Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND


EGFR epidermal growth factor receptor [Homo sapiens (human)]

Gene Symbol EGFR
Entrez Gene ID 1956
Full Name epidermal growth factor receptor
Synonyms ERBB, ERBB1, HER1, NISBD2, PIG61, mENA
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

7

7p12

Summary The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. Multiple alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2010]. lac of sum
Disorder MIM:

131550

Disorder Html: Nonsmall cell lung cancer, response to tyrosine kinase inhibitor in,
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu25365 NM_201282 Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu25409 NM_201283 Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu25398 NM_201284 Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 4, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu25437 NM_005228 Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK In stock 16 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.



CloneID OHu25365D
Sequence Information ORF Nucleotide Sequence (Length: 1887bp)
Protein sequence
SNP
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product epidermal growth factor receptor isoform b precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AW163038.1, X00588.1, AF125253.1 and AF277897.1. Summary: The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. Multiple alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2010]. Transcript Variant: This variant (2) uses a different 3' terminal exon when compared to variant 1. The resulting isoform (b) has a shorter and distinct C-terminus. Only the extracellular domain is present in isoform b. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support SAMEA1968189, SAMEA1968540 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
ATGCGACCCT CCGGGACGGC CGGGGCAGCG CTCCTGGCGC TGCTGGCTGC GCTCTGCCCG 
GCGAGTCGGG CTCTGGAGGA AAAGAAAGTT TGCCAAGGCA CGAGTAACAA GCTCACGCAG
TTGGGCACTT TTGAAGATCA TTTTCTCAGC CTCCAGAGGA TGTTCAATAA CTGTGAGGTG
GTCCTTGGGA ATTTGGAAAT TACCTATGTG CAGAGGAATT ATGATCTTTC CTTCTTAAAG
ACCATCCAGG AGGTGGCTGG TTATGTCCTC ATTGCCCTCA ACACAGTGGA GCGAATTCCT
TTGGAAAACC TGCAGATCAT CAGAGGAAAT ATGTACTACG AAAATTCCTA TGCCTTAGCA
GTCTTATCTA ACTATGATGC AAATAAAACC GGACTGAAGG AGCTGCCCAT GAGAAATTTA
CAGGAAATCC TGCATGGCGC CGTGCGGTTC AGCAACAACC CTGCCCTGTG CAACGTGGAG
AGCATCCAGT GGCGGGACAT AGTCAGCAGT GACTTTCTCA GCAACATGTC GATGGACTTC
CAGAACCACC TGGGCAGCTG CCAAAAGTGT GATCCAAGCT GTCCCAATGG GAGCTGCTGG
GGTGCAGGAG AGGAGAACTG CCAGAAACTG ACCAAAATCA TCTGTGCCCA GCAGTGCTCC
GGGCGCTGCC GTGGCAAGTC CCCCAGTGAC TGCTGCCACA ACCAGTGTGC TGCAGGCTGC
ACAGGCCCCC GGGAGAGCGA CTGCCTGGTC TGCCGCAAAT TCCGAGACGA AGCCACGTGC
AAGGACACCT GCCCCCCACT CATGCTCTAC AACCCCACCA CGTACCAGAT GGATGTGAAC
CCCGAGGGCA AATACAGCTT TGGTGCCACC TGCGTGAAGA AGTGTCCCCG TAATTATGTG
GTGACAGATC ACGGCTCGTG CGTCCGAGCC TGTGGGGCCG ACAGCTATGA GATGGAGGAA
GACGGCGTCC GCAAGTGTAA GAAGTGCGAA GGGCCTTGCC GCAAAGTGTG TAACGGAATA
GGTATTGGTG AATTTAAAGA CTCACTCTCC ATAAATGCTA CGAATATTAA ACACTTCAAA
AACTGCACCT CCATCAGTGG CGATCTCCAC ATCCTGCCGG TGGCATTTAG GGGTGACTCC
TTCACACATA CTCCTCCTCT GGATCCACAG GAACTGGATA TTCTGAAAAC CGTAAAGGAA
ATCACAGGGT TTTTGCTGAT TCAGGCTTGG CCTGAAAACA GGACGGACCT CCATGCCTTT
GAGAACCTAG AAATCATACG CGGCAGGACC AAGCAACATG GTCAGTTTTC TCTTGCAGTC
GTCAGCCTGA ACATAACATC CTTGGGATTA CGCTCCCTCA AGGAGATAAG TGATGGAGAT
GTGATAATTT CAGGAAACAA AAATTTGTGC TATGCAAATA CAATAAACTG GAAAAAACTG
TTTGGGACCT CCGGTCAGAA AACCAAAATT ATAAGCAACA GAGGTGAAAA CAGCTGCAAG
GCCACAGGCC AGGTCTGCCA TGCCTTGTGC TCCCCCGAGG GCTGCTGGGG CCCGGAGCCC
AGGGACTGCG TCTCTTGCCG GAATGTCAGC CGAGGCAGGG AATGCGTGGA CAAGTGCAAC
CTTCTGGAGG GTGAGCCAAG GGAGTTTGTG GAGAACTCTG AGTGCATACA GTGCCACCCA
GAGTGCCTGC CTCAGGCCAT GAACATCACC TGCACAGGAC GGGGACCAGA CAACTGTATC
CAGTGTGCCC ACTACATTGA CGGCCCCCAC TGCGTCAAGA CCTGCCCGGC AGGAGTCATG
GGAGAAAACA ACACCCTGGT CTGGAAGTAC GCAGACGCCG GCCATGTGTG CCACCTGTGC
CATCCAAACT GCACCTACGG GTCCTAA
The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
RefSeqNP_958439.1
CDS247..2133
Misc Feature(1)208..210(+)
Misc Feature(2)337..420(+)
Misc Feature(3)412..414(+)
Misc Feature(4)415..750(+)
Misc Feature(5)469..1146(+)
Misc Feature(6)628..630(+)
Misc Feature(7)715..807(+)
Misc Feature(8)769..771(+)
Misc Feature(9)799..1257(+)
Misc Feature(10)814..843(+)
Misc Feature(11)826..867(+)
Misc Feature(12)832..834(+)
Misc Feature(13)889..915(+)
Misc Feature(14)901..939(+)
Misc Feature(15)931..933(+)
Misc Feature(16)937..1068(+)
Misc Feature(17)940..966(+)
Misc Feature(18)952..990(+)
Misc Feature(19)997..1026(+)
Misc Feature(20)1036..1119(+)
Misc Feature(21)1129..1167(+)
Misc Feature(22)1177..1224(+)
Misc Feature(23)1231..1245(+)
Misc Feature(24)1255..1332(+)
Misc Feature(25)1300..1302(+)
Misc Feature(26)1327..1689(+)
Misc Feature(27)1327..1329(+)
Misc Feature(28)1414..2046(+)
Misc Feature(29)1483..1485(+)
Misc Feature(30)1576..1578(+)
Misc Feature(31)1654..1743(+)
Misc Feature(32)1759..2127(+)
Misc Feature(33)1762..1923(+)
Misc Feature(34)1762..1791(+)
Misc Feature(35)1774..1815(+)
Misc Feature(36)1822..1851(+)
Misc Feature(37)1828..1830(+)
Misc Feature(38)1861..1911(+)
Misc Feature(39)1918..>2040(+)
Misc Feature(40)1918..1959(+)
Misc Feature(41)1930..1983(+)
Misc Feature(42)1948..1950(+)
Misc Feature(43)1990..2019(+)
Misc Feature(44)2029..2097(+)
Misc Feature(45)2053..2055(+)
Misc Feature(46)2113..2115(+)
Exon (1)1..334
Gene:EGFR
Gene Synonym:
Exon (2)335..486
Gene:EGFR
Gene Synonym:
Exon (3)487..670
Gene:EGFR
Gene Synonym:
Exon (4)671..805
Gene:EGFR
Gene Synonym:
Exon (5)806..874
Gene:EGFR
Gene Synonym:
Exon (6)875..993
Gene:EGFR
Gene Synonym:
Exon (7)994..1135
Gene:EGFR
Gene Synonym:
Exon (8)1136..1252
Gene:EGFR
Gene Synonym:
Exon (9)1253..1379
Gene:EGFR
Gene Synonym:
Exon (10)1380..1453
Gene:EGFR
Gene Synonym:
Exon (11)1454..1544
Gene:EGFR
Gene Synonym:
Exon (12)1545..1744
Gene:EGFR
Gene Synonym:
Exon (13)1745..1877
Gene:EGFR
Gene Synonym:
Exon (14)1878..1968
Gene:EGFR
Gene Synonym:
Exon (15)1969..2126
Gene:EGFR
Gene Synonym:
Exon (16)2127..2239
Gene:EGFR
Gene Synonym:
Translation
Position Chain Variation Link
31 31 g, t dbSNP:712829
37 37 c, t dbSNP:566284155
56 56 a, c dbSNP:712830
113 113 c, t dbSNP:551488510
171 171 c, t dbSNP:570107879
178 178 c, t dbSNP:537165657
184 184 c, g dbSNP:555477367
203 203 a, t dbSNP:17288945
209 209 g, t dbSNP:746536427
215 215 c, g, t dbSNP:375923119
226 226 c, t dbSNP:781240283
244 244 a, g dbSNP:748159429
245 245 c, t dbSNP:769658183
253 253 a, c dbSNP:773069229
254 254 c, t dbSNP:749433287
257 257 c, t dbSNP:771210838
259 259 c, g dbSNP:774487133
260 260 a, g dbSNP:759582787
262 262 a, g dbSNP:767651648
264 264 c, g dbSNP:775964175
265 265 c, g, t dbSNP:761183109
267 267 c, t dbSNP:369581368
268 268 a, g dbSNP:754259847
276 276 g, t dbSNP:757936561
279 279 c, t dbSNP:766029589
284 284 c, t dbSNP:567894670
298 298 c, t dbSNP:754527029
302 302 c, g dbSNP:780865931
307 307 a, g, t dbSNP:373129709
324 324 a, g dbSNP:777385414
328 328 a, g dbSNP:749088691
330 330 a, g dbSNP:770673046
332 332 a, c dbSNP:774551548
339 339 c, t dbSNP:372917131
341 341 a, g dbSNP:746023542
343 343 a, g dbSNP:772311777
347 347 c, g dbSNP:144158123
348 348 a, g, t dbSNP:148679319
362 362 c, t dbSNP:375919121
363 363 a, g dbSNP:777186292
367 367 c, t dbSNP:762281800
373 373 a, g dbSNP:147740818
396 396 c, t dbSNP:770133522
399 399 c, t dbSNP:773745636
404 404 a, g dbSNP:759219499
413 413 a, g dbSNP:767259994
420 420 c, t dbSNP:752438083
421 421 a, g dbSNP:760228905
422 422 a, c dbSNP:763572530
458 458 a, g dbSNP:369580836
468 468 c, t dbSNP:200383389
472 472 a, c dbSNP:778638117
477 477 c, g dbSNP:61731794
487 487 a, g dbSNP:374986786
496 496 a, c, g dbSNP:753319070
509 509 a, g dbSNP:765137528
514 514 c, t dbSNP:750399097
515 515 a, t dbSNP:142061256
521 521 c, t dbSNP:779879611
529 529 a, c dbSNP:35515689
534 534 a, g dbSNP:751744275
535 535 c, g dbSNP:755189573
539 539 a, g, t dbSNP:17289589
545 545 a, c dbSNP:376963968
556 556 c, t dbSNP:756305742
561 561 a, c, g dbSNP:141271101
562 562 a, g dbSNP:771366736
572 572 c, g dbSNP:145113601
578 578 c, t dbSNP:746631025
585 585 c, t dbSNP:374582814
591 591 a, t dbSNP:773596817
600 600 c, t dbSNP:147726446
618 618 c, t dbSNP:142553829
625 625 a, g dbSNP:377444977
632 632 a, c dbSNP:762889647
636 636 c, t dbSNP:766093262
646 646 a, g dbSNP:751337426
655 655 a, g dbSNP:754854319
669 669 g, t dbSNP:767608234
680 680 a, g dbSNP:780476417
684 684 c, g, t dbSNP:199637112
685 685 a, g dbSNP:532655845
687 687 c, g, t dbSNP:138946543
691 691 c, t dbSNP:774146556
692 692 a, g dbSNP:759532524
701 701 a, g dbSNP:551591429
714 714 a, g, t dbSNP:149006234
720 720 c, t dbSNP:2072454
739 739 c, t dbSNP:587778252
740 740 a, g dbSNP:761795138
746 746 c, t dbSNP:765416003
748 748 c, g dbSNP:530692924
755 755 a, g, t dbSNP:758945260
759 759 a, c, t dbSNP:17289686
765 765 c, t dbSNP:777401847
771 771 c, t dbSNP:749002473
776 776 c, t dbSNP:770290445
777 777 a, g dbSNP:17336437
780 780 a, g dbSNP:745755245
793 793 a, c, g dbSNP:772071414
804 804 c, t dbSNP:375037710
807 807 c, t dbSNP:776568205
813 813 a, g dbSNP:748275089
820 820 a, c dbSNP:770074413
825 825 c, t dbSNP:773349388
828 828 c, t dbSNP:763086693
833 833 a, g dbSNP:766507267
840 840 c, t dbSNP:370376501
852 852 a, c dbSNP:748320322
856 856 a, g dbSNP:767829342
870 870 a, g dbSNP:753129657
878 878 c, g dbSNP:779156097
879 879 c, t dbSNP:373970245
880 880 a, c dbSNP:750423932
900 900 g, t dbSNP:776050604
904 904 c, t dbSNP:761098433
906 906 c, t dbSNP:45621033
907 907 a, g, t dbSNP:776886714
909 909 a, g dbSNP:766104143
911 911 a, g dbSNP:751295137
917 917 a, g dbSNP:759106015
921 921 -, c dbSNP:145506643
925 925 c, t dbSNP:766952405
929 929 a, c dbSNP:752616839
937 937 g, t dbSNP:756040606
938 938 c, g dbSNP:777575581
945 945 c, t dbSNP:763962907
968 968 c, t dbSNP:370744986
972 972 c, g, t dbSNP:374561933
976 976 c, t dbSNP:554981236
977 977 a, g dbSNP:200664836
984 984 c, t dbSNP:772130986
985 985 a, c, g dbSNP:780001754
992 992 c, t dbSNP:765893589
1000 1000 c, g dbSNP:775252718
1001 1001 a, g dbSNP:760101437
1004 1004 a, g dbSNP:374084791
1009 1009 c, t dbSNP:776490661
1010 1010 a, g dbSNP:372202099
1014 1014 c, t dbSNP:146098757
1015 1015 a, g dbSNP:138847501
1020 1020 c, t dbSNP:142569931
1022 1022 c, t dbSNP:766478921
1023 1023 a, g dbSNP:751873368
1032 1032 c, t dbSNP:754997451
1038 1038 c, t dbSNP:781427942
1040 1040 a, c dbSNP:748627278
1043 1043 a, c, g dbSNP:17336639
1068 1068 a, g dbSNP:749588554
1073 1073 a, g dbSNP:771396903
1080 1080 c, t dbSNP:774995708
1089 1089 c, t dbSNP:746685847
1090 1090 a, g dbSNP:199796955
1099 1099 c, t dbSNP:776146284
1107 1107 c, t dbSNP:761685805
1111 1111 a, g dbSNP:769696078
1112 1112 c, t dbSNP:149840192
1119 1119 c, t dbSNP:570790705
1120 1120 a, g dbSNP:150549265
1121 1121 c, t dbSNP:762649354
1125 1125 a, g dbSNP:766252686
1135 1135 c, t dbSNP:751667358
1147 1147 g, t dbSNP:779094647
1158 1158 a, c, t dbSNP:182002674
1161 1161 a, c, t dbSNP:566001525
1164 1164 a, c, g dbSNP:202182545
1167 1167 c, t dbSNP:17289893
1168 1168 a, g dbSNP:749132706
1181 1181 c, g dbSNP:770879879
1184 1184 c, t dbSNP:149321481
1186 1186 a, g dbSNP:552062864
1190 1190 a, g dbSNP:745658347
1191 1191 c, t dbSNP:772053702
1200 1200 g, t dbSNP:775800262
1206 1206 a, g dbSNP:760984499
1209 1209 c, t dbSNP:764038041
1210 1210 a, g dbSNP:776791214
1213 1213 a, g dbSNP:761844164
1214 1214 c, t dbSNP:367680488
1215 1215 a, c dbSNP:201040971
1217 1217 a, g dbSNP:758748662
1219 1219 a, c dbSNP:766740458
1221 1221 a, g dbSNP:752278049
1228 1228 a, c dbSNP:144460286
1231 1231 c, t dbSNP:777342222
1233 1233 c, t dbSNP:748801348
1234 1234 a, g dbSNP:139429793
1235 1235 a, g, t dbSNP:778901010
1247 1247 a, g dbSNP:771929085
1274 1274 g, t dbSNP:771398183
1275 1275 c, t dbSNP:774905136
1289 1289 c, t dbSNP:371234907
1293 1293 c, g dbSNP:759932677
1297 1297 a, g dbSNP:767790289
1307 1307 c, t dbSNP:753466844
1332 1332 c, t dbSNP:547057636
1347 1347 c, t dbSNP:185327606
1348 1348 c, g dbSNP:749927550
1349 1349 a, t dbSNP:758017949
1351 1351 a, c dbSNP:780131926
1356 1356 c, t dbSNP:539077864
1365 1365 a, g dbSNP:2302536
1371 1371 a, c dbSNP:780851909
1393 1393 a, c dbSNP:755972013
1413 1413 a, g dbSNP:777959179
1420 1420 c, t dbSNP:749526261
1423 1423 c, g dbSNP:587778246
1438 1438 a, g dbSNP:757265130
1456 1456 a, t dbSNP:777165081
1461 1461 a, g dbSNP:748900962
1484 1484 a, g dbSNP:770466526
1491 1491 g, t dbSNP:774121381
1494 1494 c, g dbSNP:758956103
1497 1497 a, c, t dbSNP:767070097
1507 1507 a, g dbSNP:760639592
1515 1515 a, g dbSNP:763830096
1519 1519 a, g dbSNP:558565565
1522 1522 a, g dbSNP:201364864
1527 1527 c, t dbSNP:367896493
1529 1529 a, g dbSNP:606231253
1535 1535 a, c dbSNP:765369188
1544 1544 a, g dbSNP:750713244
1563 1563 a, g dbSNP:17290005
1566 1566 c, t dbSNP:761495014
1571 1571 a, g dbSNP:765091640
1579 1579 a, g dbSNP:372990493
1588 1588 c, t dbSNP:750541010
1590 1590 a, c, g dbSNP:763266323
1597 1597 c, t dbSNP:377567759
1598 1598 a, g dbSNP:751667594
1617 1617 c, t dbSNP:755147377
1620 1620 c, g, t dbSNP:146711874
1624 1624 a, g dbSNP:753269876
1628 1628 c, t dbSNP:200592648
1636 1636 a, g, t dbSNP:746763556
1641 1641 a, c dbSNP:199754312
1659 1659 c, t dbSNP:771736232
1668 1668 a, c dbSNP:779726192
1673 1673 a, g dbSNP:746521110
1683 1683 a, c dbSNP:768208443
1684 1684 c, t dbSNP:147732025
1689 1689 g, t dbSNP:587778247
1698 1698 c, t dbSNP:568681121
1699 1699 a, g dbSNP:769434273
1710 1710 a, c dbSNP:773079786
1716 1716 a, t dbSNP:762704534
1717 1717 a, g dbSNP:768500612
1730 1730 a, g dbSNP:766676440
1737 1737 c, t dbSNP:774773441
1753 1753 a, g dbSNP:760711480
1755 1755 c, t dbSNP:17336800
1778 1778 a, c dbSNP:371114444
1780 1780 c, t dbSNP:587778248
1782 1782 a, c, t dbSNP:374670788
1783 1783 a, g, t dbSNP:754646330
1798 1798 c, t dbSNP:368484180
1799 1799 c, t dbSNP:564398642
1800 1800 a, g dbSNP:142429250
1802 1802 a, g dbSNP:749186957
1803 1803 g, t dbSNP:116057045
1808 1808 a, c, g, t dbSNP:2227983
1809 1809 a, g dbSNP:745709532
1815 1815 c, t dbSNP:761127339
1816 1816 a, g dbSNP:587778249
1818 1818 c, t dbSNP:760800224
1825 1825 c, t dbSNP:768627073
1826 1826 a, g dbSNP:150477666
1828 1828 a, g dbSNP:762336338
1830 1830 c, t dbSNP:765534683
1848 1848 a, g dbSNP:529355260
1851 1851 c, t dbSNP:763346690
1852 1852 a, g dbSNP:767193132
1853 1853 c, t dbSNP:752350337
1876 1876 a, g dbSNP:755584255
1877 1877 a, g dbSNP:764356379
1878 1878 c, t dbSNP:17290103
1879 1879 a, g dbSNP:778985185
1893 1893 c, t dbSNP:750403646
1902 1902 c, t dbSNP:758141603
1907 1907 a, g dbSNP:779741928
1914 1914 a, g dbSNP:747203424
1917 1917 a, g dbSNP:768735314
1920 1920 c, t dbSNP:781514400
1924 1924 a, c dbSNP:748219780
1927 1927 c, g dbSNP:769918274
1933 1933 c, t dbSNP:775394093
1936 1936 a, c, t dbSNP:773651001
1945 1945 a, g dbSNP:771278492
1955 1955 c, g dbSNP:774558548
1961 1961 c, g dbSNP:759987693
1966 1966 c, t dbSNP:760471492
1967 1967 a, g dbSNP:370810719
1974 1974 a, t dbSNP:538447477
1979 1979 a, g dbSNP:556794990
1983 1983 c, t dbSNP:776359891
1985 1985 c, t dbSNP:761585117
1987 1987 a, c dbSNP:764787649
1995 1995 c, t dbSNP:141232284
2003 2003 c, t dbSNP:542237406
2007 2007 c, t dbSNP:766220964
2012 2012 a, c dbSNP:751570775
2013 2013 c, t dbSNP:754671343
2019 2019 c, t dbSNP:767304301
2020 2020 a, g dbSNP:144943614
2021 2021 c, t dbSNP:28384375
2023 2023 a, c dbSNP:371483915
2025 2025 c, g dbSNP:756307243
2027 2027 a, c dbSNP:778011429
2034 2034 a, g dbSNP:17290162
2035 2035 g, t dbSNP:757419349
2039 2039 g, t dbSNP:139236063
2044 2044 a, g, t dbSNP:746395542
2045 2045 c, t dbSNP:149375515
2048 2048 a, g dbSNP:201498575
2052 2052 a, g dbSNP:747423535
2055 2055 c, t dbSNP:769537072
2058 2058 c, t dbSNP:773064203
2062 2062 c, g dbSNP:143152775
2064 2064 a, g, t dbSNP:148242307
2067 2067 c, t dbSNP:377048120
2076 2076 c, t dbSNP:115350205
2077 2077 a, g dbSNP:201061916
2082 2082 c, t dbSNP:150803480
2083 2083 a, g dbSNP:764290273
2085 2085 a, c, t dbSNP:17290169
2086 2086 a, g dbSNP:779076899
2087 2087 a, g dbSNP:750850720
2093 2093 c, t dbSNP:756534868
2097 2097 c, t dbSNP:143422127
2105 2105 a, g dbSNP:150899403
2113 2113 a, t dbSNP:747376358
2117 2117 g, t dbSNP:28384376
2118 2118 c, t dbSNP:769203592
2124 2124 c, t dbSNP:533525993
2125 2125 a, g dbSNP:753315940
2133 2133 a, g dbSNP:763070862
2145 2145 c, t dbSNP:766573897
2146 2146 a, g dbSNP:752073858
2147 2147 c, t dbSNP:755564991
2150 2150 a, g dbSNP:767948457
2151 2151 a, t dbSNP:561485334
2155 2155 c, t dbSNP:756492455
2161 2161 a, c dbSNP:528886309
2168 2168 a, c dbSNP:140321332
2173 2173 a, g dbSNP:757860312
2176 2176 c, t dbSNP:199683814
2180 2180 c, t dbSNP:746567781
2220 2220 c, t dbSNP:758575919

