Home » Species Summary » Homo sapiens » MEGF8 cDNA ORF clone
Email to GenScript

MEGF8 cDNA ORF clone, Homo sapiens (human)

Gene Symbol MEGF8
Entrez Gene ID 1954
Full Name multiple EGF-like-domains 8
Synonyms C19orf49, CRPT2, EGFL4, SBP1
General protein information
Preferred Names
multiple epidermal growth factor-like domains protein 8
multiple epidermal growth factor-like domains protein 8
EGF-like-domain, multiple 4
HBV pre-s2 binding protein 1
EGF-like domain-containing protein 4
epidermal growth factor-like protein 4
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene is a single-pass type I membrane protein of unknown function that contains several EGF-like domains, Kelch repeats, and PSI domains. Defects in this gene are a cause of Carpenter syndrome 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]. lac of sum
Disorder MIM:


Disorder Html:

mRNA and Protein(s)

mRNA Protein Name
NM_001410 NP_001401 multiple epidermal growth factor-like domains protein 8 isoform 2 precursor
NM_001271938 NP_001258867 multiple epidermal growth factor-like domains protein 8 isoform 1 precursor

Homo sapiens (human) MEGF8 NP_001258867.1
Pan troglodytes (chimpanzee) MEGF8 XP_003316429.1
Macaca mulatta (Rhesus monkey) LOC709352 XP_002808242.1
Canis lupus familiaris (dog) MEGF8 XP_541588.5
Bos taurus (cattle) MEGF8 XP_002695193.3
Mus musculus (house mouse) Megf8 NP_001153872.1
Rattus norvegicus (Norway rat) Megf8 NP_446080.1
Danio rerio (zebrafish) megf8 XP_005158088.1
Drosophila melanogaster (fruit fly) CG7466 NP_609180.2
Xenopus (Silurana) tropicalis (western clawed frog) megf8 XP_002936442.2


ID Name Evidence
GO:0005575 cellular_component ND
GO:0016020 membrane IEA
GO:0016021 integral to membrane IEA


ID Name Evidence
GO:0005198 structural molecule activity NAS
GO:0005509 calcium ion binding NAS


ID Name Evidence
GO:0008150 biological_process ND

The following MEGF8 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the MEGF8 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu28623 NM_001410 Homo sapiens multiple EGF-like-domains 8 (MEGF8), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu28635 NM_001271938 Homo sapiens multiple EGF-like-domains 8 (MEGF8), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu28623
Accession Version NM_001410.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 8337bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product multiple epidermal growth factor-like domains protein 8 isoform 2 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AB011541.2 and AC011497.6. This sequence is a reference standard in the RefSeqGene project. On Apr 25, 2007 this sequence version replaced gi:46195706. Summary: The protein encoded by this gene is a single-pass type I membrane protein of unknown function that contains several EGF-like domains, Kelch repeats, and PSI domains. Defects in this gene are a cause of Carpenter syndrome 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]. Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. ##Evidence-Data-START## Transcript exon combination :: BC153880.1, AB011541.2 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2157437 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)612..614(+)
Misc Feature(2)780..1052(+)
Misc Feature(3)846..1052(+)
Misc Feature(4)1317..1460(+)
Misc Feature(5)1353..1493(+)
Misc Feature(6)1470..1628(+)
Misc Feature(7)1635..1718(+)
Misc Feature(8)1842..1967(+)
Misc Feature(9)1977..2165(+)
Misc Feature(10)3654..3761(+)
Misc Feature(11)3654..3713(+)
Misc Feature(12)4062..4211(+)
Misc Feature(13)4065..4160(+)
Misc Feature(14)5127..5258(+)
Misc Feature(15)5130..5270(+)
Misc Feature(16)5292..5441(+)
Misc Feature(17)5322..5474(+)
Misc Feature(18)5448..5594(+)
Misc Feature(19)5784..5903(+)
Misc Feature(20)5787..5948(+)
Exon (1)1..822
Gene Synonym:
Exon (2)823..986
Gene Synonym:
Exon (3)987..1193
Gene Synonym:
Exon (4)1194..1374
Gene Synonym:
Exon (5)1375..1463
Gene Synonym:
Exon (6)1464..1879
Gene Synonym:
Exon (7)1880..2025
Gene Synonym:
Exon (8)2026..2148
Gene Synonym:
Exon (9)2149..2303
Gene Synonym:
Exon (10)2304..2423
Gene Synonym:
Exon (11)2424..2568
Gene Synonym:
Exon (12)2569..2732
Gene Synonym:
Exon (13)2733..2933
Gene Synonym:
Exon (14)2934..3170
Gene Synonym:
Exon (15)3171..3289
Gene Synonym:
Exon (16)3290..3421
Gene Synonym:
Exon (17)3422..3535
Gene Synonym:
Exon (18)3536..3784
Gene Synonym:
Exon (19)3785..3984
Gene Synonym:
Exon (20)3985..4195
Gene Synonym:
Exon (21)4196..4445
Gene Synonym:
Exon (22)4446..4578
Gene Synonym:
Exon (23)4579..4826
Gene Synonym:
Exon (24)4827..4937
Gene Synonym:
Exon (25)4938..5056
Gene Synonym:
Exon (26)5057..5264
Gene Synonym:
Exon (27)5265..5445
Gene Synonym:
Exon (28)5446..5609
Gene Synonym:
Exon (29)5610..5777
Gene Synonym:
Exon (30)5778..5922
Gene Synonym:
Exon (31)5923..6154
Gene Synonym:
Exon (32)6155..6278
Gene Synonym:
Exon (33)6279..6492
Gene Synonym:
Exon (34)6493..6707
Gene Synonym:
Exon (35)6708..6915
Gene Synonym:
Exon (36)6916..7075
Gene Synonym:
Exon (37)7076..7268
Gene Synonym:
Exon (38)7269..7439
Gene Synonym:
Exon (39)7440..7570
Gene Synonym:
Exon (40)7571..7703
Gene Synonym:
Exon (41)7704..10966
Gene Synonym:
Position Chain Variation Link
18 18 c, g dbSNP:779923290
19 19 a, g dbSNP:569756504
21 21 c, g dbSNP:537210098
32 32 g, t dbSNP:769784382
48 48 c, t dbSNP:775136717
61 61 a, g dbSNP:558410127
65 65 a, g dbSNP:71361013
139 139 a, g dbSNP:762909843
142 142 c, t dbSNP:570210510
193 193 g, t dbSNP:373999413
273 273 a, g dbSNP:377656252
289 289 c, t dbSNP:552562873
358 358 a, g dbSNP:77483366
386 386 c, t dbSNP:542953536
465 465 a, g dbSNP:773602097
477 477 a, t dbSNP:111536758
486 486 -, g dbSNP:34768812
503 503 c, t dbSNP:576597076
504 504 c, g dbSNP:370533137
509 509 c, t dbSNP:184902062
521 521 c, t dbSNP:543990131
540 540 c, t dbSNP:552665692
580 580 c, t dbSNP:565404145
591 591 c, t dbSNP:762981124
592 592 c, t dbSNP:766439490
598 598 a, g dbSNP:774894940
599 599 a, c dbSNP:201236933
602 602 a, g dbSNP:767873043
605 605 c, t dbSNP:752965495
607 607 a, c dbSNP:761549703
609 609 a, c dbSNP:764849283
613 613 a, c, g dbSNP:750061301
620 620 a, g dbSNP:779700424
625 625 a, c dbSNP:751559172
635 635 a, g dbSNP:754900851
642 642 c, t dbSNP:371769004
664 664 c, t dbSNP:559809654
669 669 c, g dbSNP:769597326
683 683 a, c dbSNP:777922711
684 684 c, g dbSNP:749510496
694 694 c, t dbSNP:530058933
699 699 c, t dbSNP:771011541
703 703 c, t dbSNP:774347513
705 705 c, g dbSNP:760067083
712 712 a, g, t dbSNP:377001753
714 714 a, g dbSNP:760987793
716 716 g, t dbSNP:764516595
720 720 a, g, t dbSNP:750104104
721 721 a, t dbSNP:765996558
730 730 a, g dbSNP:751060296
739 739 a, g dbSNP:754511848
742 742 g, t dbSNP:781027989
748 748 c, g dbSNP:752669700
756 756 c, t dbSNP:755931805
765 765 g, t dbSNP:777559070
778 778 c, t dbSNP:749526205
792 792 a, g dbSNP:761004605
799 799 c, g dbSNP:771093365
807 807 a, g dbSNP:778995883
814 814 a, t dbSNP:745986905
825 825 c, g dbSNP:758472569
828 828 a, g dbSNP:780112441
830 830 a, c dbSNP:536773914
840 840 c, t dbSNP:769153746
841 841 a, g dbSNP:777251009
869 869 c, t dbSNP:377231910
880 880 c, t dbSNP:748576204
881 881 a, g, t dbSNP:369259465
887 887 c, t dbSNP:773609400
896 896 c, t dbSNP:370064427
897 897 a, g dbSNP:372955721
905 905 c, t dbSNP:376175890
906 906 a, g dbSNP:369362097
909 909 a, g dbSNP:764131985
911 911 c, t dbSNP:753751733
913 913 c, g dbSNP:200910137
916 916 c, t dbSNP:570125469
918 918 c, t dbSNP:376057779
919 919 a, g dbSNP:758585947
921 921 g, t dbSNP:370744518
922 922 a, c, g dbSNP:780016069
924 924 a, c, g dbSNP:754995245
925 925 c, t dbSNP:748664087
926 926 a, g, t dbSNP:374407078
933 933 a, g dbSNP:745530684
941 941 a, g dbSNP:771715982
954 954 c, t dbSNP:774975242
955 955 a, g dbSNP:760280227
958 958 c, t dbSNP:201353508
961 961 a, c, t dbSNP:768036287
962 962 a, g dbSNP:761669548
963 963 a, c dbSNP:183986572
968 968 c, t dbSNP:371108976
969 969 a, g dbSNP:763111888
971 971 a, c dbSNP:766677631
972 972 a, g dbSNP:188320625
982 982 a, g dbSNP:200462288
992 992 a, g dbSNP:115536529
1001 1001 c, g dbSNP:749116190
1025 1025 a, c, g dbSNP:377093238
1033 1033 a, t dbSNP:773970699
1034 1034 c, t dbSNP:759871658
1037 1037 c, t dbSNP:117439608
