g dbSNP:761331762
944 944 g, t dbSNP:764675342
946 946 a, g dbSNP:536601590
949 949 c, g dbSNP:757242348
964 964 a, g dbSNP:764728312
966 966 -, a dbSNP:774958165
971 971 a, g dbSNP:200254160
974 974 a, g dbSNP:761964238
975 975 -, ta dbSNP:760236568
977 977 c, t dbSNP:371624542
979 979 a, g dbSNP:765287661
981 981 c, t dbSNP:750509072
991 991 c, g dbSNP:758654806
999 999 a, g dbSNP:142063642
1013 1013 a, c dbSNP:752514914
1020 1020 a, g dbSNP:146352309
1025 1025 c, t dbSNP:777773616
1037 1037 c, g dbSNP:749124431
1040 1040 a, g dbSNP:757207009
1044 1044 a, g dbSNP:778354704
1045 1045 a, t dbSNP:369128670
1052 1052 c, t dbSNP:771873633
1053 1053 a, g dbSNP:371769807
1059 1059 c, t dbSNP:368766697
1068 1068 a, t dbSNP:769082931
1081 1081 c, g, t dbSNP:374795215
1082 1082 a, g dbSNP:148142853
1083 1083 a, c dbSNP:773218154
1087 1087 c, t dbSNP:141974563
1088 1088 a, g dbSNP:377228966
1093 1093 c, g dbSNP:751717131
1105 1105 c, g dbSNP:765080486
1107 1107 a, g dbSNP:150692463
1118 1118 a, g dbSNP:201547892
1127 1127 c, t dbSNP:753626196
1129 1129 c, t dbSNP:571038432
1130 1130 a, g dbSNP:140031911
1135 1135 a, g dbSNP:533334741
1136 1136 g, t dbSNP:750327703
1141 1141 a, g dbSNP:758394680
1144 1144 a, t dbSNP:199749473
1175 1175 -, t dbSNP:398124552
1179 1179 a, g dbSNP:751080456
1185 1185 a, g dbSNP:754630744
1193 1193 c, g dbSNP:780852556
1195 1195 a, g dbSNP:748496016
1196 1196 a, c, g dbSNP:756437003
1198 1198 a, g dbSNP:145012972
1200 1200 a, g dbSNP:552250080
1204 1204 c, g dbSNP:774455707
1213 1213 a, c dbSNP:745926548
1219 1219 c, t dbSNP:6812252
1220 1220 a, g dbSNP:147148157
1221 1221 g, t dbSNP:761525438
1224 1224 a, g dbSNP:565742386
1230 1230 c, g dbSNP:2270655
1231 1231 a, t dbSNP:763021619
1233 1233 a, g dbSNP:766393243
1237 1237 g, t dbSNP:751133516
1240 1240 a, g dbSNP:754474832
1249 1249 c, t dbSNP:767085014
1255 1255 -, c dbSNP:765726949
1256 1256 a, g dbSNP:752340522
1257 1257 a, g dbSNP:755710950
1262 1262 a, g dbSNP:778178659
1265 1265 c, t dbSNP:749624035
1268 1268 c, t dbSNP:757810882
1271 1271 a, t dbSNP:554604284
1274 1274 a, t dbSNP:745939340
1297 1297 c, t dbSNP:374622922
1298 1298 a, c, g dbSNP:191643294
1309 1309 c, t dbSNP:267600029
1316 1316 c, t dbSNP:768964804
1317 1317 a, g dbSNP:368671164
1318 1318 a, g dbSNP:144313458
1327 1327 c, g dbSNP:766454544
1334 1334 c, t dbSNP:777459994
1361 1361 c, t dbSNP:145539291
1362 1362 a, g dbSNP:767115507
1377 1377 a, g dbSNP:184111056
1389 1389 c, t dbSNP:760417305
1391 1391 c, g dbSNP:763715364
1406 1406 c, t dbSNP:754224809
1414 1414 a, g dbSNP:576991940
1424 1424 c, t dbSNP:779405529
1427 1427 a, g dbSNP:750994850
1431 1431 a, c dbSNP:758825838
1439 1439 -, aag dbSNP:773712230
1439 1439 a, g dbSNP:780219088
1444 1444 a, g dbSNP:747034747
1446 1446 c, t dbSNP:374937807
1451 1451 a, t dbSNP:781521709
1466 1466 c, t dbSNP:545633228
1495 1495 c, g dbSNP:148424051
1497 1497 c, t dbSNP:746687923
1526 1526 a, g dbSNP:756792587
1533 1533 a, g dbSNP:780496991
1550 1550 a, g dbSNP:749564150
1575 1575 a, g dbSNP:572996882
1590 1590 a, g dbSNP:188845060
1704 1704 a, t dbSNP:74409983
1738 1738 c, t dbSNP:530774368
1778 1778 c, t dbSNP:376383308
1801 1801 c, g dbSNP:536872965
1832 1832 c, t dbSNP:72950841
1939 1939 a, g dbSNP:114729477
1968 1968 a, g dbSNP:533580327
1978 1978 c, t dbSNP:181600698
1990 1990 a, g dbSNP:565828392
1998 1998 a, g dbSNP:112882351
2005 2005 a, g dbSNP:773103545
2057 2057 c, g dbSNP:749692437
2072 2072 c, t dbSNP:374413811
2101 2101 c, t dbSNP:548243828
2130 2130 c, t dbSNP:142549499
2193 2193 c, t dbSNP:536614923
2195 2195 c, g dbSNP:78856150
2202 2202 a, t dbSNP:185541614
2209 2209 c, t dbSNP:570614939
