
SLC26A3 cDNA ORF clone, Homo sapiens (human)

Gene Symbol SLC26A3
Entrez Gene ID 1811
Full Name solute carrier family 26 (anion exchanger), member 3
Synonyms CLD, DRA
General protein information
Preferred Names
chloride anion exchanger
chloride anion exchanger
down-regulated in adenoma protein
solute carrier family 26, member 3
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a transmembrane glycoprotein that transports chloride ions across the cell membrane in exchange for bicarbonate ions. It is localized to the mucosa of the lower intestinal tract, particularly to the apical membrane of columnar epithelium and some goblet cells. The protein is essential for intestinal chloride absorption, and mutations in this gene have been associated with congenital chloride diarrhea. [provided by RefSeq, Oct 2008]. lac of sum
Disorder MIM:


Disorder Html: ?Colon cancer (1); Chloride diarrhea, congenital, Finnish type,

mRNA and Protein(s)

mRNA Protein Name
XM_011515867 XP_011514169 chloride anion exchanger isoform X1
NM_000111 NP_000102 chloride anion exchanger

hsa04972 Pancreatic secretion
hsa04978 Mineral absorption
R-HSA-425407 SLC-mediated transmembrane transport
R-HSA-382551 Transmembrane transport of small molecules
R-HSA-425393 Transport of inorganic cations/anions and amino acids/oligopeptides
R-HSA-427601 Multifunctional anion exchangers

Homo sapiens (human) SLC26A3 NP_000102.1
Pan troglodytes (chimpanzee) SLC26A3 XP_527858.2
Macaca mulatta (Rhesus monkey) SLC26A3 XP_001090155.2
Canis lupus familiaris (dog) SLC26A3 XP_540380.3
Bos taurus (cattle) SLC26A3 NP_001077145.1
Mus musculus (house mouse) Slc26a3 NP_067328.1
Rattus norvegicus (Norway rat) Slc26a3 NP_446207.1
Gallus gallus (chicken) SLC26A3 NP_001186373.1
Danio rerio (zebrafish) si:dkey-31f5.1 NP_001035265.1
Danio rerio (zebrafish) slc26a3 NP_001129155.1
Caenorhabditis elegans sulp-6 NP_491138.2
Xenopus (Silurana) tropicalis (western clawed frog) LOC101731072 XP_004913063.1


ID Name Evidence
GO:0005624 membrane fraction TAS
GO:0005886 plasma membrane TAS
GO:0016021 integral to membrane IEA
GO:0016324 apical plasma membrane IEA
GO:0031526 brush border membrane IEA


ID Name Evidence
GO:0003700 sequence-specific DNA binding transcription factor activity TAS
GO:0003712 transcription cofactor activity TAS
GO:0005215 transporter activity IEA
GO:0005452 inorganic anion exchanger activity TAS
GO:0008271 secondary active sulfate transmembrane transporter activity IEA
GO:0015297 antiporter activity IEA


ID Name Evidence
GO:0006351 transcription, DNA-dependent TAS
GO:0006811 ion transport TAS
GO:0006820 anion transport TAS
GO:0007588 excretion TAS
GO:0008272 sulfate transport IEA
GO:0055085 transmembrane transport TAS

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following SLC26A3 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the SLC26A3 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
XM_011515867 PREDICTED: Homo sapiens solute carrier family 26 (anion exchanger), member 3 (SLC26A3), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
NM_000111 Homo sapiens solute carrier family 26 (anion exchanger), member 3 (SLC26A3), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu26676
Accession Version XM_011515867.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2295bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product chloride anion exchanger isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_007933.16) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)364..615(+)
Misc Feature(2)367..2340(+)
Misc Feature(3)769..1605(+)
Misc Feature(4)1768..2328(+)
Position Chain Variation Link
91 91 a, t dbSNP:574634462
105 105 a, g dbSNP:375869839
113 113 a, c dbSNP:551025090
116 116 c, g dbSNP:537554803
119 119 c, t dbSNP:775648286
142 142 a, c dbSNP:370340588
147 147 a, t dbSNP:759470822
148 148 a, g dbSNP:543293137
149 149 g, t dbSNP:774416154
150 150 c, t dbSNP:770912757
151 151 -, agg dbSNP:775955079
153 153 a, c, g, t dbSNP:187600896
160 160 c, t dbSNP:748350542
162 162 c, t dbSNP:781435226
173 173 c, g dbSNP:548807004
175 175 a, g dbSNP:747436018
176 176 a, c dbSNP:780369359
178 178 a, g dbSNP:758949431
187 187 -, a dbSNP:766140945
188 188 c, t dbSNP:545546518
202 202 c, t dbSNP:529161051
205 205 g, t dbSNP:763684294
207 207 c, t dbSNP:755723694
221 221 c, t dbSNP:752391046
223 223 g, t dbSNP:767335781
226 226 g, t dbSNP:201803182
240 240 g, t dbSNP:182526650
241 241 c, t dbSNP:746320801
249 249 c, t dbSNP:762967942
256 256 c, g dbSNP:773069003
266 266 a, t dbSNP:375084378
273 273 g, t dbSNP:769888729
283 283 c, t dbSNP:748296975
285 285 c, t dbSNP:776824360
