Email to GenScript

DES desmin [Homo sapiens (human)]

Gene Symbol DES
Entrez Gene ID 1674
Full Name desmin
Synonyms CSM1, CSM2, LGMD2R
General protein information
Preferred Names
intermediate filament protein
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a muscle-specific class III intermediate filament. Homopolymers of this protein form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane. Mutations in this gene are associated with desmin-related myopathy, a familial cardiac and skeletal myopathy (CSM), and with distal myopathies. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Myopathy, desmin-related, cardioskeletal, 601419 (3);

The following DES gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the DES gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu22932 NM_001927 Homo sapiens desmin (DES), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $379

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu22932
Accession Version NM_001927.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1413bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product desmin
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC032116.2, BQ941246.1, AL541778.3 and BC010072.2. This sequence is a reference standard in the RefSeqGene project. On Nov 15, 2004 this sequence version replaced gi:18105049. Summary: This gene encodes a muscle-specific class III intermediate filament. Homopolymers of this protein form a stable intracytoplasmic filamentous network connecting myofibrils to each other and to the plasma membrane. Mutations in this gene are associated with desmin-related myopathy, a familial cardiac and skeletal myopathy (CSM), and with distal myopathies. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC032116.2, U59167.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1966682 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length.

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)87..407(+)
Misc Feature(2)111..404(+)
Misc Feature(3)120..122(+)
Misc Feature(4)120..122(+)
Misc Feature(5)135..137(+)
Misc Feature(6)135..137(+)
Misc Feature(7)264..266(+)
Misc Feature(8)264..266(+)
Misc Feature(9)312..314(+)
Misc Feature(10)315..317(+)
Misc Feature(11)405..1331(+)
Misc Feature(12)408..1319(+)
Misc Feature(13)1320..1493(+)
Exon (1)1..664
Gene Synonym:
Exon (2)665..725
Gene Synonym:
Exon (3)726..821
Gene Synonym:
Exon (4)822..983
Gene Synonym:
Exon (5)984..1109
Gene Synonym:
Exon (6)1110..1330
Gene Synonym:
Exon (7)1331..1374
Gene Synonym:
Exon (8)1375..1457
Gene Synonym:
Exon (9)1458..2248
Gene Synonym:
Position Chain Variation Link
14 14 a, g dbSNP:371380520
14 14 -, g dbSNP:35731749
36 36 c, t dbSNP:756369405
39 39 g, t dbSNP:780086761
40 40 c, t dbSNP:749414352
43 43 a, g dbSNP:184826121
53 53 c, t dbSNP:566678471
55 55 a, g dbSNP:746935647
56 56 a, t dbSNP:770778694
60 60 c, t dbSNP:776415825
69 69 c, t dbSNP:759194515
80 80 c, g dbSNP:764966574
81 81 a, g dbSNP:774967446
91 91 g, t dbSNP:58999456
98 98 a, c dbSNP:762566962
104 104 a, g dbSNP:199972656
108 108 a, g dbSNP:752174050
115 115 a, g dbSNP:757839952
120 120 c, t dbSNP:768075842
121 121 c, t dbSNP:267607495
124 124 c, t dbSNP:62636495
126 126 c, t dbSNP:750819338
129 129 c, g, t dbSNP:756390565
132 132 c, t dbSNP:60798368
144 144 a, g dbSNP:759306707
146 146 c, g dbSNP:1058253
