Email to GenScript

ACAN aggrecan [Homo sapiens (human)]

Gene Symbol ACAN
Entrez Gene ID 176
Full Name aggrecan
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene is a member of the aggrecan/versican proteoglycan family. The encoded protein is an integral part of the extracellular matrix in cartilagenous tissue and it withstands compression in cartilage. Mutations in this gene may be involved in skeletal dysplasia and spinal degeneration. Multiple alternatively spliced transcript variants that encode different protein isoforms have been observed in this gene. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Spondyloepiphyseal dysplasia, Kimberley type, 608361 (3);

The following ACAN gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the ACAN gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu48152 XM_006720419 PREDICTED: Homo sapiens aggrecan (ACAN), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu56217 XM_011521313 PREDICTED: Homo sapiens aggrecan (ACAN), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu56218 XM_011521314 PREDICTED: Homo sapiens aggrecan (ACAN), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu22082 NM_013227 Homo sapiens aggrecan (ACAN), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu15353 NM_001135 Homo sapiens aggrecan (ACAN), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu48152
Accession Version XM_006720419.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 7707bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product aggrecan core protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010194.18) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)481..825(+)
Misc Feature(2)502..837(+)
Misc Feature(3)832..1116(+)
Misc Feature(4)862..867(+)
Misc Feature(5)1135..1422(+)
Misc Feature(6)1156..1161(+)
Misc Feature(7)1807..2091(+)
Misc Feature(8)1837..1842(+)
Misc Feature(9)2110..2397(+)
Misc Feature(10)2131..2136(+)
Misc Feature(11)7222..7314(+)
Misc Feature(12)7321..7431(+)
Misc Feature(13)7321..7374(+)
Misc Feature(14)7447..7818(+)
Misc Feature(15)7501..7794(+)
Misc Feature(16)7630..7734(+)
Misc Feature(17)7642..7734(+)
Misc Feature(18)7702..7776(+)
Misc Feature(19)7828..7998(+)
Misc Feature(20)7858..7920(+)
Position Chain Variation Link
7 7 a, c dbSNP:529456870
48 48 c, g dbSNP:541646122
68 68 -, tc dbSNP:570563311
71 71 c, g dbSNP:559776025
122 122 c, t dbSNP:546618371
195 195 -, c dbSNP:35909381
200 200 a, t dbSNP:533641712
217 217 a, g dbSNP:552121620
223 223 a, g dbSNP:183056139
235 235 a, g dbSNP:530520157
250 250 c, t dbSNP:752547241
256 256 a, g dbSNP:548798212
287 287 a, c dbSNP:574518392
304 304 c, t dbSNP:756767682
315 315 c, t dbSNP:186720187
341 341 c, g dbSNP:778564136
371 371 g, t dbSNP:759649540
380 380 c, t dbSNP:770071622
381 381 a, c dbSNP:775539020
386 386 c, t dbSNP:202166561
388 388 c, t dbSNP:371249232
400 400 a, g dbSNP:776631256
402 402 c, g dbSNP:760468016
424 424 g, t dbSNP:766063753
425 425 c, t dbSNP:761719517
429 429 a, c dbSNP:753706123
436 436 c, g dbSNP:754672128
447 447 a, c dbSNP:571206900
455 455 a, g dbSNP:752419278
458 458 c, g dbSNP:148320028
459 459 a, g dbSNP:371259802
465 465 g, t dbSNP:751144925
474 474 c, g dbSNP:757687541
475 475 a, c, t dbSNP:550784997
479 479 a, t dbSNP:746169178
481 481 c, t dbSNP:770179538
483 483 a, g dbSNP:569119258
484 484 c, t dbSNP:536525136
488 488 c, t dbSNP:548534627
489 489 a, g dbSNP:367956651
494 494 a, g dbSNP:748319031
495 495 g, t dbSNP:374081272
504 504 a, c, g dbSNP:770715922
509 509 a, c dbSNP:759354442
510 510 c, t dbSNP:372517447
514 514 c, t dbSNP:775463088
516 516 c, t dbSNP:368322348
537 537 c, t dbSNP:377037099
538 538 a, g, t dbSNP:763861381
539 539 a, g dbSNP:370110892
543 543 c, t dbSNP:534678891
546 546 a, g dbSNP:750953875
560 560 a, c dbSNP:200239326
561 561 c, t dbSNP:191648646
562 562 a, g dbSNP:749720584
569 569 a, c dbSNP:755142678
570 570 c, t dbSNP:779210441
572 572 c, t dbSNP:748136311
574 574 a, g dbSNP:182894280
578 578 a, c dbSNP:773473572
579 579 a, c, g dbSNP:372041880
591 591 a, t dbSNP:769916642
592 592 a, g dbSNP:775409722
594 594 c, t dbSNP:762816809
604 604 c, t dbSNP:575468209
605 605 a, g dbSNP:199701329
617 617 a, g dbSNP:373267308
625 625 g, t dbSNP:766995595
652 652 c, g, t dbSNP:565318742
653 653 a, g dbSNP:376202313
654 654 c, t dbSNP:754145054
655 655 a, c, g dbSNP:370626315
658 658 c, t dbSNP:767131816
659 659 a, g dbSNP:539804190
673 673 g, t dbSNP:777992997
675 675 c, t dbSNP:374544549
680 680 a, g dbSNP:769793742
681 681 a, c dbSNP:16942318
694 694 c, t dbSNP:749000770
696 696 c, t dbSNP:768522016
697 697 a, c dbSNP:774066700
698 698 a, g dbSNP:761498283
699 699 a, c dbSNP:771780380
704 704 c, t dbSNP:370458786
705 705 a, g dbSNP:373654303
708 708 c, t dbSNP:766805580
720 720 c, t dbSNP:532105305
721 721 a, g dbSNP:760009352
729 729 a, g dbSNP:765604626
733 733 g, t dbSNP:550721325
741 741 c, t dbSNP:758677795
744 744 a, g dbSNP:778151431
745 745 c, t dbSNP:201105250
746 746 a, g dbSNP:757439227
751 751 a, c dbSNP:780095199
769 769 c, t dbSNP:550510196
770 770 a, g, t dbSNP:768518689
774 774 c, t dbSNP:529879661
775 775 a, g dbSNP:372054790
783 783 a, g dbSNP:772856511
788 788 c, g dbSNP:760138666
792 792 c, t dbSNP:375073497
793 793 a, g dbSNP:776044877
802 802 a, g dbSNP:372286756
804 804 c, g dbSNP:765720290
807 807 a, c dbSNP:376762991
809 809 c, t dbSNP:763410231
810 810 c, g dbSNP:764368613
813 813 a, g dbSNP:35600223
816 816 a, g dbSNP:571646418
819 819 a, c, t dbSNP:371875791
831 831 c, t dbSNP:193277896
834 834 c, t dbSNP:758371121
835 835 a, g dbSNP:370113313
857 857 a, c dbSNP:777539705
863 863 a, g dbSNP:746862356
867 867 c, t dbSNP:375322679
874 874 a, g dbSNP:780709119
876 876 c, t dbSNP:745339413
879 879 g, t dbSNP:769205516
884 884 a, g dbSNP:367881858
887 887 c, t dbSNP:371065660
888 888 a, g dbSNP:541976828
892 892 c, t dbSNP:374211268
893 893 a, g dbSNP:769356878
894 894 g, t dbSNP:368963320
895 895 a, g dbSNP:762284114
896 896 a, c dbSNP:767714238
897 897 c, g dbSNP:773337440
909 909 c, t dbSNP:760759621
911 911 a, g dbSNP:766337526
917 917 a, t dbSNP:199602867
926 926 c, t dbSNP:771509541
927 927 a, g dbSNP:142615277
928 928 a, c dbSNP:751285545
943 943 a, g dbSNP:374984332
945 945 c, t dbSNP:369187075
946 946 a, g dbSNP:527447898
950 950 a, g dbSNP:755834901
951 951 c, t dbSNP:373716409
952 952 a, g dbSNP:748868363
957 957 c, t dbSNP:375544241
959 959 a, g dbSNP:779568883
963 963 c, t dbSNP:531513303
975 975 c, t dbSNP:550550807
976 976 a, g dbSNP:568955745
978 978 c, t dbSNP:146033080
979 979 a, g dbSNP:771241836
1003 1003 a, g dbSNP:776632256
1017 1017 c, t dbSNP:759517649
1018 1018 a, g dbSNP:758772503
1022 1022 c, t dbSNP:191442526
1024 1024 c, g, t dbSNP:370993153
1025 1025 a, g dbSNP:757637229
1031 1031 g, t dbSNP:781581989
1037 1037 a, g dbSNP:746056428
1038 1038 c, t dbSNP:770071513
1042 1042 a, g dbSNP:374644024
1049 1049 -, a dbSNP:768599280
1051 1051 a, g dbSNP:749403999
1070 1070 c, g dbSNP:771842029
1071 1071 a, c, g, t dbSNP:767595242
1076 1076 c, g dbSNP:776609333
1078 1078 a, t dbSNP:759248879
1082 1082 a, g dbSNP:764993901
1089 1089 c, g dbSNP:368549781
1091 1091 a, g dbSNP:757955838
1092 1092 c, t dbSNP:371404599
1093 1093 a, g dbSNP:200578079
1097 1097 c, t dbSNP:757798845
1101 1101 c, t dbSNP:781529260
1114 1114 c, t dbSNP:746292202
1117 1117 a, g dbSNP:564289325
1119 1119 c, t dbSNP:35790816
1120 1120 a, g dbSNP:560781973
1122 1122 a, g dbSNP:768804104
1126 1126 a, c dbSNP:774343061
1127 1127 c, t dbSNP:528232598
1138 1138 a, g dbSNP:377286945
1139 1139 c, t dbSNP:761319997
1169 1169 a, c dbSNP:767977103
1170 1170 c, g dbSNP:750954036
1174 1174 c, g dbSNP:761136902
1180 1180 c, g dbSNP:766735190
1187 1187 a, g dbSNP:754225607
1194 1194 c, t dbSNP:755216954
1195 1195 c, t dbSNP:369870175
1196 1196 a, g dbSNP:373432805
1199 1199 a, g dbSNP:34949187
1203 1203 a, g dbSNP:778047250
1207 1207 -, c dbSNP:35281241
1210 1210 c, t dbSNP:745766545
1211 1211 a, g dbSNP:184913582
1212 1212 a, g dbSNP:779882835
1223 1223 c, t dbSNP:749047801
1224 1224 a, g dbSNP:534544364
1231 1231 c, t dbSNP:774028386