2235 2235 a, g dbSNP:539664731
2257 2257 a, g dbSNP:760991571
2261 2261 a, g dbSNP:555681986
2288 2288 a, g dbSNP:771012374
2296 2296 c, t dbSNP:552726676
2299 2299 c, t dbSNP:768720995
2321 2321 g, t dbSNP:540215076
2338 2338 a, g dbSNP:562734754
2339 2339 c, t dbSNP:111385622
2351 2351 a, c dbSNP:535567216
2387 2387 a, g dbSNP:147593159
2505 2505 -, g dbSNP:555018325
2512 2512 -, tacaactacatctacaactacaaacctgatgacca dbSNP:562586213
2513 2513 a, g dbSNP:575595640
2514 2514 g, t dbSNP:574804780
2519 2519 c, g dbSNP:774637500
2535 2535 a, g dbSNP:544237745
2578 2578 c, t dbSNP:200764256
2608 2608 g, t dbSNP:190416172
2625 2625 a, t dbSNP:375194713
2630 2630 a, g dbSNP:573591323
2644 2644 -, tg dbSNP:761741912
2676 2676 a, c dbSNP:759292618
2682 2682 a, g dbSNP:564976817
2686 2686 a, t dbSNP:182596446
2705 2705 a, g dbSNP:752613281
2803 2803 a, g dbSNP:111561610
2823 2823 c, t dbSNP:529476650
2850 2850 a, g dbSNP:548327835
2857 2857 a, g dbSNP:772249563
2866 2866 a, g dbSNP:561582557
2869 2869 a, g dbSNP:576920922
2872 2872 c, t dbSNP:544249620
2875 2875 c, t dbSNP:776544317
2982 2982 a, g dbSNP:530538534
3008 3008 c, t dbSNP:185925141
3099 3099 a, c dbSNP:756955007
3127 3127 a, t dbSNP:780680164
3180 3180 a, g dbSNP:114134771
3215 3215 c, t dbSNP:539331555
3266 3266 a, g dbSNP:546453862
3293 3293 -, ttctg dbSNP:377206435
3300 3300 a, t dbSNP:566349317
3316 3316 a, g dbSNP:755382235
3341 3341 -, t dbSNP:150630369
3350 3350 c, t dbSNP:79927727
3354 3354 c, t dbSNP:555448380
3364 3364 c, t dbSNP:147742767
3376 3376 c, t dbSNP:189992747
3386 3386 a, t dbSNP:141116337
3387 3387 c, t dbSNP:528427721
3474 3474 a, t dbSNP:181194454
3479 3479 a, g dbSNP:150239306
3537 3537 a, g dbSNP:772671304
3540 3540 c, t dbSNP:72723824
3600 3600 a, g dbSNP:763600036
3606 3606 c, g, t dbSNP:138876977
3614 3614 a, g dbSNP:532931521
3663 3663 a, t dbSNP:543204236
3693 3693 a, c dbSNP:561863636
3723 3723 c, t dbSNP:530499633
3726 3726 a, c dbSNP:751286054
3747 3747 a, g dbSNP:747040589
3762 3762 a, g dbSNP:13129907
3770 3770 a, t dbSNP:74719174
3778 3778 a, t dbSNP:759380432
3799 3799 a, g dbSNP:532736675
3858 3858 c, g dbSNP:546490347
3868 3868 a, g dbSNP:185788250
3938 3938 a, g dbSNP:566386419
3960 3960 c, t dbSNP:529092235
3971 3971 a, g dbSNP:775199322
3973 3973 c, g dbSNP:762908276
3982 3982 c, g dbSNP:763886975
3984 3984 a, g dbSNP:548904365
4003 4003 g, t dbSNP:569363374
4006 4006 c, t dbSNP:7699187
4016 4016 -, ctca dbSNP:764845583
4017 4017 -, ctca dbSNP:111858031
4019 4019 c, g dbSNP:558200462
4020 4020 -, actc dbSNP:60186480
4043 4043 c, t dbSNP:568954220
4051 4051 a, g dbSNP:761226923
4056 4056 a, g dbSNP:72723825
4086 4086 a, t dbSNP:750115092
4115 4115 g, t dbSNP:190507341
4166 4166 a, t dbSNP:7699166
4205 4205 c, t dbSNP:7675466
4206 4206 a, g dbSNP:543019315
4213 4213 c, t dbSNP:779456225
4236 4236 c, t dbSNP:143687604
4264 4264 a, g dbSNP:17020500
4281 4281 g, t dbSNP:758996405
4302 4302 a, g dbSNP:755382846
4372 4372 -, atatg dbSNP:534264968
4433 4433 a, c dbSNP:576544645
4434 4434 c, t dbSNP:747177286
4445 4445 a, c dbSNP:757267017
4453 4453 c, t dbSNP:781271928
4503 4503 c, g dbSNP:183480840
4517 4517 a, c dbSNP:71614553
4534 4534 c, t dbSNP:746091108
4544 4544 c, t dbSNP:769964379
4549 4549 a, g dbSNP:775285481
4579 4579 a, g dbSNP:564158904
4602 4602 a, g dbSNP:188863865
4652 4652 a, c dbSNP:539831571
4656 4656 -, a dbSNP:33978754
4657 4657 a, c dbSNP:79354747
4669 4669 -, aaaa dbSNP:77756937
4672 4672 -, a dbSNP:397709371
4683 4683 a, g dbSNP:142885287

Target ORF information:

RefSeq Version XM_011531684
