Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

DES desmin [Homo sapiens (human)]

Gene Symbol DES
Entrez Gene ID 1674
Full Name desmin
Synonyms CSM1, CSM2, LGMD2R
General protein information
Preferred Names
intermediate filament protein
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a muscle-specific class III intermediate filament. Homopolymers of this protein form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane. Mutations in this gene are associated with desmin-related myopathy, a familial cardiac and skeletal myopathy (CSM), and with distal myopathies. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Myopathy, desmin-related, cardioskeletal, 601419 (3);
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu22932 NM_001927 Homo sapiens desmin (DES), mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu22932D
Sequence Information ORF Nucleotide Sequence (Length: 1413bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product desmin
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC032116.2, BQ941246.1, AL541778.3 and BC010072.2. This sequence is a reference standard in the RefSeqGene project. On Nov 15, 2004 this sequence version replaced gi:18105049. Summary: This gene encodes a muscle-specific class III intermediate filament. Homopolymers of this protein form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane. Mutations in this gene are associated with desmin-related myopathy, a familial cardiac and skeletal myopathy (CSM), and with distal myopathies. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC032116.2, U59167.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)87..407(+)
Misc Feature(2)111..404(+)
Misc Feature(3)120..122(+)
Misc Feature(4)120..122(+)
Misc Feature(5)135..137(+)
Misc Feature(6)135..137(+)
Misc Feature(7)264..266(+)
Misc Feature(8)264..266(+)
Misc Feature(9)312..314(+)
Misc Feature(10)315..317(+)
Misc Feature(11)405..1331(+)
Misc Feature(12)408..1319(+)
Misc Feature(13)1320..1493(+)
Exon (1)1..664
Gene Synonym:
Exon (2)665..725
Gene Synonym:
Exon (3)726..821
Gene Synonym:
Exon (4)822..983
Gene Synonym:
Exon (5)984..1109
Gene Synonym:
Exon (6)1110..1330
Gene Synonym:
Exon (7)1331..1374
Gene Synonym:
Exon (8)1375..1457
Gene Synonym:
Exon (9)1458..2248
Gene Synonym:
Position Chain Variation Link
14 14 a, g dbSNP:371380520
14 14 -, g dbSNP:35731749
36 36 c, t dbSNP:756369405
39 39 g, t dbSNP:780086761
40 40 c, t dbSNP:749414352
43 43 a, g dbSNP:184826121
53 53 c, t dbSNP:566678471
55 55 a, g dbSNP:746935647
56 56 a, t dbSNP:770778694
60 60 c, t dbSNP:776415825
69 69 c, t dbSNP:759194515
80 80 c, g dbSNP:764966574
81 81 a, g dbSNP:774967446
91 91 g, t dbSNP:58999456
98 98 a, c dbSNP:762566962
104 104 a, g dbSNP:199972656
108 108 a, g dbSNP:752174050
115 115 a, g dbSNP:757839952
120 120 c, t dbSNP:768075842
121 121 c, t dbSNP:267607495
124 124 c, t dbSNP:62636495
126 126 c, t dbSNP:750819338
129 129 c, g, t dbSNP:756390565
132 132 c, t dbSNP:60798368
144 144 a, g dbSNP:759306707
146 146 c, g dbSNP:1058253
147 147 a, g dbSNP:749447320
148 148 c, t dbSNP:755107287
149 149 c, t dbSNP:201458068
151 151 c, g dbSNP:748158450
152 152 a, g dbSNP:767502653
154 154 a, g, t dbSNP:3903257
160 160 a, c dbSNP:745708897
161 161 a, g dbSNP:1318299