1235 1235 a, g dbSNP:747612281
1241 1241 a, c dbSNP:771549237
1242 1242 -, gta dbSNP:774474651
1243 1243 g, t dbSNP:772749915
1246 1246 c, t dbSNP:761241049
1249 1249 a, g dbSNP:766854282
1253 1253 c, g dbSNP:776985817
1261 1261 a, c dbSNP:759847781
1262 1262 c, t dbSNP:558565679
1268 1268 a, g dbSNP:752944661
1269 1269 c, t dbSNP:576947078
1270 1270 a, g dbSNP:764260441
1272 1272 c, t dbSNP:371531556
1273 1273 a, g dbSNP:746931049
1284 1284 c, t dbSNP:368988256
1288 1288 c, t dbSNP:372895171
1289 1289 a, g dbSNP:768504322
1294 1294 a, g dbSNP:778732470
1298 1298 a, g dbSNP:747767483
1299 1299 c, g dbSNP:117583968
1316 1316 c, g dbSNP:772697028
1317 1317 c, t dbSNP:746517194
1318 1318 c, t dbSNP:771427434
1323 1323 c, g dbSNP:777025489
1325 1325 a, g dbSNP:760137135
1338 1338 c, t dbSNP:765665954
1347 1347 c, t dbSNP:776059900
1348 1348 a, g, t dbSNP:200118502
1354 1354 a, c dbSNP:751588853
1356 1356 c, t dbSNP:560136999
1363 1363 a, g dbSNP:766293702
1366 1366 a, c dbSNP:753701070
1368 1368 c, t dbSNP:570748192
1373 1373 a, g dbSNP:776721559
1379 1379 c, t dbSNP:370865297
1380 1380 a, g dbSNP:572285643
1383 1383 c, t dbSNP:757990771
1387 1387 c, g, t dbSNP:777432522
1388 1388 c, g, t dbSNP:374218750
1390 1390 a, g dbSNP:746352037
1395 1395 c, t dbSNP:770477808
1402 1402 c, t dbSNP:376508432
1403 1403 a, g dbSNP:763412179
1404 1404 a, c dbSNP:12593024
1405 1405 c, t dbSNP:768962559
1406 1406 a, g dbSNP:774462118
1407 1407 c, t dbSNP:762147927
1408 1408 a, g dbSNP:767467522
1411 1411 a, g dbSNP:545729531
1419 1419 c, t dbSNP:759457761
1421 1421 a, g dbSNP:79832113
1436 1436 a, t dbSNP:749910732
1439 1439 c, t dbSNP:755711052
1455 1455 a, c dbSNP:549170099
1467 1467 a, c, g dbSNP:372104051
1469 1469 c, g dbSNP:567446094
1472 1472 a, g dbSNP:755579927
1485 1485 c, t dbSNP:779132656
1488 1488 c, g dbSNP:370104735
1489 1489 a, g dbSNP:372762081
1496 1496 c, g dbSNP:773517396
1499 1499 c, t dbSNP:747278844
1502 1502 c, g dbSNP:377176198
1504 1504 c, t dbSNP:776758695
1507 1507 a, c dbSNP:762863511
1510 1510 a, g dbSNP:764102419
1531 1531 c, g dbSNP:773948197
1532 1532 a, g dbSNP:761696605
1537 1537 a, g dbSNP:767026007
1546 1546 g, t dbSNP:369041225
1556 1556 a, g dbSNP:200709031
1558 1558 a, c, g dbSNP:117772298
1562 1562 a, c, g dbSNP:371018764
1563 1563 c, t dbSNP:572438161
1564 1564 a, g dbSNP:748422617
1570 1570 c, t dbSNP:758765920
1575 1575 c, t dbSNP:778149713
1576 1576 a, g dbSNP:200027891
1579 1579 a, g dbSNP:554949381
1583 1583 a, c dbSNP:368795077
1585 1585 a, g dbSNP:148070768
1590 1590 c, t dbSNP:745961803
1591 1591 a, g dbSNP:774443075
1593 1593 g, t dbSNP:576493396
1594 1594 g, t dbSNP:543647411
1596 1596 c, t dbSNP:16942341
1598 1598 c, g dbSNP:773211569
1601 1601 c, t dbSNP:200227191
1603 1603 a, g dbSNP:766146982
1605 1605 c, t dbSNP:753336473
1606 1606 c, t dbSNP:754551623
1611 1611 a, g dbSNP:116981974
1617 1617 c, t dbSNP:375758859
1618 1618 a, g dbSNP:758892087
1621 1621 a, g dbSNP:370296999
1629 1629 c, t dbSNP:751930065
1630 1630 a, c dbSNP:757403740
1631 1631 c, t dbSNP:374286796
1632 1632 a, g dbSNP:368193007
1640 1640 c, g dbSNP:769892728
1650 1650 c, g dbSNP:780040281
1654 1654 a, g dbSNP:748112955
1662 1662 c, t dbSNP:559634421
1663 1663 a, g, t dbSNP:367659235
1669 1669 g, t dbSNP:770670042
1672 1672 a, g dbSNP:776371059
1674 1674 c, g dbSNP:372157525
1695 1695 c, g dbSNP:368305201
1715 1715 c, t dbSNP:764796784
1717 1717 a, c dbSNP:532736974
1726 1726 a, g dbSNP:372274447
1727 1727 c, g dbSNP:764588967
1736 1736 c, t dbSNP:575245223
1737 1737 a, c, g dbSNP:757639456
1741 1741 c, t dbSNP:181736584
1746 1746 c, g dbSNP:756359756
1747 1747 a, g dbSNP:780169895
1756 1756 c, t dbSNP:749341648
1758 1758 c, t dbSNP:371505346
1759 1759 g, t dbSNP:200734577
1762 1762 a, g dbSNP:777892697
1768 1768 g, t dbSNP:761237568
1773 1773 c, t dbSNP:185960535
1774 1774 a, g dbSNP:770829348
1784 1784 a, g, t dbSNP:749892328
1786 1786 a, c dbSNP:759209767
1790 1790 c, t dbSNP:535720074
1791 1791 a, g dbSNP:530678017
1792 1792 c, t dbSNP:774993574
1800 1800 a, g dbSNP:762481427
1807 1807 g, t dbSNP:748987964
1810 1810 a, g dbSNP:369608360
1815 1815 c, g dbSNP:773918941
1822 1822 c, t dbSNP:780424423
1823 1823 a, g dbSNP:200950723
1838 1838 a, g dbSNP:202205582
1844 1844 c, t dbSNP:117116488
1845 1845 a, g dbSNP:373757072
1851 1851 c, g, t dbSNP:139042772
1858 1858 a, g dbSNP:755294223
1859 1859 a, g dbSNP:538870253
1865 1865 a, t dbSNP:117881662
1871 1871 c, t dbSNP:757190295
1879 1879 c, t dbSNP:149841431
1880 1880 c, g dbSNP:144835580
1882 1882 a, t dbSNP:374406298
1883 1883 c, t dbSNP:779937883
1884 1884 a, g dbSNP:748932986
1890 1890 a, g dbSNP:34957282
1901 1901 c, t dbSNP:773794233
1902 1902 a, g, t dbSNP:371049725
1905 1905 a, g dbSNP:34637731
1906 1906 a, g dbSNP:773619196
1911 1911 g, t dbSNP:761297861
1921 1921 a, g dbSNP:540361430
1922 1922 c, t dbSNP:564985995
1925 1925 a, c dbSNP:759770403
1926 1926 c, t dbSNP:765556817
1927 1927 a, c, g dbSNP:267604363
1931 1931 c, g dbSNP:764283130
1932 1932 a, c dbSNP:750296012
1934 1934 a, g dbSNP:756140760
1942 1942 c, g dbSNP:372777485
1943 1943 a, t dbSNP:753649277
1944 1944 c, g dbSNP:754558595
1950 1950 c, g, t dbSNP:367724066
1951 1951 a, g dbSNP:771465769
1953 1953 c, t dbSNP:777385760
1954 1954 a, g dbSNP:747469866
1955 1955 a, g dbSNP:771478914
1963 1963 a, c, t dbSNP:777066916
1964 1964 a, g dbSNP:544077619
1971 1971 c, g dbSNP:775831150
1974 1974 c, g dbSNP:763276448
1975 1975 a, g dbSNP:764074781
1984 1984 c, t dbSNP:768937241
1992 1992 a, g dbSNP:774230576
1998 1998 a, c dbSNP:2272023
1999 1999 c, t dbSNP:143697605
2000 2000 a, g dbSNP:151237327
2004 2004 a, c dbSNP:758311816
2005 2005 c, t dbSNP:759515019
2006 2006 c, t dbSNP:765015015
2010 2010 c, t dbSNP:752598382
2011 2011 a, g, t dbSNP:62640041
2013 2013 c, g dbSNP:369454178
2038 2038 a, g dbSNP:763836625
2041 2041 a, t dbSNP:750979692
2047 2047 c, t dbSNP:756802171
2048 2048 a, g dbSNP:532546900
2050 2050 g, t dbSNP:373952066
2053 2053 a, g dbSNP:770141611
2056 2056 c, t dbSNP:780224333
2057 2057 a, g, t dbSNP:376881991
2058 2058 c, g dbSNP:774656142
2059 2059 c, g dbSNP:748369134
2062 2062 c, t dbSNP:551134605
2069 2069 a, g dbSNP:569388356
2072 2072 c, t dbSNP:759458195
2076 2076 c, t dbSNP:536865924
2077 2077 a, g dbSNP:775104367
2083 2083 c, t dbSNP:762824937
2093 2093 g, t dbSNP:763839982
2094 2094 a, g dbSNP:57669733
2101 2101 c, t dbSNP:757037237
2105 2105 a, g dbSNP:767120823
2109 2109 g, t dbSNP:753077000
2110 2110 a, g dbSNP:758553258
2121 2121 c, t dbSNP:374406755
2122 2122 a, g dbSNP:747278710
2123 2123 a, c dbSNP:377338540
2128 2128 a, c, t dbSNP:144501729
2129 2129 a, g dbSNP:375567241
2130 2130 c, g dbSNP:368579188
2131 2131 c, t dbSNP:761732451
2132 2132 g, t dbSNP:546076896
2134 2134 a, g dbSNP:771802121
2138 2138 a, g dbSNP:772978689
2157 2157 a, g dbSNP:760446079
2158 2158 c, g dbSNP:765912431
2161 2161 a, g dbSNP:753349925
2170 2170 a, g dbSNP:760034910
2181 2181 g, t dbSNP:765671060
2184 2184 c, t dbSNP:1568116
2186 2186 c, g, t dbSNP:758736365
2187 2187 a, g dbSNP:576643706
2188 2188 c, t dbSNP:751772662
2192 2192 c, g dbSNP:757476544
2199 2199 a, g dbSNP:544057872
2202 2202 c, t dbSNP:781273878
2211 2211 c, t dbSNP:745939485
2212 2212 a, g dbSNP:377219636
2214 2214 c, g, t dbSNP:188044698
2215 2215 a, g, t dbSNP:771963700
2217 2217 c, t dbSNP:539649392
2222 2222 a, g dbSNP:770505276
2224 2224 c, t dbSNP:776144534
2225 2225 a, g dbSNP:34616796
2232 2232 a, g dbSNP:764772401
2241 2241 c, t dbSNP:35652696
2244 2244 c, t dbSNP:763515848
2247 2247 c, t dbSNP:371543651
2248 2248 g, t dbSNP:148018909
2257 2257 a, g dbSNP:200412974
2259 2259 c, t dbSNP:767663589
2260 2260 a, g dbSNP:369864209
2262 2262 c, t dbSNP:756126577
2263 2263 a, g dbSNP:780323898
2268 2268 c, t dbSNP:748095240
2272 2272 c, t dbSNP:758471993
2273 2273 a, g dbSNP:35965913
2283 2283 c, t dbSNP:746789171
2284 2284 a, g dbSNP:770581471
2288 2288 a, c, t dbSNP:776122536
2290 2290 c, t dbSNP:769287861
2292 2292 a, g dbSNP:775035922
2295 2295 c, g dbSNP:763391616
2302 2302 c, t dbSNP:764586930
2304 2304 c, t dbSNP:551265948