296 296 c, t dbSNP:144627478
301 301 a, g dbSNP:768883226
304 304 a, c dbSNP:747307552
305 305 -, atc dbSNP:760335912
306 306 c, t dbSNP:780498972
310 310 a, t dbSNP:758784870
311 311 a, g dbSNP:78133952
312 312 a, t dbSNP:746365141
315 315 a, g dbSNP:779354646
321 321 c, t dbSNP:199700484
325 325 c, t dbSNP:775625844
326 326 a, g dbSNP:772479643
327 327 c, t dbSNP:746274250
329 329 c, t dbSNP:779418017
330 330 a, c, t dbSNP:750358656
331 331 c, t dbSNP:747617582
334 334 c, g dbSNP:780867682
335 335 a, g dbSNP:754582033
337 337 -, aaggccaagagaa dbSNP:386833456
339 339 g, t dbSNP:200940608
345 345 a, g dbSNP:779642889
349 349 a, g dbSNP:758202770
351 351 g, t dbSNP:750202453
357 357 a, c, t dbSNP:557332354
359 359 c, t dbSNP:369767483
367 367 c, t dbSNP:371476952
369 369 -, c dbSNP:386833468
375 375 a, t dbSNP:764139096
377 377 a, c dbSNP:760709614
380 380 g, t dbSNP:539000195
395 395 a, g dbSNP:10280704
414 414 c, g dbSNP:772195554
416 416 a, g dbSNP:568647097
418 418 a, g dbSNP:774886249
423 423 a, t dbSNP:771512079
433 433 a, g dbSNP:116793431
439 439 a, g dbSNP:778461830
441 441 a, c dbSNP:201503990
450 450 g, t dbSNP:746560492
453 453 a, c, t dbSNP:202020458
454 454 a, g dbSNP:745637222
462 462 -, aa dbSNP:386833476
462 462 a, g dbSNP:778701842
464 464 -, aaaaaacaa dbSNP:745984527
466 466 g, t dbSNP:752772269
467 467 -, g dbSNP:781078889
469 469 a, g dbSNP:767469189
471 471 a, c dbSNP:755121230
486 486 c, g, t dbSNP:368890058
487 487 a, g dbSNP:150004100
493 493 a, c dbSNP:773720855
503 503 a, g dbSNP:765740009
509 509 -, t dbSNP:747227831
516 516 a, g, t dbSNP:777245366
519 519 c, t dbSNP:771453618
523 523 c, t dbSNP:745451148
524 524 c, t dbSNP:75733585
524 524 -, t dbSNP:386833477
527 527 -, c dbSNP:778170408
532 532 a, g dbSNP:781074197
536 536 -, t dbSNP:386833478
537 537 c, g dbSNP:531537088
545 545 c, t dbSNP:770574116
545 545 -, t dbSNP:752963526
547 547 c, t dbSNP:749041348
549 549 a, c, g, t dbSNP:73419912
550 550 a, g dbSNP:386833479
553 553 a, t dbSNP:755093836
558 558 c, t dbSNP:373999154
563 563 a, t dbSNP:121913030
570 570 c, t dbSNP:142349142
571 571 a, g, t dbSNP:142116047
578 578 a, c, g, t dbSNP:386833480
579 579 a, g dbSNP:754233296
584 584 -, c dbSNP:386833482
584 584 c, g, t dbSNP:386833481
585 585 a, g dbSNP:140184294
589 589 c, t dbSNP:146149806
600 600 a, g dbSNP:386833483
603 603 c, g dbSNP:750301254
622 622 a, g dbSNP:762512404
625 625 a, g dbSNP:772723797
627 627 g, t dbSNP:769497194
636 636 a, g dbSNP:761450081
641 641 c, t dbSNP:765114944
645 645 -, t dbSNP:765980141
646 646 c, t dbSNP:776524702
647 647 a, g, t dbSNP:763721296
650 650 a, g dbSNP:142400087
651 651 a, t dbSNP:372822974
656 656 c, t dbSNP:532228172
660 660 c, g, t dbSNP:778947363
669 669 -, g dbSNP:760458350
674 674 a, g dbSNP:757528549
677 677 a, g dbSNP:749565848
680 680 c, t dbSNP:778088438
690 690 g, t dbSNP:775076151
704 704 a, g dbSNP:753193754
705 705 c, t dbSNP:367588993
706 706 a, g dbSNP:71566741
716 716 c, g dbSNP:749952119
717 717 c, g dbSNP:386833484
721 721 -, tgg dbSNP:772974499
721 721 a, c, g dbSNP:769586560
722 722 c, t dbSNP:147974764
723 723 a, g dbSNP:543522300
725 725 c, t dbSNP:143515876
726 726 a, g dbSNP:149275142
728 728 c, t dbSNP:772151477
729 729 -, ggc dbSNP:369893693
729 729 a, c, g dbSNP:374927524
731 731 c, t dbSNP:770964980
747 747 g, t dbSNP:749494186
751 751 g, t dbSNP:121913032
767 767 c, g, t dbSNP:748470732
775 775 a, g dbSNP:781561601
782 782 a, g dbSNP:201844799
785 785 c, t dbSNP:747520036
788 788 g, t dbSNP:780496577
793 793 g, t dbSNP:768701230
797 797 c, t dbSNP:756781550
802 802 g, t dbSNP:386833487
808 808 c, t dbSNP:386833488
817 817 -, ctc dbSNP:773970957
823 823 a, g dbSNP:572627383
824 824 c, g dbSNP:753414608
826 826 a, g dbSNP:777504274
832 832 a, t dbSNP:755850859
841 841 c, g dbSNP:752443968
847 847 a, g, t dbSNP:138427715
850 850 c, g dbSNP:751500825
851 851 a, c dbSNP:386833489
852 852 c, t dbSNP:766239629
853 853 a, g dbSNP:370662677
875 875 c, t dbSNP:758888560
877 877 a, t dbSNP:762953026
891 891 a, g dbSNP:773309276
896 896 c, t dbSNP:769956584
897 897 a, g dbSNP:755680710
903 903 c, g dbSNP:145962719
918 918 a, g dbSNP:769061492
929 929 g, t dbSNP:753299095
933 933 a, g dbSNP:188437289
936 936 c, t dbSNP:772611971
937 937 g, t dbSNP:765863383
942 942 a, t dbSNP:746342351
944 944 a, g, t dbSNP:769410426
947 947 c, t dbSNP:747674752
951 951 a, g dbSNP:780829913
956 956 a, g dbSNP:754616407
985 985 a, g dbSNP:375650310
988 988 c, t dbSNP:779693108
1006 1006 g, t dbSNP:758230257
1008 1008 a, c dbSNP:750356211
1012 1012 a, g dbSNP:571663600
1015 1015 g, t dbSNP:551523055
1016 1016 c, t dbSNP:142128989