165 165 a, g dbSNP:727504877
179 179 c, g, t dbSNP:2017800
182 182 g, t dbSNP:763767383
185 185 c, t dbSNP:774006810
186 186 a, g dbSNP:761354307
191 191 a, c dbSNP:768166041
193 193 c, g dbSNP:750861089
195 195 c, g, t dbSNP:537881554
197 197 a, g dbSNP:754155708
198 198 a, g dbSNP:755197219
199 199 a, c dbSNP:779049308
200 200 a, g, t dbSNP:368901105
201 201 a, g dbSNP:758434755
202 202 a, g dbSNP:781231410
207 207 a, g dbSNP:745773759
213 213 a, g dbSNP:397516689
218 218 a, c, t dbSNP:769691296
223 223 a, c, t dbSNP:60794845
225 225 a, g dbSNP:79060489
227 227 a, c dbSNP:749028181
234 234 a, t dbSNP:768441697
252 252 c, g dbSNP:578066781
254 254 a, g dbSNP:761446587
256 256 c, t dbSNP:372825868
262 262 c, t dbSNP:773826073
269 269 a, c dbSNP:2854887
271 271 a, g dbSNP:760109356
279 279 a, g dbSNP:397516692
285 285 a, g dbSNP:753419517
296 296 c, g dbSNP:761255472
298 298 c, t dbSNP:759235186
302 302 a, c dbSNP:375719734
304 304 a, g dbSNP:752518966
310 310 a, g dbSNP:758281008
311 311 a, c, g dbSNP:777582958
313 313 c, t dbSNP:756139205
314 314 c, g, t dbSNP:780233346
315 315 a, g dbSNP:769034192
319 319 g, t dbSNP:573916832
323 323 a, g dbSNP:727503899
329 329 a, c, t dbSNP:201594392
336 336 a, g dbSNP:200545412
345 345 g, t dbSNP:761302314
347 347 a, g dbSNP:770325337
349 349 c, t dbSNP:776158373
363 363 c, t dbSNP:377451653
368 368 c, g dbSNP:397516693
371 371 c, t dbSNP:562875165
372 372 g, t dbSNP:201190593
377 377 a, g dbSNP:775205419
385 385 a, c dbSNP:762738069
408 408 a, g dbSNP:62636490
410 410 a, g dbSNP:138677215
414 414 c, g dbSNP:373081285
424 424 -, ag dbSNP:267607497
426 426 -, gag dbSNP:267607493
431 431 a, c dbSNP:757262397
433 433 a, g dbSNP:267607499
434 434 c, t dbSNP:766333303
439 439 a, g dbSNP:753997202
449 449 c, g dbSNP:755196132
453 453 a, g dbSNP:376048590
455 455 -, c dbSNP:747289875
455 455 c, g, t dbSNP:2666105
457 457 a, g dbSNP:564121737
458 458 a, g dbSNP:34365369
463 463 a, t dbSNP:747443082
466 466 c, g dbSNP:397516694
477 477 a, c dbSNP:771499260
488 488 a, g dbSNP:369297392
490 490 c, t dbSNP:546741834
493 493 a, t dbSNP:397516695
494 494 c, t dbSNP:111828114
496 496 c, t dbSNP:775115627
497 497 c, g dbSNP:549278754
501 501 c, g dbSNP:763769862
524 524 c, g, t dbSNP:569103926
530 530 c, g dbSNP:767505861
546 546 a, c dbSNP:753904474
547 547 a, t dbSNP:755106109
552 552 a, g dbSNP:765471098
602 602 -, gc dbSNP:769096434
603 603 -, cgcgcgcgcgtcgacgtcgag dbSNP:60538473
603 603 a, c dbSNP:752944882
605 605 c, g dbSNP:758686466
606 606 c, g dbSNP:538229035
625 625 g, t dbSNP:747420535
626 626 c, t dbSNP:757644636
668 668 a, g dbSNP:397516696
670 670 a, c, g dbSNP:761676074
679 679 c, t dbSNP:773271116
686 686 -, g dbSNP:727504448
688 688 a, g dbSNP:760744645
689 689 c, g dbSNP:765376573
695 695 a, c dbSNP:369495436
707 707 c, t dbSNP:763036386
708 708 c, t dbSNP:764389526
709 709 c, g, t dbSNP:373062962
714 714 a, g dbSNP:576601480
720 720 c, t dbSNP:781590560
721 721 a, g dbSNP:144261171
724 724 c, t dbSNP:41272699
725 725 a, g dbSNP:377337947
728 728 c, t dbSNP:370239228
729 729 a, g, t dbSNP:144908941
733 733 a, g dbSNP:778338200
735 735 a, g dbSNP:747805595
736 736 a, c dbSNP:771882136
742 742 c, t dbSNP:144901249
748 748 c, t dbSNP:746814065
750 750 c, t dbSNP:374687448