2305 2305 a, c, g dbSNP:762106035
2309 2309 g, t dbSNP:750579987
2319 2319 a, g dbSNP:201642680
2322 2322 c, t dbSNP:377391149
2323 2323 a, g dbSNP:201414869
2326 2326 a, g dbSNP:753982782
2330 2330 c, t dbSNP:373373120
2331 2331 a, g dbSNP:777892820
2338 2338 c, t dbSNP:746773847
2343 2343 c, t dbSNP:74029641
2346 2346 c, t dbSNP:376926374
2348 2348 a, g dbSNP:370283261
2350 2350 c, g dbSNP:181923062
2351 2351 a, g dbSNP:374239823
2354 2354 c, t dbSNP:141628105
2355 2355 a, g dbSNP:769101937
2357 2357 a, g dbSNP:774699509
2358 2358 c, t dbSNP:762423614
2359 2359 c, t dbSNP:772320528
2360 2360 g, t dbSNP:773685275
2373 2373 c, g dbSNP:551557520
2374 2374 g, t dbSNP:760924730
2377 2377 c, t dbSNP:766715171
2378 2378 a, g dbSNP:77572130
2379 2379 a, g dbSNP:759714158
2382 2382 a, c dbSNP:765394408
2387 2387 c, t dbSNP:751443753
2399 2399 a, g, t dbSNP:35102652
2403 2403 c, t dbSNP:771413785
2411 2411 c, t dbSNP:367992413
2412 2412 a, g dbSNP:372553119
2413 2413 g, t dbSNP:377059310
2418 2418 c, t dbSNP:775390838
2436 2436 a, g dbSNP:763114699
2441 2441 a, g dbSNP:764128416
2449 2449 a, c dbSNP:773102587
2451 2451 a, g dbSNP:760672233
2456 2456 c, t dbSNP:766150369
2457 2457 a, c dbSNP:753647557
2479 2479 a, g dbSNP:370096577
2496 2496 c, t dbSNP:377172993
2497 2497 a, c, g dbSNP:35120858
2514 2514 c, t dbSNP:777469734
2515 2515 a, g dbSNP:747501102
2520 2520 a, t dbSNP:757848551
2528 2528 a, c dbSNP:781633190
2529 2529 a, g dbSNP:534850188
2534 2534 c, t dbSNP:769858164
2536 2536 a, g dbSNP:775758199
2539 2539 c, g, t dbSNP:267604364
2540 2540 a, c dbSNP:768777515
2550 2550 a, g dbSNP:774473524
2553 2553 c, t dbSNP:760549529
2568 2568 g, t dbSNP:766310483
2571 2571 a, c dbSNP:372515989
2572 2572 a, c dbSNP:377098407
2577 2577 c, t dbSNP:546837225
2578 2578 a, g dbSNP:202060628
2588 2588 a, g dbSNP:752367506
2593 2593 a, t dbSNP:571888451
2599 2599 g, t dbSNP:763636524
2602 2602 c, g dbSNP:751115587
2604 2604 a, c dbSNP:757797101
2613 2613 c, t dbSNP:150362784
2618 2618 c, t dbSNP:781769779
2622 2622 a, g dbSNP:137972043
2627 2627 c, t dbSNP:373766961
2632 2632 a, c dbSNP:376234405
2633 2633 c, t dbSNP:749512612
2634 2634 a, g dbSNP:370627724
2636 2636 c, t dbSNP:577419060
2637 2637 a, g dbSNP:748260469
2655 2655 a, t dbSNP:554374418
2664 2664 c, t dbSNP:2351491
2665 2665 a, g dbSNP:754158581
2670 2670 c, t dbSNP:546447132
2671 2671 a, g dbSNP:150988100
2681 2681 a, g dbSNP:748421719
2682 2682 a, g dbSNP:191404107
2690 2690 c, t dbSNP:777785667
2696 2696 c, g dbSNP:745756144
2708 2708 a, c dbSNP:769618934
2713 2713 a, g dbSNP:775312655
2726 2726 c, t dbSNP:762675815
2731 2731 a, g dbSNP:758720393
2739 2739 c, t dbSNP:774114868
2742 2742 c, t dbSNP:761624092
2746 2746 a, g dbSNP:543052440
2765 2765 a, g dbSNP:78770909
2774 2774 a, c dbSNP:761177707
2777 2777 c, t dbSNP:766827687
2814 2814 c, t dbSNP:754184356
2818 2818 a, g dbSNP:755315928
2824 2824 c, t dbSNP:765633053
2825 2825 c, t dbSNP:200626682
2829 2829 c, t dbSNP:758681426
2840 2840 a, g dbSNP:777838943
2848 2848 c, t dbSNP:747087432
2858 2858 a, g dbSNP:201767607
2865 2865 c, t dbSNP:528981831
2867 2867 c, t dbSNP:547171655
2868 2868 a, c, g dbSNP:768559740
2869 2869 a, t dbSNP:747735799
2873 2873 a, c dbSNP:771635733
2878 2878 a, c dbSNP:772728936
2884 2884 c, g dbSNP:760132170
2886 2886 c, t dbSNP:765951359
2888 2888 c, t dbSNP:776978647
2889 2889 a, g, t dbSNP:3743399
2898 2898 a, g dbSNP:74664106
2903 2903 c, g dbSNP:758574714
2913 2913 c, t dbSNP:764257241
2914 2914 c, g dbSNP:372267862
2915 2915 c, t dbSNP:267604365
2916 2916 c, t dbSNP:201758384
2917 2917 a, g dbSNP:368584197
2919 2919 a, g dbSNP:556642361
2920 2920 c, g dbSNP:749234782
2922 2922 c, t dbSNP:754971280
2923 2923 a, g dbSNP:150116620
2928 2928 g, t dbSNP:538829441
2931 2931 a, t dbSNP:747977462
2934 2934 c, g dbSNP:748671945
2947 2947 c, g dbSNP:772707511
2952 2952 c, g dbSNP:746720958
2966 2966 c, t dbSNP:3743398
2969 2969 -, tgt dbSNP:769765598
2971 2971 a, g dbSNP:776186236
2978 2978 a, g dbSNP:372878138
2983 2983 g, t dbSNP:553166889
3007 3007 a, g dbSNP:368547827
3008 3008 a, g dbSNP:770312420
3014 3014 a, t dbSNP:775794880
3023 3023 a, g dbSNP:200269121
3028 3028 c, g dbSNP:374881297
3038 3038 a, g dbSNP:763199875
3040 3040 a, g dbSNP:764571461
3044 3044 c, g dbSNP:751720191
3046 3046 g, t dbSNP:762163984
3060 3060 c, g dbSNP:767430560
3075 3075 c, t dbSNP:750544614
3080 3080 c, g dbSNP:754913339
3083 3083 g, t dbSNP:779024114
3084 3084 a, t dbSNP:113581263
3089 3089 c, t dbSNP:758104180
3100 3100 a, g dbSNP:777677916
3107 3107 a, g dbSNP:746633929
3112 3112 a, c dbSNP:35430524
3117 3117 a, g dbSNP:780636375
3120 3120 a, g dbSNP:373065056
3121 3121 a, t dbSNP:769337152
3123 3123 a, t dbSNP:775956303
3126 3126 a, g dbSNP:763574287
3127 3127 c, t dbSNP:572551694
3133 3133 c, t dbSNP:377554089
3134 3134 a, c dbSNP:774783018
3135 3135 a, g dbSNP:371065054
3137 3137 g, t dbSNP:767873732
3138 3138 a, g dbSNP:750489449
3160 3160 c, t dbSNP:546089499
3164 3164 g, t dbSNP:938608
3168 3168 c, t dbSNP:752666633
3173 3173 c, t dbSNP:376179210
3174 3174 a, g dbSNP:576372390
3184 3184 c, t dbSNP:751379855
3190 3190 a, t dbSNP:938609
3197 3197 c, t dbSNP:780795750
3205 3205 a, c dbSNP:745572907
3211 3211 a, g, t dbSNP:561378076
3212 3212 c, g dbSNP:528876577
3217 3217 c, g, t dbSNP:138620973
3218 3218 c, t dbSNP:559189679
3228 3228 a, t dbSNP:533111868
3233 3233 a, t dbSNP:774530122
3234 3234 c, g, t dbSNP:371044633
3235 3235 c, g dbSNP:569930044
3240 3240 c, t dbSNP:772604061
3243 3243 a, g dbSNP:530856728
3244 3244 c, t dbSNP:761033351
3249 3249 c, t dbSNP:766559751
3256 3256 a, g dbSNP:776772838
3269 3269 -, c dbSNP:774310062
3270 3270 c, t dbSNP:762737019
3271 3271 a, t dbSNP:550185243
3277 3277 c, t dbSNP:568435726
3285 3285 a, t dbSNP:751495052
3287 3287 a, g dbSNP:757026255
3288 3288 a, g dbSNP:767359801
3291 3291 c, t dbSNP:750073964
3297 3297 c, t dbSNP:62023517
3300 3300 a, g dbSNP:748852727
3304 3304 c, t dbSNP:528763651
3310 3310 a, g dbSNP:779442875
3311 3311 g, t dbSNP:190556234
3315 3315 a, g dbSNP:772550585
3322 3322 c, g dbSNP:145274175
3327 3327 c, t dbSNP:62023518
3328 3328 a, g, t dbSNP:200194458
3330 3330 c, t dbSNP:759634656
3331 3331 g, t dbSNP:765285584
3340 3340 a, g dbSNP:368974937
3354 3354 c, t dbSNP:761808593
3355 3355 a, g dbSNP:767234739
3364 3364 g, t dbSNP:546999192
3382 3382 -, acc dbSNP:759614168
3384 3384 a, c, t dbSNP:4080952
3385 3385 a, g dbSNP:34570487
3390 3390 c, t dbSNP:754488892
3422 3422 c, g dbSNP:555664055
3423 3423 -, gga dbSNP:772215840
3440 3440 c, t dbSNP:778342580
3441 3441 c, t dbSNP:28496654
3442 3442 a, g, t dbSNP:75032377
3442 3442 ca, tg dbSNP:34309532
3446 3446 c, t dbSNP:778222669
3448 3448 c, t dbSNP:747396821
3468 3468 c, t dbSNP:771466880
3486 3486 a, g dbSNP:781458928
3498 3498 c, t dbSNP:11633157
3499 3499 a, g dbSNP:577623921
3555 3555 c, t dbSNP:113229763
3556 3556 a, g dbSNP:548914391
3559 3559 a, g dbSNP:56244342
3612 3612 c, t dbSNP:75469674
3612 3612 c, t dbSNP:77709198
3613 3613 a, g dbSNP:373544100
3632 3632 -, catcagcgggcttccttctggagaagttctagagaccgctgcccctgg agtagagga dbSNP:71149237
3669 3669 c, t dbSNP:62023519
3670 3670 a, g dbSNP:563511597
3710 3710 a, g dbSNP:112126237
3726 3726 c, t dbSNP:530742363
3783 3783 c, t dbSNP:71408894
3840 3840 c, t dbSNP:71408895
3897 3897 c, t dbSNP:67900127
3955 3955 ca, tg dbSNP:375747798
4011 4011 c, t dbSNP:79161342
4012 4012 a, g dbSNP:11638262
4031 4031 c, t dbSNP:61736998
4036 4036 a, g dbSNP:112624191
4069 4069 a, g dbSNP:113457214
4089 4089 c, g dbSNP:200536240
4109 4109 a, g dbSNP:56162368
4126 4126 a, g dbSNP:201500718
4133 4133 -, c dbSNP:387906534
4183 4183 a, g dbSNP:200089865
4201 4201 -, gac dbSNP:200039781
4240 4240 a, g dbSNP:201371548
4297 4297 a, g dbSNP:201970173
4354 4354 a, g dbSNP:200026339
4374 4374 c, g dbSNP:201114885
4411 4411 a, g dbSNP:202231802
4468 4468 a, g dbSNP:200156631
4495 4495 a, g dbSNP:201302102
4514 4514 c, t dbSNP:561175031
4525 4525 a, g dbSNP:61465251
4542 4542 g, t dbSNP:529296210
4545 4545 c, g dbSNP:201822759
4549 4549 a, g dbSNP:56014140