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens methylmalonic aciduria (cobalamin deficiency) cblA type (MMAA), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu26306
Accession Version XM_011531685.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1257bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product methylmalonic aciduria type A protein, mitochondrial isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_016354.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)406..1395(+)
Misc Feature(2)583..1026(+)
Misc Feature(3)598..624(+)
Position Chain Variation Link
6 6 a, g dbSNP:767684542
47 47 a, c dbSNP:575375678
91 91 a, t dbSNP:751609803
95 95 a, g dbSNP:4835011
102 102 c, t dbSNP:749162902
106 106 a, g, t dbSNP:376276423
113 113 c, g, t dbSNP:758937804
114 114 a, g dbSNP:774967096
116 116 a, t dbSNP:150259804
122 122 c, t dbSNP:373547595
137 137 c, g, t dbSNP:138947726
142 142 a, g dbSNP:765634183
146 146 c, g dbSNP:750568846
147 147 a, g dbSNP:374109118
148 148 a, c dbSNP:766651356
157 157 a, g dbSNP:527340737
165 165 a, g dbSNP:755914586
170 170 a, g dbSNP:777599101
182 182 a, g dbSNP:749076210
183 183 c, t dbSNP:370983676
184 184 g, t dbSNP:757224297
187 187 c, g dbSNP:778693852
194 194 a, g dbSNP:371810384
195 195 a, c dbSNP:771417006
200 200 c, t dbSNP:775224246
203 203 a, g dbSNP:746718277
207 207 a, c, g dbSNP:143211378
208 208 c, g dbSNP:762251343
214 214 c, t dbSNP:765799472
215 215 a, g, t dbSNP:375682603
218 218 a, g dbSNP:370709347
226 226 c, t dbSNP:766309050
227 227 -, c dbSNP:762276953
229 229 a, c, g dbSNP:756348773
236 236 a, g, t dbSNP:367809749
237 237 -, c dbSNP:765782136
242 242 a, g dbSNP:142126209
252 252 c, t dbSNP:146372922
262 262 a, g dbSNP:139395700
266 266 a, c dbSNP:150065810
268 268 c, t dbSNP:745735153
274 274 c, g dbSNP:758345818
279 279 a, g dbSNP:779779664
282 282 a, t dbSNP:746489522
287 287 a, c dbSNP:543412068
288 288 c, t dbSNP:34702224
297 297 -, t dbSNP:750771861
301 301 c, t dbSNP:748557981
302 302 a, g dbSNP:769983308
303 303 g, t dbSNP:773779122
315 315 g, t dbSNP:763425453
325 325 c, g dbSNP:371779800
337 337 a, g dbSNP:774453661
342 342 -, att dbSNP:758827870
349 349 g, t dbSNP:759588632
352 352 c, t dbSNP:754894257
359 359 c, t dbSNP:767748129
385 385 c, t dbSNP:752876551
392 392 a, c, g dbSNP:532407633
396 396 a, g dbSNP:750230122
404 404 c, t dbSNP:372082521
410 410 a, g dbSNP:375210272
419 419 a, t dbSNP:148404005
433 433 c, t dbSNP:104893846
438 438 a, g, t dbSNP:559279147
444 444 -, ggcctgtttagcaga dbSNP:780082584
444 444 a, g dbSNP:747694093
468 468 g, t dbSNP:769472387
470 470 c, t dbSNP:201224725
481 481 a, g, t dbSNP:778062592
486 486 c, t dbSNP:771388415
492 492 c, g dbSNP:774790573
496 496 a, c dbSNP:759642126
497 497 a, g dbSNP:772082690
504 504 a, g dbSNP:369424796
510 510 a, g dbSNP:112975623
515 515 c, t dbSNP:760875006
525 525 a, g dbSNP:184069367
528 528 a, g dbSNP:750237065
532 532 c, t dbSNP:762763078
533 533 g, t dbSNP:560188002
540 540 c, t dbSNP:766454656
543 543 a, t dbSNP:371714495
547 547 c, t dbSNP:754545360
550 550 c, g dbSNP:369113922
558 558 -, a dbSNP:751832194
561 561 a, t dbSNP:752244799
583 583 c, t dbSNP:104893851
584 584 a, g dbSNP:200577967
586 586 a, g dbSNP:530814186
597 597 -, g dbSNP:754973022
607 607 a, g dbSNP:147586746
623 623 c, t dbSNP:755600003
633 633 a, c dbSNP:374352921
638 638 c, t dbSNP:753463116
640 640 -, g dbSNP:781301826
644 644 a, g dbSNP:199809221
648 648 a, g dbSNP:186933110
650 650 c, t dbSNP:34474021
653 653 c, t dbSNP:745549667
662 662 c, g dbSNP:755659791
664 664 c, t dbSNP:191727024
666 666 c, t dbSNP:780564235
692 692 -, ctt dbSNP:748291856
708 708 a, t dbSNP:201998029
735 735 c, t dbSNP:571797666