Target ORF information:

RefSeq Version NM_201282
Organism Homo sapiens (human)
Definition Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 2, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK
NM_201282

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
ATGCGACCCT CCGGGACGGC CGGGGCAGCG CTCCTGGCGC TGCTGGCTGC GCTCTGCCCG 
GCGAGTCGGG CTCTGGAGGA AAAGAAAGTT TGCCAAGGCA CGAGTAACAA GCTCACGCAG
TTGGGCACTT TTGAAGATCA TTTTCTCAGC CTCCAGAGGA TGTTCAATAA CTGTGAGGTG
GTCCTTGGGA ATTTGGAAAT TACCTATGTG CAGAGGAATT ATGATCTTTC CTTCTTAAAG
ACCATCCAGG AGGTGGCTGG TTATGTCCTC ATTGCCCTCA ACACAGTGGA GCGAATTCCT
TTGGAAAACC TGCAGATCAT CAGAGGAAAT ATGTACTACG AAAATTCCTA TGCCTTAGCA
GTCTTATCTA ACTATGATGC AAATAAAACC GGACTGAAGG AGCTGCCCAT GAGAAATTTA
CAGGAAATCC TGCATGGCGC CGTGCGGTTC AGCAACAACC CTGCCCTGTG CAACGTGGAG
AGCATCCAGT GGCGGGACAT AGTCAGCAGT GACTTTCTCA GCAACATGTC GATGGACTTC
CAGAACCACC TGGGCAGCTG CCAAAAGTGT GATCCAAGCT GTCCCAATGG GAGCTGCTGG
GGTGCAGGAG AGGAGAACTG CCAGAAACTG ACCAAAATCA TCTGTGCCCA GCAGTGCTCC
GGGCGCTGCC GTGGCAAGTC CCCCAGTGAC TGCTGCCACA ACCAGTGTGC TGCAGGCTGC
ACAGGCCCCC GGGAGAGCGA CTGCCTGGTC TGCCGCAAAT TCCGAGACGA AGCCACGTGC
AAGGACACCT GCCCCCCACT CATGCTCTAC AACCCCACCA CGTACCAGAT GGATGTGAAC
CCCGAGGGCA AATACAGCTT TGGTGCCACC TGCGTGAAGA AGTGTCCCCG TAATTATGTG
GTGACAGATC ACGGCTCGTG CGTCCGAGCC TGTGGGGCCG ACAGCTATGA GATGGAGGAA
GACGGCGTCC GCAAGTGTAA GAAGTGCGAA GGGCCTTGCC GCAAAGTGTG TAACGGAATA
GGTATTGGTG AATTTAAAGA CTCACTCTCC ATAAATGCTA CGAATATTAA ACACTTCAAA
AACTGCACCT CCATCAGTGG CGATCTCCAC ATCCTGCCGG TGGCATTTAG GGGTGACTCC
TTCACACATA CTCCTCCTCT GGATCCACAG GAACTGGATA TTCTGAAAAC CGTAAAGGAA
ATCACAGGGT TTTTGCTGAT TCAGGCTTGG CCTGAAAACA GGACGGACCT CCATGCCTTT
GAGAACCTAG AAATCATACG CGGCAGGACC AAGCAACATG GTCAGTTTTC TCTTGCAGTC
GTCAGCCTGA ACATAACATC CTTGGGATTA CGCTCCCTCA AGGAGATAAG TGATGGAGAT
GTGATAATTT CAGGAAACAA AAATTTGTGC TATGCAAATA CAATAAACTG GAAAAAACTG
TTTGGGACCT CCGGTCAGAA AACCAAAATT ATAAGCAACA GAGGTGAAAA CAGCTGCAAG
GCCACAGGCC AGGTCTGCCA TGCCTTGTGC TCCCCCGAGG GCTGCTGGGG CCCGGAGCCC
AGGGACTGCG TCTCTTGCCG GAATGTCAGC CGAGGCAGGG AATGCGTGGA CAAGTGCAAC
CTTCTGGAGG GTGAGCCAAG GGAGTTTGTG GAGAACTCTG AGTGCATACA GTGCCACCCA
GAGTGCCTGC CTCAGGCCAT GAACATCACC TGCACAGGAC GGGGACCAGA CAACTGTATC
CAGTGTGCCC ACTACATTGA CGGCCCCCAC TGCGTCAAGA CCTGCCCGGC AGGAGTCATG
GGAGAAAACA ACACCCTGGT CTGGAAGTAC GCAGACGCCG GCCATGTGTG CCACCTGTGC
CATCCAAACT GCACCTACGG GTCCTAA

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.