4582 4582 a, g dbSNP:12899191
4591 4591 a, g dbSNP:746137604
4599 4599 g, t dbSNP:769916916
4602 4602 c, g dbSNP:28559926
4608 4608 c, t dbSNP:539580597
4609 4609 a, g dbSNP:372314637
4620 4620 -, gga dbSNP:775896176
4626 4626 a, g dbSNP:772019426
4628 4628 g, t dbSNP:551867169
4630 4630 c, t dbSNP:11634626
4633 4633 c, g dbSNP:376637662
4634 4634 a, g dbSNP:772953212
4637 4637 c, t dbSNP:760430869
4638 4638 c, t dbSNP:569889456
4639 4639 a, g, t dbSNP:35546357
4643 4643 c, t dbSNP:759176877
4645 4645 a, c, t dbSNP:764734177
4651 4651 a, g dbSNP:371237177
4656 4656 g, t dbSNP:377697360
4659 4659 c, g dbSNP:537253113
4665 4665 c, t dbSNP:78806382
4680 4680 a, g dbSNP:775197384
4695 4695 c, t dbSNP:369184696
4696 4696 a, g dbSNP:200437529
4709 4709 c, t dbSNP:757632511
4713 4713 g, t dbSNP:781478525
4714 4714 a, g dbSNP:112335908
4716 4716 c, g dbSNP:201505307
4719 4719 c, t dbSNP:780135043
4722 4722 c, t dbSNP:60790354
4723 4723 a, g dbSNP:768764707
4738 4738 a, g dbSNP:773110836
4741 4741 a, g dbSNP:760663774
4752 4752 -, tctacc dbSNP:754252968
4753 4753 g, t dbSNP:770753187
4756 4756 a, c, g dbSNP:534608385
4757 4757 c, t dbSNP:375536994
4759 4759 c, t dbSNP:552723061
4763 4763 c, g, t dbSNP:369619909
4764 4764 a, c, g dbSNP:373448175
4769 4769 a, g dbSNP:781563383
4770 4770 a, g, t dbSNP:750777160
4774 4774 a, c, t dbSNP:368875483
4776 4776 c, t dbSNP:755037598
4779 4779 c, t dbSNP:563374339
4782 4782 a, g dbSNP:373123198
4786 4786 a, c dbSNP:376237216
4795 4795 a, g dbSNP:770783402
4796 4796 -, gag dbSNP:200944977
4800 4800 a, c dbSNP:776435976
4804 4804 c, g dbSNP:140867631
4806 4806 a, g dbSNP:769666901
4808 4808 a, t dbSNP:775272723
4810 4810 a, g dbSNP:377592925
4811 4811 c, t dbSNP:763634219
4814 4814 c, t dbSNP:774014880
4818 4818 c, g dbSNP:370647891
4825 4825 a, g dbSNP:762333984
4831 4831 g, t dbSNP:561163011
4834 4834 a, c dbSNP:200795001
4835 4835 c, t dbSNP:750980297
4842 4842 a, g dbSNP:201463640
4843 4843 c, t dbSNP:756412985
4846 4846 c, t dbSNP:374560662
4848 4848 c, t dbSNP:754055146
4861 4861 a, g dbSNP:755195338
4876 4876 c, t dbSNP:528401051
4879 4879 a, g dbSNP:748195726
4887 4887 a, g dbSNP:547751329
4898 4898 a, c dbSNP:2882676
4900 4900 c, t dbSNP:200479865
4904 4904 c, t dbSNP:769711367
4921 4921 a, g dbSNP:775432317
4922 4922 a, c dbSNP:748894957
4926 4926 a, c dbSNP:768446108
4941 4941 a, g dbSNP:773960271
4945 4945 a, g dbSNP:761198297
4953 4953 c, t dbSNP:767104954
4954 4954 a, g dbSNP:773578351
4957 4957 c, t dbSNP:761310519
4959 4959 c, g dbSNP:766660734
4967 4967 a, g dbSNP:754214360
4969 4969 a, g dbSNP:755141817
4973 4973 a, g dbSNP:765471639
4975 4975 c, g dbSNP:752999140
4979 4979 c, t dbSNP:758382728
4980 4980 a, c dbSNP:763850047
4991 4991 c, t dbSNP:750263558
5003 5003 a, g dbSNP:753807315
5004 5004 a, g dbSNP:564415560
5005 5005 g, t dbSNP:779949572
5006 5006 a, t dbSNP:749127093
5014 5014 a, g dbSNP:368770768
5019 5019 a, t dbSNP:778409894
5036 5036 a, g dbSNP:747893607
5038 5038 c, g dbSNP:771476372
5041 5041 c, g dbSNP:761692908
5042 5042 a, t dbSNP:193215219
5048 5048 c, t dbSNP:761111724
5062 5062 c, g dbSNP:771449137
5074 5074 a, g dbSNP:765334806
5084 5084 a, c, t dbSNP:373706146
5099 5099 a, g dbSNP:752861429
5120 5120 a, g dbSNP:763243954
5124 5124 g, t dbSNP:764027664
5125 5125 a, g dbSNP:371634636
5130 5130 c, t dbSNP:78523879
5136 5136 g, t dbSNP:780109464
5139 5139 a, g dbSNP:567598574
5143 5143 c, t dbSNP:185250189
5148 5148 c, t dbSNP:778833544
5153 5153 -, aag dbSNP:765715449
5166 5166 a, g dbSNP:747687890
5169 5169 g, t dbSNP:369641436
5198 5198 a, c dbSNP:777097401
5202 5202 a, g dbSNP:372339423
5204 5204 c, t dbSNP:553645490
5209 5209 a, g dbSNP:777098563
5214 5214 a, t dbSNP:760091367
5218 5218 c, g dbSNP:571130169
5224 5224 a, g dbSNP:375929386
5226 5226 g, t dbSNP:763040657
5230 5230 c, g dbSNP:764412011
5239 5239 a, g dbSNP:28407189
5243 5243 a, g dbSNP:373469771
5251 5251 c, t dbSNP:767764933
5252 5252 c, t dbSNP:753824539
5253 5253 c, t dbSNP:754969277
5263 5263 a, g dbSNP:764880375
5264 5264 c, g dbSNP:752559366
5267 5267 a, g dbSNP:557081659
5270 5270 a, c dbSNP:777446851
5272 5272 c, t dbSNP:375957533
5278 5278 a, g dbSNP:575457851
5285 5285 a, g dbSNP:780687613
5296 5296 a, g dbSNP:746318703
5297 5297 g, t dbSNP:770360505
5334 5334 a, g dbSNP:374570636
5336 5336 c, g dbSNP:775681178
5347 5347 a, g dbSNP:749633671
5350 5350 c, g dbSNP:368698066
5355 5355 c, t dbSNP:774704020
5356 5356 c, t dbSNP:762194333
5385 5385 c, t dbSNP:780440434
5389 5389 a, g dbSNP:767636199
5390 5390 c, t dbSNP:773436927
5394 5394 c, t dbSNP:751889943
5395 5395 a, g dbSNP:759342865
5431 5431 a, c, t dbSNP:542821166
5438 5438 c, g dbSNP:752613906
5440 5440 a, g dbSNP:758186439
5449 5449 a, g dbSNP:763850127
5453 5453 a, c dbSNP:372919059
5460 5460 a, g, t dbSNP:377132613
5468 5468 a, g dbSNP:375118386
5473 5473 c, t dbSNP:755623051
5482 5482 a, g dbSNP:780589006
5487 5487 a, g dbSNP:267604366
5491 5491 a, g dbSNP:749818585
5493 5493 a, t dbSNP:769063514
5494 5494 a, c dbSNP:774861720
5499 5499 a, g, t dbSNP:748322585
5500 5500 c, t dbSNP:773385814
5510 5510 a, g dbSNP:760776040
5521 5521 a, c dbSNP:766415216
5522 5522 g, t dbSNP:79925540
5531 5531 c, t dbSNP:762862465
5540 5540 c, g dbSNP:200794149
5542 5542 c, t dbSNP:781449978
5543 5543 c, t dbSNP:751379789
5563 5563 c, t dbSNP:761419550
5565 5565 a, t dbSNP:767128740
5574 5574 g, t dbSNP:750092063
5577 5577 g, t dbSNP:755636808
5596 5596 a, g dbSNP:748666817
5599 5599 c, t dbSNP:779498521
5609 5609 c, t dbSNP:754305276
5612 5612 a, g dbSNP:755451428
5621 5621 c, t dbSNP:779369587
5623 5623 c, t dbSNP:367732005
5627 5627 a, g dbSNP:371211794
5628 5628 a, g dbSNP:374041400
5632 5632 a, g dbSNP:770225009
5639 5639 a, t dbSNP:367925946
5643 5643 c, t dbSNP:775729780
5644 5644 a, g dbSNP:202054679
5661 5661 a, g dbSNP:762902407
5668 5668 a, g dbSNP:4932439
5672 5672 c, g dbSNP:774316706
5683 5683 c, t dbSNP:761577704
5692 5692 a, c, g dbSNP:767359295
5693 5693 c, t dbSNP:147886342
5695 5695 g, t dbSNP:565190001
5703 5703 c, t dbSNP:533136867
5705 5705 a, g dbSNP:755500324
5726 5726 a, g dbSNP:779530084
5728 5728 c, g dbSNP:139182220
5730 5730 a, g dbSNP:758818637
5732 5732 a, g dbSNP:778345442
5743 5743 a, t dbSNP:201149160
5750 5750 a, t dbSNP:771069320
5752 5752 c, g dbSNP:377189756
5757 5757 c, t dbSNP:781293736
5758 5758 a, c dbSNP:745908761
5765 5765 c, g dbSNP:769915833
5775 5775 a, g dbSNP:544557228
5776 5776 a, g dbSNP:71403956
5777 5777 a, g dbSNP:748151960
5793 5793 g, t dbSNP:368893175
5794 5794 a, g dbSNP:772897999
5817 5817 c, t dbSNP:760324883
5818 5818 c, t dbSNP:373012933
5821 5821 g, t dbSNP:765977317
5828 5828 a, g dbSNP:776385464
5830 5830 a, g, t dbSNP:759095494
5832 5832 c, t dbSNP:753249074
5833 5833 a, g dbSNP:758975213
5835 5835 a, g dbSNP:764459159
5844 5844 c, t dbSNP:751902989
5845 5845 a, g dbSNP:375361510
5846 5846 a, g dbSNP:781252881
5848 5848 a, c, g dbSNP:369426643
5854 5854 g, t dbSNP:756182341
5856 5856 c, t dbSNP:780112267
5859 5859 g, t dbSNP:373280545
5861 5861 c, t dbSNP:772021322
5864 5864 c, t dbSNP:773018294
5867 5867 a, t dbSNP:376225697
5869 5869 a, g, t dbSNP:370620670
5890 5890 a, g dbSNP:759325407
5891 5891 c, t dbSNP:764769401
5893 5893 g, t dbSNP:373484583
5900 5900 c, t dbSNP:763502181
5907 5907 g, t dbSNP:764480078
5909 5909 -, aag dbSNP:749920465
5915 5915 a, t dbSNP:752160788
5920 5920 -, aaa dbSNP:757882287
5921 5921 c, g, t dbSNP:34124958
5922 5922 a, c dbSNP:750578281
5928 5928 c, g dbSNP:756343851
5935 5935 a, g dbSNP:780061518
5938 5938 c, t dbSNP:74505897
5942 5942 a, g dbSNP:200762388
5945 5945 g, t dbSNP:777548435
5950 5950 a, c dbSNP:747025643
5954 5954 a, c dbSNP:770623698
5955 5955 c, t dbSNP:370763565
5956 5956 a, g dbSNP:201212378
5959 5959 a, g dbSNP:267604367
5969 5969 c, t dbSNP:567724750
5982 5982 c, g, t dbSNP:149963286
5989 5989 a, g dbSNP:768274558
5991 5991 a, g dbSNP:372303872
5992 5992 c, g dbSNP:762387037
5994 5994 g, t dbSNP:767716936
5999 5999 a, g dbSNP:750810730
6002 6002 a, g dbSNP:546936803
6004 6004 a, c, g dbSNP:766554442