1033 1033 c, t dbSNP:753871343
1034 1034 a, g dbSNP:764340501
1041 1041 a, c dbSNP:755764036
1044 1044 a, c dbSNP:775819597
1055 1055 g, t dbSNP:767986225
1057 1057 a, c dbSNP:760033252
1063 1063 c, g dbSNP:774937187
1066 1066 a, g dbSNP:771569151
1068 1068 c, t dbSNP:747653037
1069 1069 a, g dbSNP:776026508
1078 1078 a, c, g dbSNP:746613423
1079 1079 c, t dbSNP:779825227
1083 1083 c, t dbSNP:367700437
1084 1084 a, g dbSNP:752002517
1107 1107 a, c, t dbSNP:386833490
1108 1108 a, g dbSNP:138234173
1113 1113 g, t dbSNP:34407351
1115 1115 a, g, t dbSNP:80222394
1126 1126 a, g dbSNP:779481750
1130 1130 a, t dbSNP:760290597
1132 1132 a, c dbSNP:372165246
1139 1139 c, g dbSNP:368292176
1141 1141 -, gtg dbSNP:121913029
1142 1142 -, tggttg dbSNP:777942640
1142 1142 g, t dbSNP:78983942
1143 1143 -, ggt dbSNP:386833491
1143 1143 g, t dbSNP:778705552
1145 1145 g, t dbSNP:770812206
1151 1151 a, g dbSNP:749174661
1161 1161 c, t dbSNP:777822570
1174 1174 c, g dbSNP:770617449
1177 1177 a, g dbSNP:369516311
1187 1187 a, g dbSNP:140952086
1188 1188 c, t dbSNP:35576676
1189 1189 a, g dbSNP:769800728
1193 1193 a, g dbSNP:748189928
1198 1198 g, t dbSNP:142761906
1202 1202 a, g dbSNP:781397312
1206 1206 c, t dbSNP:755147336
1208 1208 a, c dbSNP:751829112
1209 1209 c, t dbSNP:376695368
1210 1210 a, g dbSNP:758633508
1212 1212 a, g dbSNP:750805326
1217 1217 a, t dbSNP:765626129
1218 1218 c, t dbSNP:148961545
1220 1220 a, c, g dbSNP:386833444
1222 1222 gatgcc, ttcggcatcgcaatggtt dbSNP:386833445
1225 1225 a, g dbSNP:754394386
1228 1228 a, c dbSNP:766985569
1230 1230 c, t dbSNP:373747349
1231 1231 a, g dbSNP:773932967
1235 1235 g, t dbSNP:764086216
1236 1236 g, t dbSNP:369910571
1250 1250 g, t dbSNP:762612337
1269 1269 c, t dbSNP:773081550
1270 1270 a, g dbSNP:565092091
1281 1281 c, t dbSNP:748065286
1283 1283 a, t dbSNP:776774391
1287 1287 c, t dbSNP:768844239
1288 1288 a, g dbSNP:747100587
1305 1305 c, t dbSNP:146803737
1323 1323 c, t dbSNP:776654131
1328 1328 c, g dbSNP:386833446
1337 1337 -, aca dbSNP:755575637
1340 1340 -, ta dbSNP:386833447
1359 1359 a, g dbSNP:747047074
1369 1369 g, t dbSNP:775664534
1371 1371 c, g dbSNP:772097371
1372 1372 a, t dbSNP:746074277
1374 1374 c, t dbSNP:779074316
1376 1376 c, g dbSNP:757557395
1377 1377 c, t dbSNP:535930393
1380 1380 c, t dbSNP:139145429
1385 1385 c, t dbSNP:143839547
1392 1392 a, t dbSNP:756632280
1406 1406 a, c, g dbSNP:199638708
1409 1409 c, t dbSNP:757910330
1411 1411 c, g dbSNP:750075198
1412 1412 g, t dbSNP:764996327
1425 1425 a, g dbSNP:761636312
1431 1431 c, t dbSNP:760458819
1438 1438 a, g dbSNP:752669981
1449 1449 c, t dbSNP:140126824
1450 1450 a, g dbSNP:767357038
1452 1452 c, t dbSNP:759616448
1465 1465 a, g, t dbSNP:146161125
1468 1468 c, t dbSNP:763129448
1479 1479 a, t dbSNP:773487664
1488 1488 a, g dbSNP:771777037
1490 1490 c, t dbSNP:200724013
1491 1491 a, g dbSNP:3735605
1498 1498 c, t dbSNP:386833448
1504 1504 c, t dbSNP:763669046
1506 1506 a, c, t dbSNP:117703371
1507 1507 a, g dbSNP:183357373
1512 1512 a, c, g dbSNP:577337450
1525 1525 c, t dbSNP:777524692
1534 1534 -, tt dbSNP:386833450
1546 1546 c, t dbSNP:374372529
1552 1552 c, t dbSNP:386833451
1554 1554 -, g dbSNP:386833452
1572 1572 a, g dbSNP:755739595
1576 1576 c, t dbSNP:747881187
1577 1577 a, g dbSNP:780815307
1578 1578 a, g dbSNP:121913033
1579 1579 c, t dbSNP:386833453
1580 1580 a, g dbSNP:751483686
1583 1583 a, g dbSNP:766316670
1592 1592 -, at dbSNP:767303007
1595 1595 a, t dbSNP:386833454
1611 1611 c, t dbSNP:757427764
1614 1614 a, g dbSNP:753994994
1621 1621 a, g dbSNP:764393881
1623 1623 c, t dbSNP:761057828
1633 1633 a, g dbSNP:753130798
1644 1644 c, t dbSNP:200404042
1645 1645 a, g dbSNP:760086563
1654 1654 c, t dbSNP:774987077
1679 1679 g, t dbSNP:386833457
1687 1687 a, g dbSNP:150724234
1690 1690 a, g dbSNP:375977220
1701 1701 c, t dbSNP:111750004
1704 1704 a, g dbSNP:199870537
1705 1705 c, t dbSNP:768327121
1709 1709 -, c dbSNP:386833459
1718 1718 -, gc dbSNP:386833460
1721 1721 c, t dbSNP:60147601
1722 1722 a, g dbSNP:775193020
1728 1728 a, t dbSNP:575640113
1733 1733 c, t dbSNP:745692539
1743 1743 -, caac dbSNP:386833461
1751 1751 a, g dbSNP:386833462
1755 1755 c, g dbSNP:386833463
1756 1756 a, g dbSNP:774093404
1759 1759 a, g dbSNP:770936978
1761 1761 a, g dbSNP:749227972
1764 1764 a, g dbSNP:148222595
1766 1766 a, g dbSNP:756326040
1771 1771 -, tat dbSNP:386833464
1771 1771 g, t dbSNP:748365570
1773 1773 c, t dbSNP:781576917
1778 1778 c, g, t dbSNP:768761270
1785 1785 a, g dbSNP:769935067
1786 1786 a, c, t dbSNP:372157278
1788 1788 a, c dbSNP:755250104
1801 1801 -, a dbSNP:386833465
1811 1811 g, t dbSNP:147164102
1813 1813 c, t dbSNP:780435705