147 147 a, g dbSNP:749447320
148 148 c, t dbSNP:755107287
149 149 c, t dbSNP:201458068
151 151 c, g dbSNP:748158450
152 152 a, g dbSNP:767502653
154 154 a, g, t dbSNP:3903257
160 160 a, c dbSNP:745708897
161 161 a, g dbSNP:1318299
165 165 a, g dbSNP:727504877
179 179 c, g, t dbSNP:2017800
182 182 g, t dbSNP:763767383
185 185 c, t dbSNP:774006810
186 186 a, g dbSNP:761354307
191 191 a, c dbSNP:768166041
193 193 c, g dbSNP:750861089
195 195 c, g, t dbSNP:537881554
197 197 a, g dbSNP:754155708
198 198 a, g dbSNP:755197219
199 199 a, c dbSNP:779049308
200 200 a, g, t dbSNP:368901105
201 201 a, g dbSNP:758434755
202 202 a, g dbSNP:781231410
207 207 a, g dbSNP:745773759
213 213 a, g dbSNP:397516689
218 218 a, c, t dbSNP:769691296
223 223 a, c, t dbSNP:60794845
225 225 a, g dbSNP:79060489
227 227 a, c dbSNP:749028181
234 234 a, t dbSNP:768441697
252 252 c, g dbSNP:578066781
254 254 a, g dbSNP:761446587
256 256 c, t dbSNP:372825868
262 262 c, t dbSNP:773826073
269 269 a, c dbSNP:2854887
271 271 a, g dbSNP:760109356
279 279 a, g dbSNP:397516692
285 285 a, g dbSNP:753419517
296 296 c, g dbSNP:761255472
298 298 c, t dbSNP:759235186
302 302 a, c dbSNP:375719734
304 304 a, g dbSNP:752518966
310 310 a, g dbSNP:758281008
311 311 a, c, g dbSNP:777582958
313 313 c, t dbSNP:756139205
314 314 c, g, t dbSNP:780233346
315 315 a, g dbSNP:769034192
319 319 g, t dbSNP:573916832
323 323 a, g dbSNP:727503899
329 329 a, c, t dbSNP:201594392
336 336 a, g dbSNP:200545412
345 345 g, t dbSNP:761302314
347 347 a, g dbSNP:770325337
349 349 c, t dbSNP:776158373
363 363 c, t dbSNP:377451653
368 368 c, g dbSNP:397516693
371 371 c, t dbSNP:562875165
372 372 g, t dbSNP:201190593
377 377 a, g dbSNP:775205419
385 385 a, c dbSNP:762738069
408 408 a, g dbSNP:62636490
410 410 a, g dbSNP:138677215
414 414 c, g dbSNP:373081285
424 424 -, ag dbSNP:267607497
426 426 -, gag dbSNP:267607493
431 431 a, c dbSNP:757262397
433 433 a, g dbSNP:267607499
434 434 c, t dbSNP:766333303
439 439 a, g dbSNP:753997202
449 449 c, g dbSNP:755196132
453 453 a, g dbSNP:376048590
455 455 -, c dbSNP:747289875
455 455 c, g, t dbSNP:2666105
457 457 a, g dbSNP:564121737
458 458 a, g dbSNP:34365369
463 463 a, t dbSNP:747443082
466 466 c, g dbSNP:397516694
477 477 a, c dbSNP:771499260
488 488 a, g dbSNP:369297392
490 490 c, t dbSNP:546741834
493 493 a, t dbSNP:397516695
494 494 c, t dbSNP:111828114
496 496 c, t dbSNP:775115627
497 497 c, g dbSNP:549278754
501 501 c, g dbSNP:763769862
524 524 c, g, t dbSNP:569103926
530 530 c, g dbSNP:767505861
546 546 a, c dbSNP:753904474
547 547 a, t dbSNP:755106109
552 552 a, g dbSNP:765471098
602 602 -, gc dbSNP:769096434
603 603 -, cgcgcgcgcgtcgacgtcgag dbSNP:60538473
603 603 a, c dbSNP:752944882
605 605 c, g dbSNP:758686466
606 606 c, g dbSNP:538229035
625 625 g, t dbSNP:747420535
626 626 c, t dbSNP:757644636
668 668 a, g dbSNP:397516696
670 670 a, c, g dbSNP:761676074
679 679 c, t dbSNP:773271116
686 686 -, g dbSNP:727504448
688 688 a, g dbSNP:760744645
689 689 c, g dbSNP:765376573
695 695 a, c dbSNP:369495436
707 707 c, t dbSNP:763036386
708 708 c, t dbSNP:764389526
709 709 c, g, t dbSNP:373062962
714 714 a, g dbSNP:576601480
720 720 c, t dbSNP:781590560
721 721 a, g dbSNP:144261171
724 724 c, t dbSNP:41272699
725 725 a, g dbSNP:377337947
728 728 c, t dbSNP:370239228
729 729 a, g, t dbSNP:144908941
733 733 a, g dbSNP:778338200