CloneID OHu25409D
Sequence Information ORF Nucleotide Sequence (Length: 1218bp)
Protein sequence
SNP
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product epidermal growth factor receptor isoform c precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AW163038.1, X00588.1 and U48722.1. Summary: The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. Multiple alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2010]. Transcript Variant: This variant (3) uses a different 3' terminal exon when compared to variant 1. The resulting isoform (c) has a shorter and distinct C-terminus. Only the extracellular domain is present in isoform c. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: U48722.1, AY698024.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968189, SAMEA1968540 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
ATGCGACCCT CCGGGACGGC CGGGGCAGCG CTCCTGGCGC TGCTGGCTGC GCTCTGCCCG 
GCGAGTCGGG CTCTGGAGGA AAAGAAAGTT TGCCAAGGCA CGAGTAACAA GCTCACGCAG
TTGGGCACTT TTGAAGATCA TTTTCTCAGC CTCCAGAGGA TGTTCAATAA CTGTGAGGTG
GTCCTTGGGA ATTTGGAAAT TACCTATGTG CAGAGGAATT ATGATCTTTC CTTCTTAAAG
ACCATCCAGG AGGTGGCTGG TTATGTCCTC ATTGCCCTCA ACACAGTGGA GCGAATTCCT
TTGGAAAACC TGCAGATCAT CAGAGGAAAT ATGTACTACG AAAATTCCTA TGCCTTAGCA
GTCTTATCTA ACTATGATGC AAATAAAACC GGACTGAAGG AGCTGCCCAT GAGAAATTTA
CAGGAAATCC TGCATGGCGC CGTGCGGTTC AGCAACAACC CTGCCCTGTG CAACGTGGAG
AGCATCCAGT GGCGGGACAT AGTCAGCAGT GACTTTCTCA GCAACATGTC GATGGACTTC
CAGAACCACC TGGGCAGCTG CCAAAAGTGT GATCCAAGCT GTCCCAATGG GAGCTGCTGG
GGTGCAGGAG AGGAGAACTG CCAGAAACTG ACCAAAATCA TCTGTGCCCA GCAGTGCTCC
GGGCGCTGCC GTGGCAAGTC CCCCAGTGAC TGCTGCCACA ACCAGTGTGC TGCAGGCTGC
ACAGGCCCCC GGGAGAGCGA CTGCCTGGTC TGCCGCAAAT TCCGAGACGA AGCCACGTGC
AAGGACACCT GCCCCCCACT CATGCTCTAC AACCCCACCA CGTACCAGAT GGATGTGAAC
CCCGAGGGCA AATACAGCTT TGGTGCCACC TGCGTGAAGA AGTGTCCCCG TAATTATGTG
GTGACAGATC ACGGCTCGTG CGTCCGAGCC TGTGGGGCCG ACAGCTATGA GATGGAGGAA
GACGGCGTCC GCAAGTGTAA GAAGTGCGAA GGGCCTTGCC GCAAAGTGTG TAACGGAATA
GGTATTGGTG AATTTAAAGA CTCACTCTCC ATAAATGCTA CGAATATTAA ACACTTCAAA
AACTGCACCT CCATCAGTGG CGATCTCCAC ATCCTGCCGG TGGCATTTAG GGGTGACTCC
TTCACACATA CTCCTCCTCT GGATCCACAG GAACTGGATA TTCTGAAAAC CGTAAAGGAA
ATCACAGGTT TGAGCTGA
The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
RefSeqNP_958440.1
CDS247..1464
Misc Feature(1)208..210(+)
Misc Feature(2)337..420(+)
Misc Feature(3)412..414(+)
Misc Feature(4)415..750(+)
Misc Feature(5)469..1146(+)
Misc Feature(6)628..630(+)
Misc Feature(7)715..807(+)
Misc Feature(8)769..771(+)
Misc Feature(9)799..1257(+)
Misc Feature(10)814..843(+)
Misc Feature(11)826..867(+)
Misc Feature(12)832..834(+)
Misc Feature(13)889..915(+)
Misc Feature(14)901..939(+)
Misc Feature(15)931..933(+)
Misc Feature(16)937..1068(+)
Misc Feature(17)940..966(+)
Misc Feature(18)952..990(+)
Misc Feature(19)997..1026(+)
Misc Feature(20)1036..1119(+)
Misc Feature(21)1129..1167(+)
Misc Feature(22)1177..1224(+)
Misc Feature(23)1231..1245(+)
Misc Feature(24)1255..1332(+)
Misc Feature(25)1300..1302(+)
Misc Feature(26)1327..>1455(+)
Misc Feature(27)1327..1329(+)
Exon (1)1..334
Gene:EGFR
Gene Synonym:
Exon (2)335..486
Gene:EGFR
Gene Synonym:
Exon (3)487..670
Gene:EGFR
Gene Synonym:
Exon (4)671..805
Gene:EGFR
Gene Synonym:
Exon (5)806..874
Gene:EGFR
Gene Synonym:
Exon (6)875..993
Gene:EGFR
Gene Synonym:
Exon (7)994..1135
Gene:EGFR
Gene Synonym:
Exon (8)1136..1252
Gene:EGFR
Gene Synonym:
Exon (9)1253..1379
Gene:EGFR
Gene Synonym:
Exon (10)1380..1572
Gene:EGFR
Gene Synonym:
Translation
Position Chain Variation Link
31 31 g, t dbSNP:712829
37 37 c, t dbSNP:566284155
56 56 a, c dbSNP:712830
113 113 c, t dbSNP:551488510
171 171 c, t dbSNP:570107879
178 178 c, t dbSNP:537165657
184 184 c, g dbSNP:555477367
203 203 a, t dbSNP:17288945
209 209 g, t dbSNP:746536427
215 215 c, g, t dbSNP:375923119
226 226 c, t dbSNP:781240283
244 244 a, g dbSNP:748159429
245 245 c, t dbSNP:769658183
253 253 a, c dbSNP:773069229
254 254 c, t dbSNP:749433287
257 257 c, t dbSNP:771210838
259 259 c, g dbSNP:774487133
260 260 a, g dbSNP:759582787
262 262 a, g dbSNP:767651648
264 264 c, g dbSNP:775964175
265 265 c, g, t dbSNP:761183109
267 267 c, t dbSNP:369581368
268 268 a, g dbSNP:754259847
276 276 g, t dbSNP:757936561
279 279 c, t dbSNP:766029589
284 284 c, t dbSNP:567894670
298 298 c, t dbSNP:754527029
302 302 c, g dbSNP:780865931
307 307 a, g, t dbSNP:373129709
324 324 a, g dbSNP:777385414
328 328 a, g dbSNP:749088691
330 330 a, g dbSNP:770673046
332 332 a, c dbSNP:774551548
339 339 c, t dbSNP:372917131
341 341 a, g dbSNP:746023542
343 343 a, g dbSNP:772311777
347 347 c, g dbSNP:144158123
348 348 a, g, t dbSNP:148679319
362 362 c, t dbSNP:375919121
363 363 a, g dbSNP:777186292
367 367 c, t dbSNP:762281800
373 373 a, g dbSNP:147740818
396 396 c, t dbSNP:770133522
399 399 c, t dbSNP:773745636
404 404 a, g dbSNP:759219499
413 413 a, g dbSNP:767259994
420 420 c, t dbSNP:752438083
421 421 a, g dbSNP:760228905
422 422 a, c dbSNP:763572530
458 458 a, g dbSNP:369580836
468 468 c, t dbSNP:200383389
472 472 a, c dbSNP:778638117
477 477 c, g dbSNP:61731794
487 487 a, g dbSNP:374986786
496 496 a, c, g dbSNP:753319070
509 509 a, g dbSNP:765137528
514 514 c, t dbSNP:750399097
515 515 a, t dbSNP:142061256
521 521 c, t dbSNP:779879611
529 529 a, c dbSNP:35515689
534 534 a, g dbSNP:751744275
535 535 c, g dbSNP:755189573
539 539 a, g, t dbSNP:17289589
545 545 a, c dbSNP:376963968
556 556 c, t dbSNP:756305742
561 561 a, c, g dbSNP:141271101
562 562 a, g dbSNP:771366736
572 572 c, g dbSNP:145113601
578 578 c, t dbSNP:746631025
585 585 c, t dbSNP:374582814
591 591 a, t dbSNP:773596817
600 600 c, t dbSNP:147726446
618 618 c, t dbSNP:142553829
625 625 a, g dbSNP:377444977
632 632 a, c dbSNP:762889647
636 636 c, t dbSNP:766093262
646 646 a, g dbSNP:751337426
655 655 a, g dbSNP:754854319
669 669 g, t dbSNP:767608234
680 680 a, g dbSNP:780476417
684 684 c, g, t dbSNP:199637112
685 685 a, g dbSNP:532655845
687 687 c, g, t dbSNP:138946543
691 691 c, t dbSNP:774146556
692 692 a, g dbSNP:759532524
701 701 a, g dbSNP:551591429
714 714 a, g, t dbSNP:149006234
720 720 c, t dbSNP:2072454
739 739 c, t dbSNP:587778252
740 740 a, g dbSNP:761795138
746 746 c, t dbSNP:765416003
748 748 c, g dbSNP:530692924
755 755 a, g, t dbSNP:758945260
759 759 a, c, t dbSNP:17289686
765 765 c, t dbSNP:777401847
771 771 c, t dbSNP:749002473
776 776 c, t dbSNP:770290445
777 777 a, g dbSNP:17336437
780 780 a, g dbSNP:745755245
793 793 a, c, g dbSNP:772071414
804 804 c, t dbSNP:375037710
807 807 c, t dbSNP:776568205
813 813 a, g dbSNP:748275089
820 820 a, c dbSNP:770074413
825 825 c, t dbSNP:773349388
828 828 c, t dbSNP:763086693
833 833 a, g dbSNP:766507267
840 840 c, t dbSNP:370376501
852 852 a, c dbSNP:748320322
856 856 a, g dbSNP:767829342
870 870 a, g dbSNP:753129657
878 878 c, g dbSNP:779156097
879 879 c, t dbSNP:373970245
880 880 a, c dbSNP:750423932
900 900 g, t dbSNP:776050604
904 904 c, t dbSNP:761098433
906 906 c, t dbSNP:45621033
907 907 a, g, t dbSNP:776886714
909 909 a, g dbSNP:766104143
911 911 a, g dbSNP:751295137
917 917 a, g dbSNP:759106015
921 921 -, c dbSNP:145506643
925 925 c, t dbSNP:766952405
929 929 a, c dbSNP:752616839
937 937 g, t dbSNP:756040606
938 938 c, g dbSNP:777575581
945 945 c, t dbSNP:763962907
968 968 c, t dbSNP:370744986
972 972 c, g, t dbSNP:374561933
976 976 c, t dbSNP:554981236
977 977 a, g dbSNP:200664836
984 984 c, t dbSNP:772130986
985 985 a, c, g dbSNP:780001754
992 992 c, t dbSNP:765893589
1000 1000 c, g dbSNP:775252718
1001 1001 a, g dbSNP:760101437
1004 1004 a, g dbSNP:374084791
1009 1009 c, t dbSNP:776490661
1010 1010 a, g dbSNP:372202099
1014 1014 c, t dbSNP:146098757
1015 1015 a, g dbSNP:138847501
1020 1020 c, t dbSNP:142569931
1022 1022 c, t dbSNP:766478921
1023 1023 a, g dbSNP:751873368
1032 1032 c, t dbSNP:754997451
1038 1038 c, t dbSNP:781427942
1040 1040 a, c dbSNP:748627278
1043 1043 a, c, g dbSNP:17336639
1068 1068 a, g dbSNP:749588554
1073 1073 a, g dbSNP:771396903
1080 1080 c, t dbSNP:774995708
1089 1089 c, t dbSNP:746685847
1090 1090 a, g dbSNP:199796955
1099 1099 c, t dbSNP:776146284
1107 1107 c, t dbSNP:761685805
1111 1111 a, g dbSNP:769696078
1112 1112 c, t dbSNP:149840192
1119 1119 c, t dbSNP:570790705
1120 1120 a, g dbSNP:150549265
1121 1121 c, t dbSNP:762649354
1125 1125 a, g dbSNP:766252686
1135 1135 c, t dbSNP:751667358
1147 1147 g, t dbSNP:779094647
1158 1158 a, c, t dbSNP:182002674
1161 1161 a, c, t dbSNP:566001525
1164 1164 a, c, g dbSNP:202182545
1167 1167 c, t dbSNP:17289893
1168 1168 a, g dbSNP:749132706
1181 1181 c, g dbSNP:770879879
1184 1184 c, t dbSNP:149321481
1186 1186 a, g dbSNP:552062864
1190 1190 a, g dbSNP:745658347
1191 1191 c, t dbSNP:772053702
1200 1200 g, t dbSNP:775800262
1206 1206 a, g dbSNP:760984499
1209 1209 c, t dbSNP:764038041
1210 1210 a, g dbSNP:776791214
1213 1213 a, g dbSNP:761844164
1214 1214 c, t dbSNP:367680488
1215 1215 a, c dbSNP:201040971
1217 1217 a, g dbSNP:758748662
1219 1219 a, c dbSNP:766740458
1221 1221 a, g dbSNP:752278049
1228 1228 a, c dbSNP:144460286
1231 1231 c, t dbSNP:777342222
1233 1233 c, t dbSNP:748801348
1234 1234 a, g dbSNP:139429793
1235 1235 a, g, t dbSNP:778901010
1247 1247 a, g dbSNP:771929085
1274 1274 g, t dbSNP:771398183
1275 1275 c, t dbSNP:774905136
1289 1289 c, t dbSNP:371234907
1293 1293 c, g dbSNP:759932677
1297 1297 a, g dbSNP:767790289
1307 1307 c, t dbSNP:753466844
1332 1332 c, t dbSNP:547057636
1347 1347 c, t dbSNP:185327606
1348 1348 c, g dbSNP:749927550
1349 1349 a, t dbSNP:758017949
1351 1351 a, c dbSNP:780131926
1356 1356 c, t dbSNP:539077864
1365 1365 a, g dbSNP:2302536
1371 1371 a, c dbSNP:780851909
1393 1393 a, c dbSNP:755972013
1413 1413 a, g dbSNP:777959179
1420 1420 c, t dbSNP:749526261
1423 1423 c, g dbSNP:587778246
1438 1438 a, g dbSNP:757265130
1457 1457 -, aa dbSNP:747216672
1457 1457 a, t dbSNP:778894573
1458 1458 a, g dbSNP:746340466
1459 1459 a, c dbSNP:772432421
1463 1463 a, g dbSNP:776101904
1468 1468 a, c dbSNP:747326696
1472 1472 c, t dbSNP:769197565
1483 1483 a, g dbSNP:772941542
1484 1484 c, t dbSNP:375700897
1486 1486 c, g, t dbSNP:765945520
1489 1489 a, g dbSNP:369596578
1496 1496 c, g dbSNP:747291686
1504 1504 a, g dbSNP:767353126
1505 1505 -, ggtct dbSNP:776681846
1508 1508 a, g dbSNP:41522547
1510 1510 a, g dbSNP:781151300
1511 1511 c, t dbSNP:755846976
1567 1567 c, t dbSNP:555584059

Target ORF information:

RefSeq Version NM_201283
Organism Homo sapiens (human)
Definition Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 3, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK
NM_201283

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
ATGCGACCCT CCGGGACGGC CGGGGCAGCG CTCCTGGCGC TGCTGGCTGC GCTCTGCCCG 
GCGAGTCGGG CTCTGGAGGA AAAGAAAGTT TGCCAAGGCA CGAGTAACAA GCTCACGCAG
TTGGGCACTT TTGAAGATCA TTTTCTCAGC CTCCAGAGGA TGTTCAATAA CTGTGAGGTG
GTCCTTGGGA ATTTGGAAAT TACCTATGTG CAGAGGAATT ATGATCTTTC CTTCTTAAAG
ACCATCCAGG AGGTGGCTGG TTATGTCCTC ATTGCCCTCA ACACAGTGGA GCGAATTCCT
TTGGAAAACC TGCAGATCAT CAGAGGAAAT ATGTACTACG AAAATTCCTA TGCCTTAGCA
GTCTTATCTA ACTATGATGC AAATAAAACC GGACTGAAGG AGCTGCCCAT GAGAAATTTA
CAGGAAATCC TGCATGGCGC CGTGCGGTTC AGCAACAACC CTGCCCTGTG CAACGTGGAG
AGCATCCAGT GGCGGGACAT AGTCAGCAGT GACTTTCTCA GCAACATGTC GATGGACTTC
CAGAACCACC TGGGCAGCTG CCAAAAGTGT GATCCAAGCT GTCCCAATGG GAGCTGCTGG
GGTGCAGGAG AGGAGAACTG CCAGAAACTG ACCAAAATCA TCTGTGCCCA GCAGTGCTCC
GGGCGCTGCC GTGGCAAGTC CCCCAGTGAC TGCTGCCACA ACCAGTGTGC TGCAGGCTGC
ACAGGCCCCC GGGAGAGCGA CTGCCTGGTC TGCCGCAAAT TCCGAGACGA AGCCACGTGC
AAGGACACCT GCCCCCCACT CATGCTCTAC AACCCCACCA CGTACCAGAT GGATGTGAAC
CCCGAGGGCA AATACAGCTT TGGTGCCACC TGCGTGAAGA AGTGTCCCCG TAATTATGTG
GTGACAGATC ACGGCTCGTG CGTCCGAGCC TGTGGGGCCG ACAGCTATGA GATGGAGGAA
GACGGCGTCC GCAAGTGTAA GAAGTGCGAA GGGCCTTGCC GCAAAGTGTG TAACGGAATA
GGTATTGGTG AATTTAAAGA CTCACTCTCC ATAAATGCTA CGAATATTAA ACACTTCAAA
AACTGCACCT CCATCAGTGG CGATCTCCAC ATCCTGCCGG TGGCATTTAG GGGTGACTCC
TTCACACATA CTCCTCCTCT GGATCCACAG GAACTGGATA TTCTGAAAAC CGTAAAGGAA
ATCACAGGTT TGAGCTGA

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.