1815 1815 a, g dbSNP:368930571
1816 1816 c, tct dbSNP:386833466
1817 1817 c, g dbSNP:535987339
1822 1822 a, g dbSNP:765749439
1823 1823 a, t dbSNP:386833467
1837 1837 a, g dbSNP:184317244
1838 1838 a, t dbSNP:752239145
1841 1841 c, g dbSNP:201414043
1852 1852 c, t dbSNP:775780652
1853 1853 a, g dbSNP:2301635
1860 1860 c, t dbSNP:373684245
1863 1863 c, t dbSNP:762667509
1864 1864 a, g dbSNP:370246673
1873 1873 g, t dbSNP:768769355
1875 1875 c, g, t dbSNP:376707926
1876 1876 g, t dbSNP:772218006
1889 1889 a, g dbSNP:746185703
1894 1894 c, g dbSNP:143677801
1898 1898 a, g dbSNP:771347047
1903 1903 c, t dbSNP:749777742
1904 1904 a, g dbSNP:778152516
1913 1913 c, t dbSNP:370732546
1920 1920 c, g dbSNP:138094082
1928 1928 a, g dbSNP:201969535
1936 1936 c, g dbSNP:778338646
1943 1943 a, g dbSNP:750139993
1945 1945 a, g dbSNP:147019341
1958 1958 a, c, t dbSNP:756753223
1962 1962 a, c dbSNP:757177714
1970 1970 c, g dbSNP:767584363
1978 1978 c, g, t dbSNP:201220816
1979 1979 a, g dbSNP:768043306
1993 1993 a, g dbSNP:201078396
1994 1994 c, t dbSNP:35776303
2002 2002 c, t dbSNP:770244075
2004 2004 c, t dbSNP:372871858
2007 2007 a, c, t dbSNP:771640694
2008 2008 a, g dbSNP:745383039
2013 2013 a, c, g dbSNP:781024851
2020 2020 a, g dbSNP:756998584
2030 2030 c, t dbSNP:749006196
2031 2031 a, c dbSNP:777404277
2035 2035 a, g dbSNP:755990821
2037 2037 a, c dbSNP:752514037
2038 2038 c, t dbSNP:564106034
2039 2039 g, t dbSNP:755005048
2041 2041 a, c, g dbSNP:766486980
2042 2042 a, c dbSNP:763065069
2043 2043 a, c dbSNP:138629546
2044 2044 -, c dbSNP:748313911
2047 2047 c, t dbSNP:750715414
2057 2057 c, t dbSNP:765515301
2064 2064 a, c dbSNP:762241978
2066 2066 a, t dbSNP:777220083
2074 2074 c, g dbSNP:369667941
2077 2077 a, c dbSNP:759075042
2078 2078 c, t dbSNP:773964388
2094 2094 c, t dbSNP:751259567
2097 2097 c, t dbSNP:202216109
2107 2107 a, c dbSNP:748875936
2108 2108 a, t dbSNP:777491431
2112 2112 a, g dbSNP:769421879
2127 2127 c, t dbSNP:748000444
2128 2128 c, t dbSNP:781069890
2129 2129 c, t dbSNP:200559868
2132 2132 a, g dbSNP:754881333
2140 2140 a, g dbSNP:751549131
2145 2145 c, t dbSNP:41669
2146 2146 a, g dbSNP:140426439
2159 2159 c, t dbSNP:750543253
2162 2162 c, g dbSNP:765508880
2182 2182 -, g dbSNP:386833469
2198 2198 a, c dbSNP:762034228
2199 2199 a, g dbSNP:754283736
2211 2211 a, g dbSNP:778961592
2213 2213 a, t dbSNP:368047696
2215 2215 a, t dbSNP:754158974
2217 2217 -, atc dbSNP:121913031
2218 2218 -, tca dbSNP:386833470
2221 2221 a, g dbSNP:537063643
2222 2222 c, t dbSNP:756609986
2227 2227 a, g dbSNP:753202155
2230 2230 -, g dbSNP:35617203
2232 2232 a, t dbSNP:768094962
2235 2235 c, g dbSNP:143786154
2237 2237 a, g dbSNP:370006510
2241 2241 c, t dbSNP:376554543
2242 2242 a, g dbSNP:199895223
2243 2243 c, t dbSNP:183775228
2253 2253 a, c, t dbSNP:753904335
2254 2254 c, g dbSNP:191547831
2257 2257 g, t dbSNP:146830301
2259 2259 c, t dbSNP:143670801
2263 2263 a, t dbSNP:770111964
2264 2264 c, g, t dbSNP:781608379
2277 2277 a, c, g dbSNP:752038202
2278 2278 c, t dbSNP:780439320
2279 2279 a, g dbSNP:756707598
2280 2280 g, t dbSNP:753377877
2284 2284 c, g, t dbSNP:138002384
2295 2295 -, acc dbSNP:751159762
2296 2296 accggttttgaagtgaaaattcaaaattt, gg dbSNP:386833472
2302 2302 a, g dbSNP:752346575
2304 2304 g, t dbSNP:767337870
2308 2308 -, a dbSNP:386833473
2308 2308 a, t dbSNP:146610949
2311 2311 a, t dbSNP:759250775
2312 2312 c, t dbSNP:561848464
2324 2324 g, t dbSNP:386833474
2329 2329 a, g dbSNP:771027374
2349 2349 a, c, t dbSNP:773406211
2354 2354 c, t dbSNP:770060508
2356 2356 a, t dbSNP:748398966
2361 2361 a, c, g, t dbSNP:142908255
2367 2367 c, t dbSNP:201137330
2368 2368 a, c, t dbSNP:750975910
2376 2376 a, g, t dbSNP:554235767
2385 2385 c, t dbSNP:148586598
2390 2390 c, t dbSNP:752324214
2408 2408 c, g dbSNP:747631202
2425 2425 a, g dbSNP:780799182
2435 2435 a, g dbSNP:754569219
2439 2439 a, t dbSNP:751317669
2441 2441 g, t dbSNP:766276512
2446 2446 c, g, t dbSNP:776888978
2447 2447 a, g dbSNP:765288477
2450 2450 a, g dbSNP:35342296
2452 2452 c, t dbSNP:776540922
2453 2453 a, g dbSNP:764283355
2467 2467 c, t dbSNP:369916664
2470 2470 c, g dbSNP:767995086
2480 2480 a, c dbSNP:746542385
2481 2481 a, g dbSNP:557178886
2486 2486 a, c dbSNP:779814716
2488 2488 g, t dbSNP:771820567
2489 2489 c, g dbSNP:745564134
2495 2495 a, g dbSNP:377169910
2499 2499 c, t dbSNP:757141781
2525 2525 a, t dbSNP:753647955
2526 2526 c, t dbSNP:777775854
2531 2531 a, c, g dbSNP:752803025
2536 2536 a, t dbSNP:757668067
2548 2548 g, t dbSNP:576957004
2553 2553 c, t dbSNP:557083292
2578 2578 a, g dbSNP:751054210
2600 2600 c, t dbSNP:192893142
2603 2603 c, t dbSNP:374422181