737 737 a, g dbSNP:144389160
740 740 -, tgac dbSNP:779859711
742 742 a, g dbSNP:781395862
747 747 a, g dbSNP:116773849
760 760 a, g dbSNP:370375675
770 770 a, g dbSNP:104893849
772 772 a, c dbSNP:773516780
777 777 a, g dbSNP:745687257
779 779 c, t dbSNP:771832448
780 780 a, g dbSNP:374347679
782 782 c, t dbSNP:760732816
796 796 a, c dbSNP:768447137
797 797 c, g dbSNP:776168690
800 800 c, t dbSNP:140356252
808 808 a, g dbSNP:150376474
823 823 a, g dbSNP:750014244
824 824 a, g, t dbSNP:763324433
845 845 a, g dbSNP:751861917
851 851 c, t dbSNP:367609164
852 852 g, t dbSNP:781525637
868 868 c, t dbSNP:752844506
871 871 a, g dbSNP:756221585
872 872 c, t dbSNP:371068331
879 879 c, t dbSNP:138111772
880 880 a, g dbSNP:771044996
892 892 c, t dbSNP:757548934
894 894 g, t dbSNP:778955528
896 896 c, t dbSNP:746853773
897 897 a, g dbSNP:11721553
906 906 c, t dbSNP:781124654
907 907 a, g dbSNP:748145761
910 910 a, g dbSNP:769722136
911 911 c, t dbSNP:145018955
917 917 c, t dbSNP:748721023
925 925 a, c dbSNP:770636513
936 936 a, g dbSNP:773833728
937 937 c, t dbSNP:759947234
945 945 a, c dbSNP:767934772
950 950 c, t dbSNP:138854691
952 952 a, g dbSNP:761331762
953 953 g, t dbSNP:764675342
955 955 a, g dbSNP:536601590
958 958 c, g dbSNP:757242348
973 973 a, g dbSNP:764728312
975 975 -, a dbSNP:774958165
980 980 a, g dbSNP:200254160
983 983 a, g dbSNP:761964238
984 984 -, ta dbSNP:760236568
986 986 c, t dbSNP:371624542
988 988 a, g dbSNP:765287661
990 990 c, t dbSNP:750509072
1000 1000 c, g dbSNP:758654806
1008 1008 a, g dbSNP:142063642
1022 1022 a, c dbSNP:752514914
1029 1029 a, g dbSNP:146352309
1034 1034 c, t dbSNP:777773616
1046 1046 c, g dbSNP:749124431
1049 1049 a, g dbSNP:757207009
1053 1053 a, g dbSNP:778354704
1054 1054 a, t dbSNP:369128670
1061 1061 c, t dbSNP:771873633
1062 1062 a, g dbSNP:371769807
1068 1068 c, t dbSNP:368766697
1077 1077 a, t dbSNP:769082931
1090 1090 c, g, t dbSNP:374795215
1091 1091 a, g dbSNP:148142853
1092 1092 a, c dbSNP:773218154
1096 1096 c, t dbSNP:141974563
1097 1097 a, g dbSNP:377228966
1102 1102 c, g dbSNP:751717131
1114 1114 c, g dbSNP:765080486
1116 1116 a, g dbSNP:150692463
1127 1127 a, g dbSNP:201547892
1136 1136 c, t dbSNP:753626196
1138 1138 c, t dbSNP:571038432
1139 1139 a, g dbSNP:140031911
1144 1144 a, g dbSNP:533334741
1145 1145 g, t dbSNP:750327703
1150 1150 a, g dbSNP:758394680
1153 1153 a, t dbSNP:199749473
1184 1184 -, t dbSNP:398124552
1188 1188 a, g dbSNP:751080456
1194 1194 a, g dbSNP:754630744
1202 1202 c, g dbSNP:780852556
1204 1204 a, g dbSNP:748496016
1205 1205 a, c, g dbSNP:756437003
1207 1207 a, g dbSNP:145012972
1209 1209 a, g dbSNP:552250080
1213 1213 c, g dbSNP:774455707
1222 1222 a, c dbSNP:745926548
1228 1228 c, t dbSNP:6812252
1229 1229 a, g dbSNP:147148157
1230 1230 g, t dbSNP:761525438
1233 1233 a, g dbSNP:565742386
1239 1239 c, g dbSNP:2270655
1240 1240 a, t dbSNP:763021619
1242 1242 a, g dbSNP:766393243
1246 1246 g, t dbSNP:751133516
1249 1249 a, g dbSNP:754474832
1258 1258 c, t dbSNP:767085014
1264 1264 -, c dbSNP:765726949
1265 1265 a, g dbSNP:752340522
1266 1266 a, g dbSNP:755710950
1271 1271 a, g dbSNP:778178659
1274 1274 c, t dbSNP:749624035
1277 1277 c, t dbSNP:757810882
1280 1280 a, t dbSNP:554604284
1283 1283 a, t dbSNP:745939340
1306 1306 c, t dbSNP:374622922
1307 1307 a, c, g dbSNP:191643294
1318 1318 c, t dbSNP:267600029
1325 1325 c, t dbSNP:768964804
1326 1326 a, g dbSNP:368671164
1327 1327 a, g dbSNP:144313458
1336 1336 c, g dbSNP:766454544
1343 1343 c, t dbSNP:777459994
1370 1370 c, t dbSNP:145539291
1371 1371 a, g dbSNP:767115507
1386 1386 a, g dbSNP:184111056
1398 1398 c, t dbSNP:760417305
1400 1400 c, g dbSNP:763715364