6019 6019 a, g dbSNP:754999272
6021 6021 c, g, t dbSNP:779115729
6022 6022 a, g, t dbSNP:757229334
6030 6030 c, t dbSNP:745686964
6032 6032 a, g dbSNP:769763273
6038 6038 c, t dbSNP:377284915
6039 6039 a, g dbSNP:749040666
6049 6049 c, t dbSNP:767984963
6050 6050 c, g, t dbSNP:368491136
6051 6051 a, g dbSNP:772667742
6062 6062 a, g dbSNP:773746919
6067 6067 c, t dbSNP:761003367
6071 6071 a, g dbSNP:190099162
6075 6075 c, t dbSNP:375848120
6080 6080 c, t dbSNP:759804072
6089 6089 a, g dbSNP:765168922
6101 6101 c, g dbSNP:761774197
6106 6106 a, g dbSNP:757101081
6119 6119 a, c, g dbSNP:781254805
6120 6120 c, t dbSNP:755969485
6124 6124 c, t dbSNP:780000533
6125 6125 g, t dbSNP:748839172
6131 6131 c, t dbSNP:200271564
6132 6132 a, g dbSNP:778250246
6138 6138 a, g dbSNP:747665270
6147 6147 c, t dbSNP:771616712
6154 6154 a, g dbSNP:373374575
6174 6174 a, g, t dbSNP:3825994
6175 6175 c, g dbSNP:76282091
6218 6218 c, t dbSNP:759627177
6219 6219 c, t dbSNP:765525300
6221 6221 c, t dbSNP:775613487
6224 6224 c, t dbSNP:763076469
6226 6226 g, t dbSNP:764337871
6235 6235 g, t dbSNP:181541436
6237 6237 -, agg dbSNP:779505018
6241 6241 a, g dbSNP:750319773
6245 6245 c, g dbSNP:756133965
6254 6254 a, g dbSNP:766231705
6264 6264 a, g dbSNP:753701920
6276 6276 c, t dbSNP:754771797
6279 6279 c, t dbSNP:778604362
6288 6288 a, g dbSNP:747810644
6289 6289 c, t dbSNP:572903055
6295 6295 a, g dbSNP:369221267
6296 6296 c, t dbSNP:74477529
6306 6306 a, g, t dbSNP:200212015
6325 6325 c, t dbSNP:776820500
6329 6329 g, t dbSNP:746211609
6342 6342 c, t dbSNP:201107277
6343 6343 a, c, g dbSNP:775778624
6344 6344 c, g dbSNP:372709777
6354 6354 g, t dbSNP:774599873
6356 6356 c, g dbSNP:760652757
6357 6357 a, c dbSNP:766391130
6360 6360 c, t dbSNP:753770648
6361 6361 a, g dbSNP:377010256
6367 6367 -, cc dbSNP:201923184
6373 6373 a, c, g dbSNP:34546634
6374 6374 a, c, g dbSNP:367930275
6376 6376 a, g dbSNP:755204048
6381 6381 a, g dbSNP:756799210
6382 6382 c, t dbSNP:781707379
6384 6384 c, t dbSNP:35676128
6387 6387 c, t dbSNP:770131495
6388 6388 a, g dbSNP:199709827
6394 6394 a, g dbSNP:753033186
6401 6401 c, t dbSNP:207475683
6405 6405 c, t dbSNP:368840579
6407 6407 c, t dbSNP:774757326
6413 6413 a, c, g dbSNP:372805764
6414 6414 c, t dbSNP:542684725
6415 6415 c, g dbSNP:756575823
6428 6428 a, c dbSNP:375734624
6432 6432 c, t dbSNP:371314805
6440 6440 c, t dbSNP:375008777
6445 6445 a, t dbSNP:763703399
6446 6446 c, t dbSNP:751259125
6448 6448 a, t dbSNP:756758122
6457 6457 c, g dbSNP:780573868
6458 6458 a, c dbSNP:750884988
6461 6461 c, t dbSNP:369174647
6484 6484 a, g dbSNP:749852017
6488 6488 c, t dbSNP:149083251
6499 6499 a, g dbSNP:200423695
6502 6502 a, g dbSNP:267604368
6517 6517 c, g dbSNP:201538650
6518 6518 a, c dbSNP:34074148
6520 6520 a, c dbSNP:369443823
6521 6521 c, t dbSNP:200203683
6522 6522 c, t dbSNP:373971849
6532 6532 a, g dbSNP:547217291
6534 6534 a, g dbSNP:376899394
6535 6535 c, t dbSNP:769651133
6536 6536 c, t dbSNP:775445247
6538 6538 a, g dbSNP:762713480
6542 6542 a, t dbSNP:763932519
6548 6548 c, t dbSNP:35061438
6551 6551 c, t dbSNP:373173874
6553 6553 a, g dbSNP:767004998
6556 6556 -, ac dbSNP:751260854
6571 6571 c, g dbSNP:749933055
6583 6583 a, c dbSNP:755694129
6584 6584 a, g, t dbSNP:766973962
6585 6585 c, t dbSNP:551308331
6589 6589 a, g dbSNP:746649096
6592 6592 g, t dbSNP:748318826
6607 6607 g, t dbSNP:185800102
6609 6609 c, t dbSNP:536254297
6610 6610 a, g dbSNP:1042630
6617 6617 c, g dbSNP:771090332
6626 6626 c, t dbSNP:775391979
6638 6638 c, g dbSNP:201755419
6646 6646 a, g, t dbSNP:776423623
6654 6654 a, g dbSNP:774155114
6657 6657 a, g dbSNP:761487982
6661 6661 g, t dbSNP:767050244
6672 6672 g, t dbSNP:772971226
6681 6681 a, g dbSNP:62023520
6683 6683 c, t dbSNP:375589819
6684 6684 a, g dbSNP:766056972
6687 6687 c, t dbSNP:368590289
6688 6688 a, g dbSNP:755552903
6695 6695 c, t dbSNP:371419855
6700 6700 g, t dbSNP:753031097
6709 6709 a, g dbSNP:758835805
6720 6720 c, t dbSNP:777836353
6721 6721 a, g dbSNP:747312001
6723 6723 c, t dbSNP:757278878
6724 6724 c, t dbSNP:781264311
6728 6728 a, g dbSNP:749177064
6735 6735 c, g dbSNP:34153007
6737 6737 a, g dbSNP:774312864
6739 6739 c, g dbSNP:747876368
6747 6747 c, t dbSNP:771965005
6751 6751 c, t dbSNP:772738227
6760 6760 c, g dbSNP:760376412
6770 6770 c, g dbSNP:765927279
6774 6774 c, t dbSNP:776299459
6783 6783 c, t dbSNP:760076437
6786 6786 c, t dbSNP:34543273
6787 6787 a, g dbSNP:371628768
6795 6795 c, t dbSNP:372625220
6798 6798 c, t dbSNP:1042631
6799 6799 a, g dbSNP:556062259
6809 6809 c, t dbSNP:757495567
6810 6810 c, t dbSNP:781209235
6825 6825 c, t dbSNP:371937649
6826 6826 a, g dbSNP:143156437
6828 6828 c, t dbSNP:778706501
6836 6836 c, t dbSNP:542651723
6840 6840 a, g dbSNP:771700964
6847 6847 a, g dbSNP:777634655
6849 6849 a, c dbSNP:746590966
6850 6850 a, g dbSNP:770733422
6852 6852 a, c, g, t dbSNP:369871844
6853 6853 a, g dbSNP:373460432
6855 6855 a, g dbSNP:763519030
6857 6857 c, t dbSNP:764318576
6858 6858 a, g dbSNP:532557786
6861 6861 c, t dbSNP:377405150
6862 6862 a, g dbSNP:766547434
6863 6863 c, g dbSNP:573314060
6866 6866 c, t dbSNP:368693410
6869 6869 c, t dbSNP:540453723
6878 6878 a, g dbSNP:752522191
6881 6881 a, g dbSNP:116530539
6883 6883 a, c, g dbSNP:777387397
6884 6884 a, g dbSNP:770898523
6900 6900 c, t dbSNP:780978239
6904 6904 -, gtg dbSNP:754609660
6904 6904 a, g dbSNP:745580775
6905 6905 c, t dbSNP:188663484
6909 6909 c, g dbSNP:775089463
6911 6911 c, t dbSNP:376406609
6915 6915 a, g dbSNP:769175954
6919 6919 a, c dbSNP:774770888
6920 6920 c, t dbSNP:551246840
6921 6921 a, g dbSNP:563183177
6924 6924 c, g dbSNP:371290730
6944 6944 c, t dbSNP:773358643
6945 6945 a, g, t dbSNP:529706918
6946 6946 g, t dbSNP:377558109
6958 6958 a, g dbSNP:755048682
6960 6960 a, g dbSNP:764067487
6964 6964 a, g dbSNP:751604379
6972 6972 c, t dbSNP:757114270
6973 6973 a, g dbSNP:548216816
6976 6976 c, g dbSNP:745458647
6987 6987 a, c, t dbSNP:755822949
6993 6993 c, g dbSNP:748809787
6996 6996 a, g dbSNP:768109783
7000 7000 c, t dbSNP:374434189
7005 7005 c, t dbSNP:550992941
7006 7006 a, g dbSNP:533925391
7015 7015 a, g dbSNP:773591919
7021 7021 a, g dbSNP:760843861
7024 7024 a, t dbSNP:367726004
7030 7030 c, g dbSNP:371239048
7032 7032 c, g dbSNP:759647045
7045 7045 -, cag dbSNP:781031062
7045 7045 a, c dbSNP:765299489
7057 7057 c, t dbSNP:751475234
7058 7058 a, g dbSNP:374891622
7060 7060 a, c dbSNP:767382429
7063 7063 g, t dbSNP:201436752
7064 7064 c, g dbSNP:767636869
7065 7065 a, g dbSNP:570283804
7070 7070 c, t dbSNP:181029183
7071 7071 a, g dbSNP:753047932
7089 7089 c, t dbSNP:369329108
7091 7091 c, t dbSNP:372580346
7095 7095 c, t dbSNP:748609736
7098 7098 c, t dbSNP:140306805
7099 7099 c, g dbSNP:373438469
7101 7101 a, g dbSNP:773744916
7102 7102 c, t dbSNP:368163315
7111 7111 a, g dbSNP:771255342
7114 7114 a, g dbSNP:776906125
7118 7118 c, t dbSNP:574437652
7123 7123 a, c dbSNP:769936963
7125 7125 a, c dbSNP:756420982
7128 7128 c, t dbSNP:775732956
7130 7130 a, c dbSNP:763166741
7134 7134 a, c dbSNP:767540027
7137 7137 c, t dbSNP:750446234
7139 7139 c, g dbSNP:372788256
7140 7140 c, t dbSNP:766094495
7143 7143 c, t dbSNP:536229548
7145 7145 c, g dbSNP:145203473
7148 7148 a, c dbSNP:754614021
7155 7155 a, c, g, t dbSNP:698621
7158 7158 c, t dbSNP:368877815
7161 7161 c, t dbSNP:778237491
7163 7163 a, c dbSNP:747535301
7172 7172 c, t dbSNP:771258166
7173 7173 a, g dbSNP:376248183
7183 7183 c, t dbSNP:536333497
7186 7186 a, g dbSNP:369258827
7208 7208 c, t dbSNP:749098394
7212 7212 c, t dbSNP:376745222
7213 7213 a, g dbSNP:531336434
7215 7215 c, t dbSNP:757896854
7217 7217 c, g dbSNP:777268408
7220 7220 c, t dbSNP:752044557
7240 7240 a, g dbSNP:757726420
7241 7241 g, t dbSNP:781579675
7247 7247 a, g dbSNP:746196673
7256 7256 a, c dbSNP:370618858
7262 7262 c, t dbSNP:531788785
7266 7266 a, g dbSNP:549479070
7269 7269 a, c, g dbSNP:373512626
7271 7271 a, g dbSNP:768801235
7272 7272 c, t dbSNP:370259683
7273 7273 a, g dbSNP:373674144
7275 7275 c, t dbSNP:368166847
7281 7281 c, t dbSNP:776676545
7287 7287 -, c dbSNP:777726601
7293 7293 -, t dbSNP:749151163