751 751 a, g dbSNP:367961979
753 753 a, g dbSNP:745847521
755 755 c, t dbSNP:75882680
759 759 c, t dbSNP:774330779
762 762 a, g dbSNP:761978219
765 765 a, c, t dbSNP:767743962
766 766 a, g dbSNP:141486420
767 767 c, g, t dbSNP:113288175
769 769 g, t dbSNP:754350026
776 776 a, g dbSNP:142145822
780 780 c, t dbSNP:764764823
783 783 a, g dbSNP:752276536
785 785 c, t dbSNP:758066814
786 786 a, g dbSNP:774739275
791 791 a, g dbSNP:370836572
795 795 a, g dbSNP:397516697
796 796 c, t dbSNP:374144840
797 797 a, g dbSNP:757102249
800 800 c, t dbSNP:780896752
806 806 -, a dbSNP:57659464
807 807 a, g dbSNP:201945924
812 812 a, g dbSNP:745782708
813 813 c, t dbSNP:769647148
821 821 c, g dbSNP:267607486
822 822 a, g dbSNP:144057476
826 826 -, a dbSNP:35419667
828 828 c, t dbSNP:772117708
829 829 a, g dbSNP:375906682
871 871 a, t dbSNP:147327878
878 878 c, t dbSNP:150370918
898 898 c, t dbSNP:776995850
902 902 c, t dbSNP:759823001
903 903 a, g dbSNP:770258461
905 905 a, c dbSNP:776125412
907 907 c, g, t dbSNP:267607494
908 908 c, t dbSNP:763599850
911 911 a, g dbSNP:369144706
914 914 c, t dbSNP:1058261
919 919 a, g dbSNP:761475402
923 923 c, t dbSNP:372532465
925 925 a, g dbSNP:750160975
941 941 a, g dbSNP:139818514
949 949 a, g dbSNP:779875721
961 961 c, g dbSNP:753745620
971 971 a, g dbSNP:146755676
977 977 a, g dbSNP:754941710
979 979 c, t dbSNP:62636491
980 980 a, g dbSNP:747073500
990 990 a, g dbSNP:753655637
995 995 a, g dbSNP:754852794
998 998 c, t dbSNP:778826152
1002 1002 a, g dbSNP:752747277
1009 1009 a, g dbSNP:375709017
1010 1010 a, c, t dbSNP:578191306
1019 1019 c, t dbSNP:756434148
1020 1020 a, g dbSNP:34337334
1021 1021 a, c dbSNP:148947510
1022 1022 c, t dbSNP:769213907
1023 1023 a, g dbSNP:766252091
1029 1029 c, t dbSNP:748742357
1030 1030 a, g, t dbSNP:771455648
1044 1044 a, g dbSNP:751348358
1048 1048 a, t dbSNP:760197212
1060 1060 a, g dbSNP:766035912
1064 1064 c, t dbSNP:375238266
1066 1066 a, c dbSNP:397516700
1070 1070 c, t dbSNP:776345779
1071 1071 c, t dbSNP:759320891
1079 1079 c, t dbSNP:200858541
1081 1081 a, c, t dbSNP:368453327
1094 1094 c, t dbSNP:531293539
1095 1095 a, c, g dbSNP:59962885
1097 1097 c, t dbSNP:369537705
1099 1099 g, t dbSNP:57496341
1100 1100 c, g dbSNP:12920
1110 1110 a, g dbSNP:267607482
1112 1112 c, t dbSNP:61731508
1113 1113 a, g dbSNP:763903197
1120 1120 c, t dbSNP:57639980
1124 1124 a, g dbSNP:778340812
1128 1128 a, c dbSNP:747571500
1133 1133 a, g dbSNP:375005961
1134 1134 c, t dbSNP:62636492
1135 1135 a, c, g dbSNP:57965306
1136 1136 a, g dbSNP:769505280
1141 1141 c, t dbSNP:775085773
1149 1149 c, t dbSNP:762808690
1150 1150 a, c, g dbSNP:61368398
1152 1152 c, t dbSNP:774411836
1155 1155 c, g dbSNP:58898021
1161 1161 -, gaggccagt dbSNP:58409037
1163 1163 a, g dbSNP:756205824
1164 1164 c, g dbSNP:121913000
1165 1165 c, t dbSNP:141592925
1175 1175 a, c dbSNP:766531033
1180 1180 a, t dbSNP:753995173
1182 1182 -, aac dbSNP:58687088
1185 1185 a, c, g, t dbSNP:62636494
1189 1189 c, t dbSNP:371830218
1190 1190 a, g dbSNP:1058284
1193 1193 a, c dbSNP:778046116
1195 1195 c, t dbSNP:59308628
1202 1202 a, g dbSNP:752030448
1203 1203 a, g dbSNP:757792359
1205 1205 a, t dbSNP:780628142
1209 1209 c, t dbSNP:375218723
1212 1212 c, t dbSNP:57404866
1214 1214 c, t dbSNP:769260641