1038 1038 a, g dbSNP:775833160
1047 1047 c, t dbSNP:760894078
1048 1048 a, g dbSNP:551896120
1056 1056 c, t dbSNP:372360094
1061 1061 c, t dbSNP:757646385
1063 1063 a, c, t dbSNP:765654107
1082 1082 c, t dbSNP:758727994
1088 1088 a, g dbSNP:375747976
1099 1099 c, t dbSNP:747798007
1104 1104 a, g dbSNP:755629942
1106 1106 a, g dbSNP:534353727
1115 1115 c, t dbSNP:546589831
1116 1116 a, g dbSNP:762892185
1120 1120 c, t dbSNP:770734416
1121 1121 a, g dbSNP:774315411
1125 1125 -, g dbSNP:774089783
1126 1126 -, g dbSNP:762115034
1130 1130 c, g dbSNP:146885610
1132 1132 g, t dbSNP:79719576
1133 1133 c, t dbSNP:78558888
1135 1135 c, g dbSNP:62114375
1136 1136 g, t dbSNP:771980126
1152 1152 a, g dbSNP:775920740
1154 1154 a, g dbSNP:760912094
1162 1162 c, g dbSNP:764246520
1178 1178 a, c dbSNP:776522130
1179 1179 a, g dbSNP:762411505
1181 1181 c, t dbSNP:765699703
1183 1183 c, t dbSNP:750904616
1187 1187 c, t dbSNP:758831089
1188 1188 a, g dbSNP:766668498
1192 1192 c, t dbSNP:111865089
1200 1200 a, g dbSNP:200037040
1203 1203 c, t dbSNP:756784580
1209 1209 c, t dbSNP:778498838
1210 1210 a, g, t dbSNP:548945656
1215 1215 a, g dbSNP:780023172
1229 1229 a, g dbSNP:746838623
1233 1233 c, t dbSNP:200803481
1234 1234 a, g, t dbSNP:201881006
1235 1235 c, t dbSNP:769780869
1263 1263 a, c dbSNP:773229520
1270 1270 c, t dbSNP:763485160
1273 1273 c, g dbSNP:374831922
1286 1286 a, c, t dbSNP:774819152
1287 1287 c, g dbSNP:767920960
1299 1299 a, g dbSNP:747359795
1303 1303 c, t dbSNP:771375239
1307 1307 c, g dbSNP:761471557
1313 1313 c, t dbSNP:373385185
1316 1316 c, g dbSNP:749911120
1317 1317 c, t dbSNP:565934429
1330 1330 c, t dbSNP:780187231
1334 1334 c, t dbSNP:751496800
1335 1335 a, g, t dbSNP:201282412
1343 1343 c, g dbSNP:748344812
1344 1344 a, t dbSNP:559212665
1345 1345 c, t dbSNP:756322438
1346 1346 c, t dbSNP:777944709
1361 1361 c, g dbSNP:749420064
1365 1365 c, g dbSNP:370196231
1370 1370 c, t dbSNP:374994765
1371 1371 a, g dbSNP:367866745
1382 1382 c, t dbSNP:769124262
1383 1383 c, g dbSNP:773064133
1387 1387 a, g dbSNP:762625035
1388 1388 c, t dbSNP:766012578
1389 1389 a, g dbSNP:769584545
1398 1398 a, g dbSNP:773873521
1406 1406 c, t dbSNP:574819813
1407 1407 a, g dbSNP:375853163
1417 1417 a, g dbSNP:752564927
1424 1424 c, t dbSNP:368954010
1425 1425 a, g dbSNP:371198327
1432 1432 c, g dbSNP:754073773
1433 1433 c, t dbSNP:374751788
1437 1437 a, g dbSNP:757420208
1446 1446 c, g dbSNP:778888305
1451 1451 a, g dbSNP:750556225
1456 1456 c, g dbSNP:758384902
1458 1458 a, g dbSNP:780664531
1462 1462 c, t dbSNP:747511405
1471 1471 a, g dbSNP:765439952
1488 1488 a, g dbSNP:376248434
1500 1500 a, g dbSNP:753588973
1534 1534 a, g dbSNP:535520607
1536 1536 a, g dbSNP:369528104
1540 1540 c, t dbSNP:750594133
1541 1541 a, g dbSNP:758567389
1549 1549 a, g dbSNP:779928251
1550 1550 c, t dbSNP:542301839
1551 1551 a, g dbSNP:755505678
1553 1553 c, t dbSNP:373759775
1554 1554 a, g dbSNP:201180083
1556 1556 c, g dbSNP:770045100
1562 1562 c, t dbSNP:778694669
1578 1578 a, g dbSNP:745445494
1581 1581 a, g dbSNP:771627803
1582 1582 a, g dbSNP:774933621
1584 1584 c, t dbSNP:760635447
1596 1596 c, t dbSNP:768617831
1600 1600 c, t dbSNP:776527811
1603 1603 a, c dbSNP:761653309
1614 1614 a, g dbSNP:764933318
1621 1621 c, g, t dbSNP:750660042
1622 1622 a, g dbSNP:371526577
1625 1625 a, g dbSNP:751731282
1630 1630 c, t dbSNP:758460565
1639 1639 c, t dbSNP:755090133
1646 1646 c, t dbSNP:370064096
1649 1649 a, g dbSNP:539356202
1653 1653 a, g dbSNP:200235162
1659 1659 a, g dbSNP:372990477
1661 1661 a, g dbSNP:745557904
1663 1663 a, g dbSNP:757946834
1666 1666 a, g dbSNP:199720072
1678 1678 a, t dbSNP:746570237
1679 1679 c, t dbSNP:768140773
1692 1692 c, t dbSNP:554274233
1693 1693 a, g dbSNP:747964609
1694 1694 c, t dbSNP:769642189
1699 1699 c, t dbSNP:201929902
1700 1700 a, g dbSNP:762781473
1703 1703 c, t dbSNP:766759999
1720 1720 g, t dbSNP:747480874
1721 1721 c, t dbSNP:759760089
1722 1722 c, g dbSNP:767639907
1729 1729 a, g dbSNP:753269923
1734 1734 c, t dbSNP:756531536
1736 1736 c, t dbSNP:764552930
1743 1743 a, g dbSNP:754193202
1744 1744 a, g dbSNP:757618177
1745 1745 c, t dbSNP:779740348
1751 1751 a, c, t dbSNP:746659886
1752 1752 a, g dbSNP:780619794
1760 1760 c, t dbSNP:748137207
1770 1770 a, g dbSNP:769661801
1773 1773 a, t dbSNP:773182043
1777 1777 c, t dbSNP:749099841
1778 1778 a, g dbSNP:573670934
1783 1783 g, t dbSNP:774720321
1784 1784 c, g dbSNP:759776106
1785 1785 a, g dbSNP:772302830
1787 1787 a, c dbSNP:775394935
1788 1788 c, t dbSNP:760775705
1789 1789 a, g dbSNP:764557517
1791 1791 a, c dbSNP:754356057
1793 1793 c, g dbSNP:762150997
1797 1797 a, g dbSNP:200502457
1815 1815 a, g dbSNP:751222342
1818 1818 a, g dbSNP:754572887
1828 1828 c, t dbSNP:780709754
1832 1832 c, g, t dbSNP:149190709
1839 1839 a, g dbSNP:777642371
1842 1842 c, t dbSNP:201062210
1858 1858 a, g dbSNP:770863873
1863 1863 c, t dbSNP:755656068
1864 1864 a, g dbSNP:370518508
1867 1867 c, t dbSNP:746125032
1871 1871 c, t dbSNP:772465428
1878 1878 c, t dbSNP:775756534
1879 1879 a, g dbSNP:760723521
1884 1884 c, t dbSNP:770322892
1892 1892 a, g dbSNP:760506675
1893 1893 a, g dbSNP:763379149
1895 1895 a, g dbSNP:766704197
1897 1897 a, t dbSNP:775022715
1910 1910 c, t dbSNP:370779185
1916 1916 c, t dbSNP:765479973
1917 1917 a, g, t dbSNP:200630623
1923 1923 a, c, t dbSNP:765321277
1924 1924 a, g dbSNP:375504309
1929 1929 g, t dbSNP:544335371
1936 1936 c, t dbSNP:747214327
1939 1939 c, t dbSNP:200021307
1940 1940 a, g dbSNP:202046167
1946 1946 a, g dbSNP:372297256
1950 1950 c, t dbSNP:769862975
1962 1962 c, g dbSNP:773716450
1963 1963 a, c dbSNP:544659951
1965 1965 a, g dbSNP:771222674
1968 1968 c, g dbSNP:774738057
1972 1972 c, g dbSNP:759790038
1977 1977 c, t dbSNP:397514621
1983 1983 c, t dbSNP:763858957
1985 1985 c, t dbSNP:776406997
1993 1993 c, g dbSNP:761480799
2013 2013 a, g dbSNP:764773192
2018 2018 a, g dbSNP:146980004
2021 2021 c, g dbSNP:758302996
2028 2028 a, g dbSNP:769451119
2039 2039 c, t dbSNP:772804384
2040 2040 a, g dbSNP:762337124
2045 2045 c, t dbSNP:138141882
2055 2055 c, g dbSNP:751435946
2057 2057 a, g dbSNP:373127505
2066 2066 c, t dbSNP:759381367
2075 2075 c, t dbSNP:767243118
2077 2077 c, t dbSNP:370287880
2080 2080 c, t dbSNP:756293002
2081 2081 a, c dbSNP:141773838
2096 2096 c, g dbSNP:777944855
2104 2104 a, g dbSNP:754002454
2105 2105 a, g dbSNP:757273121
2121 2121 a, g dbSNP:779538653
2132 2132 a, g, t dbSNP:374205876
2140 2140 c, g dbSNP:780513971
2145 2145 a, g dbSNP:747833755
2148 2148 a, g dbSNP:769609153
2150 2150 c, t dbSNP:201031505
2158 2158 c, t dbSNP:555480088
2159 2159 c, g dbSNP:748837091
2165 2165 a, c dbSNP:770497713
2183 2183 c, t dbSNP:200112539
2192 2192 c, g dbSNP:745356072
2204 2204 c, t dbSNP:150171260
2207 2207 c, t dbSNP:375943387
2208 2208 a, g dbSNP:760533124
2210 2210 c, t dbSNP:763808530
2214 2214 c, t dbSNP:776922420
2221 2221 c, t dbSNP:761889161
2222 2222 -, g dbSNP:756940744
2231 2231 c, t dbSNP:765385983
2235 2235 a, g dbSNP:750508368
2238 2238 c, t dbSNP:758529363
2239 2239 a, g dbSNP:767049386
2241 2241 a, c dbSNP:752106496
2244 2244 c, t dbSNP:755408868
2253 2253 a, t dbSNP:138359626
2260 2260 c, t dbSNP:759983093
2268 2268 a, g dbSNP:749001871
2271 2271 c, t dbSNP:756900845
2273 2273 c, t dbSNP:778610636
2275 2275 a, c dbSNP:745444778
2282 2282 a, g dbSNP:771569648
2291 2291 a, c dbSNP:775414246
2298 2298 a, c, g dbSNP:562426921
2299 2299 c, g dbSNP:768515891
2303 2303 c, t dbSNP:370015031
2309 2309 c, g dbSNP:747950293
2316 2316 c, t dbSNP:769625761
2319 2319 c, t dbSNP:773571582
2320 2320 g, t dbSNP:763220781
2329 2329 -, cacagaccacagcgtctgctc dbSNP:755627164
2330 2330 c, t dbSNP:771168312
2333 2333 a, c, t dbSNP:377340282
2337 2337 c, t dbSNP:369202655
2342 2342 c, t dbSNP:201780276
2343 2343 a, g dbSNP:767970851
2352 2352 c, t dbSNP:369696855
2353 2353 a, g dbSNP:760954782
2359 2359 c, t dbSNP:373575110
2360 2360 a, g dbSNP:750096359
2397 2397 a, c dbSNP:758003145
2398 2398 a, c, g, t dbSNP:779646470
2399 2399 c, t dbSNP:267605514
2400 2400 c, g dbSNP:781058253
2401 2401 a, c dbSNP:377009181
2411 2411 c, g dbSNP:769487581
2419 2419 a, g dbSNP:777672123
2426 2426 c, t dbSNP:777831498
2432 2432 a, c, t dbSNP:749153853