7305 7305 c, t dbSNP:759308876
7306 7306 a, g dbSNP:765080728
7308 7308 g, t dbSNP:775056039
7311 7311 c, g dbSNP:370515602
7315 7315 a, g dbSNP:763610801
7318 7318 a, g dbSNP:374577791
7320 7320 a, t dbSNP:751061684
7340 7340 c, g dbSNP:148334815
7353 7353 c, g dbSNP:542570930
7381 7381 a, g dbSNP:751636799
7413 7413 c, t dbSNP:776426551
7414 7414 a, g dbSNP:548481167
7439 7439 a, g dbSNP:748466186
7441 7441 a, g dbSNP:758341169
7455 7455 a, g dbSNP:534424968
7465 7465 a, g dbSNP:745755155
7467 7467 a, g dbSNP:368979713
7475 7475 a, g dbSNP:780006455
7485 7485 c, t dbSNP:749069893
7486 7486 c, t dbSNP:768563192
7487 7487 a, g dbSNP:773809580
7496 7496 c, t dbSNP:761543122
7497 7497 a, g dbSNP:372888180
7498 7498 c, g dbSNP:772883781
7502 7502 g, t dbSNP:760305263
7503 7503 c, t dbSNP:182888026
7506 7506 g, t dbSNP:754450944
7507 7507 a, t dbSNP:369624139
7513 7513 a, g dbSNP:759812417
7524 7524 g, t dbSNP:765636005
7526 7526 a, g dbSNP:199999713
7527 7527 -, cggtgt dbSNP:775701947
7529 7529 a, g dbSNP:747182944
7532 7532 a, g dbSNP:777789052
7534 7534 a, c, t dbSNP:376535037
7535 7535 a, g dbSNP:200921049
7536 7536 a, g dbSNP:749228410
7549 7549 c, t dbSNP:574395127
7550 7550 a, g dbSNP:778792706
7557 7557 c, t dbSNP:368404569
7563 7563 c, t dbSNP:376206831
7564 7564 a, c, g dbSNP:150555123
7571 7571 c, g dbSNP:770628724
7572 7572 c, g, t dbSNP:35446117
7573 7573 a, g dbSNP:765467543
7576 7576 a, g dbSNP:753135658
7590 7590 c, t dbSNP:551998328
7599 7599 c, t dbSNP:375863291
7601 7601 c, g dbSNP:762045879
7607 7607 a, t dbSNP:767547523
7608 7608 c, g dbSNP:3817428
7620 7620 a, c, t dbSNP:756200365
7621 7621 a, g dbSNP:752648715
7623 7623 c, g dbSNP:758195928
7629 7629 c, t dbSNP:372066173
7630 7630 a, g dbSNP:121913568
7638 7638 c, g dbSNP:746607972
7641 7641 c, t dbSNP:756998612
7644 7644 a, c, t dbSNP:780745834
7646 7646 c, g dbSNP:374842225
7655 7655 a, g dbSNP:368833137
7671 7671 c, t dbSNP:749774270
7672 7672 c, t dbSNP:571846898
7673 7673 c, g dbSNP:774731139
7676 7676 c, t dbSNP:762207698
7679 7679 a, c dbSNP:759731578
7684 7684 a, g dbSNP:764102913
7693 7693 c, t dbSNP:751606366
7694 7694 a, g dbSNP:535702010
7697 7697 c, g dbSNP:767230096
7702 7702 a, c dbSNP:758352547
7722 7722 c, t dbSNP:141037246
7723 7723 a, g dbSNP:192568553
7738 7738 a, g dbSNP:267606625
7741 7741 a, g dbSNP:779794758
7749 7749 a, c dbSNP:753321079
7754 7754 a, g dbSNP:754538010
7755 7755 c, t dbSNP:373470699
7756 7756 a, g dbSNP:183636867
7757 7757 a, c dbSNP:772428950
7762 7762 a, g dbSNP:778025458
7764 7764 c, t dbSNP:747217927
7765 7765 a, g dbSNP:201154137
7774 7774 c, g dbSNP:777044543
7805 7805 c, t dbSNP:759677135
7806 7806 a, g dbSNP:576129384
7820 7820 c, t dbSNP:770216280
7821 7821 a, g dbSNP:774364796
7823 7823 c, t dbSNP:775742882
7826 7826 c, t dbSNP:543497679
7830 7830 c, t dbSNP:117879889
7831 7831 a, c, g dbSNP:202059945
7835 7835 a, g dbSNP:766163010
7837 7837 c, t dbSNP:375041472
7839 7839 a, c dbSNP:759212812
7841 7841 c, t dbSNP:764690562
7852 7852 c, t dbSNP:752175506
7853 7853 a, g dbSNP:757978070
7859 7859 c, g dbSNP:764496641
7862 7862 c, g, t dbSNP:752177184
7863 7863 c, t dbSNP:781700675
7867 7867 a, c, g dbSNP:200180285
7871 7871 -, aga dbSNP:765929803
7877 7877 a, c dbSNP:780471356
7882 7882 c, t dbSNP:766292185
7883 7883 a, g, t dbSNP:529444135
7899 7899 c, t dbSNP:190361551
7906 7906 c, t dbSNP:149099819
7907 7907 a, g dbSNP:755055654
7908 7908 c, g dbSNP:759370137
7917 7917 c, t dbSNP:533629952
7925 7925 g, t dbSNP:775273821
7930 7930 c, g dbSNP:762367567
7936 7936 c, t dbSNP:781181702
7937 7937 a, g dbSNP:368796568
7942 7942 -, a dbSNP:751064775
7946 7946 a, c dbSNP:762433371
7947 7947 -, a dbSNP:754629848
7953 7953 a, c dbSNP:551809799
7955 7955 a, g dbSNP:200868527
7956 7956 a, g dbSNP:530456916
7959 7959 c, t dbSNP:780416247
7963 7963 c, t dbSNP:754092324
7968 7968 a, c, t dbSNP:754952252
7969 7969 a, g dbSNP:746885216
7973 7973 a, g dbSNP:201983356
7981 7981 a, g dbSNP:781159162
7984 7984 c, g dbSNP:745652554
7987 7987 c, g, t dbSNP:367553476
7988 7988 a, g dbSNP:1126823
7999 7999 a, c dbSNP:774940617
8005 8005 c, t dbSNP:201449366
8013 8013 c, g dbSNP:771656914
8016 8016 c, t dbSNP:768189043
8020 8020 c, t dbSNP:571382991
8021 8021 a, g dbSNP:746554508
8033 8033 a, c dbSNP:771450196
8035 8035 c, t dbSNP:538486886
8036 8036 a, g dbSNP:759942986
8045 8045 a, g dbSNP:377398069
8048 8048 a, g dbSNP:775633191
8054 8054 a, g dbSNP:763186710
8058 8058 g, t dbSNP:764118916
8062 8062 c, t dbSNP:368681276
8063 8063 a, g dbSNP:186576211
8073 8073 a, g dbSNP:747795392
8089 8089 c, t dbSNP:766334726
8098 8098 c, t dbSNP:753721566
8099 8099 a, c, g dbSNP:377128538
8109 8109 c, t dbSNP:370912629
8118 8118 c, t dbSNP:374133594
8120 8120 a, g dbSNP:569099619
8136 8136 a, g dbSNP:777620991
8137 8137 c, t dbSNP:114820113
8154 8154 c, t dbSNP:555296922
8155 8155 a, g, t dbSNP:781678075
8162 8162 g, t dbSNP:573720666
8171 8171 c, t dbSNP:756732368
8179 8179 c, g dbSNP:770148257
8211 8211 a, c dbSNP:762732138
8266 8266 a, g dbSNP:541093536
8272 8272 a, c dbSNP:150780510
8281 8281 a, g dbSNP:189855701
8283 8283 c, t dbSNP:181173463
8284 8284 a, g dbSNP:561506930
8291 8291 a, c dbSNP:774253478
8311 8311 c, t dbSNP:563997728
8323 8323 c, t dbSNP:745511073
8327 8327 a, t dbSNP:531189005
8328 8328 c, t dbSNP:759418555
8355 8355 a, g dbSNP:368319248
8380 8380 a, g dbSNP:543345101
8381 8381 a, g dbSNP:560838194
8384 8384 -, g dbSNP:141417438
8460 8460 c, t dbSNP:76635155
8470 8470 g, t dbSNP:137976779
8497 8497 -, gga dbSNP:778505521
8553 8553 c, g dbSNP:564879903
8558 8558 c, t dbSNP:371957402
8578 8578 a, t dbSNP:375287129
8601 8601 a, c, g dbSNP:73458267
8627 8627 c, g dbSNP:368712709
8641 8641 g, t dbSNP:542722810
8657 8657 c, g dbSNP:558985876
8696 8696 c, t dbSNP:74892133
8725 8725 c, g dbSNP:536114263
8739 8739 c, t dbSNP:371300162
8755 8755 c, t dbSNP:73458269
8818 8818 g, t dbSNP:534725756
8826 8826 c, t dbSNP:143545838
8827 8827 a, g dbSNP:578065470
8836 8836 c, t dbSNP:539130701
8841 8841 c, t dbSNP:557224987
8866 8866 a, g dbSNP:757662135
8875 8875 c, t dbSNP:575930549
8886 8886 g, t dbSNP:746336697
8926 8926 -, ata dbSNP:749706488
8942 8942 a, t dbSNP:543306353
8953 8953 c, g dbSNP:561599720

Target ORF information:

RefSeq Version XM_006720419
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens aggrecan (ACAN), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu56217
Accession Version XM_011521313.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 7593bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product aggrecan core protein isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010194.18) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)481..825(+)
Misc Feature(2)502..837(+)
Misc Feature(3)832..1116(+)
Misc Feature(4)862..867(+)
Misc Feature(5)1135..1422(+)
Misc Feature(6)1156..1161(+)
Misc Feature(7)1807..2091(+)
Misc Feature(8)1837..1842(+)
Misc Feature(9)2110..2397(+)
Misc Feature(10)2131..2136(+)
Misc Feature(11)7207..7317(+)
Misc Feature(12)7207..7260(+)
Misc Feature(13)7333..7704(+)
Misc Feature(14)7387..7680(+)
Misc Feature(15)7516..7620(+)
Misc Feature(16)7528..7620(+)
Misc Feature(17)7588..7662(+)
Misc Feature(18)7714..7884(+)
Misc Feature(19)7744..7806(+)
Position Chain Variation Link
7 7 a, c dbSNP:529456870
48 48 c, g dbSNP:541646122
68 68 -, tc dbSNP:570563311
71 71 c, g dbSNP:559776025
122 122 c, t dbSNP:546618371
195 195 -, c dbSNP:35909381
200 200 a, t dbSNP:533641712
217 217 a, g dbSNP:552121620
223 223 a, g dbSNP:183056139
235 235 a, g dbSNP:530520157
250 250 c, t dbSNP:752547241
256 256 a, g dbSNP:548798212
287 287 a, c dbSNP:574518392
304 304 c, t dbSNP:756767682
315 315 c, t dbSNP:186720187
341 341 c, g dbSNP:778564136
371 371 g, t dbSNP:759649540
380 380 c, t dbSNP:770071622
381 381 a, c dbSNP:775539020
386 386 c, t dbSNP:202166561
388 388 c, t dbSNP:371249232
400 400 a, g dbSNP:776631256
402 402 c, g dbSNP:760468016
424 424 g, t dbSNP:766063753
425 425 c, t dbSNP:761719517
429 429 a, c dbSNP:753706123
436 436 c, g dbSNP:754672128
447 447 a, c dbSNP:571206900
455 455 a, g dbSNP:752419278