CloneID OHu25398D
Sequence Information ORF Nucleotide Sequence (Length: 2118bp)
Protein sequence
SNP
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product epidermal growth factor receptor isoform d precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AW163038.1, X00588.1 and AF125253.1. Summary: The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. Multiple alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2010]. Transcript Variant: This variant (4) uses a different 3' terminal exon when compared to variant 1. The resulting isoform (d) has a shorter and distinct C-terminus. Only the extracellular domain is present in isoform d. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF125253.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2149398 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
ATGCGACCCT CCGGGACGGC CGGGGCAGCG CTCCTGGCGC TGCTGGCTGC GCTCTGCCCG 
GCGAGTCGGG CTCTGGAGGA AAAGAAAGTT TGCCAAGGCA CGAGTAACAA GCTCACGCAG
TTGGGCACTT TTGAAGATCA TTTTCTCAGC CTCCAGAGGA TGTTCAATAA CTGTGAGGTG
GTCCTTGGGA ATTTGGAAAT TACCTATGTG CAGAGGAATT ATGATCTTTC CTTCTTAAAG
ACCATCCAGG AGGTGGCTGG TTATGTCCTC ATTGCCCTCA ACACAGTGGA GCGAATTCCT
TTGGAAAACC TGCAGATCAT CAGAGGAAAT ATGTACTACG AAAATTCCTA TGCCTTAGCA
GTCTTATCTA ACTATGATGC AAATAAAACC GGACTGAAGG AGCTGCCCAT GAGAAATTTA
CAGGAAATCC TGCATGGCGC CGTGCGGTTC AGCAACAACC CTGCCCTGTG CAACGTGGAG
AGCATCCAGT GGCGGGACAT AGTCAGCAGT GACTTTCTCA GCAACATGTC GATGGACTTC
CAGAACCACC TGGGCAGCTG CCAAAAGTGT GATCCAAGCT GTCCCAATGG GAGCTGCTGG
GGTGCAGGAG AGGAGAACTG CCAGAAACTG ACCAAAATCA TCTGTGCCCA GCAGTGCTCC
GGGCGCTGCC GTGGCAAGTC CCCCAGTGAC TGCTGCCACA ACCAGTGTGC TGCAGGCTGC
ACAGGCCCCC GGGAGAGCGA CTGCCTGGTC TGCCGCAAAT TCCGAGACGA AGCCACGTGC
AAGGACACCT GCCCCCCACT CATGCTCTAC AACCCCACCA CGTACCAGAT GGATGTGAAC
CCCGAGGGCA AATACAGCTT TGGTGCCACC TGCGTGAAGA AGTGTCCCCG TAATTATGTG
GTGACAGATC ACGGCTCGTG CGTCCGAGCC TGTGGGGCCG ACAGCTATGA GATGGAGGAA
GACGGCGTCC GCAAGTGTAA GAAGTGCGAA GGGCCTTGCC GCAAAGTGTG TAACGGAATA
GGTATTGGTG AATTTAAAGA CTCACTCTCC ATAAATGCTA CGAATATTAA ACACTTCAAA
AACTGCACCT CCATCAGTGG CGATCTCCAC ATCCTGCCGG TGGCATTTAG GGGTGACTCC
TTCACACATA CTCCTCCTCT GGATCCACAG GAACTGGATA TTCTGAAAAC CGTAAAGGAA
ATCACAGGGT TTTTGCTGAT TCAGGCTTGG CCTGAAAACA GGACGGACCT CCATGCCTTT
GAGAACCTAG AAATCATACG CGGCAGGACC AAGCAACATG GTCAGTTTTC TCTTGCAGTC
GTCAGCCTGA ACATAACATC CTTGGGATTA CGCTCCCTCA AGGAGATAAG TGATGGAGAT
GTGATAATTT CAGGAAACAA AAATTTGTGC TATGCAAATA CAATAAACTG GAAAAAACTG
TTTGGGACCT CCGGTCAGAA AACCAAAATT ATAAGCAACA GAGGTGAAAA CAGCTGCAAG
GCCACAGGCC AGGTCTGCCA TGCCTTGTGC TCCCCCGAGG GCTGCTGGGG CCCGGAGCCC
AGGGACTGCG TCTCTTGCCG GAATGTCAGC CGAGGCAGGG AATGCGTGGA CAAGTGCAAC
CTTCTGGAGG GTGAGCCAAG GGAGTTTGTG GAGAACTCTG AGTGCATACA GTGCCACCCA
GAGTGCCTGC CTCAGGCCAT GAACATCACC TGCACAGGAC GGGGACCAGA CAACTGTATC
CAGTGTGCCC ACTACATTGA CGGCCCCCAC TGCGTCAAGA CCTGCCCGGC AGGAGTCATG
GGAGAAAACA ACACCCTGGT CTGGAAGTAC GCAGACGCCG GCCATGTGTG CCACCTGTGC
CATCCAAACT GCACCTACGG GCCAGGAAAT GAGAGTCTCA AAGCCATGTT ATTCTGCCTT
TTTAAACTAT CATCCTGTAA TCAAAGTAAT GATGGCAGCG TGTCCCACCA GAGCGGGAGC
CCAGCTGCTC AGGAGTCATG CTTAGGATGG ATCCCTTCTC TTCTGCCGTC AGAGTTTCAG
CTGGGTTGGG GTGGATGCAG CCACCTCCAT GCCTGGCCTT CTGCATCTGT GATCATCACG
GCCTCCTCCT GCCACTGA
The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
RefSeqNP_958441.1
CDS247..2364
Misc Feature(1)208..210(+)
Misc Feature(2)337..420(+)
Misc Feature(3)412..414(+)
Misc Feature(4)415..750(+)
Misc Feature(5)469..1146(+)
Misc Feature(6)628..630(+)
Misc Feature(7)715..807(+)
Misc Feature(8)769..771(+)
Misc Feature(9)799..1257(+)
Misc Feature(10)814..843(+)
Misc Feature(11)826..867(+)
Misc Feature(12)832..834(+)
Misc Feature(13)889..915(+)
Misc Feature(14)901..939(+)
Misc Feature(15)931..933(+)
Misc Feature(16)937..1068(+)
Misc Feature(17)940..966(+)
Misc Feature(18)952..990(+)
Misc Feature(19)997..1026(+)
Misc Feature(20)1036..1119(+)
Misc Feature(21)1129..1167(+)
Misc Feature(22)1177..1224(+)
Misc Feature(23)1231..1245(+)
Misc Feature(24)1255..1332(+)
Misc Feature(25)1300..1302(+)
Misc Feature(26)1327..1689(+)
Misc Feature(27)1327..1329(+)
Misc Feature(28)1414..2046(+)
Misc Feature(29)1483..1485(+)
Misc Feature(30)1576..1578(+)
Misc Feature(31)1654..1743(+)
Misc Feature(32)1759..2127(+)
Misc Feature(33)1762..1923(+)
Misc Feature(34)1762..1791(+)
Misc Feature(35)1774..1815(+)
Misc Feature(36)1822..1851(+)
Misc Feature(37)1828..1830(+)
Misc Feature(38)1861..1911(+)
Misc Feature(39)1918..>2040(+)
Misc Feature(40)1918..1959(+)
Misc Feature(41)1930..1983(+)
Misc Feature(42)1948..1950(+)
Misc Feature(43)1990..2019(+)
Misc Feature(44)2029..2097(+)
Misc Feature(45)2053..2055(+)
Misc Feature(46)2113..2115(+)
Misc Feature(47)2323..2325(+)
Exon (1)1..334
Gene:EGFR
Gene Synonym:
Exon (2)335..486
Gene:EGFR
Gene Synonym:
Exon (3)487..670
Gene:EGFR
Gene Synonym:
Exon (4)671..805
Gene:EGFR
Gene Synonym:
Exon (5)806..874
Gene:EGFR
Gene Synonym:
Exon (6)875..993
Gene:EGFR
Gene Synonym:
Exon (7)994..1135
Gene:EGFR
Gene Synonym:
Exon (8)1136..1252
Gene:EGFR
Gene Synonym:
Exon (9)1253..1379
Gene:EGFR
Gene Synonym:
Exon (10)1380..1453
Gene:EGFR
Gene Synonym:
Exon (11)1454..1544
Gene:EGFR
Gene Synonym:
Exon (12)1545..1744
Gene:EGFR
Gene Synonym:
Exon (13)1745..1877
Gene:EGFR
Gene Synonym:
Exon (14)1878..1968
Gene:EGFR
Gene Synonym:
Exon (15)1969..2126
Gene:EGFR
Gene Synonym:
Exon (16)2127..2865
Gene:EGFR
Gene Synonym:
Translation
Position Chain Variation Link
31 31 g, t dbSNP:712829
37 37 c, t dbSNP:566284155
56 56 a, c dbSNP:712830
113 113 c, t dbSNP:551488510
171 171 c, t dbSNP:570107879
178 178 c, t dbSNP:537165657
184 184 c, g dbSNP:555477367
203 203 a, t dbSNP:17288945
209 209 g, t dbSNP:746536427
215 215 c, g, t dbSNP:375923119
226 226 c, t dbSNP:781240283
244 244 a, g dbSNP:748159429
245 245 c, t dbSNP:769658183
253 253 a, c dbSNP:773069229
254 254 c, t dbSNP:749433287
257 257 c, t dbSNP:771210838
259 259 c, g dbSNP:774487133
260 260 a, g dbSNP:759582787
262 262 a, g dbSNP:767651648
264 264 c, g dbSNP:775964175
265 265 c, g, t dbSNP:761183109
267 267 c, t dbSNP:369581368
268 268 a, g dbSNP:754259847
276 276 g, t dbSNP:757936561
279 279 c, t dbSNP:766029589
284 284 c, t dbSNP:567894670
298 298 c, t dbSNP:754527029
302 302 c, g dbSNP:780865931
307 307 a, g, t dbSNP:373129709
324 324 a, g dbSNP:777385414
328 328 a, g dbSNP:749088691
330 330 a, g dbSNP:770673046
332 332 a, c dbSNP:774551548
339 339 c, t dbSNP:372917131
341 341 a, g dbSNP:746023542
343 343 a, g dbSNP:772311777
347 347 c, g dbSNP:144158123
348 348 a, g, t dbSNP:148679319
362 362 c, t dbSNP:375919121
363 363 a, g dbSNP:777186292
367 367 c, t dbSNP:762281800
373 373 a, g dbSNP:147740818
396 396 c, t dbSNP:770133522
399 399 c, t dbSNP:773745636
404 404 a, g dbSNP:759219499
413 413 a, g dbSNP:767259994
420 420 c, t dbSNP:752438083
421 421 a, g dbSNP:760228905
422 422 a, c dbSNP:763572530
458 458 a, g dbSNP:369580836
468 468 c, t dbSNP:200383389
472 472 a, c dbSNP:778638117
477 477 c, g dbSNP:61731794
487 487 a, g dbSNP:374986786
496 496 a, c, g dbSNP:753319070
509 509 a, g dbSNP:765137528
514 514 c, t dbSNP:750399097
515 515 a, t dbSNP:142061256
521 521 c, t dbSNP:779879611
529 529 a, c dbSNP:35515689
534 534 a, g dbSNP:751744275
535 535 c, g dbSNP:755189573
539 539 a, g, t dbSNP:17289589
545 545 a, c dbSNP:376963968
556 556 c, t dbSNP:756305742
561 561 a, c, g dbSNP:141271101
562 562 a, g dbSNP:771366736
572 572 c, g dbSNP:145113601
578 578 c, t dbSNP:746631025
585 585 c, t dbSNP:374582814
591 591 a, t dbSNP:773596817
600 600 c, t dbSNP:147726446
618 618 c, t dbSNP:142553829
625 625 a, g dbSNP:377444977
632 632 a, c dbSNP:762889647
636 636 c, t dbSNP:766093262
646 646 a, g dbSNP:751337426
655 655 a, g dbSNP:754854319
669 669 g, t dbSNP:767608234
680 680 a, g dbSNP:780476417
684 684 c, g, t dbSNP:199637112
685 685 a, g dbSNP:532655845
687 687 c, g, t dbSNP:138946543
691 691 c, t dbSNP:774146556
692 692 a, g dbSNP:759532524
701 701 a, g dbSNP:551591429
714 714 a, g, t dbSNP:149006234
720 720 c, t dbSNP:2072454
739 739 c, t dbSNP:587778252
740 740 a, g dbSNP:761795138
746 746 c, t dbSNP:765416003
748 748 c, g dbSNP:530692924
755 755 a, g, t dbSNP:758945260
759 759 a, c, t dbSNP:17289686
765 765 c, t dbSNP:777401847
771 771 c, t dbSNP:749002473
776 776 c, t dbSNP:770290445
777 777 a, g dbSNP:17336437
780 780 a, g dbSNP:745755245
793 793 a, c, g dbSNP:772071414
804 804 c, t dbSNP:375037710
807 807 c, t dbSNP:776568205
813 813 a, g dbSNP:748275089
820 820 a, c dbSNP:770074413
825 825 c, t dbSNP:773349388
828 828 c, t dbSNP:763086693
833 833 a, g dbSNP:766507267
840 840 c, t dbSNP:370376501
852 852 a, c dbSNP:748320322
856 856 a, g dbSNP:767829342
870 870 a, g dbSNP:753129657
878 878 c, g dbSNP:779156097
879 879 c, t dbSNP:373970245
880 880 a, c dbSNP:750423932
900 900 g, t dbSNP:776050604
904 904 c, t dbSNP:761098433
906 906 c, t dbSNP:45621033
907 907 a, g, t dbSNP:776886714
909 909 a, g dbSNP:766104143
911 911 a, g dbSNP:751295137
917 917 a, g dbSNP:759106015
921 921 -, c dbSNP:145506643
925 925 c, t dbSNP:766952405
929 929 a, c dbSNP:752616839
937 937 g, t dbSNP:756040606
938 938 c, g dbSNP:777575581
945 945 c, t dbSNP:763962907
968 968 c, t dbSNP:370744986
972 972 c, g, t dbSNP:374561933
976 976 c, t dbSNP:554981236
977 977 a, g dbSNP:200664836
984 984 c, t dbSNP:772130986
985 985 a, c, g dbSNP:780001754
992 992 c, t dbSNP:765893589