735 735 a, g dbSNP:747805595
736 736 a, c dbSNP:771882136
742 742 c, t dbSNP:144901249
748 748 c, t dbSNP:746814065
750 750 c, t dbSNP:374687448
751 751 a, g dbSNP:367961979
753 753 a, g dbSNP:745847521
755 755 c, t dbSNP:75882680
759 759 c, t dbSNP:774330779
762 762 a, g dbSNP:761978219
765 765 a, c, t dbSNP:767743962
766 766 a, g dbSNP:141486420
767 767 c, g, t dbSNP:113288175
769 769 g, t dbSNP:754350026
776 776 a, g dbSNP:142145822
780 780 c, t dbSNP:764764823
783 783 a, g dbSNP:752276536
785 785 c, t dbSNP:758066814
786 786 a, g dbSNP:774739275
791 791 a, g dbSNP:370836572
795 795 a, g dbSNP:397516697
796 796 c, t dbSNP:374144840
797 797 a, g dbSNP:757102249
800 800 c, t dbSNP:780896752
806 806 -, a dbSNP:57659464
807 807 a, g dbSNP:201945924
812 812 a, g dbSNP:745782708
813 813 c, t dbSNP:769647148
821 821 c, g dbSNP:267607486
822 822 a, g dbSNP:144057476
826 826 -, a dbSNP:35419667
828 828 c, t dbSNP:772117708
829 829 a, g dbSNP:375906682
871 871 a, t dbSNP:147327878
878 878 c, t dbSNP:150370918
898 898 c, t dbSNP:776995850
902 902 c, t dbSNP:759823001
903 903 a, g dbSNP:770258461
905 905 a, c dbSNP:776125412
907 907 c, g, t dbSNP:267607494
908 908 c, t dbSNP:763599850
911 911 a, g dbSNP:369144706
914 914 c, t dbSNP:1058261
919 919 a, g dbSNP:761475402
923 923 c, t dbSNP:372532465
925 925 a, g dbSNP:750160975
941 941 a, g dbSNP:139818514
949 949 a, g dbSNP:779875721
961 961 c, g dbSNP:753745620
971 971 a, g dbSNP:146755676
977 977 a, g dbSNP:754941710
979 979 c, t dbSNP:62636491
980 980 a, g dbSNP:747073500
990 990 a, g dbSNP:753655637
995 995 a, g dbSNP:754852794
998 998 c, t dbSNP:778826152
1002 1002 a, g dbSNP:752747277
1009 1009 a, g dbSNP:375709017
1010 1010 a, c, t dbSNP:578191306
1019 1019 c, t dbSNP:756434148
1020 1020 a, g dbSNP:34337334
1021 1021 a, c dbSNP:148947510
1022 1022 c, t dbSNP:769213907
1023 1023 a, g dbSNP:766252091
1029 1029 c, t dbSNP:748742357
1030 1030 a, g, t dbSNP:771455648
1044 1044 a, g dbSNP:751348358
1048 1048 a, t dbSNP:760197212
1060 1060 a, g dbSNP:766035912
1064 1064 c, t dbSNP:375238266
1066 1066 a, c dbSNP:397516700
1070 1070 c, t dbSNP:776345779
1071 1071 c, t dbSNP:759320891
1079 1079 c, t dbSNP:200858541
1081 1081 a, c, t dbSNP:368453327
1094 1094 c, t dbSNP:531293539
1095 1095 a, c, g dbSNP:59962885
1097 1097 c, t dbSNP:369537705
1099 1099 g, t dbSNP:57496341
1100 1100 c, g dbSNP:12920
1110 1110 a, g dbSNP:267607482
1112 1112 c, t dbSNP:61731508
1113 1113 a, g dbSNP:763903197
1120 1120 c, t dbSNP:57639980
1124 1124 a, g dbSNP:778340812
1128 1128 a, c dbSNP:747571500
1133 1133 a, g dbSNP:375005961
1134 1134 c, t dbSNP:62636492
1135 1135 a, c, g dbSNP:57965306
1136 1136 a, g dbSNP:769505280
1141 1141 c, t dbSNP:775085773
1149 1149 c, t dbSNP:762808690
1150 1150 a, c, g dbSNP:61368398
1152 1152 c, t dbSNP:774411836
1155 1155 c, g dbSNP:58898021
1161 1161 -, gaggccagt dbSNP:58409037
1163 1163 a, g dbSNP:756205824
1164 1164 c, g dbSNP:121913000
1165 1165 c, t dbSNP:141592925
1175 1175 a, c dbSNP:766531033
1180 1180 a, t dbSNP:753995173
1182 1182 -, aac dbSNP:58687088
1185 1185 a, c, g, t dbSNP:62636494
1189 1189 c, t dbSNP:371830218
1190 1190 a, g dbSNP:1058284
1193 1193 a, c dbSNP:778046116
1195 1195 c, t dbSNP:59308628
1202 1202 a, g dbSNP:752030448
1203 1203 a, g dbSNP:757792359
1205 1205 a, t dbSNP:780628142
1209 1209 c, t dbSNP:375218723