2629 2629 a, t dbSNP:568915502
2648 2648 a, c dbSNP:548053324
2669 2669 a, g dbSNP:534833629
2717 2717 -, att dbSNP:375666941
2729 2729 a, c dbSNP:565598733
2750 2750 c, g dbSNP:116732405
2752 2752 c, t dbSNP:772326710
2757 2757 a, t dbSNP:550422691
2800 2800 c, t dbSNP:763857842
2869 2869 c, g dbSNP:188158351
2873 2873 a, g dbSNP:183578733

Target ORF information:

RefSeq Version XM_011515867
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens solute carrier family 26 (anion exchanger), member 3 (SLC26A3), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu26676
Accession Version NM_000111.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2295bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product chloride anion exchanger
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BP262081.1, BC025671.1 and AC002467.1. This sequence is a reference standard in the RefSeqGene project. On Apr 1, 2008 this sequence version replaced gi:4557534. Summary: The protein encoded by this gene is a transmembrane glycoprotein that transports chloride ions across the cell membrane in exchange for bicarbonate ions. It is localized to the mucosa of the lower intestinal tract, particularly to the apical membrane of columnar epithelium and some goblet cells. The protein is essential for intestinal chloride absorption, and mutations in this gene have been associated with congenital chloride diarrhea. [provided by RefSeq, Oct 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC025671.1, L02785.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968540 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)11..11(+)
Misc Feature(2)131..133(+)
Misc Feature(3)383..634(+)
Misc Feature(4)386..2359(+)
Misc Feature(5)440..502(+)
Misc Feature(6)509..571(+)
Misc Feature(7)584..646(+)
Misc Feature(8)737..799(+)
Misc Feature(9)788..1624(+)
Misc Feature(10)803..865(+)
Misc Feature(11)986..1048(+)
Misc Feature(12)1067..1129(+)
Misc Feature(13)1238..1300(+)
Misc Feature(14)1334..1396(+)
Misc Feature(15)1445..1507(+)
Misc Feature(16)1526..1588(+)
Misc Feature(17)1619..1681(+)
Misc Feature(18)1718..1720(+)
Misc Feature(19)1736..1738(+)
Misc Feature(20)1769..1771(+)
Misc Feature(21)1787..2347(+)
Misc Feature(22)2141..2203(+)
Misc Feature(23)2315..2377(+)
Exon (1)1..123
Gene Synonym:
Exon (2)124..342
Gene Synonym:
Exon (3)343..482
Gene Synonym:
Exon (4)483..593
Gene Synonym:
Exon (5)594..781
Gene Synonym:
Exon (6)782..946
Gene Synonym:
Exon (7)947..1099
Gene Synonym:
Exon (8)1100..1182
Gene Synonym:
Exon (9)1183..1330
Gene Synonym:
Exon (10)1331..1444
Gene Synonym:
Exon (11)1445..1522
Gene Synonym:
Exon (12)1523..1618
Gene Synonym:
Exon (13)1619..1725
Gene Synonym:
Exon (14)1726..1795
Gene Synonym:
Exon (15)1796..1888
Gene Synonym:
Exon (16)1889..1984
Gene Synonym:
Exon (17)1985..2218
Gene Synonym:
Exon (18)2219..2273
Gene Synonym:
Exon (19)2274..2416
Gene Synonym:
Exon (20)2417..2482
Gene Synonym:
Exon (21)2483..2894
Gene Synonym:
Position Chain Variation Link
99 99 a, t dbSNP:574634462
115 115 -, atgt dbSNP:549855616
122 122 a, g dbSNP:554796886
124 124 a, g dbSNP:375869839
132 132 a, c dbSNP:551025090
135 135 c, g dbSNP:537554803
138 138 c, t dbSNP:775648286
161 161 a, c dbSNP:370340588
166 166 a, t dbSNP:759470822
167 167 a, g dbSNP:543293137
168 168 g, t dbSNP:774416154
169 169 c, t dbSNP:770912757
170 170 -, agg dbSNP:775955079
172 172 a, c, g, t dbSNP:187600896
179 179 c, t dbSNP:748350542
181 181 c, t dbSNP:781435226
192 192 c, g dbSNP:548807004
194 194 a, g dbSNP:747436018
195 195 a, c dbSNP:780369359
197 197 a, g dbSNP:758949431
206 206 -, a dbSNP:766140945
207 207 c, t dbSNP:545546518
221 221 c, t dbSNP:529161051
224 224 g, t dbSNP:763684294
226 226 c, t dbSNP:755723694
240 240 c, t dbSNP:752391046
242 242 g, t dbSNP:767335781
245 245 g, t dbSNP:201803182
259 259 g, t dbSNP:182526650
260 260 c, t dbSNP:746320801
268 268 c, t dbSNP:762967942
275 275 c, g dbSNP:773069003
285 285 a, t dbSNP:375084378
292 292 g, t dbSNP:769888729
302 302 c, t dbSNP:748296975
304 304 c, t dbSNP:776824360
315 315 c, t dbSNP:144627478
320 320 a, g dbSNP:768883226
323 323 a, c dbSNP:747307552
324 324 -, atc dbSNP:760335912
325 325 c, t dbSNP:780498972
329 329 a, t dbSNP:758784870
330 330 a, g dbSNP:78133952
331 331 a, t dbSNP:746365141
334 334 a, g dbSNP:779354646
340 340 c, t dbSNP:199700484
344 344 c, t dbSNP:775625844
345 345 a, g dbSNP:772479643
346 346 c, t dbSNP:746274250
348 348 c, t dbSNP:779418017
349 349 a, c, t dbSNP:750358656
350 350 c, t dbSNP:747617582
353 353 c, g dbSNP:780867682
354 354 a, g dbSNP:754582033
356 356 -, aaggccaagagaa dbSNP:386833456
358 358 g, t dbSNP:200940608