1000 1000 c, g dbSNP:775252718
1001 1001 a, g dbSNP:760101437
1004 1004 a, g dbSNP:374084791
1009 1009 c, t dbSNP:776490661
1010 1010 a, g dbSNP:372202099
1014 1014 c, t dbSNP:146098757
1015 1015 a, g dbSNP:138847501
1020 1020 c, t dbSNP:142569931
1022 1022 c, t dbSNP:766478921
1023 1023 a, g dbSNP:751873368
1032 1032 c, t dbSNP:754997451
1038 1038 c, t dbSNP:781427942
1040 1040 a, c dbSNP:748627278
1043 1043 a, c, g dbSNP:17336639
1068 1068 a, g dbSNP:749588554
1073 1073 a, g dbSNP:771396903
1080 1080 c, t dbSNP:774995708
1089 1089 c, t dbSNP:746685847
1090 1090 a, g dbSNP:199796955
1099 1099 c, t dbSNP:776146284
1107 1107 c, t dbSNP:761685805
1111 1111 a, g dbSNP:769696078
1112 1112 c, t dbSNP:149840192
1119 1119 c, t dbSNP:570790705
1120 1120 a, g dbSNP:150549265
1121 1121 c, t dbSNP:762649354
1125 1125 a, g dbSNP:766252686
1135 1135 c, t dbSNP:751667358
1147 1147 g, t dbSNP:779094647
1158 1158 a, c, t dbSNP:182002674
1161 1161 a, c, t dbSNP:566001525
1164 1164 a, c, g dbSNP:202182545
1167 1167 c, t dbSNP:17289893
1168 1168 a, g dbSNP:749132706
1181 1181 c, g dbSNP:770879879
1184 1184 c, t dbSNP:149321481
1186 1186 a, g dbSNP:552062864
1190 1190 a, g dbSNP:745658347
1191 1191 c, t dbSNP:772053702
1200 1200 g, t dbSNP:775800262
1206 1206 a, g dbSNP:760984499
1209 1209 c, t dbSNP:764038041
1210 1210 a, g dbSNP:776791214
1213 1213 a, g dbSNP:761844164
1214 1214 c, t dbSNP:367680488
1215 1215 a, c dbSNP:201040971
1217 1217 a, g dbSNP:758748662
1219 1219 a, c dbSNP:766740458
1221 1221 a, g dbSNP:752278049
1228 1228 a, c dbSNP:144460286
1231 1231 c, t dbSNP:777342222
1233 1233 c, t dbSNP:748801348
1234 1234 a, g dbSNP:139429793
1235 1235 a, g, t dbSNP:778901010
1247 1247 a, g dbSNP:771929085
1274 1274 g, t dbSNP:771398183
1275 1275 c, t dbSNP:774905136
1289 1289 c, t dbSNP:371234907
1293 1293 c, g dbSNP:759932677
1297 1297 a, g dbSNP:767790289
1307 1307 c, t dbSNP:753466844
1332 1332 c, t dbSNP:547057636
1347 1347 c, t dbSNP:185327606
1348 1348 c, g dbSNP:749927550
1349 1349 a, t dbSNP:758017949
1351 1351 a, c dbSNP:780131926
1356 1356 c, t dbSNP:539077864
1365 1365 a, g dbSNP:2302536
1371 1371 a, c dbSNP:780851909
1393 1393 a, c dbSNP:755972013
1413 1413 a, g dbSNP:777959179
1420 1420 c, t dbSNP:749526261
1423 1423 c, g dbSNP:587778246
1438 1438 a, g dbSNP:757265130
1456 1456 a, t dbSNP:777165081
1461 1461 a, g dbSNP:748900962
1484 1484 a, g dbSNP:770466526
1491 1491 g, t dbSNP:774121381
1494 1494 c, g dbSNP:758956103
1497 1497 a, c, t dbSNP:767070097
1507 1507 a, g dbSNP:760639592
1515 1515 a, g dbSNP:763830096
1519 1519 a, g dbSNP:558565565
1522 1522 a, g dbSNP:201364864
1527 1527 c, t dbSNP:367896493
1529 1529 a, g dbSNP:606231253
1535 1535 a, c dbSNP:765369188
1544 1544 a, g dbSNP:750713244
1563 1563 a, g dbSNP:17290005
1566 1566 c, t dbSNP:761495014
1571 1571 a, g dbSNP:765091640
1579 1579 a, g dbSNP:372990493
1588 1588 c, t dbSNP:750541010
1590 1590 a, c, g dbSNP:763266323
1597 1597 c, t dbSNP:377567759
1598 1598 a, g dbSNP:751667594
1617 1617 c, t dbSNP:755147377
1620 1620 c, g, t dbSNP:146711874
1624 1624 a, g dbSNP:753269876
1628 1628 c, t dbSNP:200592648
1636 1636 a, g, t dbSNP:746763556
1641 1641 a, c dbSNP:199754312
1659 1659 c, t dbSNP:771736232
1668 1668 a, c dbSNP:779726192
1673 1673 a, g dbSNP:746521110
1683 1683 a, c dbSNP:768208443
1684 1684 c, t dbSNP:147732025
1689 1689 g, t dbSNP:587778247
1698 1698 c, t dbSNP:568681121
1699 1699 a, g dbSNP:769434273
1710 1710 a, c dbSNP:773079786
1716 1716 a, t dbSNP:762704534
1717 1717 a, g dbSNP:768500612
1730 1730 a, g dbSNP:766676440
1737 1737 c, t dbSNP:774773441
1753 1753 a, g dbSNP:760711480
1755 1755 c, t dbSNP:17336800
1778 1778 a, c dbSNP:371114444
1780 1780 c, t dbSNP:587778248
1782 1782 a, c, t dbSNP:374670788
1783 1783 a, g, t dbSNP:754646330
1798 1798 c, t dbSNP:368484180
1799 1799 c, t dbSNP:564398642
1800 1800 a, g dbSNP:142429250
1802 1802 a, g dbSNP:749186957
1803 1803 g, t dbSNP:116057045
1808 1808 a, c, g, t dbSNP:2227983
1809 1809 a, g dbSNP:745709532
1815 1815 c, t dbSNP:761127339
1816 1816 a, g dbSNP:587778249
1818 1818 c, t dbSNP:760800224
1825 1825 c, t dbSNP:768627073
1826 1826 a, g dbSNP:150477666
1828 1828 a, g dbSNP:762336338
1830 1830 c, t dbSNP:765534683
1848 1848 a, g dbSNP:529355260
1851 1851 c, t dbSNP:763346690
1852 1852 a, g dbSNP:767193132
1853 1853 c, t dbSNP:752350337
1876 1876 a, g dbSNP:755584255
1877 1877 a, g dbSNP:764356379
1878 1878 c, t dbSNP:17290103
1879 1879 a, g dbSNP:778985185
1893 1893 c, t dbSNP:750403646
1902 1902 c, t dbSNP:758141603
1907 1907 a, g dbSNP:779741928
1914 1914 a, g dbSNP:747203424
1917 1917 a, g dbSNP:768735314
1920 1920 c, t dbSNP:781514400
1924 1924 a, c dbSNP:748219780
1927 1927 c, g dbSNP:769918274
1933 1933 c, t dbSNP:775394093
1936 1936 a, c, t dbSNP:773651001
1945 1945 a, g dbSNP:771278492
1955 1955 c, g dbSNP:774558548
1961 1961 c, g dbSNP:759987693
1966 1966 c, t dbSNP:760471492
1967 1967 a, g dbSNP:370810719
1974 1974 a, t dbSNP:538447477
1979 1979 a, g dbSNP:556794990
1983 1983 c, t dbSNP:776359891
1985 1985 c, t dbSNP:761585117
1987 1987 a, c dbSNP:764787649
1995 1995 c, t dbSNP:141232284
2003 2003 c, t dbSNP:542237406
2007 2007 c, t dbSNP:766220964
2012 2012 a, c dbSNP:751570775
2013 2013 c, t dbSNP:754671343
2019 2019 c, t dbSNP:767304301
2020 2020 a, g dbSNP:144943614
2021 2021 c, t dbSNP:28384375
2023 2023 a, c dbSNP:371483915
2025 2025 c, g dbSNP:756307243
2027 2027 a, c dbSNP:778011429
2034 2034 a, g dbSNP:17290162
2035 2035 g, t dbSNP:757419349
2039 2039 g, t dbSNP:139236063
2044 2044 a, g, t dbSNP:746395542
2045 2045 c, t dbSNP:149375515
2048 2048 a, g dbSNP:201498575
2052 2052 a, g dbSNP:747423535
2055 2055 c, t dbSNP:769537072
2058 2058 c, t dbSNP:773064203
2062 2062 c, g dbSNP:143152775
2064 2064 a, g, t dbSNP:148242307
2067 2067 c, t dbSNP:377048120
2076 2076 c, t dbSNP:115350205
2077 2077 a, g dbSNP:201061916
2082 2082 c, t dbSNP:150803480
2083 2083 a, g dbSNP:764290273
2085 2085 a, c, t dbSNP:17290169
2086 2086 a, g dbSNP:779076899
2087 2087 a, g dbSNP:750850720
2093 2093 c, t dbSNP:756534868
2097 2097 c, t dbSNP:143422127
2105 2105 a, g dbSNP:150899403
2113 2113 a, t dbSNP:747376358
2117 2117 g, t dbSNP:28384376
2118 2118 c, t dbSNP:769203592
2124 2124 c, t dbSNP:533525993
2125 2125 a, g dbSNP:753315940
2132 2132 a, g dbSNP:371814116
2137 2137 -, ga dbSNP:758925495
2139 2139 a, c, g dbSNP:567073985
2140 2140 a, g dbSNP:750024622
2143 2143 a, c dbSNP:369826866
2144 2144 c, t dbSNP:779726134
2149 2149 g, t dbSNP:147139524
2152 2152 a, g dbSNP:754507771
2162 2162 c, g dbSNP:781128508
2164 2164 a, c dbSNP:140443314
2169 2169 a, t dbSNP:769593091
2177 2177 c, t dbSNP:777733466
2180 2180 c, t dbSNP:749145316
2183 2183 g, t dbSNP:771274615
2186 2186 a, c dbSNP:774771530
2190 2190 a, g dbSNP:759602022
2201 2201 a, g, t dbSNP:371909721
2206 2206 a, g dbSNP:761106266
2212 2212 c, t dbSNP:764631638
2214 2214 c, t dbSNP:10258429
2215 2215 c, t dbSNP:578183026
2219 2219 a, g dbSNP:762236315
2220 2220 c, t dbSNP:376733874
2221 2221 a, g dbSNP:145830434
2223 2223 a, g dbSNP:370071208
2225 2225 c, g dbSNP:754446310
2233 2233 g, t dbSNP:780600637
2247 2247 c, t dbSNP:369256206
2256 2256 g, t dbSNP:374459674
2269 2269 a, c, g dbSNP:138963326
2271 2271 a, g dbSNP:749080156
2273 2273 a, c dbSNP:770861870
2274 2274 a, g dbSNP:17336988
2280 2280 a, g dbSNP:746105512
2282 2282 c, t dbSNP:772139095
2286 2286 c, g dbSNP:201419843
2291 2291 g, t dbSNP:775407038
2294 2294 a, g dbSNP:760845355
2295 2295 a, g dbSNP:769151043
2297 2297 a, g dbSNP:777184524
2301 2301 a, t dbSNP:762109788
2303 2303 a, g dbSNP:111275056
2306 2306 g, t dbSNP:751185812
2314 2314 c, t dbSNP:759135866
2332 2332 a, t dbSNP:767248396
2334 2334 c, t dbSNP:752117680
2339 2339 c, t dbSNP:755742111
2343 2343 c, t dbSNP:183216180
2344 2344 a, c dbSNP:753828905
2345 2345 c, t dbSNP:368763603
2346 2346 a, g dbSNP:778870778
2350 2350 c, t dbSNP:745721490
2353 2353 c, t dbSNP:77402685
2354 2354 c, t dbSNP:10258568
2358 2358 c, t dbSNP:747050636
2373 2373 c, t dbSNP:768740350
2374 2374 c, t dbSNP:777057963
2378 2378 a, c dbSNP:748687776
2379 2379 c, t dbSNP:565556314
2380 2380 a, c, g, t dbSNP:17290225
2386 2386 g, t dbSNP:775222124
2393 2393 c, t dbSNP:760194723
2394 2394 a, c, g, t dbSNP:530043155
2395 2395 a, g, t dbSNP:10228436
2403 2403 c, t dbSNP:758274673
2413 2413 c, t dbSNP:780086345
2421 2421 a, g dbSNP:17290239
2428 2428 a, g dbSNP:187324734
2440 2440 a, g dbSNP:146390049
2443 2443 c, g dbSNP:779270612
2491 2491 a, c dbSNP:113869003
2492 2492 c, t dbSNP:752776901
2507 2507 a, g dbSNP:17336995
2514 2514 -, c dbSNP:781307402
2533 2533 c, t dbSNP:538888597
2534 2534 c, t dbSNP:561407812
2545 2545 c, g dbSNP:565105141
2575 2575 a, g dbSNP:531636345
2583 2583 g, t dbSNP:575149033
2586 2586 a, g dbSNP:75529744
2588 2588 c, g dbSNP:554690485
2591 2591 g, t dbSNP:10277413
2604 2604 c, g dbSNP:373533282
2612 2612 a, g dbSNP:540824714
2638 2638 c, t dbSNP:565519908
2640 2640 c, g dbSNP:532436033
2663 2663 -, t dbSNP:758872139
2724 2724 a, g dbSNP:112565702
2742 2742 a, t dbSNP:149659398
2769 2769 a, c, t dbSNP:17337009
2770 2770 a, g dbSNP:17337016
2807 2807 -, gt dbSNP:374202229
2807 2807 a, g dbSNP:563058557
2834 2834 a, g dbSNP:768686299
2841 2841 a, g dbSNP:530069761