1415 1415 c, t dbSNP:754224809
1423 1423 a, g dbSNP:576991940
1433 1433 c, t dbSNP:779405529
1436 1436 a, g dbSNP:750994850
1440 1440 a, c dbSNP:758825838
1448 1448 -, aag dbSNP:773712230
1448 1448 a, g dbSNP:780219088
1453 1453 a, g dbSNP:747034747
1455 1455 c, t dbSNP:374937807
1460 1460 a, t dbSNP:781521709
1475 1475 c, t dbSNP:545633228
1504 1504 c, g dbSNP:148424051
1506 1506 c, t dbSNP:746687923
1535 1535 a, g dbSNP:756792587
1542 1542 a, g dbSNP:780496991
1559 1559 a, g dbSNP:749564150
1584 1584 a, g dbSNP:572996882
1599 1599 a, g dbSNP:188845060
1713 1713 a, t dbSNP:74409983
1747 1747 c, t dbSNP:530774368
1787 1787 c, t dbSNP:376383308
1810 1810 c, g dbSNP:536872965
1841 1841 c, t dbSNP:72950841
1948 1948 a, g dbSNP:114729477
1977 1977 a, g dbSNP:533580327
1987 1987 c, t dbSNP:181600698
1999 1999 a, g dbSNP:565828392
2007 2007 a, g dbSNP:112882351
2014 2014 a, g dbSNP:773103545
2066 2066 c, g dbSNP:749692437
2081 2081 c, t dbSNP:374413811
2110 2110 c, t dbSNP:548243828
2139 2139 c, t dbSNP:142549499
2202 2202 c, t dbSNP:536614923
2204 2204 c, g dbSNP:78856150
2211 2211 a, t dbSNP:185541614
2218 2218 c, t dbSNP:570614939
2244 2244 a, g dbSNP:539664731
2266 2266 a, g dbSNP:760991571
2270 2270 a, g dbSNP:555681986
2297 2297 a, g dbSNP:771012374
2305 2305 c, t dbSNP:552726676
2308 2308 c, t dbSNP:768720995
2330 2330 g, t dbSNP:540215076
2347 2347 a, g dbSNP:562734754
2348 2348 c, t dbSNP:111385622
2360 2360 a, c dbSNP:535567216
2396 2396 a, g dbSNP:147593159
2514 2514 -, g dbSNP:555018325
2521 2521 -, tacaactacatctacaactacaaacctgatgacca dbSNP:562586213
2522 2522 a, g dbSNP:575595640
2523 2523 g, t dbSNP:574804780
2528 2528 c, g dbSNP:774637500
2544 2544 a, g dbSNP:544237745
2587 2587 c, t dbSNP:200764256
2617 2617 g, t dbSNP:190416172
2634 2634 a, t dbSNP:375194713
2639 2639 a, g dbSNP:573591323
2653 2653 -, tg dbSNP:761741912
2685 2685 a, c dbSNP:759292618
2691 2691 a, g dbSNP:564976817
2695 2695 a, t dbSNP:182596446
2714 2714 a, g dbSNP:752613281
2812 2812 a, g dbSNP:111561610
2832 2832 c, t dbSNP:529476650
2859 2859 a, g dbSNP:548327835
2866 2866 a, g dbSNP:772249563
2875 2875 a, g dbSNP:561582557
2878 2878 a, g dbSNP:576920922
2881 2881 c, t dbSNP:544249620
2884 2884 c, t dbSNP:776544317
2991 2991 a, g dbSNP:530538534
3017 3017 c, t dbSNP:185925141
3108 3108 a, c dbSNP:756955007
3136 3136 a, t dbSNP:780680164
3189 3189 a, g dbSNP:114134771
3224 3224 c, t dbSNP:539331555
3275 3275 a, g dbSNP:546453862
3302 3302 -, ttctg dbSNP:377206435
3309 3309 a, t dbSNP:566349317
3325 3325 a, g dbSNP:755382235
3350 3350 -, t dbSNP:150630369
3359 3359 c, t dbSNP:79927727
3363 3363 c, t dbSNP:555448380
3373 3373 c, t dbSNP:147742767
3385 3385 c, t dbSNP:189992747
3395 3395 a, t dbSNP:141116337
3396 3396 c, t dbSNP:528427721
3483 3483 a, t dbSNP:181194454
3488 3488 a, g dbSNP:150239306
3546 3546 a, g dbSNP:772671304
3549 3549 c, t dbSNP:72723824
3609 3609 a, g dbSNP:763600036
3615 3615 c, g, t dbSNP:138876977
3623 3623 a, g dbSNP:532931521
3672 3672 a, t dbSNP:543204236
3702 3702 a, c dbSNP:561863636
3732 3732 c, t dbSNP:530499633
3735 3735 a, c dbSNP:751286054
3756 3756 a, g dbSNP:747040589
3771 3771 a, g dbSNP:13129907
3779 3779 a, t dbSNP:74719174
3787 3787 a, t dbSNP:759380432
3808 3808 a, g dbSNP:532736675
3867 3867 c, g dbSNP:546490347
3877 3877 a, g dbSNP:185788250
3947 3947 a, g dbSNP:566386419
3969 3969 c, t dbSNP:529092235
3980 3980 a, g dbSNP:775199322
3982 3982 c, g dbSNP:762908276
3991 3991 c, g dbSNP:763886975
3993 3993 a, g dbSNP:548904365
4012 4012 g, t dbSNP:569363374
4015 4015 c, t dbSNP:7699187
4025 4025 -, ctca dbSNP:764845583
4026 4026 -, ctca dbSNP:111858031