364 364 a, g dbSNP:779642889
368 368 a, g dbSNP:758202770
370 370 g, t dbSNP:750202453
376 376 a, c, t dbSNP:557332354
378 378 c, t dbSNP:369767483
386 386 c, t dbSNP:371476952
388 388 -, c dbSNP:386833468
394 394 a, t dbSNP:764139096
396 396 a, c dbSNP:760709614
399 399 g, t dbSNP:539000195
414 414 a, g dbSNP:10280704
433 433 c, g dbSNP:772195554
435 435 a, g dbSNP:568647097
437 437 a, g dbSNP:774886249
442 442 a, t dbSNP:771512079
452 452 a, g dbSNP:116793431
458 458 a, g dbSNP:778461830
460 460 a, c dbSNP:201503990
469 469 g, t dbSNP:746560492
472 472 a, c, t dbSNP:202020458
473 473 a, g dbSNP:745637222
481 481 -, aa dbSNP:386833476
481 481 a, g dbSNP:778701842
483 483 -, aaaaaacaa dbSNP:745984527
485 485 g, t dbSNP:752772269
486 486 -, g dbSNP:781078889
488 488 a, g dbSNP:767469189
490 490 a, c dbSNP:755121230
505 505 c, g, t dbSNP:368890058
506 506 a, g dbSNP:150004100
512 512 a, c dbSNP:773720855
522 522 a, g dbSNP:765740009
528 528 -, t dbSNP:747227831
535 535 a, g, t dbSNP:777245366
538 538 c, t dbSNP:771453618
542 542 c, t dbSNP:745451148
543 543 c, t dbSNP:75733585
543 543 -, t dbSNP:386833477
546 546 -, c dbSNP:778170408
551 551 a, g dbSNP:781074197
555 555 -, t dbSNP:386833478
556 556 c, g dbSNP:531537088
564 564 c, t dbSNP:770574116
564 564 -, t dbSNP:752963526
566 566 c, t dbSNP:749041348
568 568 a, c, g, t dbSNP:73419912
569 569 a, g dbSNP:386833479
572 572 a, t dbSNP:755093836
577 577 c, t dbSNP:373999154
582 582 a, t dbSNP:121913030
589 589 c, t dbSNP:142349142
590 590 a, g, t dbSNP:142116047
597 597 a, c, g, t dbSNP:386833480
598 598 a, g dbSNP:754233296
603 603 -, c dbSNP:386833482
603 603 c, g, t dbSNP:386833481
604 604 a, g dbSNP:140184294
608 608 c, t dbSNP:146149806
619 619 a, g dbSNP:386833483
622 622 c, g dbSNP:750301254
641 641 a, g dbSNP:762512404
644 644 a, g dbSNP:772723797
646 646 g, t dbSNP:769497194
655 655 a, g dbSNP:761450081
660 660 c, t dbSNP:765114944
664 664 -, t dbSNP:765980141
665 665 c, t dbSNP:776524702
666 666 a, g, t dbSNP:763721296
669 669 a, g dbSNP:142400087
670 670 a, t dbSNP:372822974
675 675 c, t dbSNP:532228172
679 679 c, g, t dbSNP:778947363
688 688 -, g dbSNP:760458350
693 693 a, g dbSNP:757528549
696 696 a, g dbSNP:749565848
699 699 c, t dbSNP:778088438
709 709 g, t dbSNP:775076151
723 723 a, g dbSNP:753193754
724 724 c, t dbSNP:367588993
725 725 a, g dbSNP:71566741
735 735 c, g dbSNP:749952119
736 736 c, g dbSNP:386833484
740 740 -, tgg dbSNP:772974499
740 740 a, c, g dbSNP:769586560
741 741 c, t dbSNP:147974764
742 742 a, g dbSNP:543522300
744 744 c, t dbSNP:143515876
745 745 a, g dbSNP:149275142
747 747 c, t dbSNP:772151477
748 748 -, ggc dbSNP:369893693
748 748 a, c, g dbSNP:374927524
750 750 c, t dbSNP:770964980
766 766 g, t dbSNP:749494186
770 770 g, t dbSNP:121913032
786 786 c, g, t dbSNP:748470732
794 794 a, g dbSNP:781561601
801 801 a, g dbSNP:201844799
804 804 c, t dbSNP:747520036
807 807 g, t dbSNP:780496577
812 812 g, t dbSNP:768701230
816 816 c, t dbSNP:756781550
821 821 g, t dbSNP:386833487
827 827 c, t dbSNP:386833488
836 836 -, ctc dbSNP:773970957
842 842 a, g dbSNP:572627383
843 843 c, g dbSNP:753414608
845 845 a, g dbSNP:777504274
851 851 a, t dbSNP:755850859
860 860 c, g dbSNP:752443968
866 866 a, g, t dbSNP:138427715
869 869 c, g dbSNP:751500825
870 870 a, c dbSNP:386833489
871 871 c, t dbSNP:766239629
872 872 a, g dbSNP:370662677
894 894 c, t dbSNP:758888560
896 896 a, t dbSNP:762953026
910 910 a, g dbSNP:773309276
915 915 c, t dbSNP:769956584
916 916 a, g dbSNP:755680710
922 922 c, g dbSNP:145962719
937 937 a, g dbSNP:769061492
948 948 g, t dbSNP:753299095
952 952 a, g dbSNP:188437289
955 955 c, t dbSNP:772611971
956 956 g, t dbSNP:765863383
961 961 a, t dbSNP:746342351
963 963 a, g, t dbSNP:769410426
966 966 c, t dbSNP:747674752
970 970 a, g dbSNP:780829913
975 975 a, g dbSNP:754616407
1004 1004 a, g dbSNP:375650310
1007 1007 c, t dbSNP:779693108
1025 1025 g, t dbSNP:758230257
1027 1027 a, c dbSNP:750356211
1031 1031 a, g dbSNP:571663600
1034 1034 g, t dbSNP:551523055
1035 1035 c, t dbSNP:142128989
1052 1052 c, t dbSNP:753871343
1053 1053 a, g dbSNP:764340501
1060 1060 a, c dbSNP:755764036
1063 1063 a, c dbSNP:775819597
1074 1074 g, t dbSNP:767986225
1076 1076 a, c dbSNP:760033252
1082 1082 c, g dbSNP:774937187
1085 1085 a, g dbSNP:771569151
1087 1087 c, t dbSNP:747653037
1088 1088 a, g dbSNP:776026508
1097 1097 a, c, g dbSNP:746613423
1098 1098 c, t dbSNP:779825227
1102 1102 c, t dbSNP:367700437
1103 1103 a, g dbSNP:752002517
1126 1126 a, c, t dbSNP:386833490
1127 1127 a, g dbSNP:138234173
1132 1132 g, t dbSNP:34407351
1134 1134 a, g, t dbSNP:80222394
1145 1145 a, g dbSNP:779481750