2433 2433 a, g dbSNP:779285900
2444 2444 a, g dbSNP:369970545
2448 2448 c, g dbSNP:772070723
2450 2450 c, g dbSNP:775596744
2454 2454 c, t dbSNP:747026334
2455 2455 a, g dbSNP:769196067
2468 2468 c, g dbSNP:372468505
2495 2495 c, t dbSNP:149246261
2511 2511 c, t dbSNP:369796236
2512 2512 a, g dbSNP:773886995
2515 2515 a, g dbSNP:759178290
2521 2521 a, g dbSNP:767048124
2522 2522 c, t dbSNP:752302131
2524 2524 c, g dbSNP:755672509
2525 2525 c, g dbSNP:377040375
2526 2526 c, t dbSNP:753765040
2528 2528 c, g dbSNP:757134743
2537 2537 c, t dbSNP:150535071
2538 2538 a, g dbSNP:746105455
2543 2543 c, t dbSNP:758684436
2545 2545 a, g dbSNP:369191682
2549 2549 a, g dbSNP:747167022
2552 2552 c, t dbSNP:768717655
2558 2558 a, c dbSNP:777127253
2559 2559 c, t dbSNP:748593827
2560 2560 c, g dbSNP:770165316
2571 2571 a, c dbSNP:201134458
2577 2577 c, t dbSNP:761382753
2578 2578 a, g dbSNP:765273470
2583 2583 c, t dbSNP:750318898
2587 2587 a, g dbSNP:762810587
2595 2595 a, g dbSNP:766029134
2599 2599 c, g dbSNP:751800916
2603 2603 c, t dbSNP:755152090
2606 2606 c, t dbSNP:781371635
2621 2621 a, g dbSNP:200647067
2627 2627 a, g dbSNP:753660883
2636 2636 c, t dbSNP:778349119
2637 2637 a, g dbSNP:749703192
2641 2641 c, t dbSNP:370121559
2642 2642 a, g dbSNP:779109120
2648 2648 g, t dbSNP:746207162
2649 2649 a, c, g dbSNP:139182618
2657 2657 c, t dbSNP:776406937
2658 2658 a, g dbSNP:374100226
2665 2665 a, g dbSNP:535539556
2674 2674 a, t dbSNP:199665461
2688 2688 g, t dbSNP:762749073
2697 2697 c, t dbSNP:766228120
2707 2707 c, t dbSNP:774171456
2708 2708 a, g dbSNP:199656818
2713 2713 a, g dbSNP:142485616
2716 2716 c, t dbSNP:201674841
2728 2728 a, g dbSNP:756232567
2745 2745 c, t dbSNP:766961466
2746 2746 g, t dbSNP:751917185
2760 2760 c, t dbSNP:755366410
2772 2772 a, g dbSNP:777295481
2773 2773 c, t dbSNP:549937261
2774 2774 a, g, t dbSNP:776196677
2775 2775 c, t dbSNP:745353025
2776 2776 a, g dbSNP:146355445
2781 2781 c, g dbSNP:780031708
2787 2787 c, t dbSNP:746842471
2789 2789 a, c dbSNP:768427844
2791 2791 c, g dbSNP:114954140
2798 2798 c, t dbSNP:762075719
2802 2802 c, t dbSNP:544202578
2803 2803 a, g, t dbSNP:745557568
2807 2807 c, g dbSNP:767051188
2824 2824 a, g dbSNP:368683081
2825 2825 c, g dbSNP:759831641
2837 2837 a, t dbSNP:767876302
2840 2840 a, c dbSNP:753466402
2852 2852 g, t dbSNP:184412435
2864 2864 c, t dbSNP:28621009
2869 2869 c, t dbSNP:372613242
2870 2870 a, c, g dbSNP:199938628
2880 2880 a, g dbSNP:746904563
2884 2884 a, g dbSNP:151116615
2886 2886 a, g dbSNP:780999517
2887 2887 a, g dbSNP:747919363
2888 2888 c, t dbSNP:140035679
2903 2903 a, g dbSNP:773553559
2910 2910 c, t dbSNP:749384463
2911 2911 a, g dbSNP:775071124
2919 2919 a, g dbSNP:530378456
2923 2923 c, g dbSNP:774744502
2933 2933 c, t dbSNP:201202292
2939 2939 -, ctc dbSNP:764496061
2963 2963 c, t dbSNP:748013884
2964 2964 c, t dbSNP:755969171
2966 2966 c, t dbSNP:376907694
2969 2969 a, g dbSNP:369367512
2971 2971 c, t dbSNP:148207079
2972 2972 a, g dbSNP:575383298
2980 2980 c, t dbSNP:745915167
2987 2987 c, t dbSNP:201242310
2997 2997 c, t dbSNP:772696463
3030 3030 g, t dbSNP:775976318
3035 3035 a, g dbSNP:761036108
3054 3054 c, g, t dbSNP:545610720
3057 3057 c, t dbSNP:762624155
3058 3058 a, g dbSNP:149768800
3065 3065 c, t dbSNP:751128659
3066 3066 a, g dbSNP:754432292
3069 3069 g, t dbSNP:147886477
3071 3071 a, c dbSNP:752623938
3075 3075 c, t dbSNP:755995994
3077 3077 c, t dbSNP:141629313
3078 3078 a, g dbSNP:147068787
3083 3083 c, t dbSNP:757551016
3086 3086 c, t dbSNP:200383522
3087 3087 a, g dbSNP:746031284
3088 3088 a, g dbSNP:771983135
3100 3100 c, g dbSNP:753963611
3101 3101 c, t dbSNP:780548431
3111 3111 c, g, t dbSNP:540243963
3123 3123 c, t dbSNP:777017134
3132 3132 a, c dbSNP:762059116
3137 3137 c, t dbSNP:201814836
3138 3138 a, g dbSNP:773870498
3147 3147 c, t dbSNP:375529059
3149 3149 a, g dbSNP:767087960
3158 3158 c, t dbSNP:752713774
3159 3159 a, g dbSNP:760736368
3164 3164 c, t dbSNP:764102952
3184 3184 a, g dbSNP:771820597
3198 3198 a, c dbSNP:775190705
3204 3204 c, t dbSNP:760250242
3205 3205 a, g dbSNP:368247409
3215 3215 a, c, t dbSNP:761765707
3216 3216 a, g dbSNP:372083317
3217 3217 c, t dbSNP:200104182
3218 3218 a, g dbSNP:750686408
3227 3227 c, t dbSNP:758656651
3231 3231 c, t dbSNP:766562569
3237 3237 c, t dbSNP:529287618
3238 3238 a, g dbSNP:755045738
3243 3243 c, t dbSNP:781666509
3245 3245 a, g dbSNP:750709778
3246 3246 g, t dbSNP:748545141
3247 3247 a, g dbSNP:756533048
3251 3251 c, t dbSNP:778039973
3277 3277 c, g dbSNP:771693018
3278 3278 a, g dbSNP:771910535
3291 3291 a, c, t dbSNP:757631754
3311 3311 c, t dbSNP:569144296
3312 3312 c, t dbSNP:768317212
3324 3324 a, g dbSNP:149088443
3332 3332 c, g, t dbSNP:773071296
3333 3333 a, g dbSNP:143160271
3335 3335 c, t dbSNP:769680142
3342 3342 c, t dbSNP:773198385
3350 3350 c, t dbSNP:762742289
3353 3353 c, t dbSNP:766105588
3364 3364 c, t dbSNP:774578166
3385 3385 a, g dbSNP:759793369
3392 3392 a, g dbSNP:767756921
3393 3393 c, g dbSNP:752775785
3395 3395 c, t dbSNP:760802467
3396 3396 a, g dbSNP:764510742
3398 3398 a, g dbSNP:754334916
3399 3399 a, g dbSNP:539307956
3400 3400 c, g dbSNP:757715325
3405 3405 c, t dbSNP:779375840
3414 3414 a, g dbSNP:200485103
3416 3416 c, t dbSNP:754638874
3417 3417 a, g dbSNP:780887227
3430 3430 c, t dbSNP:780715056
3431 3431 c, g dbSNP:752338645
3434 3434 a, g dbSNP:755602869
3439 3439 a, g dbSNP:372885044
3444 3444 c, t dbSNP:141383715
3445 3445 a, g dbSNP:770911706
3451 3451 a, g dbSNP:778816177
3452 3452 c, t dbSNP:745653157
3453 3453 a, g dbSNP:771840324
3458 3458 c, t dbSNP:775595083
3461 3461 c, g dbSNP:760908525
3465 3465 a, c dbSNP:768725087
3467 3467 c, t dbSNP:145216125
3471 3471 c, g dbSNP:761975438
3475 3475 a, c dbSNP:765914934
3491 3491 c, t dbSNP:147534464
3504 3504 g, t dbSNP:763242460
3506 3506 g, t dbSNP:766718776
3520 3520 a, g dbSNP:752323870
3525 3525 a, g dbSNP:755839114
3527 3527 a, g dbSNP:375018737
3528 3528 c, g dbSNP:753410940
3534 3534 c, t dbSNP:369700472
3535 3535 a, g dbSNP:778832627
3542 3542 a, g dbSNP:763739986
3556 3556 c, t dbSNP:753429196
3567 3567 a, g dbSNP:756780589
3568 3568 a, c, g dbSNP:764684398
3574 3574 c, g dbSNP:751571654
3588 3588 c, t dbSNP:202039332
3595 3595 a, g dbSNP:779846533
3601 3601 c, g dbSNP:746892451
3602 3602 c, t dbSNP:754755957
3608 3608 a, g dbSNP:781581211
3614 3614 c, t dbSNP:373122915
3624 3624 a, c dbSNP:770026911
3625 3625 a, c dbSNP:773382680
3630 3630 c, t dbSNP:550956511
3631 3631 a, c, g dbSNP:771533990
3641 3641 c, t dbSNP:562711787
3642 3642 a, g dbSNP:772370974
3645 3645 c, t dbSNP:776294154
3656 3656 c, t dbSNP:752073932
3662 3662 c, t dbSNP:764771703
3665 3665 a, g dbSNP:533273623
3670 3670 a, g dbSNP:762369657
3674 3674 a, g dbSNP:766346816
3677 3677 c, t dbSNP:751398802
3686 3686 a, g dbSNP:754843722
3694 3694 c, t dbSNP:781096678
3695 3695 a, g, t dbSNP:377425535
3696 3696 c, t dbSNP:756454771
3697 3697 a, g dbSNP:777852895
3700 3700 c, t dbSNP:749389938
3701 3701 a, g dbSNP:770856754
3703 3703 a, c dbSNP:558173499
3704 3704 c, t dbSNP:746330933
3715 3715 c, t dbSNP:772535224
3718 3718 a, c dbSNP:775878262
3719 3719 c, t dbSNP:761011213
3728 3728 c, t dbSNP:769560341
3729 3729 a, g dbSNP:772677118
3744 3744 c, t dbSNP:370522595
3767 3767 a, c dbSNP:765761004
3771 3771 c, t dbSNP:370419567
3772 3772 a, g dbSNP:759589147
3778 3778 a, t dbSNP:767539999
3780 3780 a, c, t dbSNP:781355884
3781 3781 a, c, g, t dbSNP:551687173
3784 3784 c, t dbSNP:753957347
3802 3802 g, t dbSNP:750565790
3811 3811 g, t dbSNP:758410324
3812 3812 a, g dbSNP:780556649
3816 3816 a, g dbSNP:747469147
3821 3821 c, t dbSNP:755405101
3822 3822 a, c dbSNP:781451872
3826 3826 c, g, t dbSNP:748525586
3827 3827 a, g dbSNP:774143536
3839 3839 c, t dbSNP:745383213
3840 3840 a, g dbSNP:771657070
3842 3842 g, t dbSNP:775598017
3846 3846 a, c, g dbSNP:374300363
3856 3856 a, g dbSNP:200096403
3860 3860 a, g dbSNP:137894484
3862 3862 c, t dbSNP:368693886
3865 3865 a, c dbSNP:573143647
3867 3867 c, t dbSNP:115335139
3875 3875 a, t dbSNP:372361923
3884 3884 c, t dbSNP:149155949
3885 3885 a, g dbSNP:373631162
3889 3889 c, t dbSNP:367649187
3890 3890 a, g dbSNP:200838638
3894 3894 c, t dbSNP:748528692