458 458 c, g dbSNP:148320028
459 459 a, g dbSNP:371259802
465 465 g, t dbSNP:751144925
474 474 c, g dbSNP:757687541
475 475 a, c, t dbSNP:550784997
479 479 a, t dbSNP:746169178
481 481 c, t dbSNP:770179538
483 483 a, g dbSNP:569119258
484 484 c, t dbSNP:536525136
488 488 c, t dbSNP:548534627
489 489 a, g dbSNP:367956651
494 494 a, g dbSNP:748319031
495 495 g, t dbSNP:374081272
504 504 a, c, g dbSNP:770715922
509 509 a, c dbSNP:759354442
510 510 c, t dbSNP:372517447
514 514 c, t dbSNP:775463088
516 516 c, t dbSNP:368322348
537 537 c, t dbSNP:377037099
538 538 a, g, t dbSNP:763861381
539 539 a, g dbSNP:370110892
543 543 c, t dbSNP:534678891
546 546 a, g dbSNP:750953875
560 560 a, c dbSNP:200239326
561 561 c, t dbSNP:191648646
562 562 a, g dbSNP:749720584
569 569 a, c dbSNP:755142678
570 570 c, t dbSNP:779210441
572 572 c, t dbSNP:748136311
574 574 a, g dbSNP:182894280
578 578 a, c dbSNP:773473572
579 579 a, c, g dbSNP:372041880
591 591 a, t dbSNP:769916642
592 592 a, g dbSNP:775409722
594 594 c, t dbSNP:762816809
604 604 c, t dbSNP:575468209
605 605 a, g dbSNP:199701329
617 617 a, g dbSNP:373267308
625 625 g, t dbSNP:766995595
652 652 c, g, t dbSNP:565318742
653 653 a, g dbSNP:376202313
654 654 c, t dbSNP:754145054
655 655 a, c, g dbSNP:370626315
658 658 c, t dbSNP:767131816
659 659 a, g dbSNP:539804190
673 673 g, t dbSNP:777992997
675 675 c, t dbSNP:374544549
680 680 a, g dbSNP:769793742
681 681 a, c dbSNP:16942318
694 694 c, t dbSNP:749000770
696 696 c, t dbSNP:768522016
697 697 a, c dbSNP:774066700
698 698 a, g dbSNP:761498283
699 699 a, c dbSNP:771780380
704 704 c, t dbSNP:370458786
705 705 a, g dbSNP:373654303
708 708 c, t dbSNP:766805580
720 720 c, t dbSNP:532105305
721 721 a, g dbSNP:760009352
729 729 a, g dbSNP:765604626
733 733 g, t dbSNP:550721325
741 741 c, t dbSNP:758677795
744 744 a, g dbSNP:778151431
745 745 c, t dbSNP:201105250
746 746 a, g dbSNP:757439227
751 751 a, c dbSNP:780095199
769 769 c, t dbSNP:550510196
770 770 a, g, t dbSNP:768518689
774 774 c, t dbSNP:529879661
775 775 a, g dbSNP:372054790
783 783 a, g dbSNP:772856511
788 788 c, g dbSNP:760138666
792 792 c, t dbSNP:375073497
793 793 a, g dbSNP:776044877
802 802 a, g dbSNP:372286756
804 804 c, g dbSNP:765720290
807 807 a, c dbSNP:376762991
809 809 c, t dbSNP:763410231
810 810 c, g dbSNP:764368613
813 813 a, g dbSNP:35600223
816 816 a, g dbSNP:571646418
819 819 a, c, t dbSNP:371875791
831 831 c, t dbSNP:193277896
834 834 c, t dbSNP:758371121
835 835 a, g dbSNP:370113313
857 857 a, c dbSNP:777539705
863 863 a, g dbSNP:746862356
867 867 c, t dbSNP:375322679
874 874 a, g dbSNP:780709119
876 876 c, t dbSNP:745339413
879 879 g, t dbSNP:769205516
884 884 a, g dbSNP:367881858
887 887 c, t dbSNP:371065660
888 888 a, g dbSNP:541976828
892 892 c, t dbSNP:374211268
893 893 a, g dbSNP:769356878
894 894 g, t dbSNP:368963320
895 895 a, g dbSNP:762284114
896 896 a, c dbSNP:767714238
897 897 c, g dbSNP:773337440
909 909 c, t dbSNP:760759621
911 911 a, g dbSNP:766337526
917 917 a, t dbSNP:199602867
926 926 c, t dbSNP:771509541
927 927 a, g dbSNP:142615277
928 928 a, c dbSNP:751285545
943 943 a, g dbSNP:374984332
945 945 c, t dbSNP:369187075
946 946 a, g dbSNP:527447898
950 950 a, g dbSNP:755834901
951 951 c, t dbSNP:373716409
952 952 a, g dbSNP:748868363
957 957 c, t dbSNP:375544241
959 959 a, g dbSNP:779568883
963 963 c, t dbSNP:531513303
975 975 c, t dbSNP:550550807
976 976 a, g dbSNP:568955745
978 978 c, t dbSNP:146033080
979 979 a, g dbSNP:771241836
1003 1003 a, g dbSNP:776632256
1017 1017 c, t dbSNP:759517649
1018 1018 a, g dbSNP:758772503
1022 1022 c, t dbSNP:191442526
1024 1024 c, g, t dbSNP:370993153
1025 1025 a, g dbSNP:757637229
1031 1031 g, t dbSNP:781581989
1037 1037 a, g dbSNP:746056428
1038 1038 c, t dbSNP:770071513
1042 1042 a, g dbSNP:374644024
1049 1049 -, a dbSNP:768599280
1051 1051 a, g dbSNP:749403999
1070 1070 c, g dbSNP:771842029
1071 1071 a, c, g, t dbSNP:767595242
1076 1076 c, g dbSNP:776609333
1078 1078 a, t dbSNP:759248879
1082 1082 a, g dbSNP:764993901
1089 1089 c, g dbSNP:368549781
1091 1091 a, g dbSNP:757955838
1092 1092 c, t dbSNP:371404599
1093 1093 a, g dbSNP:200578079
1097 1097 c, t dbSNP:757798845
1101 1101 c, t dbSNP:781529260
1114 1114 c, t dbSNP:746292202
1117 1117 a, g dbSNP:564289325
1119 1119 c, t dbSNP:35790816
1120 1120 a, g dbSNP:560781973
1122 1122 a, g dbSNP:768804104
1126 1126 a, c dbSNP:774343061
1127 1127 c, t dbSNP:528232598
1138 1138 a, g dbSNP:377286945
1139 1139 c, t dbSNP:761319997
1169 1169 a, c dbSNP:767977103
1170 1170 c, g dbSNP:750954036
1174 1174 c, g dbSNP:761136902
1180 1180 c, g dbSNP:766735190
1187 1187 a, g dbSNP:754225607
1194 1194 c, t dbSNP:755216954
1195 1195 c, t dbSNP:369870175
1196 1196 a, g dbSNP:373432805
1199 1199 a, g dbSNP:34949187
1203 1203 a, g dbSNP:778047250
1207 1207 -, c dbSNP:35281241
1210 1210 c, t dbSNP:745766545
1211 1211 a, g dbSNP:184913582
1212 1212 a, g dbSNP:779882835
1223 1223 c, t dbSNP:749047801
1224 1224 a, g dbSNP:534544364
1231 1231 c, t dbSNP:774028386
1235 1235 a, g dbSNP:747612281
1241 1241 a, c dbSNP:771549237
1242 1242 -, gta dbSNP:774474651
1243 1243 g, t dbSNP:772749915
1246 1246 c, t dbSNP:761241049
1249 1249 a, g dbSNP:766854282
1253 1253 c, g dbSNP:776985817
1261 1261 a, c dbSNP:759847781
1262 1262 c, t dbSNP:558565679
1268 1268 a, g dbSNP:752944661
1269 1269 c, t dbSNP:576947078
1270 1270 a, g dbSNP:764260441
1272 1272 c, t dbSNP:371531556
1273 1273 a, g dbSNP:746931049
1284 1284 c, t dbSNP:368988256
1288 1288 c, t dbSNP:372895171
1289 1289 a, g dbSNP:768504322
1294 1294 a, g dbSNP:778732470
1298 1298 a, g dbSNP:747767483
1299 1299 c, g dbSNP:117583968
1316 1316 c, g dbSNP:772697028
1317 1317 c, t dbSNP:746517194
1318 1318 c, t dbSNP:771427434
1323 1323 c, g dbSNP:777025489
1325 1325 a, g dbSNP:760137135
1338 1338 c, t dbSNP:765665954
1347 1347 c, t dbSNP:776059900
1348 1348 a, g, t dbSNP:200118502
1354 1354 a, c dbSNP:751588853
1356 1356 c, t dbSNP:560136999
1363 1363 a, g dbSNP:766293702
1366 1366 a, c dbSNP:753701070
1368 1368 c, t dbSNP:570748192
1373 1373 a, g dbSNP:776721559
1379 1379 c, t dbSNP:370865297
1380 1380 a, g dbSNP:572285643
1383 1383 c, t dbSNP:757990771
1387 1387 c, g, t dbSNP:777432522
1388 1388 c, g, t dbSNP:374218750
1390 1390 a, g dbSNP:746352037
1395 1395 c, t dbSNP:770477808
1402 1402 c, t dbSNP:376508432
1403 1403 a, g dbSNP:763412179
1404 1404 a, c dbSNP:12593024
1405 1405 c, t dbSNP:768962559
1406 1406 a, g dbSNP:774462118
1407 1407 c, t dbSNP:762147927
1408 1408 a, g dbSNP:767467522
1411 1411 a, g dbSNP:545729531
1419 1419 c, t dbSNP:759457761
1421 1421 a, g dbSNP:79832113
1436 1436 a, t dbSNP:749910732
1439 1439 c, t dbSNP:755711052
1455 1455 a, c dbSNP:549170099
1467 1467 a, c, g dbSNP:372104051
1469 1469 c, g dbSNP:567446094
1472 1472 a, g dbSNP:755579927
1485 1485 c, t dbSNP:779132656
1488 1488 c, g dbSNP:370104735
1489 1489 a, g dbSNP:372762081
1496 1496 c, g dbSNP:773517396
1499 1499 c, t dbSNP:747278844
1502 1502 c, g dbSNP:377176198
1504 1504 c, t dbSNP:776758695
1507 1507 a, c dbSNP:762863511
1510 1510 a, g dbSNP:764102419
1531 1531 c, g dbSNP:773948197
1532 1532 a, g dbSNP:761696605
1537 1537 a, g dbSNP:767026007
1546 1546 g, t dbSNP:369041225
1556 1556 a, g dbSNP:200709031
1558 1558 a, c, g dbSNP:117772298
1562 1562 a, c, g dbSNP:371018764
1563 1563 c, t dbSNP:572438161
1564 1564 a, g dbSNP:748422617
1570 1570 c, t dbSNP:758765920
1575 1575 c, t dbSNP:778149713
1576 1576 a, g dbSNP:200027891
1579 1579 a, g dbSNP:554949381
1583 1583 a, c dbSNP:368795077
1585 1585 a, g dbSNP:148070768
1590 1590 c, t dbSNP:745961803
1591 1591 a, g dbSNP:774443075
1593 1593 g, t dbSNP:576493396
1594 1594 g, t dbSNP:543647411
1596 1596 c, t dbSNP:16942341
1598 1598 c, g dbSNP:773211569
1601 1601 c, t dbSNP:200227191
1603 1603 a, g dbSNP:766146982
1605 1605 c, t dbSNP:753336473
1606 1606 c, t dbSNP:754551623
1611 1611 a, g dbSNP:116981974
1617 1617 c, t dbSNP:375758859
1618 1618 a, g dbSNP:758892087
1621 1621 a, g dbSNP:370296999
1629 1629 c, t dbSNP:751930065
1630 1630 a, c dbSNP:757403740
1631 1631 c, t dbSNP:374286796