4028 4028 c, g dbSNP:558200462
4029 4029 -, actc dbSNP:60186480
4052 4052 c, t dbSNP:568954220
4060 4060 a, g dbSNP:761226923
4065 4065 a, g dbSNP:72723825
4095 4095 a, t dbSNP:750115092
4124 4124 g, t dbSNP:190507341
4175 4175 a, t dbSNP:7699166
4214 4214 c, t dbSNP:7675466
4215 4215 a, g dbSNP:543019315
4222 4222 c, t dbSNP:779456225
4245 4245 c, t dbSNP:143687604
4273 4273 a, g dbSNP:17020500
4290 4290 g, t dbSNP:758996405
4311 4311 a, g dbSNP:755382846
4381 4381 -, atatg dbSNP:534264968
4442 4442 a, c dbSNP:576544645
4443 4443 c, t dbSNP:747177286
4454 4454 a, c dbSNP:757267017
4462 4462 c, t dbSNP:781271928
4512 4512 c, g dbSNP:183480840
4526 4526 a, c dbSNP:71614553
4543 4543 c, t dbSNP:746091108
4553 4553 c, t dbSNP:769964379
4558 4558 a, g dbSNP:775285481
4588 4588 a, g dbSNP:564158904
4611 4611 a, g dbSNP:188863865
4661 4661 a, c dbSNP:539831571
4665 4665 -, a dbSNP:33978754
4666 4666 a, c dbSNP:79354747
4678 4678 -, aaaa dbSNP:77756937
4681 4681 -, a dbSNP:397709371
4692 4692 a, g dbSNP:142885287

Target ORF information:

RefSeq Version XM_011531685
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens methylmalonic aciduria (cobalamin deficiency) cblA type (MMAA), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu77338
Accession Version XM_011531686.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 762bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product methylmalonic aciduria type A protein, mitochondrial isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_016354.20) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)314..1072(+)
Position Chain Variation Link
6 6 a, t dbSNP:760789947
15 15 c, g dbSNP:768786277
25 25 c, t dbSNP:570852529
32 32 -, a dbSNP:533009455
33 33 a, t dbSNP:539742744
49 49 a, c dbSNP:553180576
59 59 c, t dbSNP:186607217
66 66 c, t dbSNP:191397407
77 77 a, g dbSNP:4835012
82 82 a, g dbSNP:574425559
115 115 a, g dbSNP:183881549
118 118 a, g dbSNP:556985302
123 123 a, t dbSNP:529784480
147 147 a, g dbSNP:115954832
187 187 a, g dbSNP:546097020
231 231 c, t dbSNP:4835239
265 265 -, g dbSNP:754973022
275 275 a, g dbSNP:147586746
291 291 c, t dbSNP:755600003
301 301 a, c dbSNP:374352921
306 306 c, t dbSNP:753463116
308 308 -, g dbSNP:781301826
312 312 a, g dbSNP:199809221
316 316 a, g dbSNP:186933110
318 318 c, t dbSNP:34474021
321 321 c, t dbSNP:745549667
330 330 c, g dbSNP:755659791
332 332 c, t dbSNP:191727024
334 334 c, t dbSNP:780564235
360 360 -, ctt dbSNP:748291856
376 376 a, t dbSNP:201998029
403 403 c, t dbSNP:571797666
405 405 a, g dbSNP:144389160
408 408 -, tgac dbSNP:779859711
410 410 a, g dbSNP:781395862
415 415 a, g dbSNP:116773849
428 428 a, g dbSNP:370375675
438 438 a, g dbSNP:104893849
440 440 a, c dbSNP:773516780
445 445 a, g dbSNP:745687257
447 447 c, t dbSNP:771832448
448 448 a, g dbSNP:374347679
450 450 c, t dbSNP:760732816
464 464 a, c dbSNP:768447137
465 465 c, g dbSNP:776168690
468 468 c, t dbSNP:140356252
476 476 a, g dbSNP:150376474
491 491 a, g dbSNP:750014244
492 492 a, g, t dbSNP:763324433
513 513 a, g dbSNP:751861917
519 519 c, t dbSNP:367609164
520 520 g, t dbSNP:781525637
536 536 c, t dbSNP:752844506
539 539 a, g dbSNP:756221585
540 540 c, t dbSNP:371068331
547 547 c, t dbSNP:138111772
548 548 a, g dbSNP:771044996
560 560 c, t dbSNP:757548934
562 562 g, t dbSNP:778955528
564 564 c, t dbSNP:746853773
565 565 a, g dbSNP:11721553
574 574 c, t dbSNP:781124654
575 575 a, g dbSNP:748145761
578 578 a, g dbSNP:769722136
579 579 c, t dbSNP:145018955
585 585 c, t dbSNP:748721023
593 593 a, c dbSNP:770636513
604 604 a, g dbSNP:773833728
605 605 c, t dbSNP:759947234
613 613 a, c dbSNP:767934772
618 618 c, t dbSNP:138854691