3895 3895 c, t dbSNP:562936594
3896 3896 a, g dbSNP:778729903
3907 3907 a, g dbSNP:745476792
3915 3915 c, t dbSNP:771818419
3916 3916 a, g dbSNP:533343939
3925 3925 g, t dbSNP:545368166
3937 3937 a, c dbSNP:746512440
3941 3941 c, t dbSNP:768538893
3948 3948 c, t dbSNP:376582167
3974 3974 c, t dbSNP:371402264
3975 3975 a, g dbSNP:185009718
3977 3977 a, g dbSNP:527543385
3992 3992 a, c dbSNP:767915504
3994 3994 c, g dbSNP:753199102
3996 3996 g, t dbSNP:756577669
4002 4002 c, g dbSNP:778320987
4007 4007 c, t dbSNP:754228625
4011 4011 c, g dbSNP:758179285
4018 4018 a, g dbSNP:779749950
4022 4022 c, t dbSNP:374616111
4023 4023 a, g dbSNP:139332716
4026 4026 a, c dbSNP:534194675
4030 4030 g, t dbSNP:748082298
4031 4031 c, t dbSNP:769691799
4032 4032 a, c, g dbSNP:374935528
4033 4033 a, g dbSNP:369401044
4037 4037 c, t dbSNP:540512909
4043 4043 a, g dbSNP:759555622
4059 4059 c, t dbSNP:372257661
4060 4060 a, g dbSNP:556378666
4063 4063 a, c dbSNP:761313195
4069 4069 a, g dbSNP:372294386
4075 4075 a, g dbSNP:764681351
4076 4076 c, t dbSNP:754316452
4077 4077 a, g dbSNP:149613080
4078 4078 a, g dbSNP:1212934
4082 4082 c, t dbSNP:144358189
4083 4083 a, g dbSNP:751177819
4090 4090 a, c dbSNP:754481112
4092 4092 c, t dbSNP:762398666
4095 4095 c, t dbSNP:747638869
4096 4096 a, g dbSNP:375618779
4097 4097 g, t dbSNP:777682959
4101 4101 c, t dbSNP:749087436
4106 4106 c, t dbSNP:369994002
4117 4117 a, g, t dbSNP:374413723
4145 4145 c, t dbSNP:746140237
4146 4146 a, g dbSNP:377750684
4163 4163 a, g dbSNP:775693098
4166 4166 c, t dbSNP:760828598
4173 4173 a, c dbSNP:764699934
4186 4186 a, g dbSNP:777218164
4187 4187 a, g dbSNP:762294424
4188 4188 a, g dbSNP:578098855
4194 4194 c, t dbSNP:200195292
4196 4196 c, g dbSNP:752290321
4199 4199 c, t dbSNP:755644539
4200 4200 a, g dbSNP:763633644
4201 4201 a, g dbSNP:753322711
4208 4208 c, t dbSNP:757276600
4216 4216 a, g dbSNP:778710515
4230 4230 c, t dbSNP:750730059
4232 4232 c, t dbSNP:750232469
4233 4233 a, g dbSNP:758067731
4238 4238 c, t dbSNP:780442723
4242 4242 a, t dbSNP:747196729
4244 4244 c, t dbSNP:768970893
4246 4246 a, g dbSNP:781474959
4247 4247 c, t dbSNP:748166857
4248 4248 a, g, t dbSNP:770399527
4262 4262 a, g dbSNP:373565478
4268 4268 -, c dbSNP:777587948
4272 4272 c, t dbSNP:771238352
4273 4273 a, g dbSNP:368787343
4275 4275 c, t dbSNP:371283114
4276 4276 a, g dbSNP:374189635
4277 4277 a, g dbSNP:148792547
4279 4279 c, t dbSNP:761157640
4280 4280 c, t dbSNP:142473307
4281 4281 a, g dbSNP:750275998
4293 4293 c, t dbSNP:758241653
4300 4300 g, t dbSNP:780037599
4301 4301 a, t dbSNP:368402363
4305 4305 g, t dbSNP:755312971
4307 4307 a, g, t dbSNP:373710119
4319 4319 c, t dbSNP:147869980
4320 4320 a, g dbSNP:546120448
4321 4321 a, g dbSNP:367923884
4327 4327 g, t dbSNP:771404217
4332 4332 c, t dbSNP:762409712
4334 4334 c, g dbSNP:774753718
4337 4337 c, t dbSNP:766685400
4354 4354 c, t dbSNP:768302132
4356 4356 a, g dbSNP:776085762
4365 4365 g, t dbSNP:761406257
4375 4375 c, t dbSNP:764610687
4383 4383 c, t dbSNP:749921436
4385 4385 c, t dbSNP:139891048
4386 4386 g, t dbSNP:766409677
4389 4389 a, g dbSNP:531381174
4391 4391 a, c dbSNP:754753739
4398 4398 c, t dbSNP:767867271
4402 4402 c, g dbSNP:189681080
4408 4408 c, t dbSNP:571020930
4409 4409 c, t dbSNP:532034819
4412 4412 c, t dbSNP:777762858
4418 4418 c, g dbSNP:749373272
4420 4420 c, t dbSNP:753417146
4424 4424 c, t dbSNP:141015952
4445 4445 a, g, t dbSNP:149716961
4454 4454 c, t dbSNP:35473255
4455 4455 a, c, g dbSNP:549875912
4462 4462 c, t dbSNP:746330794
4463 4463 a, c, g dbSNP:758869270
4475 4475 c, t dbSNP:148895205
4479 4479 c, t dbSNP:368468093
4480 4480 a, g dbSNP:772858157
4481 4481 c, t dbSNP:748821417
4482 4482 c, t dbSNP:201209045
4487 4487 a, g dbSNP:770518344
4494 4494 a, g dbSNP:774462945
4496 4496 g, t dbSNP:778957010
4497 4497 a, g dbSNP:3745234
4499 4499 c, t dbSNP:61995685
4502 4502 c, t dbSNP:775214534
4507 4507 c, t dbSNP:760451604
4508 4508 a, g dbSNP:372557198
4512 4512 c, t dbSNP:754006123
4513 4513 a, g dbSNP:761908769
4522 4522 c, t dbSNP:765337936
4535 4535 c, t dbSNP:376855081
4536 4536 a, g dbSNP:758888823
4538 4538 c, t dbSNP:370189807
4545 4545 c, t dbSNP:780609454
4559 4559 c, t dbSNP:751878364
4560 4560 a, g dbSNP:755317091
4563 4563 a, g dbSNP:373459551
4571 4571 c, g dbSNP:748911193
4572 4572 c, t dbSNP:770677974
4586 4586 c, t dbSNP:34225188
4587 4587 a, g dbSNP:369352974
4595 4595 c, t dbSNP:753091733
4601 4601 a, g dbSNP:566045123
4608 4608 a, g dbSNP:778640003
4609 4609 a, g dbSNP:745383186
4610 4610 c, t dbSNP:771562306
4623 4623 a, g dbSNP:779883123
4630 4630 a, g dbSNP:536724995
4634 4634 c, t dbSNP:752183998
4636 4636 c, t dbSNP:768453015
4637 4637 a, g dbSNP:183527379
4640 4640 g, t dbSNP:747935374
4642 4642 g, t dbSNP:770011525
4643 4643 c, t dbSNP:773368910
4649 4649 c, t dbSNP:150132353
4650 4650 c, t dbSNP:762968675
4658 4658 g, t dbSNP:757880105
4666 4666 a, g dbSNP:766442833
4667 4667 c, t dbSNP:774265168
4668 4668 a, c dbSNP:760139304
4670 4670 c, t dbSNP:144628745
4671 4671 a, g dbSNP:768127043
4682 4682 c, t dbSNP:112934297
4683 4683 a, g dbSNP:756485611
4693 4693 a, c dbSNP:148217267
4698 4698 a, g dbSNP:141221243
4700 4700 c, g dbSNP:750048280
4708 4708 a, g dbSNP:757955337
4709 4709 c, t dbSNP:377217717
4710 4710 a, g dbSNP:746486631
4711 4711 c, g dbSNP:754972626
4717 4717 c, t dbSNP:781043047
4720 4720 g, t dbSNP:747951716
4721 4721 c, t dbSNP:769529505
4723 4723 c, t dbSNP:777183202
4724 4724 a, g dbSNP:565713715
4732 4732 a, g dbSNP:150661961
4735 4735 a, g dbSNP:774551623
4737 4737 c, t dbSNP:759465531
4752 4752 a, g dbSNP:777973742
4762 4762 a, g dbSNP:768149358
4763 4763 c, t dbSNP:371781628
4765 4765 g, t dbSNP:776088296
4766 4766 c, t dbSNP:761147949
4767 4767 c, t dbSNP:374942873
4768 4768 g, t dbSNP:138904325
4770 4770 a, g dbSNP:539733408
4776 4776 c, g dbSNP:758127113
4778 4778 a, g dbSNP:765940754
4793 4793 c, t dbSNP:369967292
4804 4804 c, t dbSNP:754429015
4807 4807 a, g dbSNP:781130941
4821 4821 a, t dbSNP:748037792
4832 4832 c, g dbSNP:753677627
4835 4835 c, t dbSNP:569891691
4849 4849 c, t dbSNP:147539384
4850 4850 c, t dbSNP:139822806
4851 4851 a, g dbSNP:746128972
4854 4854 a, g dbSNP:772400231
4859 4859 c, t dbSNP:145348824
4860 4860 a, g dbSNP:747079911
4868 4868 c, t dbSNP:371090576
4869 4869 a, g dbSNP:776947766
4871 4871 c, t dbSNP:762262198
4873 4873 a, g dbSNP:770016000
4874 4874 c, t dbSNP:138473998
4875 4875 a, g dbSNP:781123189
4880 4880 c, t dbSNP:767147066
4882 4882 a, c dbSNP:752273945
4892 4892 c, t dbSNP:760114120
4893 4893 a, g dbSNP:764112268
4899 4899 c, t dbSNP:753676279
4901 4901 a, g dbSNP:757184427
4905 4905 g, t dbSNP:778618329
4906 4906 c, g dbSNP:750229800
4912 4912 a, c dbSNP:758759457
4914 4914 c, g dbSNP:780355005
4922 4922 c, t dbSNP:745726059
4926 4926 c, t dbSNP:747096596
4929 4929 c, g dbSNP:754966620
4937 4937 c, t dbSNP:148739946
4946 4946 c, t dbSNP:756649655
4950 4950 c, t dbSNP:142361779
4951 4951 a, g dbSNP:749669318
4960 4960 a, g dbSNP:771242519
4962 4962 c, t dbSNP:774663979
4963 4963 a, g dbSNP:541874206
4967 4967 a, g dbSNP:768338029
4982 4982 a, g dbSNP:151186249
4985 4985 c, t dbSNP:563168077
4992 4992 a, g dbSNP:761320396
4997 4997 c, t dbSNP:537267559
5003 5003 a, g dbSNP:201294981
5016 5016 c, g dbSNP:773233865
5025 5025 c, t dbSNP:200791026
5028 5028 c, t dbSNP:762873102
5041 5041 a, t dbSNP:766319489
5063 5063 a, g dbSNP:140305632
5073 5073 -, g dbSNP:35399265
5073 5073 c, t dbSNP:778503199
5074 5074 a, g dbSNP:372798483
5076 5076 c, t dbSNP:763033925
5077 5077 a, g dbSNP:375249697
5087 5087 c, g dbSNP:201947104
5095 5095 c, t dbSNP:774083503
5096 5096 a, g dbSNP:759312023
5103 5103 a, g dbSNP:767649270
5108 5108 c, t dbSNP:552764885
5109 5109 a, g dbSNP:760852092
5111 5111 a, g dbSNP:764204747
5113 5113 g, t dbSNP:753896870
5116 5116 c, t dbSNP:144124759
5120 5120 c, t dbSNP:779325459
5124 5124 c, t dbSNP:750766731
5125 5125 c, t dbSNP:758739283
5126 5126 a, g dbSNP:780737583
5131 5131 a, g dbSNP:397515427
5136 5136 c, t dbSNP:747875374
5137 5137 c, t dbSNP:376812395
5147 5147 c, t dbSNP:149279834
5148 5148 a, g dbSNP:777483950
5159 5159 c, t dbSNP:200468005
5160 5160 a, g dbSNP:771000965
5166 5166 c, t dbSNP:774288940