1632 1632 a, g dbSNP:368193007
1640 1640 c, g dbSNP:769892728
1650 1650 c, g dbSNP:780040281
1654 1654 a, g dbSNP:748112955
1662 1662 c, t dbSNP:559634421
1663 1663 a, g, t dbSNP:367659235
1669 1669 g, t dbSNP:770670042
1672 1672 a, g dbSNP:776371059
1674 1674 c, g dbSNP:372157525
1695 1695 c, g dbSNP:368305201
1715 1715 c, t dbSNP:764796784
1717 1717 a, c dbSNP:532736974
1726 1726 a, g dbSNP:372274447
1727 1727 c, g dbSNP:764588967
1736 1736 c, t dbSNP:575245223
1737 1737 a, c, g dbSNP:757639456
1741 1741 c, t dbSNP:181736584
1746 1746 c, g dbSNP:756359756
1747 1747 a, g dbSNP:780169895
1756 1756 c, t dbSNP:749341648
1758 1758 c, t dbSNP:371505346
1759 1759 g, t dbSNP:200734577
1762 1762 a, g dbSNP:777892697
1768 1768 g, t dbSNP:761237568
1773 1773 c, t dbSNP:185960535
1774 1774 a, g dbSNP:770829348
1784 1784 a, g, t dbSNP:749892328
1786 1786 a, c dbSNP:759209767
1790 1790 c, t dbSNP:535720074
1791 1791 a, g dbSNP:530678017
1792 1792 c, t dbSNP:774993574
1800 1800 a, g dbSNP:762481427
1807 1807 g, t dbSNP:748987964
1810 1810 a, g dbSNP:369608360
1815 1815 c, g dbSNP:773918941
1822 1822 c, t dbSNP:780424423
1823 1823 a, g dbSNP:200950723
1838 1838 a, g dbSNP:202205582
1844 1844 c, t dbSNP:117116488
1845 1845 a, g dbSNP:373757072
1851 1851 c, g, t dbSNP:139042772
1858 1858 a, g dbSNP:755294223
1859 1859 a, g dbSNP:538870253
1865 1865 a, t dbSNP:117881662
1871 1871 c, t dbSNP:757190295
1879 1879 c, t dbSNP:149841431
1880 1880 c, g dbSNP:144835580
1882 1882 a, t dbSNP:374406298
1883 1883 c, t dbSNP:779937883
1884 1884 a, g dbSNP:748932986
1890 1890 a, g dbSNP:34957282
1901 1901 c, t dbSNP:773794233
1902 1902 a, g, t dbSNP:371049725
1905 1905 a, g dbSNP:34637731
1906 1906 a, g dbSNP:773619196
1911 1911 g, t dbSNP:761297861
1921 1921 a, g dbSNP:540361430
1922 1922 c, t dbSNP:564985995
1925 1925 a, c dbSNP:759770403
1926 1926 c, t dbSNP:765556817
1927 1927 a, c, g dbSNP:267604363
1931 1931 c, g dbSNP:764283130
1932 1932 a, c dbSNP:750296012
1934 1934 a, g dbSNP:756140760
1942 1942 c, g dbSNP:372777485
1943 1943 a, t dbSNP:753649277
1944 1944 c, g dbSNP:754558595
1950 1950 c, g, t dbSNP:367724066
1951 1951 a, g dbSNP:771465769
1953 1953 c, t dbSNP:777385760
1954 1954 a, g dbSNP:747469866
1955 1955 a, g dbSNP:771478914
1963 1963 a, c, t dbSNP:777066916
1964 1964 a, g dbSNP:544077619
1971 1971 c, g dbSNP:775831150
1974 1974 c, g dbSNP:763276448
1975 1975 a, g dbSNP:764074781
1984 1984 c, t dbSNP:768937241
1992 1992 a, g dbSNP:774230576
1998 1998 a, c dbSNP:2272023
1999 1999 c, t dbSNP:143697605
2000 2000 a, g dbSNP:151237327
2004 2004 a, c dbSNP:758311816
2005 2005 c, t dbSNP:759515019
2006 2006 c, t dbSNP:765015015
2010 2010 c, t dbSNP:752598382
2011 2011 a, g, t dbSNP:62640041
2013 2013 c, g dbSNP:369454178
2038 2038 a, g dbSNP:763836625
2041 2041 a, t dbSNP:750979692
2047 2047 c, t dbSNP:756802171
2048 2048 a, g dbSNP:532546900
2050 2050 g, t dbSNP:373952066
2053 2053 a, g dbSNP:770141611
2056 2056 c, t dbSNP:780224333
2057 2057 a, g, t dbSNP:376881991
2058 2058 c, g dbSNP:774656142
2059 2059 c, g dbSNP:748369134
2062 2062 c, t dbSNP:551134605
2069 2069 a, g dbSNP:569388356
2072 2072 c, t dbSNP:759458195
2076 2076 c, t dbSNP:536865924
2077 2077 a, g dbSNP:775104367
2083 2083 c, t dbSNP:762824937
2093 2093 g, t dbSNP:763839982
2094 2094 a, g dbSNP:57669733
2101 2101 c, t dbSNP:757037237
2105 2105 a, g dbSNP:767120823
2109 2109 g, t dbSNP:753077000
2110 2110 a, g dbSNP:758553258
2121 2121 c, t dbSNP:374406755
2122 2122 a, g dbSNP:747278710
2123 2123 a, c dbSNP:377338540
2128 2128 a, c, t dbSNP:144501729
2129 2129 a, g dbSNP:375567241
2130 2130 c, g dbSNP:368579188
2131 2131 c, t dbSNP:761732451
2132 2132 g, t dbSNP:546076896
2134 2134 a, g dbSNP:771802121
2138 2138 a, g dbSNP:772978689
2157 2157 a, g dbSNP:760446079
2158 2158 c, g dbSNP:765912431
2161 2161 a, g dbSNP:753349925
2170 2170 a, g dbSNP:760034910
2181 2181 g, t dbSNP:765671060
2184 2184 c, t dbSNP:1568116
2186 2186 c, g, t dbSNP:758736365
2187 2187 a, g dbSNP:576643706
2188 2188 c, t dbSNP:751772662
2192 2192 c, g dbSNP:757476544
2199 2199 a, g dbSNP:544057872
2202 2202 c, t dbSNP:781273878
2211 2211 c, t dbSNP:745939485
2212 2212 a, g dbSNP:377219636
2214 2214 c, g, t dbSNP:188044698
2215 2215 a, g, t dbSNP:771963700
2217 2217 c, t dbSNP:539649392
2222 2222 a, g dbSNP:770505276
2224 2224 c, t dbSNP:776144534
2225 2225 a, g dbSNP:34616796
2232 2232 a, g dbSNP:764772401
2241 2241 c, t dbSNP:35652696
2244 2244 c, t dbSNP:763515848
2247 2247 c, t dbSNP:371543651
2248 2248 g, t dbSNP:148018909
2257 2257 a, g dbSNP:200412974
2259 2259 c, t dbSNP:767663589
2260 2260 a, g dbSNP:369864209
2262 2262 c, t dbSNP:756126577
2263 2263 a, g dbSNP:780323898
2268 2268 c, t dbSNP:748095240
2272 2272 c, t dbSNP:758471993
2273 2273 a, g dbSNP:35965913
2283 2283 c, t dbSNP:746789171
2284 2284 a, g dbSNP:770581471
2288 2288 a, c, t dbSNP:776122536
2290 2290 c, t dbSNP:769287861
2292 2292 a, g dbSNP:775035922
2295 2295 c, g dbSNP:763391616
2302 2302 c, t dbSNP:764586930
2304 2304 c, t dbSNP:551265948
2305 2305 a, c, g dbSNP:762106035
2309 2309 g, t dbSNP:750579987
2319 2319 a, g dbSNP:201642680
2322 2322 c, t dbSNP:377391149
2323 2323 a, g dbSNP:201414869
2326 2326 a, g dbSNP:753982782
2330 2330 c, t dbSNP:373373120
2331 2331 a, g dbSNP:777892820
2338 2338 c, t dbSNP:746773847
2343 2343 c, t dbSNP:74029641
2346 2346 c, t dbSNP:376926374
2348 2348 a, g dbSNP:370283261
2350 2350 c, g dbSNP:181923062
2351 2351 a, g dbSNP:374239823
2354 2354 c, t dbSNP:141628105
2355 2355 a, g dbSNP:769101937
2357 2357 a, g dbSNP:774699509
2358 2358 c, t dbSNP:762423614
2359 2359 c, t dbSNP:772320528
2360 2360 g, t dbSNP:773685275
2373 2373 c, g dbSNP:551557520
2374 2374 g, t dbSNP:760924730
2377 2377 c, t dbSNP:766715171
2378 2378 a, g dbSNP:77572130
2379 2379 a, g dbSNP:759714158
2382 2382 a, c dbSNP:765394408
2387 2387 c, t dbSNP:751443753
2399 2399 a, g, t dbSNP:35102652
2403 2403 c, t dbSNP:771413785
2411 2411 c, t dbSNP:367992413
2412 2412 a, g dbSNP:372553119
2413 2413 g, t dbSNP:377059310
2418 2418 c, t dbSNP:775390838
2436 2436 a, g dbSNP:763114699
2441 2441 a, g dbSNP:764128416
2449 2449 a, c dbSNP:773102587
2451 2451 a, g dbSNP:760672233
2456 2456 c, t dbSNP:766150369
2457 2457 a, c dbSNP:753647557
2479 2479 a, g dbSNP:370096577
2496 2496 c, t dbSNP:377172993
2497 2497 a, c, g dbSNP:35120858
2514 2514 c, t dbSNP:777469734
2515 2515 a, g dbSNP:747501102
2520 2520 a, t dbSNP:757848551
2528 2528 a, c dbSNP:781633190
2529 2529 a, g dbSNP:534850188
2534 2534 c, t dbSNP:769858164
2536 2536 a, g dbSNP:775758199
2539 2539 c, g, t dbSNP:267604364
2540 2540 a, c dbSNP:768777515
2550 2550 a, g dbSNP:774473524
2553 2553 c, t dbSNP:760549529
2568 2568 g, t dbSNP:766310483
2571 2571 a, c dbSNP:372515989
2572 2572 a, c dbSNP:377098407
2577 2577 c, t dbSNP:546837225
2578 2578 a, g dbSNP:202060628
2588 2588 a, g dbSNP:752367506
2593 2593 a, t dbSNP:571888451
2599 2599 g, t dbSNP:763636524
2602 2602 c, g dbSNP:751115587
2604 2604 a, c dbSNP:757797101
2613 2613 c, t dbSNP:150362784
2618 2618 c, t dbSNP:781769779
2622 2622 a, g dbSNP:137972043
2627 2627 c, t dbSNP:373766961
2632 2632 a, c dbSNP:376234405
2633 2633 c, t dbSNP:749512612
2634 2634 a, g dbSNP:370627724
2636 2636 c, t dbSNP:577419060
2637 2637 a, g dbSNP:748260469
2655 2655 a, t dbSNP:554374418
2664 2664 c, t dbSNP:2351491
2665 2665 a, g dbSNP:754158581
2670 2670 c, t dbSNP:546447132
2671 2671 a, g dbSNP:150988100
2681 2681 a, g dbSNP:748421719
2682 2682 a, g dbSNP:191404107
2690 2690 c, t dbSNP:777785667
2696 2696 c, g dbSNP:745756144
2708 2708 a, c dbSNP:769618934
2713 2713 a, g dbSNP:775312655
2726 2726 c, t dbSNP:762675815
2731 2731 a, g dbSNP:758720393
2739 2739 c, t dbSNP:774114868
2742 2742 c, t dbSNP:761624092
2746 2746 a, g dbSNP:543052440
2765 2765 a, g dbSNP:78770909
2774 2774 a, c dbSNP:761177707
2777 2777 c, t dbSNP:766827687
2814 2814 c, t dbSNP:754184356
2818 2818 a, g dbSNP:755315928
2824 2824 c, t dbSNP:765633053
2825 2825 c, t dbSNP:200626682
2829 2829 c, t dbSNP:758681426
2840 2840 a, g dbSNP:777838943
2848 2848 c, t dbSNP:747087432
2858 2858