Target ORF information:

RefSeq Version NM_201284
Organism Homo sapiens (human)
Definition Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 4, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK
NM_201284

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
ATGCGACCCT CCGGGACGGC CGGGGCAGCG CTCCTGGCGC TGCTGGCTGC GCTCTGCCCG 
GCGAGTCGGG CTCTGGAGGA AAAGAAAGTT TGCCAAGGCA CGAGTAACAA GCTCACGCAG
TTGGGCACTT TTGAAGATCA TTTTCTCAGC CTCCAGAGGA TGTTCAATAA CTGTGAGGTG
GTCCTTGGGA ATTTGGAAAT TACCTATGTG CAGAGGAATT ATGATCTTTC CTTCTTAAAG
ACCATCCAGG AGGTGGCTGG TTATGTCCTC ATTGCCCTCA ACACAGTGGA GCGAATTCCT
TTGGAAAACC TGCAGATCAT CAGAGGAAAT ATGTACTACG AAAATTCCTA TGCCTTAGCA
GTCTTATCTA ACTATGATGC AAATAAAACC GGACTGAAGG AGCTGCCCAT GAGAAATTTA
CAGGAAATCC TGCATGGCGC CGTGCGGTTC AGCAACAACC CTGCCCTGTG CAACGTGGAG
AGCATCCAGT GGCGGGACAT AGTCAGCAGT GACTTTCTCA GCAACATGTC GATGGACTTC
CAGAACCACC TGGGCAGCTG CCAAAAGTGT GATCCAAGCT GTCCCAATGG GAGCTGCTGG
GGTGCAGGAG AGGAGAACTG CCAGAAACTG ACCAAAATCA TCTGTGCCCA GCAGTGCTCC
GGGCGCTGCC GTGGCAAGTC CCCCAGTGAC TGCTGCCACA ACCAGTGTGC TGCAGGCTGC
ACAGGCCCCC GGGAGAGCGA CTGCCTGGTC TGCCGCAAAT TCCGAGACGA AGCCACGTGC
AAGGACACCT GCCCCCCACT CATGCTCTAC AACCCCACCA CGTACCAGAT GGATGTGAAC
CCCGAGGGCA AATACAGCTT TGGTGCCACC TGCGTGAAGA AGTGTCCCCG TAATTATGTG
GTGACAGATC ACGGCTCGTG CGTCCGAGCC TGTGGGGCCG ACAGCTATGA GATGGAGGAA
GACGGCGTCC GCAAGTGTAA GAAGTGCGAA GGGCCTTGCC GCAAAGTGTG TAACGGAATA
GGTATTGGTG AATTTAAAGA CTCACTCTCC ATAAATGCTA CGAATATTAA ACACTTCAAA
AACTGCACCT CCATCAGTGG CGATCTCCAC ATCCTGCCGG TGGCATTTAG GGGTGACTCC
TTCACACATA CTCCTCCTCT GGATCCACAG GAACTGGATA TTCTGAAAAC CGTAAAGGAA
ATCACAGGGT TTTTGCTGAT TCAGGCTTGG CCTGAAAACA GGACGGACCT CCATGCCTTT
GAGAACCTAG AAATCATACG CGGCAGGACC AAGCAACATG GTCAGTTTTC TCTTGCAGTC
GTCAGCCTGA ACATAACATC CTTGGGATTA CGCTCCCTCA AGGAGATAAG TGATGGAGAT
GTGATAATTT CAGGAAACAA AAATTTGTGC TATGCAAATA CAATAAACTG GAAAAAACTG
TTTGGGACCT CCGGTCAGAA AACCAAAATT ATAAGCAACA GAGGTGAAAA CAGCTGCAAG
GCCACAGGCC AGGTCTGCCA TGCCTTGTGC TCCCCCGAGG GCTGCTGGGG CCCGGAGCCC
AGGGACTGCG TCTCTTGCCG GAATGTCAGC CGAGGCAGGG AATGCGTGGA CAAGTGCAAC
CTTCTGGAGG GTGAGCCAAG GGAGTTTGTG GAGAACTCTG AGTGCATACA GTGCCACCCA
GAGTGCCTGC CTCAGGCCAT GAACATCACC TGCACAGGAC GGGGACCAGA CAACTGTATC
CAGTGTGCCC ACTACATTGA CGGCCCCCAC TGCGTCAAGA CCTGCCCGGC AGGAGTCATG
GGAGAAAACA ACACCCTGGT CTGGAAGTAC GCAGACGCCG GCCATGTGTG CCACCTGTGC
CATCCAAACT GCACCTACGG GCCAGGAAAT GAGAGTCTCA AAGCCATGTT ATTCTGCCTT
TTTAAACTAT CATCCTGTAA TCAAAGTAAT GATGGCAGCG TGTCCCACCA GAGCGGGAGC
CCAGCTGCTC AGGAGTCATG CTTAGGATGG ATCCCTTCTC TTCTGCCGTC AGAGTTTCAG
CTGGGTTGGG GTGGATGCAG CCACCTCCAT GCCTGGCCTT CTGCATCTGT GATCATCACG
GCCTCCTCCT GCCACTGA

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.