620 620 a, g dbSNP:761331762
621 621 g, t dbSNP:764675342
623 623 a, g dbSNP:536601590
626 626 c, g dbSNP:757242348
641 641 a, g dbSNP:764728312
643 643 -, a dbSNP:774958165
648 648 a, g dbSNP:200254160
651 651 a, g dbSNP:761964238
652 652 -, ta dbSNP:760236568
654 654 c, t dbSNP:371624542
656 656 a, g dbSNP:765287661
658 658 c, t dbSNP:750509072
668 668 c, g dbSNP:758654806
676 676 a, g dbSNP:142063642
690 690 a, c dbSNP:752514914
697 697 a, g dbSNP:146352309
702 702 c, t dbSNP:777773616
714 714 c, g dbSNP:749124431
717 717 a, g dbSNP:757207009
721 721 a, g dbSNP:778354704
722 722 a, t dbSNP:369128670
729 729 c, t dbSNP:771873633
730 730 a, g dbSNP:371769807
736 736 c, t dbSNP:368766697
745 745 a, t dbSNP:769082931
758 758 c, g, t dbSNP:374795215
759 759 a, g dbSNP:148142853
760 760 a, c dbSNP:773218154
764 764 c, t dbSNP:141974563
765 765 a, g dbSNP:377228966
770 770 c, g dbSNP:751717131
782 782 c, g dbSNP:765080486
784 784 a, g dbSNP:150692463
795 795 a, g dbSNP:201547892
804 804 c, t dbSNP:753626196
806 806 c, t dbSNP:571038432
807 807 a, g dbSNP:140031911
812 812 a, g dbSNP:533334741
813 813 g, t dbSNP:750327703
818 818 a, g dbSNP:758394680
821 821 a, t dbSNP:199749473
852 852 -, t dbSNP:398124552
856 856 a, g dbSNP:751080456
862 862 a, g dbSNP:754630744
870 870 c, g dbSNP:780852556
872 872 a, g dbSNP:748496016
873 873 a, c, g dbSNP:756437003
875 875 a, g dbSNP:145012972
877 877 a, g dbSNP:552250080
881 881 c, g dbSNP:774455707
890 890 a, c dbSNP:745926548
896 896 c, t dbSNP:6812252
897 897 a, g dbSNP:147148157
898 898 g, t dbSNP:761525438
901 901 a, g dbSNP:565742386
907 907 c, g dbSNP:2270655
908 908 a, t dbSNP:763021619
910 910 a, g dbSNP:766393243
914 914 g, t dbSNP:751133516
917 917 a, g dbSNP:754474832
926 926 c, t dbSNP:767085014
932 932 -, c dbSNP:765726949
933 933 a, g dbSNP:752340522
934 934 a, g dbSNP:755710950
939 939 a, g dbSNP:778178659
942 942 c, t dbSNP:749624035
945 945 c, t dbSNP:757810882
948 948 a, t dbSNP:554604284
951 951 a, t dbSNP:745939340
974 974 c, t dbSNP:374622922
975 975 a, c, g dbSNP:191643294
986 986 c, t dbSNP:267600029
993 993 c, t dbSNP:768964804
994 994 a, g dbSNP:368671164
995 995 a, g dbSNP:144313458
1004 1004 c, g dbSNP:766454544
1011 1011 c, t dbSNP:777459994
1038 1038 c, t dbSNP:145539291
1039 1039 a, g dbSNP:767115507
1054 1054 a, g dbSNP:184111056
1066 1066 c, t dbSNP:760417305
1068 1068 c, g dbSNP:763715364
1083 1083 c, t dbSNP:754224809
1091 1091 a, g dbSNP:576991940
1101 1101 c, t dbSNP:779405529
1104 1104 a, g dbSNP:750994850
1108 1108 a, c dbSNP:758825838
1116 1116 -, aag dbSNP:773712230
1116 1116 a, g dbSNP:780219088
1121 1121 a, g dbSNP:747034747
1123 1123 c, t dbSNP:374937807
1128 1128 a, t dbSNP:781521709
1143 1143 c, t dbSNP:545633228
1172 1172 c, g dbSNP:148424051
1174 1174 c, t dbSNP:746687923
1203 1203 a, g dbSNP:756792587
1210 1210 a, g dbSNP:780496991
1227 1227 a, g dbSNP:749564150
1252 1252 a, g dbSNP:572996882
1267 1267 a, g dbSNP:188845060
1381 1381 a, t dbSNP:74409983
1415 1415 c, t dbSNP:530774368
1455 1455 c, t dbSNP:376383308
1478 1478 c, g dbSNP:536872965
1509 1509 c, t dbSNP:72950841
1616 1616 a, g dbSNP:114729477
1645 1645 a, g dbSNP:533580327
1655 1655 c, t dbSNP:181600698
1667 1667 a, g dbSNP:565828392
1675 1675 a, g dbSNP:112882351
1682 1682 a, g dbSNP:773103545
1734 1734 c, g dbSNP:749692437
1749 1749 c, t dbSNP:374413811
1778 1778 c, t dbSNP:548243828
1807 1807 c, t dbSNP:142549499
1870 1870 c, t dbSNP:536614923
1872 1872 c, g dbSNP:78856150
1879 1879 a, t dbSNP:185541614
1886 1886 c, t dbSNP:570614939
1912 1912 a, g dbSNP:539664731
1934 1934 a, g dbSNP:760991571
1938 1938 a, g dbSNP:555681986