5167 5167 a, g dbSNP:759275421
5173 5173 c, t dbSNP:557012688
5177 5177 c, g dbSNP:77422116
5186 5186 c, g dbSNP:541175277
5186 5186 -, g dbSNP:769979815
5193 5193 a, c dbSNP:764292493
5197 5197 c, g dbSNP:753919019
5198 5198 c, t dbSNP:776947386
5199 5199 a, g dbSNP:375545228
5207 5207 c, t dbSNP:750901186
5208 5208 a, g dbSNP:758801392
5211 5211 a, g dbSNP:564045592
5215 5215 a, g dbSNP:141153248
5220 5220 c, t dbSNP:144595008
5226 5226 c, g dbSNP:755897855
5231 5231 c, t dbSNP:777504419
5233 5233 a, g dbSNP:748825495
5234 5234 c, t dbSNP:756781768
5253 5253 a, c, t dbSNP:778751036
5254 5254 a, g dbSNP:771888892
5258 5258 c, g dbSNP:775418910
5263 5263 a, t dbSNP:746735812
5265 5265 -, c dbSNP:763484373
5266 5266 c, g dbSNP:779797232
5268 5268 c, t dbSNP:746827747
5269 5269 a, c dbSNP:138397020
5276 5276 c, t dbSNP:35468447
5291 5291 c, t dbSNP:143507034
5292 5292 a, g dbSNP:748419823
5313 5313 a, g dbSNP:769897000
5316 5316 c, t dbSNP:371138631
5320 5320 a, g dbSNP:762874704
5322 5322 g, t dbSNP:766927080
5324 5324 c, g dbSNP:148341236
5325 5325 c, t dbSNP:543654043
5327 5327 c, g dbSNP:768037339
5336 5336 -, c dbSNP:764398133
5336 5336 c, t dbSNP:753094166
5339 5339 a, g dbSNP:761590112
5342 5342 g, t dbSNP:764726976
5345 5345 c, t dbSNP:749960291
5346 5346 g, t dbSNP:757795832
5352 5352 c, t dbSNP:779996043
5356 5356 c, t dbSNP:200200636
5357 5357 a, g dbSNP:754887376
5361 5361 a, g dbSNP:781022903
5363 5363 c, t dbSNP:747890643
5373 5373 c, t dbSNP:770062059
5376 5376 a, c dbSNP:777801738
5396 5396 a, g dbSNP:372224111
5402 5402 c, t dbSNP:749410347
5403 5403 c, g, t dbSNP:770879154
5416 5416 c, t dbSNP:760174580
5419 5419 c, g dbSNP:772698035
5420 5420 a, c dbSNP:776000322
5423 5423 a, c dbSNP:760887363
5429 5429 c, t dbSNP:764964359
5437 5437 c, g dbSNP:750002229
5441 5441 a, c, t dbSNP:755932452
5448 5448 a, c dbSNP:373373576
5452 5452 a, g dbSNP:143215498
5468 5468 c, t dbSNP:773855561
5474 5474 c, t dbSNP:758990105
5475 5475 a, g dbSNP:767465945
5483 5483 c, t dbSNP:752540472
5495 5495 c, t dbSNP:767163810
5496 5496 a, g dbSNP:763848067
5504 5504 a, g dbSNP:753659128
5506 5506 -, gt dbSNP:760330658
5510 5510 a, c dbSNP:757553830
5518 5518 a, t dbSNP:779216381
5530 5530 c, t dbSNP:745965273
5541 5541 c, t dbSNP:532969963
5543 5543 c, t dbSNP:185198604
5544 5544 a, g dbSNP:747518909
5546 5546 a, g dbSNP:377577186
5550 5550 a, t dbSNP:776927604
5552 5552 c, t dbSNP:190043758
5559 5559 c, t dbSNP:770586263
5566 5566 c, t dbSNP:773945286
5572 5572 a, g dbSNP:367825461
5575 5575 c, t dbSNP:767056887
5584 5584 a, t dbSNP:775046696
5595 5595 c, t dbSNP:760591664
5601 5601 a, c, g dbSNP:764022580
5602 5602 c, g dbSNP:757067402
5604 5604 a, g, t dbSNP:575409028
5610 5610 c, t dbSNP:760169784
5611 5611 a, g dbSNP:768497871
5617 5617 a, g dbSNP:776666559
5621 5621 a, g dbSNP:761809949
5623 5623 g, t dbSNP:540356511
5631 5631 c, t dbSNP:113983707
5632 5632 a, g dbSNP:371976691
5636 5636 c, t dbSNP:763333660
5639 5639 a, c dbSNP:766557202
5641 5641 c, t dbSNP:751604046
5643 5643 c, t dbSNP:375083726
5644 5644 a, g dbSNP:781582606
5652 5652 a, g dbSNP:369842921
5653 5653 a, g dbSNP:372360723
5661 5661 c, t dbSNP:778172293
5673 5673 c, t dbSNP:147522761
5682 5682 -, g dbSNP:754534130
5688 5688 c, t dbSNP:771633323
5691 5691 c, t dbSNP:139859934
5692 5692 a, g dbSNP:201626121
5699 5699 c, t dbSNP:768250260
5700 5700 a, g dbSNP:776256709
5706 5706 a, g dbSNP:1206038
5709 5709 a, g dbSNP:562782890
5712 5712 a, g dbSNP:773145911
5715 5715 c, g, t dbSNP:150607375
5721 5721 a, g, t dbSNP:751766816
5722 5722 c, t dbSNP:767687495
5731 5731 c, g dbSNP:752764127
5736 5736 a, g dbSNP:756683475
5738 5738 -, agg dbSNP:764776871
5750 5750 a, g dbSNP:112433681
5751 5751 a, g dbSNP:754218851
5754 5754 c, g dbSNP:149787596
5763 5763 c, t dbSNP:779113255
5766 5766 a, c dbSNP:746722708
5777 5777 a, g dbSNP:768179223
5779 5779 c, t dbSNP:537432708
5780 5780 a, c dbSNP:770762925
5781 5781 c, t dbSNP:373745990
5782 5782 a, g dbSNP:183945597
5786 5786 c, t dbSNP:745586029
5787 5787 c, t dbSNP:772299336
5788 5788 a, g dbSNP:775645539
5799 5799 a, g dbSNP:376869149
5801 5801 c, t dbSNP:539715865
5805 5805 g, t dbSNP:370106282
5814 5814 g, t dbSNP:144734416
5817 5817 a, g dbSNP:765595234
5822 5822 c, g dbSNP:750813302
5823 5823 a, g dbSNP:758787847
5829 5829 a, g dbSNP:767310853
5840 5840 g, t dbSNP:752439724
5841 5841 c, t dbSNP:755807533
5842 5842 a, g dbSNP:777401427
5844 5844 c, t dbSNP:748747156
5845 5845 c, t dbSNP:757227265
5846 5846 a, g dbSNP:139648725
5849 5849 -, c dbSNP:746753312
5855 5855 c, g, t dbSNP:377685078
5856 5856 a, g dbSNP:771890594
5867 5867 c, t dbSNP:370949857
5868 5868 a, g dbSNP:747286989
5870 5870 c, t dbSNP:768859074
5871 5871 a, g dbSNP:375636196
5875 5875 c, t dbSNP:761740209
5891 5891 c, t dbSNP:540767989
5892 5892 g, t dbSNP:770356408
5897 5897 c, t dbSNP:370482940
5904 5904 a, c dbSNP:763524369
5909 5909 a, g, t dbSNP:116630802
5911 5911 c, g dbSNP:373601254
5912 5912 c, t dbSNP:763589986
5913 5913 a, g dbSNP:753405679
5916 5916 c, t dbSNP:756677988
5922 5922 c, t dbSNP:778451338
5926 5926 c, t dbSNP:139959427
5932 5932 c, t dbSNP:759962028
5939 5939 g, t dbSNP:763852948
5941 5941 c, t dbSNP:753468610
5946 5946 a, g dbSNP:200501111
5952 5952 a, g dbSNP:764670241
5955 5955 a, t dbSNP:538368877
5958 5958 c, g dbSNP:143508185
5974 5974 c, t dbSNP:765113981
5981 5981 c, t dbSNP:751406034
5982 5982 a, g dbSNP:754698123
5988 5988 c, t dbSNP:751715083
5989 5989 a, g dbSNP:556689644
5990 5990 c, t dbSNP:756300122
5993 5993 a, g dbSNP:36016565
5996 5996 a, t dbSNP:749372231
6011 6011 -, g dbSNP:34886828
6011 6011 c, t dbSNP:151134622
6015 6015 a, g dbSNP:774973725
6017 6017 a, c dbSNP:746270596
6018 6018 a, g dbSNP:772349120
6023 6023 c, t dbSNP:371490515
6024 6024 c, t dbSNP:775870539
6030 6030 c, t dbSNP:761380156
6033 6033 c, t dbSNP:373998831
6035 6035 c, g dbSNP:772768540
6038 6038 a, g dbSNP:762428543
6041 6041 a, g dbSNP:554088449
6045 6045 a, c dbSNP:751528860
6047 6047 c, t dbSNP:754895093
6058 6058 a, c dbSNP:767228232
6066 6066 c, t dbSNP:572272792
6067 6067 a, g dbSNP:756355683
6068 6068 c, t dbSNP:62648096
6080 6080 a, g dbSNP:749425382
6087 6087 a, g dbSNP:757377529
6089 6089 a, t dbSNP:779091598
6095 6095 c, t dbSNP:746378550
6103 6103 a, g dbSNP:772567593
6109 6109 a, g dbSNP:775787509
6111 6111 a, c dbSNP:747389441
6120 6120 c, t dbSNP:150311870
6124 6124 a, g dbSNP:772821463
6137 6137 c, t dbSNP:762553051
6138 6138 a, c, g dbSNP:765896835
6140 6140 a, g dbSNP:759395924
6141 6141 c, g dbSNP:767483374
6142 6142 a, t dbSNP:758042892
6153 6153 a, g dbSNP:760492927
6156 6156 c, t dbSNP:144945446
6159 6159 a, g dbSNP:752130198
6163 6163 a, g dbSNP:571725575
6164 6164 c, t dbSNP:369480415
6165 6165 a, g dbSNP:574708619
6167 6167 a, g dbSNP:138644598
6168 6168 g, t dbSNP:371862361
6173 6173 a, c, t dbSNP:770625540
6174 6174 c, g dbSNP:147084460
6176 6176 c, t dbSNP:771640188
6182 6182 c, g dbSNP:774809942
6185 6185 a, g dbSNP:200526872
6186 6186 a, g dbSNP:768713408
6188 6188 a, g dbSNP:776629555
6190 6190 c, t dbSNP:761681313
6192 6192 c, t dbSNP:765419448
6193 6193 a, g dbSNP:773515719
6196 6196 c, t dbSNP:763036582
6199 6199 c, t dbSNP:766493787
6200 6200 a, g dbSNP:571282039
6207 6207 c, t dbSNP:755544228
6213 6213 c, t dbSNP:368438075
6214 6214 a, g dbSNP:559115816
6219 6219 c, t dbSNP:529688057
6243 6243 c, t dbSNP:777955709
6244 6244 a, g dbSNP:745553573
6246 6246 c, t dbSNP:757924699
6248 6248 c, t dbSNP:779686316
6249 6249 c, t dbSNP:746507572
6252 6252 c, t dbSNP:768766308
6253 6253 a, g dbSNP:776680225
6267 6267 a, g dbSNP:748061021
6276 6276 c, g dbSNP:542990173
6278 6278 c, g dbSNP:772826136
6280 6280 c, t dbSNP:779553499
6281 6281 a, g dbSNP:369807153
6287 6287 a, c dbSNP:754567747
6289 6289 a, c, t dbSNP:759524232
6290 6290 a, c, g dbSNP:748110110
6291 6291 c, g, t dbSNP:34475546
6292 6292 a, g dbSNP:771233244
6294 6294 c, t dbSNP:774522665
6299 6299 a, g dbSNP:550418060
6304 6304 a, g dbSNP:772158196
6308 6308 c, t dbSNP:775487813
6314 6314 c, t dbSNP:761314605
6317 6317 c, t dbSNP:571835019
6323 6323 g, t dbSNP:754280637
6337 6337 a, g dbSNP:762056701
6340 6340 a, g dbSNP:765659720
6341 6341 c, t dbSNP:751281117