1219 1219 a, c dbSNP:202010947
1228 1228 c, t dbSNP:779749720
1233 1233 c, t dbSNP:748945548
1240 1240 c, t dbSNP:57955682
1242 1242 c, t dbSNP:369765867
1244 1244 c, t dbSNP:774323736
1252 1252 a, c dbSNP:121913004
1259 1259 a, g dbSNP:761797652
1261 1261 c, t dbSNP:62636493
1264 1264 a, g, t dbSNP:121913001
1266 1266 a, g dbSNP:776786349
1275 1275 a, g dbSNP:727502951
1281 1281 g, t dbSNP:61130669
1283 1283 g, t dbSNP:765293482
1287 1287 a, g dbSNP:57694264
1295 1295 c, t dbSNP:200054661
1302 1302 c, t dbSNP:121913003
1312 1312 c, t dbSNP:397516687
1313 1313 a, g dbSNP:143954788
1323 1323 a, g dbSNP:61726467
1328 1328 c, t dbSNP:764402662
1329 1329 c, t dbSNP:751942358
1331 1331 a, g dbSNP:762158541
1336 1336 a, g dbSNP:376141178
1341 1341 c, t dbSNP:62635763
1343 1343 c, t dbSNP:143154982
1346 1346 c, t dbSNP:397516688
1348 1348 a, g dbSNP:756613339
1355 1355 c, t dbSNP:765867148
1358 1358 c, t dbSNP:370720293
1359 1359 c, g dbSNP:753305257
1362 1362 c, t dbSNP:754592742
1366 1366 a, g dbSNP:142712150
1367 1367 c, t dbSNP:17853018
1368 1368 g, t dbSNP:758247019
1371 1371 c, t dbSNP:150974575
1372 1372 a, c, g dbSNP:200580581
1387 1387 a, g dbSNP:777575289
1395 1395 a, g dbSNP:572525055
1409 1409 c, t dbSNP:751325263
1411 1411 c, t dbSNP:121913005
1419 1419 a, g dbSNP:267607498
1420 1420 c, t dbSNP:147803084
1421 1421 a, g dbSNP:780984657
1432 1432 a, c dbSNP:267607485
1439 1439 c, g, t dbSNP:121913002
1444 1444 c, t dbSNP:267607488
1446 1446 c, t dbSNP:267607490
1447 1447 a, g dbSNP:541585670
1449 1449 a, g dbSNP:778998180
1452 1452 a, g dbSNP:397516690
1456 1456 a, t dbSNP:267607496
1458 1458 a, g dbSNP:762635412
1460 1460 c, t dbSNP:727502952
1461 1461 a, g dbSNP:73991549
1465 1465 g, t dbSNP:267607491
1471 1471 a, c dbSNP:756984927
1472 1472 c, g dbSNP:1135931
1484 1484 a, g dbSNP:371644801
1490 1490 a, g dbSNP:397516691
1491 1491 a, g dbSNP:267607487
1507 1507 a, g dbSNP:778910048
1510 1510 c, t dbSNP:369913496
1517 1517 c, t dbSNP:748235694
1518 1518 a, g dbSNP:560344912
1527 1527 c, t dbSNP:575130072
1528 1528 a, g dbSNP:747305981
1540 1540 a, g dbSNP:771171473
1543 1543 c, t dbSNP:777083715
1550 1550 a, c dbSNP:372291142
1581 1581 a, g dbSNP:544267874
1583 1583 a, g dbSNP:564082825
1600 1600 a, t dbSNP:577767946
1611 1611 c, g dbSNP:540351476
1613 1613 g, t dbSNP:755277387
1675 1675 g, t dbSNP:553673192
1697 1697 a, g dbSNP:560055588
1723 1723 a, c dbSNP:529122515
1784 1784 c, t dbSNP:548986110
1800 1800 -, c dbSNP:760272041
1807 1807 a, c dbSNP:140222667
1842 1842 c, t dbSNP:1058616
1860 1860 c, t dbSNP:150319065
1875 1875 a, g dbSNP:768035073
1916 1916 a, g dbSNP:551321742
1942 1942 a, t dbSNP:1058876
1967 1967 g, t dbSNP:73085265
1974 1974 g, t dbSNP:138913201
1978 1978 a, t dbSNP:745307832
1991 1991 a, g dbSNP:757955535
2058 2058 a, g dbSNP:547498920
2087 2087 a, g dbSNP:746886224
2146 2146 c, t dbSNP:567741120
2160 2160 g, t dbSNP:371079685
2161 2161 a, g dbSNP:116635264
2169 2169 a, c dbSNP:13012557
2180 2180 a, c dbSNP:113832558
2183 2183 c, t dbSNP:181219659
2193 2193 c, t dbSNP:2859788
2242 2242 a, g dbSNP:111793338

Target ORF information:

RefSeq Version NM_001927
Organism Homo sapiens (human)
Definition Homo sapiens desmin (DES), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.