CloneID OHu25437D
Sequence Information ORF Nucleotide Sequence (Length: 3633bp)
Protein sequence
SNP
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product epidermal growth factor receptor isoform a precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AW163038.1, X00588.1, AF125253.1, AU137334.1, CB160831.1, AL598260.1, AI217671.1 and AW295229.1. This sequence is a reference standard in the RefSeqGene project. On Jan 26, 2004 this sequence version replaced gi:29725608. Summary: The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. Multiple alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2010]. Transcript Variant: This variant (1) is the longest transcript and it encodes the longest isoform (a). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: X00588.1, BC070081.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968189, SAMEA1968540 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
3241
3301
3361
3421
3481
3541
3601
ATGCGACCCT CCGGGACGGC CGGGGCAGCG CTCCTGGCGC TGCTGGCTGC GCTCTGCCCG 
GCGAGTCGGG CTCTGGAGGA AAAGAAAGTT TGCCAAGGCA CGAGTAACAA GCTCACGCAG
TTGGGCACTT TTGAAGATCA TTTTCTCAGC CTCCAGAGGA TGTTCAATAA CTGTGAGGTG
GTCCTTGGGA ATTTGGAAAT TACCTATGTG CAGAGGAATT ATGATCTTTC CTTCTTAAAG
ACCATCCAGG AGGTGGCTGG TTATGTCCTC ATTGCCCTCA ACACAGTGGA GCGAATTCCT
TTGGAAAACC TGCAGATCAT CAGAGGAAAT ATGTACTACG AAAATTCCTA TGCCTTAGCA
GTCTTATCTA ACTATGATGC AAATAAAACC GGACTGAAGG AGCTGCCCAT GAGAAATTTA
CAGGAAATCC TGCATGGCGC CGTGCGGTTC AGCAACAACC CTGCCCTGTG CAACGTGGAG
AGCATCCAGT GGCGGGACAT AGTCAGCAGT GACTTTCTCA GCAACATGTC GATGGACTTC
CAGAACCACC TGGGCAGCTG CCAAAAGTGT GATCCAAGCT GTCCCAATGG GAGCTGCTGG
GGTGCAGGAG AGGAGAACTG CCAGAAACTG ACCAAAATCA TCTGTGCCCA GCAGTGCTCC
GGGCGCTGCC GTGGCAAGTC CCCCAGTGAC TGCTGCCACA ACCAGTGTGC TGCAGGCTGC
ACAGGCCCCC GGGAGAGCGA CTGCCTGGTC TGCCGCAAAT TCCGAGACGA AGCCACGTGC
AAGGACACCT GCCCCCCACT CATGCTCTAC AACCCCACCA CGTACCAGAT GGATGTGAAC
CCCGAGGGCA AATACAGCTT TGGTGCCACC TGCGTGAAGA AGTGTCCCCG TAATTATGTG
GTGACAGATC ACGGCTCGTG CGTCCGAGCC TGTGGGGCCG ACAGCTATGA GATGGAGGAA
GACGGCGTCC GCAAGTGTAA GAAGTGCGAA GGGCCTTGCC GCAAAGTGTG TAACGGAATA
GGTATTGGTG AATTTAAAGA CTCACTCTCC ATAAATGCTA CGAATATTAA ACACTTCAAA
AACTGCACCT CCATCAGTGG CGATCTCCAC ATCCTGCCGG TGGCATTTAG GGGTGACTCC
TTCACACATA CTCCTCCTCT GGATCCACAG GAACTGGATA TTCTGAAAAC CGTAAAGGAA
ATCACAGGGT TTTTGCTGAT TCAGGCTTGG CCTGAAAACA GGACGGACCT CCATGCCTTT
GAGAACCTAG AAATCATACG CGGCAGGACC AAGCAACATG GTCAGTTTTC TCTTGCAGTC
GTCAGCCTGA ACATAACATC CTTGGGATTA CGCTCCCTCA AGGAGATAAG TGATGGAGAT
GTGATAATTT CAGGAAACAA AAATTTGTGC TATGCAAATA CAATAAACTG GAAAAAACTG
TTTGGGACCT CCGGTCAGAA AACCAAAATT ATAAGCAACA GAGGTGAAAA CAGCTGCAAG
GCCACAGGCC AGGTCTGCCA TGCCTTGTGC TCCCCCGAGG GCTGCTGGGG CCCGGAGCCC
AGGGACTGCG TCTCTTGCCG GAATGTCAGC CGAGGCAGGG AATGCGTGGA CAAGTGCAAC
CTTCTGGAGG GTGAGCCAAG GGAGTTTGTG GAGAACTCTG AGTGCATACA GTGCCACCCA
GAGTGCCTGC CTCAGGCCAT GAACATCACC TGCACAGGAC GGGGACCAGA CAACTGTATC
CAGTGTGCCC ACTACATTGA CGGCCCCCAC TGCGTCAAGA CCTGCCCGGC AGGAGTCATG
GGAGAAAACA ACACCCTGGT CTGGAAGTAC GCAGACGCCG GCCATGTGTG CCACCTGTGC
CATCCAAACT GCACCTACGG ATGCACTGGG CCAGGTCTTG AAGGCTGTCC AACGAATGGG
CCTAAGATCC CGTCCATCGC CACTGGGATG GTGGGGGCCC TCCTCTTGCT GCTGGTGGTG
GCCCTGGGGA TCGGCCTCTT CATGCGAAGG CGCCACATCG TTCGGAAGCG CACGCTGCGG
AGGCTGCTGC AGGAGAGGGA GCTTGTGGAG CCTCTTACAC CCAGTGGAGA AGCTCCCAAC
CAAGCTCTCT TGAGGATCTT GAAGGAAACT GAATTCAAAA AGATCAAAGT GCTGGGCTCC
GGTGCGTTCG GCACGGTGTA TAAGGGACTC TGGATCCCAG AAGGTGAGAA AGTTAAAATT
CCCGTCGCTA TCAAGGAATT AAGAGAAGCA ACATCTCCGA AAGCCAACAA GGAAATCCTC
GATGAAGCCT ACGTGATGGC CAGCGTGGAC AACCCCCACG TGTGCCGCCT GCTGGGCATC
TGCCTCACCT CCACCGTGCA GCTCATCACG CAGCTCATGC CCTTCGGCTG CCTCCTGGAC
TATGTCCGGG AACACAAAGA CAATATTGGC TCCCAGTACC TGCTCAACTG GTGTGTGCAG
ATCGCAAAGG GCATGAACTA CTTGGAGGAC CGTCGCTTGG TGCACCGCGA CCTGGCAGCC
AGGAACGTAC TGGTGAAAAC ACCGCAGCAT GTCAAGATCA CAGATTTTGG GCTGGCCAAA
CTGCTGGGTG CGGAAGAGAA AGAATACCAT GCAGAAGGAG GCAAAGTGCC TATCAAGTGG
ATGGCATTGG AATCAATTTT ACACAGAATC TATACCCACC AGAGTGATGT CTGGAGCTAC
GGGGTGACCG TTTGGGAGTT GATGACCTTT GGATCCAAGC CATATGACGG AATCCCTGCC
AGCGAGATCT CCTCCATCCT GGAGAAAGGA GAACGCCTCC CTCAGCCACC CATATGTACC
ATCGATGTCT ACATGATCAT GGTCAAGTGC TGGATGATAG ACGCAGATAG TCGCCCAAAG
TTCCGTGAGT TGATCATCGA ATTCTCCAAA ATGGCCCGAG ACCCCCAGCG CTACCTTGTC
ATTCAGGGGG ATGAAAGAAT GCATTTGCCA AGTCCTACAG ACTCCAACTT CTACCGTGCC
CTGATGGATG AAGAAGACAT GGACGACGTG GTGGATGCCG ACGAGTACCT CATCCCACAG
CAGGGCTTCT TCAGCAGCCC CTCCACGTCA CGGACTCCCC TCCTGAGCTC TCTGAGTGCA
ACCAGCAACA ATTCCACCGT GGCTTGCATT GATAGAAATG GGCTGCAAAG CTGTCCCATC
AAGGAAGACA GCTTCTTGCA GCGATACAGC TCAGACCCCA CAGGCGCCTT GACTGAGGAC
AGCATAGACG ACACCTTCCT CCCAGTGCCT GAATACATAA ACCAGTCCGT TCCCAAAAGG
CCCGCTGGCT CTGTGCAGAA TCCTGTCTAT CACAATCAGC CTCTGAACCC CGCGCCCAGC
AGAGACCCAC ACTACCAGGA CCCCCACAGC ACTGCAGTGG GCAACCCCGA GTATCTCAAC
ACTGTCCAGC CCACCTGTGT CAACAGCACA TTCGACAGCC CTGCCCACTG GGCCCAGAAA
GGCAGCCACC AAATTAGCCT GGACAACCCT GACTACCAGC AGGACTTCTT TCCCAAGGAA
GCCAAGCCAA ATGGCATCTT TAAGGGCTCC ACAGCTGAAA ATGCAGAATA CCTAAGGGTC
GCGCCACAAA GCAGTGAATT TATTGGAGCA TGA
The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
RefSeqNP_005219.2
CDS247..3879
Misc Feature(1)208..210(+)
Misc Feature(2)337..420(+)
Misc Feature(3)412..414(+)
Misc Feature(4)415..750(+)
Misc Feature(5)469..1146(+)
Misc Feature(6)628..630(+)
Misc Feature(7)715..807(+)
Misc Feature(8)769..771(+)
Misc Feature(9)799..1257(+)
Misc Feature(10)814..843(+)
Misc Feature(11)826..867(+)
Misc Feature(12)832..834(+)
Misc Feature(13)889..915(+)
Misc Feature(14)901..939(+)
Misc Feature(15)931..933(+)
Misc Feature(16)937..1068(+)
Misc Feature(17)940..966(+)
Misc Feature(18)952..990(+)
Misc Feature(19)997..1026(+)
Misc Feature(20)1036..1119(+)
Misc Feature(21)1129..1167(+)
Misc Feature(22)1177..1224(+)
Misc Feature(23)1231..1245(+)
Misc Feature(24)1255..1332(+)
Misc Feature(25)1300..1302(+)
Misc Feature(26)1327..1689(+)
Misc Feature(27)1327..1329(+)
Misc Feature(28)1414..2046(+)
Misc Feature(29)1483..1485(+)
Misc Feature(30)1576..1578(+)
Misc Feature(31)1654..1743(+)
Misc Feature(32)1759..2157(+)
Misc Feature(33)1762..1923(+)
Misc Feature(34)1762..1791(+)
Misc Feature(35)1774..1815(+)
Misc Feature(36)1822..1851(+)
Misc Feature(37)1828..1830(+)
Misc Feature(38)1861..1911(+)
Misc Feature(39)1918..>2040(+)
Misc Feature(40)1918..1959(+)
Misc Feature(41)1930..1983(+)
Misc Feature(42)1948..1950(+)
Misc Feature(43)1990..2019(+)
Misc Feature(44)2029..2097(+)
Misc Feature(45)2053..2055(+)
Misc Feature(46)2104..2130(+)
Misc Feature(47)2113..2115(+)
Misc Feature(48)2116..2154(+)
Misc Feature(49)2146..2277(+)
Misc Feature(50)2176..2217(+)
Misc Feature(51)2182..2250(+)
Misc Feature(52)2278..2280(+)
Misc Feature(53)2278..2280(+)
Misc Feature(54)2308..2358(+)
Misc Feature(55)2323..2325(+)
Misc Feature(56)2323..2325(+)
Misc Feature(57)2329..2331(+)
Misc Feature(58)2356..3294(+)
Misc Feature(59)2380..3150(+)
Misc Feature(60)2389..3276(+)
Misc Feature(61)2398..2913(+)
Misc Feature(62)2398..2811(+)
Misc Feature(63)2425..2427(+)
Misc Feature(64)2548..2550(+)
Misc Feature(65)2806..2883(+)
Misc Feature(66)2851..2853(+)
Misc Feature(67)2872..2913(+)
Misc Feature(68)2917..2919(+)
Misc Feature(69)2989..2991(+)
Misc Feature(70)3076..3078(+)
Misc Feature(71)3178..3180(+)
Misc Feature(72)3217..3219(+)
Misc Feature(73)3217..3219(+)
Misc Feature(74)3229..3231(+)
Misc Feature(75)3229..3231(+)
Misc Feature(76)3238..3240(+)
Misc Feature(77)3238..3240(+)
Misc Feature(78)3292..3294(+)
Misc Feature(79)3292..3294(+)
Misc Feature(80)3292..3294(+)
Misc Feature(81)3292..3294(+)
Misc Feature(82)3292..3294(+)
Misc Feature(83)3322..3324(+)
Misc Feature(84)3322..3324(+)
Misc Feature(85)3352..3354(+)
Misc Feature(86)3355..3357(+)
Misc Feature(87)3361..3363(+)
Misc Feature(88)3361..3363(+)
Misc Feature(89)3367..3369(+)
Misc Feature(90)3367..3369(+)
Misc Feature(91)3370..3372(+)
Misc Feature(92)3370..3372(+)
Misc Feature(93)3379..3381(+)
Misc Feature(94)3436..3438(+)
Misc Feature(95)3436..3438(+)
Misc Feature(96)3451..3453(+)
Misc Feature(97)3451..3453(+)
Misc Feature(98)3451..3453(+)
Misc Feature(99)3451..3453(+)
Misc Feature(100)3451..3453(+)
Misc Feature(101)3454..3456(+)
Misc Feature(102)3454..3456(+)
Misc Feature(103)3454..3456(+)
Misc Feature(104)3457..3459(+)
Misc Feature(105)3457..3459(+)
Misc Feature(106)3457..3459(+)
Misc Feature(107)3487..3489(+)
Misc Feature(108)3487..3489(+)
Misc Feature(109)3520..3522(+)
Misc Feature(110)3520..3522(+)
Misc Feature(111)3520..3522(+)
Misc Feature(112)3574..3576(+)
Misc Feature(113)3574..3576(+)
Misc Feature(114)3604..3606(+)
Misc Feature(115)3619..3621(+)
Misc Feature(116)3658..3660(+)
Misc Feature(117)3742..3744(+)
Misc Feature(118)3742..3744(+)
Misc Feature(119)3760..3762(+)
Misc Feature(120)3760..3762(+)
Misc Feature(121)3835..3837(+)
Misc Feature(122)3835..3837(+)
Misc Feature(123)3835..3837(+)
Misc Feature(124)3841..3843(+)
Exon (1)1..334
Gene:EGFR
Gene Synonym:
Exon (2)335..486
Gene:EGFR
Gene Synonym:
Exon (3)487..670
Gene:EGFR
Gene Synonym:
Exon (4)671..805
Gene:EGFR
Gene Synonym:
Exon (5)806..874
Gene:EGFR
Gene Synonym:
Exon (6)875..993
Gene:EGFR
Gene Synonym:
Exon (7)994..1135
Gene:EGFR
Gene Synonym:
Exon (8)1136..1252
Gene:EGFR
Gene Synonym:
Exon (9)1253..1379
Gene:EGFR
Gene Synonym:
Exon (10)1380..1453
Gene:EGFR
Gene Synonym:
Exon (11)1454..1544
Gene:EGFR
Gene Synonym:
Exon (12)1545..1744
Gene:EGFR
Gene Synonym:
Exon (13)1745..1877
Gene:EGFR
Gene Synonym:
Exon (14)1878..1968
Gene:EGFR
Gene Synonym:
Exon (15)1969..2126
Gene:EGFR
Gene Synonym:
Exon (16)2127..2165
Gene:EGFR
Gene Synonym:
Exon (17)2166..2307
Gene:EGFR
Gene Synonym:
Exon (18)2308..2430
Gene:EGFR
Gene Synonym:
Exon (19)2431..2529
Gene:EGFR
Gene Synonym:
Exon (20)2530..2715
Gene:EGFR
Gene Synonym:
Exon (21)2716..2871
Gene:EGFR
Gene Synonym:
Exon (22)2872..2947
Gene:EGFR
Gene Synonym:
Exon (23)2948..3094
Gene:EGFR
Gene Synonym:
Exon (24)3095..3192
Gene:EGFR
Gene Synonym:
Exon (25)3193..3360
Gene:EGFR
Gene Synonym:
Exon (26)3361..3408
Gene:EGFR
Gene Synonym:
Exon (27)3409..3517
Gene:EGFR
Gene Synonym:
Exon (28)3518..5600
Gene:EGFR
Gene Synonym:
Translation
Position Chain Variation Link
31 31 g, t dbSNP:712829
37 37 c, t dbSNP:566284155
56 56 a, c dbSNP:712830
113 113 c, t dbSNP:551488510
171 171 c, t dbSNP:570107879
178 178 c, t dbSNP:537165657
184 184 c, g dbSNP:555477367
203 203 a, t dbSNP:17288945
209 209 g, t dbSNP:746536427
215 215 c, g, t dbSNP:375923119
226 226 c, t dbSNP:781240283
244 244 a, g dbSNP:748159429
245 245 c, t dbSNP:769658183
253 253 a, c dbSNP:773069229
254 254 c, t dbSNP:749433287
257 257 c, t dbSNP:771210838
259 259 c, g dbSNP:774487133
260 260 a, g dbSNP:759582787
262 262 a, g dbSNP:767651648
264 264 c, g dbSNP:775964175
265 265 c, g, t dbSNP:761183109
267 267 c, t dbSNP:369581368
268 268 a, g dbSNP:754259847
276 276 g, t dbSNP:757936561
279 279 c, t dbSNP:766029589
284 284 c, t dbSNP:567894670
298 298 c, t dbSNP:754527029
302 302 c, g dbSNP:780865931
307 307 a, g, t dbSNP:373129709
324 324 a, g dbSNP:777385414
328 328 a, g dbSNP:749088691
330 330 a, g dbSNP:770673046
332 332 a, c dbSNP:774551548
339 339 c, t dbSNP:372917131
341 341 a, g dbSNP:746023542
343 343 a, g dbSNP:772311777
347 347 c, g dbSNP:144158123
348 348 a, g, t dbSNP:148679319
362 362 c, t dbSNP:375919121
363 363 a, g dbSNP:777186292
367 367 c, t dbSNP:762281800
373 373 a, g dbSNP:147740818
396 396 c, t dbSNP:770133522
399 399 c, t dbSNP:773745636
404 404 a, g dbSNP:759219499
413 413 a, g dbSNP:767259994
420 420 c, t dbSNP:752438083
421 421 a, g dbSNP:760228905
422 422 a, c dbSNP:763572530
458 458 a, g dbSNP:369580836
468 468 c, t dbSNP:200383389
472 472 a, c dbSNP:778638117
477 477 c, g dbSNP:61731794
487 487 a, g dbSNP:374986786
496 496 a, c, g dbSNP:753319070
509 509 a, g dbSNP:765137528
514 514 c, t dbSNP:750399097
515 515 a, t dbSNP:142061256
521 521 c, t dbSNP:779879611
529 529 a, c dbSNP:35515689
534 534 a, g dbSNP:751744275
535 535 c, g dbSNP:755189573
539 539 a, g, t dbSNP:17289589
545 545 a, c dbSNP:376963968
556 556 c, t dbSNP:756305742
561 561 a, c, g dbSNP:141271101
562 562 a, g dbSNP:771366736
572 572 c, g dbSNP:145113601
578 578 c, t dbSNP:746631025
585 585 c, t dbSNP:374582814
591 591 a, t dbSNP:773596817
600 600 c, t dbSNP:147726446
618 618 c, t dbSNP:142553829
625 625 a, g dbSNP:377444977
632 632 a, c dbSNP:762889647
636 636 c, t dbSNP:766093262
646 646 a, g dbSNP:751337426
655 655 a, g dbSNP:754854319
669 669 g, t dbSNP:767608234
680 680 a, g dbSNP:780476417
684 684 c, g, t dbSNP:199637112
685 685 a, g dbSNP:532655845
687 687 c, g, t dbSNP:138946543
691 691 c, t dbSNP:774146556
692 692 a, g dbSNP:759532524
701 701 a, g dbSNP:551591429
714 714 a, g, t dbSNP:149006234
720 720 c, t dbSNP:2072454
739 739 c, t dbSNP:587778252
740 740 a, g dbSNP:761795138
746 746 c, t dbSNP:765416003
748 748 c, g dbSNP:530692924
755 755 a, g, t dbSNP:758945260
759 759 a, c, t dbSNP:17289686
765 765 c, t dbSNP:777401847
771 771 c, t dbSNP:749002473
776 776 c, t dbSNP:770290445
777 777 a, g dbSNP:17336437
780 780 a, g dbSNP:745755245
793 793 a, c, g dbSNP:772071414
804 804 c, t dbSNP:375037710
807 807 c, t dbSNP:776568205
813 813 a, g dbSNP:748275089
820 820 a, c dbSNP:770074413
825 825 c, t dbSNP:773349388
828 828 c, t dbSNP:763086693
833 833 a, g dbSNP:766507267
840 840 c, t dbSNP:370376501
852 852 a, c dbSNP:748320322
856 856 a, g dbSNP:767829342
870 870 a, g dbSNP:753129657
878 878 c, g dbSNP:779156097
879 879 c, t dbSNP:373970245
880 880 a, c dbSNP:750423932
900 900 g, t dbSNP:776050604
904 904 c, t dbSNP:761098433
906 906 c, t dbSNP:45621033
907 907 a, g, t dbSNP:776886714
909 909 a, g dbSNP:766104143
911 911 a, g dbSNP:751295137
917 917 a, g dbSNP:759106015
921 921 -, c dbSNP:145506643