1965 1965 a, g dbSNP:771012374
1973 1973 c, t dbSNP:552726676
1976 1976 c, t dbSNP:768720995
1998 1998 g, t dbSNP:540215076
2015 2015 a, g dbSNP:562734754
2016 2016 c, t dbSNP:111385622
2028 2028 a, c dbSNP:535567216
2064 2064 a, g dbSNP:147593159
2182 2182 -, g dbSNP:555018325
2189 2189 -, tacaactacatctacaactacaaacctgatgacca dbSNP:562586213
2190 2190 a, g dbSNP:575595640
2191 2191 g, t dbSNP:574804780
2196 2196 c, g dbSNP:774637500
2212 2212 a, g dbSNP:544237745
2255 2255 c, t dbSNP:200764256
2285 2285 g, t dbSNP:190416172
2302 2302 a, t dbSNP:375194713
2307 2307 a, g dbSNP:573591323
2321 2321 -, tg dbSNP:761741912
2353 2353 a, c dbSNP:759292618
2359 2359 a, g dbSNP:564976817
2363 2363 a, t dbSNP:182596446
2382 2382 a, g dbSNP:752613281
2480 2480 a, g dbSNP:111561610
2500 2500 c, t dbSNP:529476650
2527 2527 a, g dbSNP:548327835
2534 2534 a, g dbSNP:772249563
2543 2543 a, g dbSNP:561582557
2546 2546 a, g dbSNP:576920922
2549 2549 c, t dbSNP:544249620
2552 2552 c, t dbSNP:776544317
2659 2659 a, g dbSNP:530538534
2685 2685 c, t dbSNP:185925141
2776 2776 a, c dbSNP:756955007
2804 2804 a, t dbSNP:780680164
2857 2857 a, g dbSNP:114134771
2892 2892 c, t dbSNP:539331555
2943 2943 a, g dbSNP:546453862
2970 2970 -, ttctg dbSNP:377206435
2977 2977 a, t dbSNP:566349317
2993 2993 a, g dbSNP:755382235
3018 3018 -, t dbSNP:150630369
3027 3027 c, t dbSNP:79927727
3031 3031 c, t dbSNP:555448380
3041 3041 c, t dbSNP:147742767
3053 3053 c, t dbSNP:189992747
3063 3063 a, t dbSNP:141116337
3064 3064 c, t dbSNP:528427721
3151 3151 a, t dbSNP:181194454
3156 3156 a, g dbSNP:150239306
3214 3214 a, g dbSNP:772671304
3217 3217 c, t dbSNP:72723824
3277 3277 a, g dbSNP:763600036
3283 3283 c, g, t dbSNP:138876977
3291 3291 a, g dbSNP:532931521
3340 3340 a, t dbSNP:543204236
3370 3370 a, c dbSNP:561863636
3400 3400 c, t dbSNP:530499633
3403 3403 a, c dbSNP:751286054
3424 3424 a, g dbSNP:747040589
3439 3439 a, g dbSNP:13129907
3447 3447 a, t dbSNP:74719174
3455 3455 a, t dbSNP:759380432
3476 3476 a, g dbSNP:532736675
3535 3535 c, g dbSNP:546490347
3545 3545 a, g dbSNP:185788250
3615 3615 a, g dbSNP:566386419
3637 3637 c, t dbSNP:529092235
3648 3648 a, g dbSNP:775199322
3650 3650 c, g dbSNP:762908276
3659 3659 c, g dbSNP:763886975
3661 3661 a, g dbSNP:548904365
3680 3680 g, t dbSNP:569363374
3683 3683 c, t dbSNP:7699187
3693 3693 -, ctca dbSNP:764845583
3694 3694 -, ctca dbSNP:111858031
3696 3696 c, g dbSNP:558200462
3697 3697 -, actc dbSNP:60186480
3720 3720 c, t dbSNP:568954220
3728 3728 a, g dbSNP:761226923
3733 3733 a, g dbSNP:72723825
3763 3763 a, t dbSNP:750115092
3792 3792 g, t dbSNP:190507341
3843 3843 a, t dbSNP:7699166
3882 3882 c, t dbSNP:7675466
3883 3883 a, g dbSNP:543019315
3890 3890 c, t dbSNP:779456225
3913 3913 c, t dbSNP:143687604
3941 3941 a, g dbSNP:17020500
3958 3958 g, t dbSNP:758996405
3979 3979 a, g dbSNP:755382846
4049 4049 -, atatg dbSNP:534264968
4110 4110 a, c dbSNP:576544645
4111 4111 c, t dbSNP:747177286
4122 4122 a, c dbSNP:757267017
4130 4130 c, t dbSNP:781271928
4180 4180 c, g dbSNP:183480840
4194 4194 a, c dbSNP:71614553
4211 4211 c, t dbSNP:746091108
4221 4221 c, t dbSNP:769964379
4226 4226 a, g dbSNP:775285481
4256 4256 a, g dbSNP:564158904
4279 4279 a, g dbSNP:188863865
4329 4329 a, c dbSNP:539831571
4333 4333 -, a dbSNP:33978754
4334 4334 a, c dbSNP:79354747
4346 4346 -, aaaa dbSNP:77756937
4349 4349 -, a dbSNP:397709371
4360 4360 a, g dbSNP:142885287

Target ORF information:

RefSeq Version XM_011531686
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens methylmalonic aciduria (cobalamin deficiency) cblA type (MMAA), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.