1149 1149 a, t dbSNP:760290597
1151 1151 a, c dbSNP:372165246
1158 1158 c, g dbSNP:368292176
1160 1160 -, gtg dbSNP:121913029
1161 1161 -, tggttg dbSNP:777942640
1161 1161 g, t dbSNP:78983942
1162 1162 -, ggt dbSNP:386833491
1162 1162 g, t dbSNP:778705552
1164 1164 g, t dbSNP:770812206
1170 1170 a, g dbSNP:749174661
1180 1180 c, t dbSNP:777822570
1193 1193 c, g dbSNP:770617449
1196 1196 a, g dbSNP:369516311
1206 1206 a, g dbSNP:140952086
1207 1207 c, t dbSNP:35576676
1208 1208 a, g dbSNP:769800728
1212 1212 a, g dbSNP:748189928
1217 1217 g, t dbSNP:142761906
1221 1221 a, g dbSNP:781397312
1225 1225 c, t dbSNP:755147336
1227 1227 a, c dbSNP:751829112
1228 1228 c, t dbSNP:376695368
1229 1229 a, g dbSNP:758633508
1231 1231 a, g dbSNP:750805326
1236 1236 a, t dbSNP:765626129
1237 1237 c, t dbSNP:148961545
1239 1239 a, c, g dbSNP:386833444
1241 1241 gatgcc, ttcggcatcgcaatggtt dbSNP:386833445
1244 1244 a, g dbSNP:754394386
1247 1247 a, c dbSNP:766985569
1249 1249 c, t dbSNP:373747349
1250 1250 a, g dbSNP:773932967
1254 1254 g, t dbSNP:764086216
1255 1255 g, t dbSNP:369910571
1269 1269 g, t dbSNP:762612337
1288 1288 c, t dbSNP:773081550
1289 1289 a, g dbSNP:565092091
1300 1300 c, t dbSNP:748065286
1302 1302 a, t dbSNP:776774391
1306 1306 c, t dbSNP:768844239
1307 1307 a, g dbSNP:747100587
1324 1324 c, t dbSNP:146803737
1342 1342 c, t dbSNP:776654131
1347 1347 c, g dbSNP:386833446
1356 1356 -, aca dbSNP:755575637
1359 1359 -, ta dbSNP:386833447
1378 1378 a, g dbSNP:747047074
1388 1388 g, t dbSNP:775664534
1390 1390 c, g dbSNP:772097371
1391 1391 a, t dbSNP:746074277
1393 1393 c, t dbSNP:779074316
1395 1395 c, g dbSNP:757557395
1396 1396 c, t dbSNP:535930393
1399 1399 c, t dbSNP:139145429
1404 1404 c, t dbSNP:143839547
1411 1411 a, t dbSNP:756632280
1425 1425 a, c, g dbSNP:199638708
1428 1428 c, t dbSNP:757910330
1430 1430 c, g dbSNP:750075198
1431 1431 g, t dbSNP:764996327
1444 1444 a, g dbSNP:761636312
1450 1450 c, t dbSNP:760458819
1457 1457 a, g dbSNP:752669981
1468 1468 c, t dbSNP:140126824
1469 1469 a, g dbSNP:767357038
1471 1471 c, t dbSNP:759616448
1484 1484 a, g, t dbSNP:146161125
1487 1487 c, t dbSNP:763129448
1498 1498 a, t dbSNP:773487664
1507 1507 a, g dbSNP:771777037
1509 1509 c, t dbSNP:200724013
1510 1510 a, g dbSNP:3735605
1517 1517 c, t dbSNP:386833448
1523 1523 c, t dbSNP:763669046
1525 1525 a, c, t dbSNP:117703371
1526 1526 a, g dbSNP:183357373
1531 1531 a, c, g dbSNP:577337450
1544 1544 c, t dbSNP:777524692
1553 1553 -, tt dbSNP:386833450
1565 1565 c, t dbSNP:374372529
1571 1571 c, t dbSNP:386833451
1573 1573 -, g dbSNP:386833452
1591 1591 a, g dbSNP:755739595
1595 1595 c, t dbSNP:747881187
1596 1596 a, g dbSNP:780815307
1597 1597 a, g dbSNP:121913033
1598 1598 c, t dbSNP:386833453
1599 1599 a, g dbSNP:751483686
1602 1602 a, g dbSNP:766316670
1611 1611 -, at dbSNP:767303007
1614 1614 a, t dbSNP:386833454
1630 1630 c, t dbSNP:757427764
1633 1633 a, g dbSNP:753994994
1640 1640 a, g dbSNP:764393881
1642 1642 c, t dbSNP:761057828
1652 1652 a, g dbSNP:753130798
1663 1663 c, t dbSNP:200404042
1664 1664 a, g dbSNP:760086563
1673 1673 c, t dbSNP:774987077
1698 1698 g, t dbSNP:386833457
1706 1706 a, g dbSNP:150724234
1709 1709 a, g dbSNP:375977220
1720 1720 c, t dbSNP:111750004
1723 1723 a, g dbSNP:199870537
1724 1724 c, t dbSNP:768327121
1728 1728 -, c dbSNP:386833459
1737 1737 -, gc dbSNP:386833460
1740 1740 c, t dbSNP:60147601
1741 1741 a, g dbSNP:775193020
1747 1747 a, t dbSNP:575640113
1752 1752 c, t dbSNP:745692539
1762 1762 -, caac dbSNP:386833461
1770 1770 a, g dbSNP:386833462
1774 1774 c, g dbSNP:386833463
1775 1775 a, g dbSNP:774093404
1778 1778 a, g dbSNP:770936978
1780 1780 a, g dbSNP:749227972
1783 1783 a, g dbSNP:148222595
1785 1785 a, g dbSNP:756326040
1790 1790 -, tat dbSNP:386833464
1790 1790 g, t dbSNP:748365570
1792 1792 c, t dbSNP:781576917
1797 1797 c, g, t dbSNP:768761270
1804 1804 a, g dbSNP:769935067
1805 1805 a, c, t dbSNP:372157278
1807 1807 a, c dbSNP:755250104
1820 1820 -, a dbSNP:386833465
1830 1830 g, t dbSNP:147164102
1832 1832 c, t dbSNP:780435705
1834 1834 a, g dbSNP:368930571
1835 1835 c, tct dbSNP:386833466
1836 1836 c, g dbSNP:535987339
1841 1841 a, g dbSNP:765749439
1842 1842 a, t dbSNP:386833467
1856 1856 a, g dbSNP:184317244
1857 1857 a, t dbSNP:752239145
1860 1860 c, g dbSNP:201414043
1871 1871 c, t dbSNP:775780652
1872 1872 a, g dbSNP:2301635
1879 1879 c, t dbSNP:373684245
1882 1882 c, t dbSNP:762667509
1883 1883 a, g dbSNP:370246673
1892 1892 g, t dbSNP:768769355
1894 1894 c, g, t dbSNP:376707926
1895 1895 g, t dbSNP:772218006
1908 1908 a, g dbSNP:746185703
1913 1913 c, g dbSNP:143677801
1917 1917 a, g dbSNP:771347047