6343 6343 g, t dbSNP:200684391
6352 6352 c, t dbSNP:371840641
6368 6368 c, t dbSNP:200085640
6371 6371 a, g dbSNP:200310970
6381 6381 c, t dbSNP:756134457
6393 6393 c, t dbSNP:144057511
6398 6398 a, c dbSNP:749147794
6418 6418 c, t dbSNP:374797693
6419 6419 a, g dbSNP:143397959
6422 6422 c, t dbSNP:746099460
6437 6437 c, t dbSNP:536661123
6438 6438 c, g dbSNP:775608612
6448 6448 c, g, t dbSNP:760653254
6449 6449 c, g dbSNP:777039692
6450 6450 a, c, t dbSNP:762333959
6451 6451 a, g dbSNP:750750960
6466 6466 c, t dbSNP:759329751
6473 6473 a, g dbSNP:767265802
6497 6497 a, g dbSNP:758223781
6498 6498 a, c dbSNP:779853780
6501 6501 c, t dbSNP:747210470
6504 6504 c, t dbSNP:755163904
6515 6515 c, t dbSNP:781196047
6518 6518 a, g dbSNP:547635717
6525 6525 a, g dbSNP:770471420
6526 6526 a, c dbSNP:377486370
6538 6538 c, t dbSNP:749772025
6548 6548 c, t dbSNP:369680099
6572 6572 c, t dbSNP:148286629
6578 6578 a, g, t dbSNP:141413149
6581 6581 a, g dbSNP:763794930
6587 6587 a, g dbSNP:776057241
6596 6596 a, g dbSNP:200338219
6599 6599 a, g dbSNP:756634799
6608 6608 c, t dbSNP:764690745
6611 6611 c, t dbSNP:750386603
6612 6612 c, g dbSNP:758275007
6622 6622 g, t dbSNP:766092293
6623 6623 c, t dbSNP:751367723
6645 6645 a, c dbSNP:202175287
6647 6647 a, g dbSNP:781452874
6653 6653 c, t dbSNP:373068327
6656 6656 a, g dbSNP:150834651
6668 6668 a, g dbSNP:756293283
6670 6670 a, g dbSNP:777950047
6698 6698 c, t dbSNP:749822993
6704 6704 g, t dbSNP:771398845
6706 6706 a, g dbSNP:779209679
6738 6738 c, t dbSNP:747804190
6739 6739 c, g dbSNP:764738722
6741 6741 a, g dbSNP:368780512
6742 6742 c, t dbSNP:769820912
6744 6744 g, t dbSNP:772768716
6746 6746 c, t dbSNP:762428598
6768 6768 c, t dbSNP:770812017
6769 6769 a, g dbSNP:139601509
6772 6772 a, g dbSNP:759342849
6782 6782 c, t dbSNP:767358326
6787 6787 -, c dbSNP:759153150
6787 6787 c, t dbSNP:752470473
6792 6792 a, g dbSNP:761041438
6793 6793 c, g dbSNP:546522308
6797 6797 c, t dbSNP:754017719
6804 6804 a, g dbSNP:757392894
6815 6815 c, t dbSNP:532126083
6816 6816 a, g dbSNP:750958421
6828 6828 c, t dbSNP:371194840
6829 6829 a, g dbSNP:201140958
6831 6831 c, t dbSNP:373739098
6832 6832 a, g dbSNP:755814245
6842 6842 c, t dbSNP:751851442
6849 6849 g, t dbSNP:748851480
6858 6858 a, c, g, t dbSNP:770495431
6860 6860 a, c, g dbSNP:772127120
6867 6867 a, g dbSNP:760521667
6874 6874 a, g dbSNP:763943694
6879 6879 c, t dbSNP:367975745
6894 6894 a, g dbSNP:777017940
6902 6902 c, t dbSNP:761887293
6903 6903 a, g dbSNP:549617171
6906 6906 c, t dbSNP:750465936
6909 6909 c, g, t dbSNP:201858033
6910 6910 a, g dbSNP:751962550
6912 6912 c, g dbSNP:755365009
6918 6918 a, c dbSNP:765365135
6931 6931 a, g dbSNP:370984978
6934 6934 c, t dbSNP:372350131
6935 6935 a, g dbSNP:145990797
6939 6939 a, g dbSNP:752081500
6940 6940 c, t dbSNP:755820029
6953 6953 c, t dbSNP:2288922
6954 6954 c, t dbSNP:375806503
6956 6956 c, g dbSNP:756989594
6959 6959 c, t dbSNP:370110232
6962 6962 c, t dbSNP:536107755
6965 6965 c, t dbSNP:554372087
6966 6966 a, c, g dbSNP:758007636
6967 6967 a, c, t dbSNP:575829700
6974 6974 c, t dbSNP:781099770
6977 6977 a, g dbSNP:747874175
6981 6981 g, t dbSNP:536792549
6986 6986 c, t dbSNP:773339356
6989 6989 a, g dbSNP:763111062
6995 6995 c, t dbSNP:779531430
6996 6996 a, g dbSNP:374088709
7002 7002 a, g dbSNP:760101944
7004 7004 a, c, t dbSNP:767893103
7005 7005 a, g dbSNP:760913754
7007 7007 g, t dbSNP:764477325
7009 7009 c, t dbSNP:367956687
7010 7010 a, g dbSNP:10425783
7011 7011 c, t dbSNP:762873793
7015 7015 a, g dbSNP:779780127
7022 7022 c, t dbSNP:751105144
7023 7023 a, g dbSNP:755014441
7034 7034 c, t dbSNP:780962133
7046 7046 c, t dbSNP:371268413
7052 7052 c, t dbSNP:769501510
7057 7057 c, t dbSNP:374178667
7058 7058 c, t dbSNP:368865740
7059 7059 a, g dbSNP:771136518
7077 7077 a, g dbSNP:762237400
7079 7079 a, g dbSNP:765658058
7088 7088 a, g dbSNP:774170306
7092 7092 c, t dbSNP:759172296
7093 7093 a, g dbSNP:370288131
7094 7094 c, t dbSNP:752246587
7103 7103 c, t dbSNP:199937913
7104 7104 a, g dbSNP:767906925
7111 7111 a, g dbSNP:753669734
7116 7116 a, g dbSNP:757071241
7121 7121 c, t dbSNP:373665146
7127 7127 -, at dbSNP:752197763
7127 7127 a, c dbSNP:746097325
7130 7130 c, t dbSNP:369775275
7139 7139 c, t dbSNP:149735243
7140 7140 a, g dbSNP:747093369
7142 7142 c, t dbSNP:769084448
7147 7147 c, g dbSNP:777310098
7150 7150 a, g dbSNP:532673964
7154 7154 c, t dbSNP:373527346
7163 7163 c, t dbSNP:773643156
7167 7167 c, g dbSNP:376399763
7174 7174 a, c, g dbSNP:767184727
7186 7186 c, t dbSNP:370225382
7187 7187 a, g dbSNP:372437317
7194 7194 a, c, t dbSNP:750817882
7195 7195 a, g dbSNP:761677916
7199 7199 c, t dbSNP:145630132
7204 7204 a, g dbSNP:376007307
7217 7217 c, t dbSNP:758601040
7218 7218 a, g dbSNP:780296443
7230 7230 -, c dbSNP:762806936
7231 7231 c, t dbSNP:368451814
7232 7232 a, g dbSNP:755134868
7234 7234 a, g dbSNP:201847832
7249 7249 c, t dbSNP:748672158
7254 7254 c, t dbSNP:770418164
7255 7255 a, g dbSNP:73554568
7265 7265 a, c dbSNP:749637793
7270 7270 c, g dbSNP:752807945
7277 7277 c, t dbSNP:748403466
7290 7290 c, t dbSNP:370379302
7294 7294 c, t dbSNP:778308144
7295 7295 a, g dbSNP:749719126
7316 7316 c, g, t dbSNP:771348053
7317 7317 -, g dbSNP:760253277
7322 7322 c, t dbSNP:35019445
7324 7324 a, g dbSNP:768286057
7326 7326 a, c dbSNP:776168721
7332 7332 c, t dbSNP:563329836
7333 7333 a, g dbSNP:769253504
7335 7335 c, t dbSNP:530864821
7343 7343 c, t dbSNP:552181649
7344 7344 a, g dbSNP:185811990
7345 7345 a, c dbSNP:528281178
7354 7354 a, g, t dbSNP:142506261
7365 7365 c, t dbSNP:150940603
7368 7368 a, g dbSNP:142042363
7370 7370 a, c dbSNP:764031754
7375 7375 c, t dbSNP:754382502
7378 7378 a, c dbSNP:757636417
7381 7381 a, g dbSNP:373842617
7394 7394 a, g dbSNP:749556085
7400 7400 c, t dbSNP:754666704
7405 7405 a, g dbSNP:377068929
7409 7409 g, t dbSNP:370364807
7442 7442 g, t dbSNP:765632405
7448 7448 c, t dbSNP:537788689
7452 7452 g, t dbSNP:367851164
7475 7475 c, t dbSNP:145886667
7476 7476 a, g dbSNP:147708727
7480 7480 c, g dbSNP:747807960
7481 7481 c, t dbSNP:369359832
7482 7482 a, g dbSNP:73033442
7487 7487 c, t dbSNP:28483598
7488 7488 a, g dbSNP:112167630
7496 7496 c, t dbSNP:149439392
7497 7497 c, g dbSNP:745748127
7510 7510 a, g dbSNP:143643113
7517 7517 a, g dbSNP:775356941
7523 7523 c, t dbSNP:138235390
7529 7529 c, t dbSNP:370715695
7533 7533 c, t dbSNP:768745459
7550 7550 c, g dbSNP:372380349
7551 7551 c, t dbSNP:761830237
7556 7556 c, t dbSNP:765312333
7589 7589 c, t dbSNP:775919574
7591 7591 c, t dbSNP:372558876
7592 7592 a, g dbSNP:753419162
7604 7604 c, t dbSNP:759123523
7605 7605 a, g dbSNP:750058084
7618 7618 c, t dbSNP:758007485
7624 7624 a, g dbSNP:765931068
7628 7628 a, c dbSNP:751456440
7648 7648 c, t dbSNP:142829766
7649 7649 a, g dbSNP:780911219
7680 7680 c, t dbSNP:747955335
7681 7681 a, g dbSNP:756370726
7684 7684 a, g dbSNP:777998313
7706 7706 c, g, t dbSNP:113822011
7707 7707 a, g dbSNP:146094970
7715 7715 c, t dbSNP:780634034
7730 7730 c, t dbSNP:371582489
7734 7734 a, g dbSNP:397515428
7738 7738 c, t dbSNP:769146702
7739 7739 a, g, t dbSNP:777132271
7745 7745 c, t dbSNP:375011847
7746 7746 a, g dbSNP:773776672
7759 7759 a, t dbSNP:759121016
7760 7760 c, t dbSNP:369521038
7761 7761 c, t dbSNP:766886630
7769 7769 c, g dbSNP:373259008
7773 7773 g, t dbSNP:760535193
7789 7789 a, g dbSNP:763940342
7797 7797 c, t dbSNP:753615923
7801 7801 c, t dbSNP:757470081
7802 7802 a, g dbSNP:779163527
7805 7805 c, t dbSNP:750569726
7810 7810 c, t dbSNP:758520252
7813 7813 a, g dbSNP:779934071
7823 7823 c, t dbSNP:747586833
7833 7833 c, t dbSNP:769273382
7834 7834 a, g, t dbSNP:757739507
7835 7835 a, c, t dbSNP:781629694
7837 7837 a, g dbSNP:774072433
7840 7840 c, t dbSNP:759050174
7841 7841 a, g dbSNP:111595088
7845 7845 a, g dbSNP:558569357
7850 7850 c, t dbSNP:760662063
7851 7851 a, g dbSNP:763997439
7854 7854 c, t dbSNP:753671779
7855 7855 a, g dbSNP:45623135
7864 7864 c, t dbSNP:764884283
7865 7865 -, t dbSNP:36086620
7865 7865 c, g dbSNP:750662301
7871 7871 c, t dbSNP:758546477
7872 7872 a, g dbSNP:766625279
7892 7892 c, t dbSNP:376414502
7899 7899 a, g dbSNP:755585384
7901 7901 c, g dbSNP:781773462
7902 7902 c, t dbSNP:368024107
7903 7903 g, t dbSNP:756510671