1212 1212 c, t dbSNP:57404866
1214 1214 c, t dbSNP:769260641
1219 1219 a, c dbSNP:202010947
1228 1228 c, t dbSNP:779749720
1233 1233 c, t dbSNP:748945548
1240 1240 c, t dbSNP:57955682
1242 1242 c, t dbSNP:369765867
1244 1244 c, t dbSNP:774323736
1252 1252 a, c dbSNP:121913004
1259 1259 a, g dbSNP:761797652
1261 1261 c, t dbSNP:62636493
1264 1264 a, g, t dbSNP:121913001
1266 1266 a, g dbSNP:776786349
1275 1275 a, g dbSNP:727502951
1281 1281 g, t dbSNP:61130669
1283 1283 g, t dbSNP:765293482
1287 1287 a, g dbSNP:57694264
1295 1295 c, t dbSNP:200054661
1302 1302 c, t dbSNP:121913003
1312 1312 c, t dbSNP:397516687
1313 1313 a, g dbSNP:143954788
1323 1323 a, g dbSNP:61726467
1328 1328 c, t dbSNP:764402662
1329 1329 c, t dbSNP:751942358
1331 1331 a, g dbSNP:762158541
1336 1336 a, g dbSNP:376141178
1341 1341 c, t dbSNP:62635763
1343 1343 c, t dbSNP:143154982
1346 1346 c, t dbSNP:397516688
1348 1348 a, g dbSNP:756613339
1355 1355 c, t dbSNP:765867148
1358 1358 c, t dbSNP:370720293
1359 1359 c, g dbSNP:753305257
1362 1362 c, t dbSNP:754592742
1366 1366 a, g dbSNP:142712150
1367 1367 c, t dbSNP:17853018
1368 1368 g, t dbSNP:758247019
1371 1371 c, t dbSNP:150974575
1372 1372 a, c, g dbSNP:200580581
1387 1387 a, g dbSNP:777575289
1395 1395 a, g dbSNP:572525055
1409 1409 c, t dbSNP:751325263
1411 1411 c, t dbSNP:121913005
1419 1419 a, g dbSNP:267607498
1420 1420 c, t dbSNP:147803084
1421 1421 a, g dbSNP:780984657
1432 1432 a, c dbSNP:267607485
1439 1439 c, g, t dbSNP:121913002
1444 1444 c, t dbSNP:267607488
1446 1446 c, t dbSNP:267607490
1447 1447 a, g dbSNP:541585670
1449 1449 a, g dbSNP:778998180
1452 1452 a, g dbSNP:397516690
1456 1456 a, t dbSNP:267607496
1458 1458 a, g dbSNP:762635412
1460 1460 c, t dbSNP:727502952
1461 1461 a, g dbSNP:73991549
1465 1465 g, t dbSNP:267607491
1471 1471 a, c dbSNP:756984927
1472 1472 c, g dbSNP:1135931
1484 1484 a, g dbSNP:371644801
1490 1490 a, g dbSNP:397516691
1491 1491 a, g dbSNP:267607487
1507 1507 a, g dbSNP:778910048
1510 1510 c, t dbSNP:369913496
1517 1517 c, t dbSNP:748235694
1518 1518 a, g dbSNP:560344912
1527 1527 c, t dbSNP:575130072
1528 1528 a, g dbSNP:747305981
1540 1540 a, g dbSNP:771171473
1543 1543 c, t dbSNP:777083715
1550 1550 a, c dbSNP:372291142
1581 1581 a, g dbSNP:544267874
1583 1583 a, g dbSNP:564082825
1600 1600 a, t dbSNP:577767946
1611 1611 c, g dbSNP:540351476
1613 1613 g, t dbSNP:755277387
1675 1675 g, t dbSNP:553673192
1697 1697 a, g dbSNP:560055588
1723 1723 a, c dbSNP:529122515
1784 1784 c, t dbSNP:548986110
1800 1800 -, c dbSNP:760272041
1807 1807 a, c dbSNP:140222667
1842 1842 c, t dbSNP:1058616
1860 1860 c, t dbSNP:150319065
1875 1875 a, g dbSNP:768035073
1916 1916 a, g dbSNP:551321742
1942 1942 a, t dbSNP:1058876
1967 1967 g, t dbSNP:73085265
1974 1974 g, t dbSNP:138913201
1978 1978 a, t dbSNP:745307832
1991 1991 a, g dbSNP:757955535
2058 2058 a, g dbSNP:547498920
2087 2087 a, g dbSNP:746886224
2146 2146 c, t dbSNP:567741120
2160 2160 g, t dbSNP:371079685
2161 2161 a, g dbSNP:116635264
2169 2169 a, c dbSNP:13012557
2180 2180 a, c dbSNP:113832558
2183 2183 c, t dbSNP:181219659
2193 2193 c, t dbSNP:2859788
2242 2242 a, g dbSNP:111793338

Target ORF information:

RefSeq Version NM_001927
Organism Homo sapiens (human)
Definition Homo sapiens desmin (DES), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.