1922 1922 c, t dbSNP:749777742
1923 1923 a, g dbSNP:778152516
1932 1932 c, t dbSNP:370732546
1939 1939 c, g dbSNP:138094082
1947 1947 a, g dbSNP:201969535
1955 1955 c, g dbSNP:778338646
1962 1962 a, g dbSNP:750139993
1964 1964 a, g dbSNP:147019341
1977 1977 a, c, t dbSNP:756753223
1981 1981 a, c dbSNP:757177714
1989 1989 c, g dbSNP:767584363
1997 1997 c, g, t dbSNP:201220816
1998 1998 a, g dbSNP:768043306
2012 2012 a, g dbSNP:201078396
2013 2013 c, t dbSNP:35776303
2021 2021 c, t dbSNP:770244075
2023 2023 c, t dbSNP:372871858
2026 2026 a, c, t dbSNP:771640694
2027 2027 a, g dbSNP:745383039
2032 2032 a, c, g dbSNP:781024851
2039 2039 a, g dbSNP:756998584
2049 2049 c, t dbSNP:749006196
2050 2050 a, c dbSNP:777404277
2054 2054 a, g dbSNP:755990821
2056 2056 a, c dbSNP:752514037
2057 2057 c, t dbSNP:564106034
2058 2058 g, t dbSNP:755005048
2060 2060 a, c, g dbSNP:766486980
2061 2061 a, c dbSNP:763065069
2062 2062 a, c dbSNP:138629546
2063 2063 -, c dbSNP:748313911
2066 2066 c, t dbSNP:750715414
2076 2076 c, t dbSNP:765515301
2083 2083 a, c dbSNP:762241978
2085 2085 a, t dbSNP:777220083
2093 2093 c, g dbSNP:369667941
2096 2096 a, c dbSNP:759075042
2097 2097 c, t dbSNP:773964388
2113 2113 c, t dbSNP:751259567
2116 2116 c, t dbSNP:202216109
2126 2126 a, c dbSNP:748875936
2127 2127 a, t dbSNP:777491431
2131 2131 a, g dbSNP:769421879
2146 2146 c, t dbSNP:748000444
2147 2147 c, t dbSNP:781069890
2148 2148 c, t dbSNP:200559868
2151 2151 a, g dbSNP:754881333
2159 2159 a, g dbSNP:751549131
2164 2164 c, t dbSNP:41669
2165 2165 a, g dbSNP:140426439
2178 2178 c, t dbSNP:750543253
2181 2181 c, g dbSNP:765508880
2201 2201 -, g dbSNP:386833469
2217 2217 a, c dbSNP:762034228
2218 2218 a, g dbSNP:754283736
2230 2230 a, g dbSNP:778961592
2232 2232 a, t dbSNP:368047696
2234 2234 a, t dbSNP:754158974
2236 2236 -, atc dbSNP:121913031
2237 2237 -, tca dbSNP:386833470
2240 2240 a, g dbSNP:537063643
2241 2241 c, t dbSNP:756609986
2246 2246 a, g dbSNP:753202155
2249 2249 -, g dbSNP:35617203
2251 2251 a, t dbSNP:768094962
2254 2254 c, g dbSNP:143786154
2256 2256 a, g dbSNP:370006510
2260 2260 c, t dbSNP:376554543
2261 2261 a, g dbSNP:199895223
2262 2262 c, t dbSNP:183775228
2272 2272 a, c, t dbSNP:753904335
2273 2273 c, g dbSNP:191547831
2276 2276 g, t dbSNP:146830301
2278 2278 c, t dbSNP:143670801
2282 2282 a, t dbSNP:770111964
2283 2283 c, g, t dbSNP:781608379
2296 2296 a, c, g dbSNP:752038202
2297 2297 c, t dbSNP:780439320
2298 2298 a, g dbSNP:756707598
2299 2299 g, t dbSNP:753377877
2303 2303 c, g, t dbSNP:138002384
2314 2314 -, acc dbSNP:751159762
2315 2315 accggttttgaagtgaaaattcaaaattt, gg dbSNP:386833472
2321 2321 a, g dbSNP:752346575
2323 2323 g, t dbSNP:767337870
2327 2327 -, a dbSNP:386833473
2327 2327 a, t dbSNP:146610949
2330 2330 a, t dbSNP:759250775
2331 2331 c, t dbSNP:561848464
2343 2343 g, t dbSNP:386833474
2348 2348 a, g dbSNP:771027374
2368 2368 a, c, t dbSNP:773406211
2373 2373 c, t dbSNP:770060508
2375 2375 a, t dbSNP:748398966
2380 2380 a, c, g, t dbSNP:142908255
2386 2386 c, t dbSNP:201137330
2387 2387 a, c, t dbSNP:750975910
2395 2395 a, g, t dbSNP:554235767
2404 2404 c, t dbSNP:148586598
2409 2409 c, t dbSNP:752324214
2427 2427 c, g dbSNP:747631202
2444 2444 a, g dbSNP:780799182
2454 2454 a, g dbSNP:754569219
2458 2458 a, t dbSNP:751317669
2460 2460 g, t dbSNP:766276512
2465 2465 c, g, t dbSNP:776888978
2466 2466 a, g dbSNP:765288477
2469 2469 a, g dbSNP:35342296
2471 2471 c, t dbSNP:776540922
2472 2472 a, g dbSNP:764283355
2486 2486 c, t dbSNP:369916664
2489 2489 c, g dbSNP:767995086
2499 2499 a, c dbSNP:746542385
2500 2500 a, g dbSNP:557178886
2505 2505 a, c dbSNP:779814716
2507 2507 g, t dbSNP:771820567
2508 2508 c, g dbSNP:745564134
2514 2514 a, g dbSNP:377169910
2518 2518 c, t dbSNP:757141781
2544 2544 a, t dbSNP:753647955
2545 2545 c, t dbSNP:777775854
2550 2550 a, c, g dbSNP:752803025
2555 2555 a, t dbSNP:757668067
2567 2567 g, t dbSNP:576957004
2572 2572 c, t dbSNP:557083292
2597 2597 a, g dbSNP:751054210
2619 2619 c, t dbSNP:192893142
2622 2622 c, t dbSNP:374422181
2648 2648 a, t dbSNP:568915502
2667 2667 a, c dbSNP:548053324
2688 2688 a, g dbSNP:534833629
2736 2736 -, att dbSNP:375666941
2748 2748 a, c dbSNP:565598733
2769 2769 c, g dbSNP:116732405
2771 2771 c, t dbSNP:772326710
2776 2776 a, t dbSNP:550422691
2819 2819 c, t dbSNP:763857842
2888 2888 c, g dbSNP:188158351
2892 2892 a, g dbSNP:183578733
2894 2894 a, c dbSNP:369781711

Target ORF information:

RefSeq Version NM_000111
Organism Homo sapiens (human)
Definition Homo sapiens solute carrier family 26 (anion exchanger), member 3 (SLC26A3), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