7905 7905 c, t dbSNP:777929046
7909 7909 c, t dbSNP:745598545
7910 7910 a, g dbSNP:199786210
7911 7911 c, t dbSNP:775029418
7916 7916 c, t dbSNP:746488503
7917 7917 a, g dbSNP:376078071
7922 7922 c, t dbSNP:776570913
7925 7925 c, t dbSNP:761589016
7926 7926 a, g dbSNP:554506062
7944 7944 a, g dbSNP:772871276
7957 7957 a, g dbSNP:763286751
7964 7964 c, t dbSNP:766680466
7967 7967 c, t dbSNP:572752054
7968 7968 a, g dbSNP:150782421
7973 7973 c, t dbSNP:767644140
7974 7974 c, t dbSNP:753248304
7975 7975 a, g, t dbSNP:369692848
7988 7988 c, g dbSNP:749592583
7993 7993 a, g dbSNP:758084935
7994 7994 c, t dbSNP:373059614
7995 7995 a, g dbSNP:746615045
8001 8001 a, g dbSNP:139192223
8007 8007 c, t dbSNP:531863035
8008 8008 a, t dbSNP:377601737
8023 8023 c, t dbSNP:769598183
8026 8026 c, t dbSNP:773102301
8028 8028 -, ccaccacct dbSNP:773517915
8037 8037 c, g dbSNP:149965041
8043 8043 a, c dbSNP:766231753
8044 8044 c, t dbSNP:774730847
8046 8046 a, c dbSNP:759761956
8047 8047 c, t dbSNP:767768711
8055 8055 c, g dbSNP:543549761
8064 8064 c, g, t dbSNP:565321934
8065 8065 a, g dbSNP:754329335
8070 8070 g, t dbSNP:757641182
8074 8074 c, g dbSNP:779190529
8080 8080 c, t dbSNP:751281247
8083 8083 a, g dbSNP:754611814
8085 8085 a, g dbSNP:576074108
8086 8086 -, a dbSNP:759200371
8089 8089 c, g dbSNP:747582206
8094 8094 g, t dbSNP:112469278
8098 8098 a, g, t dbSNP:769310948
8099 8099 c, g dbSNP:532380579
8104 8104 a, g dbSNP:749183655
8107 8107 c, t dbSNP:147216997
8108 8108 a, g dbSNP:774279106
8111 8111 c, g dbSNP:759892500
8112 8112 a, g dbSNP:772398020
8115 8115 c, t dbSNP:748884146
8116 8116 c, g dbSNP:775678472
8127 8127 c, t dbSNP:760698976
8128 8128 a, g dbSNP:764185083
8130 8130 a, g dbSNP:754313677
8133 8133 c, t dbSNP:762303782
8134 8134 a, g dbSNP:565653220
8139 8139 a, g dbSNP:147133204
8146 8146 c, t dbSNP:754666792
8147 8147 a, g dbSNP:200748447
8148 8148 c, t dbSNP:374292471
8149 8149 a, g dbSNP:755596877
8153 8153 c, t dbSNP:777274120
8158 8158 c, t dbSNP:368743788
8165 8165 c, t dbSNP:3745237
8166 8166 a, g dbSNP:778897649
8170 8170 c, t dbSNP:745623883
8171 8171 a, c, g dbSNP:78335246
8176 8176 c, t dbSNP:760894129
8177 8177 a, g dbSNP:144256916
8185 8185 c, t dbSNP:372348183
8196 8196 a, g dbSNP:147796963
8203 8203 a, g dbSNP:765704447
8204 8204 c, t dbSNP:558377122
8207 8207 c, t dbSNP:375633770
8208 8208 a, g dbSNP:148860986
8211 8211 c, t dbSNP:367639760
8212 8212 a, g dbSNP:371459258
8219 8219 a, g, t dbSNP:374927201
8220 8220 a, c dbSNP:140517402
8223 8223 a, g dbSNP:779024048
8224 8224 g, t dbSNP:745748581
8226 8226 a, c dbSNP:758141124
8240 8240 a, c, t dbSNP:369259843
8243 8243 g, t dbSNP:768902189
8245 8245 a, g dbSNP:552972983
8260 8260 c, t dbSNP:748260455
8263 8263 c, g dbSNP:769818172
8265 8265 c, t dbSNP:773724721
8266 8266 a, g dbSNP:763453691
8272 8272 a, t dbSNP:766724451
8274 8274 -, ctg dbSNP:769425498
8289 8289 a, c, g, t dbSNP:772954605
8296 8296 a, g dbSNP:140588377
8302 8302 a, g dbSNP:753498301
8305 8305 g, t dbSNP:756847499
8309 8309 c, t dbSNP:572813671
8310 8310 a, g dbSNP:200506642
8312 8312 c, t dbSNP:555193419
8313 8313 a, g dbSNP:779762562
8314 8314 c, t dbSNP:746788380
8318 8318 c, t dbSNP:576552216
8319 8319 a, g dbSNP:543957344
8327 8327 c, t dbSNP:150486662
8328 8328 a, g dbSNP:748313683
8333 8333 a, g dbSNP:769869312
8339 8339 c, t dbSNP:773278649
8342 8342 a, g dbSNP:749822553
8353 8353 a, g dbSNP:771443838
8355 8355 a, c dbSNP:375577811
8375 8375 c, t dbSNP:565238812
8393 8393 c, t dbSNP:759973744
8394 8394 a, g dbSNP:373377277
8402 8402 -, ctc dbSNP:775004286
8402 8402 c, t dbSNP:532443309
8406 8406 g, t dbSNP:772514096
8407 8407 g, t dbSNP:776435405
8425 8425 c, t dbSNP:761489341
8426 8426 a, c dbSNP:764906442
8430 8430 -, tg dbSNP:762585224
8431 8431 g, t dbSNP:749927655
8439 8439 c, t dbSNP:762839723
8448 8448 g, t dbSNP:766373206
8453 8453 a, g dbSNP:751405339
8464 8464 a, g dbSNP:541061019
8465 8465 c, g dbSNP:780901983
8469 8469 c, t dbSNP:752987335
8476 8476 a, g dbSNP:199675024
8484 8484 c, t dbSNP:377748543
8485 8485 a, g dbSNP:749352975
8487 8487 c, t dbSNP:770873055
8517 8517 c, t dbSNP:779493868
8518 8518 a, g dbSNP:370389657
8519 8519 -, c dbSNP:35869141
8537 8537 c, t dbSNP:772567355
8543 8543 c, t dbSNP:775992266
8546 8546 c, t dbSNP:761615916
8550 8550 a, c dbSNP:769540970
8551 8551 a, c dbSNP:772701511
8556 8556 a, c dbSNP:373293709
8560 8560 c, t dbSNP:765750865
8566 8566 c, t dbSNP:377485395
8567 8567 a, g, t dbSNP:370578585
8570 8570 a, c dbSNP:752471888
8573 8573 c, t dbSNP:199681302
8574 8574 a, g, t dbSNP:548176972
8582 8582 g, t dbSNP:757370273
8584 8584 c, t dbSNP:778790173
8585 8585 a, g dbSNP:569890011
8589 8589 a, g dbSNP:772693677
8591 8591 a, g dbSNP:780606137
8597 8597 a, c dbSNP:749753797
8599 8599 c, g dbSNP:747409318
8603 8603 c, t dbSNP:138179740
8604 8604 a, g dbSNP:530619835
8610 8610 c, t dbSNP:141224456
8611 8611 a, g dbSNP:554106070
8613 8613 c, t dbSNP:773723714
8614 8614 a, g, t dbSNP:759523264
8623 8623 a, c, g dbSNP:775363240
8632 8632 a, c dbSNP:763736870
8637 8637 c, g dbSNP:754092671
8648 8648 -, ag dbSNP:751584125
8648 8648 -, a dbSNP:761798044
8650 8650 c, g dbSNP:746792292
8654 8654 c, t dbSNP:570579608
8655 8655 a, g dbSNP:765414410
8657 8657 g, t dbSNP:750507989
8661 8661 c, g dbSNP:758513082
8673 8673 a, g dbSNP:780730679
8692 8692 c, t dbSNP:747462291
8705 8705 c, t dbSNP:755400663
8706 8706 a, g dbSNP:781408938
8710 8710 c, t dbSNP:749030562
8718 8718 a, g dbSNP:770472361
8740 8740 c, g dbSNP:773956907
8744 8744 c, t dbSNP:745409996
8768 8768 c, t dbSNP:771518606
8771 8771 c, t dbSNP:115428796
8780 8780 a, g dbSNP:371296750
8801 8801 c, t dbSNP:764014679
8802 8802 a, g dbSNP:776276340
8804 8804 g, t dbSNP:762145561
8807 8807 c, t dbSNP:374532854
8819 8819 c, t dbSNP:750624206
8833 8833 a, g dbSNP:758564292
8843 8843 c, t dbSNP:766498456
8852 8852 c, g dbSNP:752176283
8853 8853 a, c dbSNP:755424542
8854 8854 a, g dbSNP:546648359
8856 8856 c, t dbSNP:748426418
8860 8860 a, g dbSNP:11881304
8867 8867 c, t dbSNP:371191311
8870 8870 c, g dbSNP:554973700
8880 8880 g, t dbSNP:373738711
8881 8881 g, t dbSNP:367932670
8883 8883 a, g dbSNP:779537526
8884 8884 c, g dbSNP:747008772
8885 8885 -, g dbSNP:36092031
8888 8888 a, g dbSNP:768457030
8889 8889 c, g dbSNP:369099717
8900 8900 a, c dbSNP:576629405
8901 8901 a, g dbSNP:537269414
8906 8906 g, t dbSNP:559090398
8912 8912 a, g dbSNP:371666486
8921 8921 a, g dbSNP:773571688
8925 8925 c, t dbSNP:763261685
8926 8926 a, g dbSNP:766621187
8942 8942 c, t dbSNP:374681560
8950 8950 a, c, g dbSNP:61978610
8996 8996 a, g dbSNP:183763590
9000 9000 c, t dbSNP:201280861
9007 9007 a, g dbSNP:767936116
9020 9020 a, g dbSNP:574499016
9028 9028 c, t dbSNP:757289588
9029 9029 c, t dbSNP:186608346
9048 9048 a, g dbSNP:563454126
9049 9049 g, t dbSNP:530795840
9051 9051 a, c dbSNP:560397338
9083 9083 -, c dbSNP:34892701
9145 9145 c, t dbSNP:76737545
9172 9172 a, g dbSNP:759114641
9177 9177 c, t dbSNP:564254065
9178 9178 a, g dbSNP:113687701
9184 9184 c, t dbSNP:75698590
9210 9210 c, t dbSNP:750840417
9226 9226 a, c dbSNP:140158124
9236 9236 g, t dbSNP:568121750
9250 9250 a, g dbSNP:117510235
9276 9276 c, t dbSNP:7248473
9302 9302 c, t dbSNP:570269386
9336 9336 a, g dbSNP:373162589
9343 9343 c, g dbSNP:376937334
9351 9351 c, g dbSNP:775990752
9354 9354 c, t dbSNP:763401587
9378 9378 a, g dbSNP:370226063
9423 9423 a, c, t dbSNP:558770995
9424 9424 a, g dbSNP:191467722
9478 9478 a, g dbSNP:373032041
9501 9501 c, t dbSNP:751909099
9502 9502 c, t dbSNP:552646780
9545 9545 a, g dbSNP:149900703
9592 9592 c, t dbSNP:574844451
9633 9633 a, g dbSNP:541872835
9672 9672 a, g dbSNP:377660370
9678 9678 g, t dbSNP:749716595
9684 9684 c, t dbSNP:575478984
9807 9807 a, g dbSNP:769160949
9816 9816 c, t dbSNP:546077788
9858 9858 -, t dbSNP:34366582
9859 9859 a, t dbSNP:778666438
9861 9861 c, g dbSNP:564316984
9877 9877 a, g dbSNP:113078604
9887 9887 a, g dbSNP:750650081
9892 9892 a, g dbSNP:370554126
9898 9898 c, t dbSNP:546770607
9915 9915 c, t dbSNP:771648983
9916 9916 a, g dbSNP:561790570
9925 9925 a, c dbSNP:375170891
9940 9940 c, t dbSNP:772835295
9950 9950 c, t dbSNP:182796455
10000 10000 a, t dbSNP:550332688
10037 10037 c, t dbSNP:140796510
10038 10038 a, g dbSNP:186938488
10129 10129 a, g dbSNP:191355802
10137 10137 a, g dbSNP:145916665
10140 10140 a, g dbSNP:77151871
10162 10162 a, c dbSNP:553115010
10199 10199 g, t dbSNP:776268489
10221 10221 a, t dbSNP:759278149
10235 10235 -, g dbSNP:577151474
10249 10249 a, c dbSNP:568493542
10281 10281 a, t dbSNP:138454226
10294 10294 c, g dbSNP:765049885
10298 10298 c, t dbSNP:573912637
10333 10333 -, ac dbSNP:552289943
10337 10337 g, t dbSNP:751715293
10377 10377 a, g dbSNP:762039496
10384 10384 c, t dbSNP:575877475
10385 10385 a, g dbSNP:557124831
10418 10418 c, t dbSNP:28572784
10419 10419 c, t dbSNP:546182060
10420 10420 a, g dbSNP:564184424
10426 10426 g, t dbSNP:74859271
10439 10439 -, agg dbSNP:532261864
10466 10466 c, t dbSNP:533363078
10472 10472 a, g dbSNP:183496152
10476 10476 a, g dbSNP:750587106
10479 10479 g, t dbSNP:756551783
10487 10487 c, g dbSNP:540449918
10500 10500 c, t dbSNP:754424720
10520 10520 a, c dbSNP:561849817
10528 10528 c, t dbSNP:112456113
10555 10555 -, a dbSNP:568692440
10565 10565 a, g dbSNP:529025420
10590 10590 a, g dbSNP:540736478
10594 10594 a, g dbSNP:45444992
10621 10621 c, t dbSNP:11878207
10623 10623 a, g dbSNP:747786875
10625 10625 c, t dbSNP:187974955
10629 10629 a, g, t dbSNP:117935336
10649 10649 c, g dbSNP:528742107
10653 10653 c, g dbSNP:370185775
10661 10661 c, t dbSNP:372584932
10673 10673 c, t dbSNP:1053626
10690 10690 a, g dbSNP:377178491
10698 10698 a, g dbSNP:535619330
10711 10711 c, t dbSNP:2304211
10753 10753 c, g dbSNP:569208491
10756 10756 c, t dbSNP:1053629
10772 10772 c, t dbSNP:1053630
10778 10778 c, g dbSNP:539863017
10794 10794 c, t dbSNP:746840377
10824 10824 c, g dbSNP:11878297
10830 10830 a, c dbSNP:746756031
10847 10847 c, t dbSNP:753203310
10848 10848 a, g dbSNP:573210106
10850 10850 g, t dbSNP:778047779
10870 10870 g, t dbSNP:750145356
10873 10873 c, t dbSNP:758033957
10874 10874 -, a dbSNP:753002699
10875 10875 -, a dbSNP:3214618
10894 10894 a, c, g dbSNP:1053632
10898 10898 c, t dbSNP:2304210
10911 10911 a, g dbSNP:143324344
10914 10914 -, aga dbSNP:750184867
10966 10966 a, g dbSNP:573788678

Target ORF information:

RefSeq Version NM_001410
Organism Homo sapiens (human)
Definition Homo sapiens multiple EGF-like-domains 8 (MEGF8), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu28635
Accession Version NM_001271938.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 8538bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product multiple epidermal growth factor-like domains protein 8 isoform 1 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC153880.1, AY280362.1 and AC011497.6. Summary: The protein encoded by this gene is a single-pass type I membrane protein of unknown function that contains several EGF-like domains, Kelch repeats, and PSI domains. Defects in this gene are a cause of Carpenter syndrome 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]. Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMEA1968832, SAMEA1968968 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)612..614(+)
Misc Feature(2)780..1052(+)
Misc Feature(3)846..1052(+)
Misc Feature(4)1317..1460(+)
Misc Feature(5)1353..1493(+)
Misc Feature(6)1356..1496(+)
Misc Feature(7)1470..1628(+)
Misc Feature(8)1503..1649(+)
Misc Feature(9)1635..1718(+)
Misc Feature(10)1671..1832(+)
Misc Feature(11)1839..1994(+)
Misc Feature(12)1842..1967(+)
Misc Feature(13)1977..2165(+)
Misc Feature(14)2010..2168(+)
Misc Feature(15)2208..2360(+)
Misc Feature(16)3855..3962(+)
Misc Feature(17)3855..3914(+)
Misc Feature(18)4263..4412(+)
Misc Feature(19)4266..4361(+)
Misc Feature(20)5199..5345(+)
Misc Feature(21)5328..5459(+)
Misc Feature(22)5331..5471(+)
Misc Feature(23)5373..5513(+)
Misc Feature(24)5493..5642(+)
Misc Feature(25)5523..5675(+)
Misc Feature(26)5529..5672(+)
Misc Feature(27)5649..5795(+)
Misc Feature(28)5688..5840(+)
Misc Feature(29)5985..6104(+)
Misc Feature(30)5988..6149(+)
Misc Feature(31)6021..6164(+)
Misc Feature(32)6189..6329(+)
Misc Feature(33)8577..8639(+)
Exon (1)1..822
Gene Synonym:
Exon (2)823..986
Gene Synonym:
Exon (3)987..1193
Gene Synonym:
Exon (4)1194..1374
Gene Synonym:
Exon (5)1375..1463
Gene Synonym:
Exon (6)1464..1879
Gene Synonym:
Exon (7)1880..2025
Gene Synonym:
Exon (8)2026..2148
Gene Synonym:
Exon (9)2149..2303
Gene Synonym:
Exon (10)2304..2423
Gene Synonym:
Exon (11)2424..2568
Gene Synonym:
Exon (12)2569..2732
Gene Synonym:
Exon (13)2733..2933
Gene Synonym:
Exon (14)2934..3134
Gene Synonym:
Exon (15)3135..3371
Gene Synonym:
Exon (16)3372..3490
Gene Synonym:
Exon (17)3491..3622
Gene Synonym:
Exon (18)3623..3736
Gene Synonym:
Exon (19)3737..3985
Gene Synonym:
Exon (20)3986..4185
Gene Synonym:
Exon (21)4186..4396
Gene Synonym:
Exon (22)4397..4646
Gene Synonym:
Exon (23)4647..4779
Gene Synonym:
Exon (24)4780..5027
Gene Synonym:
Exon (25)5028..5138
Gene Synonym:
Exon (26)5139..5257
Gene Synonym:
Exon (27)5258..5465
Gene Synonym:
Exon (28)5466..5646
Gene Synonym:
Exon (29)5647..5810
Gene Synonym:
Exon (30)5811..5978
Gene Synonym:
Exon (31)5979..6123
Gene Synonym:
Exon (32)6124..6355
Gene Synonym:
Exon (33)6356..6479
Gene Synonym:
Exon (34)6480..6693
Gene Synonym:
Exon (35)6694..6908
Gene Synonym:
Exon (36)6909..7116
Gene Synonym:
Exon (37)7117..7276
Gene Synonym:
Exon (38)7277..7469
Gene Synonym:
Exon (39)7470..7640
Gene Synonym:
Exon (40)7641..7771
Gene Synonym:
Exon (41)7772..7904
Gene Synonym:
Exon (42)7905..11167
Gene Synonym:
Position Chain Variation Link
18 18 c, g dbSNP:779923290
19 19 a, g dbSNP:569756504
21 21 c, g dbSNP:537210098
32 32 g, t dbSNP:769784382
48 48 c, t dbSNP:775136717
61 61 a, g dbSNP:558410127
65 65 a, g dbSNP:71361013
139 139 a, g dbSNP:762909843
142 142 c, t dbSNP:570210510
193 193 g, t dbSNP:373999413
273 273 a, g dbSNP:377656252
289 289 c, t dbSNP:552562873
358 358 a, g dbSNP:77483366
386 386 c, t dbSNP:542953536
465 465 a, g dbSNP:773602097
477 477 a, t dbSNP:111536758
486 486 -, g dbSNP:34768812
503 503 c, t dbSNP:576597076
504 504 c, g dbSNP:370533137
509 509 c, t dbSNP:184902062
521 521 c, t dbSNP:543990131
540 540 c, t dbSNP:552665692
580 580 c, t dbSNP:565404145
591 591 c, t dbSNP:762981124
592 592 c, t dbSNP:766439490
598 598 a, g dbSNP:774894940
599 599 a, c dbSNP:201236933
602 602 a, g dbSNP:767873043
605 605 c, t dbSNP:752965495
607 607 a, c dbSNP:761549703
609 609 a, c dbSNP:764849283
613 613 a, c, g dbSNP:750061301
620 620 a, g dbSNP:779700424
625 625 a, c dbSNP:751559172
635 635 a, g dbSNP:754900851
642 642 c, t dbSNP:371769004
664 664 c, t dbSNP:559809654
669 669 c, g dbSNP:769597326
683 683 a, c dbSNP:777922711
684 684 c, g dbSNP:749510496
694 694 c, t dbSNP:530058933
699 699 c, t dbSNP:771011541
703 703 c, t dbSNP:774347513
705 705 c, g dbSNP:760067083
712 712 a, g, t dbSNP:377001753
714 714 a, g dbSNP:760987793
716 716 g, t dbSNP:764516595
720 720 a, g, t dbSNP:750104104
721 721 a, t dbSNP:765996558
730 730 a, g dbSNP:751060296
739 739 a, g dbSNP:754511848
742 742 g, t dbSNP:781027989
748 748 c, g dbSNP:752669700
756 756 c, t dbSNP:755931805
765 765 g, t dbSNP:777559070
778 778 c, t dbSNP:749526205
792 792 a, g dbSNP:761004605
799 799 c, g dbSNP:771093365
807 807 a, g dbSNP:778995883
814 814 a, t dbSNP:745986905
825 825 c, g dbSNP:758472569
828 828 a, g dbSNP:780112441
830 830 a, c dbSNP:536773914
840 840 c, t dbSNP:769153746
841 841 a, g dbSNP:777251009
869 869 c, t dbSNP:377231910
880 880 c, t dbSNP:748576204
881 881 a, g, t dbSNP:369259465
887 887 c, t dbSNP:773609400
896 896 c, t dbSNP:370064427
897 897 a, g dbSNP:372955721
905 905 c, t dbSNP:376175890
906 906 a, g dbSNP:369362097
909 909 a, g dbSNP:764131985
911 911 c, t dbSNP:753751733
913 913 c, g dbSNP:200910137
916 916 c, t dbSNP:570125469
918 918 c, t dbSNP:376057779
919 919 a, g dbSNP:758585947
921 921 g, t dbSNP:370744518
922 922 a, c, g dbSNP:780016069
924 924 a, c, g dbSNP:754995245
925 925 c, t dbSNP:748664087
926 926 a, g, t dbSNP:374407078
933 933 a, g dbSNP:745530684
941 941 a, g dbSNP:771715982
954 954 c, t dbSNP:774975242
955 955 a, g dbSNP:760280227
958 958 c, t dbSNP:201353508
961 961 a, c, t dbSNP:768036287
962 962 a, g dbSNP:761669548
963 963 a, c dbSNP:183986572
968 968 c, t dbSNP:371108976
969 969 a, g dbSNP:763111888
971 971 a, c dbSNP:766677631