925 925 c, t dbSNP:766952405
929 929 a, c dbSNP:752616839
937 937 g, t dbSNP:756040606
938 938 c, g dbSNP:777575581
945 945 c, t dbSNP:763962907
968 968 c, t dbSNP:370744986
972 972 c, g, t dbSNP:374561933
976 976 c, t dbSNP:554981236
977 977 a, g dbSNP:200664836
984 984 c, t dbSNP:772130986
985 985 a, c, g dbSNP:780001754
992 992 c, t dbSNP:765893589
1000 1000 c, g dbSNP:775252718
1001 1001 a, g dbSNP:760101437
1004 1004 a, g dbSNP:374084791
1009 1009 c, t dbSNP:776490661
1010 1010 a, g dbSNP:372202099
1014 1014 c, t dbSNP:146098757
1015 1015 a, g dbSNP:138847501
1020 1020 c, t dbSNP:142569931
1022 1022 c, t dbSNP:766478921
1023 1023 a, g dbSNP:751873368
1032 1032 c, t dbSNP:754997451
1038 1038 c, t dbSNP:781427942
1040 1040 a, c dbSNP:748627278
1043 1043 a, c, g dbSNP:17336639
1068 1068 a, g dbSNP:749588554
1073 1073 a, g dbSNP:771396903
1080 1080 c, t dbSNP:774995708
1089 1089 c, t dbSNP:746685847
1090 1090 a, g dbSNP:199796955
1099 1099 c, t dbSNP:776146284
1107 1107 c, t dbSNP:761685805
1111 1111 a, g dbSNP:769696078
1112 1112 c, t dbSNP:149840192
1119 1119 c, t dbSNP:570790705
1120 1120 a, g dbSNP:150549265
1121 1121 c, t dbSNP:762649354
1125 1125 a, g dbSNP:766252686
1135 1135 c, t dbSNP:751667358
1147 1147 g, t dbSNP:779094647
1158 1158 a, c, t dbSNP:182002674
1161 1161 a, c, t dbSNP:566001525
1164 1164 a, c, g dbSNP:202182545
1167 1167 c, t dbSNP:17289893
1168 1168 a, g dbSNP:749132706
1181 1181 c, g dbSNP:770879879
1184 1184 c, t dbSNP:149321481
1186 1186 a, g dbSNP:552062864
1190 1190 a, g dbSNP:745658347
1191 1191 c, t dbSNP:772053702
1200 1200 g, t dbSNP:775800262
1206 1206 a, g dbSNP:760984499
1209 1209 c, t dbSNP:764038041
1210 1210 a, g dbSNP:776791214
1213 1213 a, g dbSNP:761844164
1214 1214 c, t dbSNP:367680488
1215 1215 a, c dbSNP:201040971
1217 1217 a, g dbSNP:758748662
1219 1219 a, c dbSNP:766740458
1221 1221 a, g dbSNP:752278049
1228 1228 a, c dbSNP:144460286
1231 1231 c, t dbSNP:777342222
1233 1233 c, t dbSNP:748801348
1234 1234 a, g dbSNP:139429793
1235 1235 a, g, t dbSNP:778901010
1247 1247 a, g dbSNP:771929085
1274 1274 g, t dbSNP:771398183
1275 1275 c, t dbSNP:774905136
1289 1289 c, t dbSNP:371234907
1293 1293 c, g dbSNP:759932677
1297 1297 a, g dbSNP:767790289
1307 1307 c, t dbSNP:753466844
1332 1332 c, t dbSNP:547057636
1347 1347 c, t dbSNP:185327606
1348 1348 c, g dbSNP:749927550
1349 1349 a, t dbSNP:758017949
1351 1351 a, c dbSNP:780131926
1356 1356 c, t dbSNP:539077864
1365 1365 a, g dbSNP:2302536
1371 1371 a, c dbSNP:780851909
1393 1393 a, c dbSNP:755972013
1413 1413 a, g dbSNP:777959179
1420 1420 c, t dbSNP:749526261
1423 1423 c, g dbSNP:587778246
1438 1438 a, g dbSNP:757265130
1456 1456 a, t dbSNP:777165081
1461 1461 a, g dbSNP:748900962
1484 1484 a, g dbSNP:770466526
1491 1491 g, t dbSNP:774121381
1494 1494 c, g dbSNP:758956103
1497 1497 a, c, t dbSNP:767070097
1507 1507 a, g dbSNP:760639592
1515 1515 a, g dbSNP:763830096
1519 1519 a, g dbSNP:558565565
1522 1522 a, g dbSNP:201364864
1527 1527 c, t dbSNP:367896493
1529 1529 a, g dbSNP:606231253
1535 1535 a, c dbSNP:765369188
1544 1544 a, g dbSNP:750713244
1563 1563 a, g dbSNP:17290005
1566 1566 c, t dbSNP:761495014
1571 1571 a, g dbSNP:765091640
1579 1579 a, g dbSNP:372990493
1588 1588 c, t dbSNP:750541010
1590 1590 a, c, g dbSNP:763266323
1597 1597 c, t dbSNP:377567759
1598 1598 a, g dbSNP:751667594
1617 1617 c, t dbSNP:755147377
1620 1620 c, g, t dbSNP:146711874
1624 1624 a, g dbSNP:753269876
1628 1628 c, t dbSNP:200592648
1636 1636 a, g, t dbSNP:746763556
1641 1641 a, c dbSNP:199754312
1659 1659 c, t dbSNP:771736232
1668 1668 a, c dbSNP:779726192
1673 1673 a, g dbSNP:746521110
1683 1683 a, c dbSNP:768208443
1684 1684 c, t dbSNP:147732025
1689 1689 g, t dbSNP:587778247
1698 1698 c, t dbSNP:568681121
1699 1699 a, g dbSNP:769434273
1710 1710 a, c dbSNP:773079786
1716 1716 a, t dbSNP:762704534
1717 1717 a, g dbSNP:768500612
1730 1730 a, g dbSNP:766676440
1737 1737 c, t dbSNP:774773441
1753 1753 a, g dbSNP:760711480
1755 1755 c, t dbSNP:17336800
1778 1778 a, c dbSNP:371114444
1780 1780 c, t dbSNP:587778248
1782 1782 a, c, t dbSNP:374670788
1783 1783 a, g, t dbSNP:754646330
1798 1798 c, t dbSNP:368484180
1799 1799 c, t dbSNP:564398642
1800 1800 a, g dbSNP:142429250
1802 1802 a, g dbSNP:749186957
1803 1803 g, t dbSNP:116057045
1808 1808 a, c, g, t dbSNP:2227983
1809 1809 a, g dbSNP:745709532
1815 1815 c, t dbSNP:761127339
1816 1816 a, g dbSNP:587778249
1818 1818 c, t dbSNP:760800224
1825 1825 c, t dbSNP:768627073
1826 1826 a, g dbSNP:150477666
1828 1828 a, g dbSNP:762336338
1830 1830 c, t dbSNP:765534683
1848 1848 a, g dbSNP:529355260
1851 1851 c, t dbSNP:763346690
1852 1852 a, g dbSNP:767193132
1853 1853 c, t dbSNP:752350337
1876 1876 a, g dbSNP:755584255
1877 1877 a, g dbSNP:764356379
1878 1878 c, t dbSNP:17290103
1879 1879 a, g dbSNP:778985185
1893 1893 c, t dbSNP:750403646
1902 1902 c, t dbSNP:758141603
1907 1907 a, g dbSNP:779741928
1914 1914 a, g dbSNP:747203424
1917 1917 a, g dbSNP:768735314
1920 1920 c, t dbSNP:781514400
1924 1924 a, c dbSNP:748219780
1927 1927 c, g dbSNP:769918274
1933 1933 c, t dbSNP:775394093
1936 1936 a, c, t dbSNP:773651001
1945 1945 a, g dbSNP:771278492
1955 1955 c, g dbSNP:774558548
1961 1961 c, g dbSNP:759987693
1966 1966 c, t dbSNP:760471492
1967 1967 a, g dbSNP:370810719
1974 1974 a, t dbSNP:538447477
1979 1979 a, g dbSNP:556794990
1983 1983 c, t dbSNP:776359891
1985 1985 c, t dbSNP:761585117
1987 1987 a, c dbSNP:764787649
1995 1995 c, t dbSNP:141232284
2003 2003 c, t dbSNP:542237406
2007 2007 c, t dbSNP:766220964
2012 2012 a, c dbSNP:751570775
2013 2013 c, t dbSNP:754671343
2019 2019 c, t dbSNP:767304301
2020 2020 a, g dbSNP:144943614
2021 2021 c, t dbSNP:28384375
2023 2023 a, c dbSNP:371483915
2025 2025 c, g dbSNP:756307243
2027 2027 a, c dbSNP:778011429
2034 2034 a, g dbSNP:17290162
2035 2035 g, t dbSNP:757419349
2039 2039 g, t dbSNP:139236063
2044 2044 a, g, t dbSNP:746395542
2045 2045 c, t dbSNP:149375515
2048 2048 a, g dbSNP:201498575
2052 2052 a, g dbSNP:747423535
2055 2055 c, t dbSNP:769537072
2058 2058 c, t dbSNP:773064203
2062 2062 c, g dbSNP:143152775
2064 2064 a, g, t dbSNP:148242307
2067 2067 c, t dbSNP:377048120
2076 2076 c, t dbSNP:115350205
2077 2077 a, g dbSNP:201061916
2082 2082 c, t dbSNP:150803480
2083 2083 a, g dbSNP:764290273
2085 2085 a, c, t dbSNP:17290169
2086 2086 a, g dbSNP:779076899
2087 2087 a, g dbSNP:750850720
2093 2093 c, t dbSNP:756534868
2097 2097 c, t dbSNP:143422127
2105 2105 a, g dbSNP:150899403
2113 2113 a, t dbSNP:747376358
2117 2117 g, t dbSNP:28384376
2118 2118 c, t dbSNP:769203592
2124 2124 c, t dbSNP:533525993
2125 2125 a, g dbSNP:753315940
2133 2133 a, g, t dbSNP:2227984
2137 2137 c, t dbSNP:552265738
2146 2146 a, g dbSNP:765068810
2151 2151 c, t dbSNP:371148125
2158 2158 a, g dbSNP:762592162
2159 2159 c, t dbSNP:571064657
2160 2160 a, g dbSNP:146783627
2164 2164 g, t dbSNP:200989322
2177 2177 c, t dbSNP:770443325
2178 2178 a, g, t dbSNP:367909827
2180 2180 c, g dbSNP:772046081
2182 2182 a, c dbSNP:140516819
2184 2184 c, t dbSNP:760450694
2185 2185 a, g dbSNP:764359156
2189 2189 c, g, t dbSNP:776728879
2190 2190 c, t dbSNP:765441420
2193 2193 c, g dbSNP:531361756
2198 2198 g, t dbSNP:758954817
2209 2209 c, g dbSNP:767037049
2217 2217 g, t dbSNP:751948988
2221 2221 c, g dbSNP:201580890
2222 2222 c, t dbSNP:755356995
2232 2232 g, t dbSNP:377187758
2235 2235 a, g dbSNP:748898746
2236 2236 a, t dbSNP:756705853
2238 2238 c, t dbSNP:200855539
2239 2239 a, g dbSNP:745422316
2242 2242 c, t dbSNP:771988878
2244 2244 c, g dbSNP:779909747
2248 2248 a, g dbSNP:746757722
2249 2249 g, t dbSNP:76946721
2252 2252 a, g dbSNP:768336804
2256 2256 a, g, t dbSNP:776875545
2257 2257 c, t dbSNP:770193776
2259 2259 a, c dbSNP:773398218
2265 2265 c, t dbSNP:763193362
2266 2266 a, g, t dbSNP:17337079
2270 2270 a, g dbSNP:150423237
2271 2271 a, c, g dbSNP:372471129
2276 2276 a, g dbSNP:756870976
2279 2279 c, t dbSNP:138193597
2280 2280 a, g, t dbSNP:780214453
2281 2281 c, t dbSNP:374117790
2284 2284 c, t dbSNP:369399038
2285 2285 a, g dbSNP:373336251
2289 2289 a, g dbSNP:746948587
2293 2293 c, t dbSNP:55669340
2308 2308 c, t dbSNP:749554270
2311 2311 c, g dbSNP:397517083
2340 2340 c, t dbSNP:370409092
2347 2347 a, c dbSNP:774261340
2351 2351 c, t dbSNP:549015965
2355 2355 c, g dbSNP:746027140
2363 2363 c, t dbSNP:397517084
2371 2371 a, g dbSNP:727504256
2372 2372 a, c, g, t dbSNP:397517085
2373 2373 aact, c dbSNP:397517087
2373 2373 -, aac dbSNP:397517086
2376 2376 c, t dbSNP:775986651
2384 2384 a, c dbSNP:373578289
2391 2391 c, t dbSNP:764470595
2400 2400 a, g, t dbSNP:397517088
2401 2401 a, c, g, t dbSNP:28929495
2402 2402 a, c, g dbSNP:121913428
2405 2405 c, g dbSNP:772799315
2411 2411 c, t dbSNP:762494280
2412 2412 a, c, g dbSNP:367694667
2415 2415 c, t dbSNP:370590012
2418 2418 c, t dbSNP:754578411
2420 2420 c, t dbSNP:767505234
2421 2421 a, c, g dbSNP:55959834
2422 2422 a, g dbSNP:483352805
2424 2424 a, g dbSNP:777735216
2426 2426 a, g dbSNP:138240620
2434 2434 c, g, t dbSNP:121913434
2435 2435 c, g, t dbSNP:771995749
2436 2436 c, g dbSNP:758357735
2438 2438 a, g dbSNP:397517089
2439 2439 a, g dbSNP:121913467
2444 2444 c, t dbSNP:121913446
2446 2446 a, g dbSNP:121913420
2449 2449 a, g dbSNP:121913430
2463 2463 a, t dbSNP:780083331
2464 2464 a, g dbSNP:747133806
2465 2465 c, t dbSNP:397517092
2466 2466 c, t dbSNP:769149292
2469 2469 a, c, t dbSNP:372772241
2470 2470 a, g dbSNP:587778250
2471 2471 c, t dbSNP:121913466
2472 2472 c, t dbSNP:773835994
2473 2473 a, g dbSNP:759256622
2476 2476 atcaaggaattaagagaagc, gtcaa dbSNP:727503014
2477 2477 -, aaaattcccgtcgcta dbSNP:727504326
2478 2478 aaagtt, caaggaattaagagaagcaac dbSNP:727504428
2478 2478 -, caaggaattaagagaagca dbSNP:727504324
2478 2478 aaa, caaggaattaagagaagc dbSNP:397517094
2478 2478 -, aaaattcccgtcgctatc dbSNP:397517090
2478 2478 c, t dbSNP:397517093
2480 2480 -, aattcccgtcgctatcaa dbSNP:397517091
2480 2480 a, g dbSNP:121913433
2481 2481 aattc, ggaattaagagaagcaa dbSNP:727504332
2481 2481 -, ggaattaagagaagc dbSNP:121913421
2481 2481 aattc, ggaattaagagaag dbSNP:727504281
2481 2481 -, ggaattaag dbSNP:727504266
2482 2482 -, gaattaagagaagcaaca dbSNP:121913426
2482 2482 at, gaattaagagaagcaac dbSNP:727504402
2482 2482 -, gaattaagagaagca dbSNP:727504233
2482 2482 a, c, g dbSNP:121913427
2483 2483 aattaagagaagcaacatctc, tct dbSNP:727504282
2483 2483 aattaagagaagcaacatct, tc dbSNP:121913424
2483 2483 aattaagagaagcaacatc, t dbSNP:727504258
2483 2483 -, aattaagagaagcaacat dbSNP:121913422
2483 2483 -, aattaagagaagcaa dbSNP:121913425
2483 2483 aattaagagaagcaa, ttc dbSNP:727503016
2483 2483 aattaagagaag, cac, ccc dbSNP:727503015
2483 2483 aattaagaga, c dbSNP:727504444
2484 2484 -, attaagagaagcaacatc dbSNP:121913423
2484 2484 attaagagaagcaa, gc dbSNP:727504257
2484 2484 attaagagaag, gc dbSNP:121913435
2485 2485 acgagaga, ttaagagaagcaacatctccgaaagc dbSNP:727504414
2485 2485 ca, ttaagagaagcaacatctcc dbSNP:121913437
2485 2485 a, caat, ttaagagaagcaacatctc dbSNP:727504339
2485 2485 -, ttaagagaagcaacatct dbSNP:121913440
2485 2485 c, ttaagagaagcaa dbSNP:397509368
2485 2485 c, ttaagagaag dbSNP:727504278
2485 2485 -, ttaagagaa dbSNP:121913436
2485 2485 cc, tt dbSNP:397517096
2485 2485 c, t dbSNP:397517095
2486 2486 -, taagagaagcaacatctc dbSNP:121913438
2486 2486 -, taagagaagcaacat dbSNP:121913442
2486 2486 -, taagagaagcaa dbSNP:121913441
2486 2486 -, taagagaag dbSNP:397517098
2486 2486 c, t dbSNP:397517097
2487 2487 aaga, cccg dbSNP:121913439
2493 2493 -, agcaacatctccgaaagc dbSNP:397517099
2494 2494 c, g dbSNP:121913229
2497 2497 acatctccgaaagccaacaaggaaatc, gat dbSNP:727504395
2497 2497 -, acatctccgaaagccaacaaggaaa dbSNP:727504284
2498 2498 aa, catctccgaaagccaacaaggaaatc dbSNP:397517100
2498 2498 c, t dbSNP:727504316
2499 2499 -, atctccgaaagccaacaaggaaat dbSNP:727504232
2500 2500 -, tctccgaaagccaacaaggaaatc dbSNP:121913463
2501 2501 a, c dbSNP:121913464
2503 2503 c, t dbSNP:121913231
2504 2504 c, t dbSNP:559717059
2505 2505 a, g dbSNP:764064214
2506 2506 a, g dbSNP:397517101
2511 2511 c, g dbSNP:727503017
2516 2516 a, g, t dbSNP:397517102
2519 2519 a, g dbSNP:761470472
2523 2523 -, t dbSNP:727503018
2526 2526 c, t dbSNP:397517103
2527 2527 a, g, t dbSNP:121913418
2535 2535 c, g dbSNP:117420095
2536 2536 -, accatc, tccaggaagcct dbSNP:397517106
2538 2538 c, t dbSNP:755011268
2539 2539 a, c, g dbSNP:374873413
2545 2545 g, t dbSNP:759418157
2546 2546 c, t dbSNP:397517107
2548 2548 a, g dbSNP:756614898
2549 2549 -, gcgtggaca dbSNP:146024686
2549 2549 gc, tt dbSNP:397517108
2549 2549 g, t dbSNP:121913465
2550 2550 c, t dbSNP:778199483
2551 2551 -, tggccagcg dbSNP:730880339
2551 2551 a, c, g, t dbSNP:147149347
2552 2552 -, ggccagcgt dbSNP:730880334
2553 2553 a, g dbSNP:757699292
2554 2554 gac, tggg dbSNP:727503019
2555 2555 -, cagcgtgga dbSNP:727503012
2556 2556 -, gggttg dbSNP:397517111
2556 2556 c, t dbSNP:397517110
2557 2557 -, cac, gcgtggaca, gtt dbSNP:397517109
2557 2557 a, g dbSNP:727503020
2558 2558 accc, gcgtggacaaccg dbSNP:121913445
2558 2558 -, tgt dbSNP:727503021
2560 2560 -, acc dbSNP:397517112
2560 2560 c, g dbSNP:746677478
2561 2561 -, ggacaaccc dbSNP:730880333
2562 2562 c, g dbSNP:761020556
2563 2563 -, acaaccccc, cgaaccccc dbSNP:727503013
2563 2563 c, g dbSNP:767075090
2564 2564 a, g dbSNP:121913432
2565 2565 c, t dbSNP:768468531
2566 2566 a, c, g dbSNP:567477136
2567 2567 -, cccccacgt dbSNP:397517113
2568 2568 -, cacgtg dbSNP:397517116
2573 2573 a, g dbSNP:483352806
2574 2574 a, c, g dbSNP:142999400
2575 2575 c, t dbSNP:397517117
2580 2580 a, g, t dbSNP:397517118
2581 2581 g, t dbSNP:397517119
2582 2582 g, t dbSNP:397517120
2586 2586 c, t dbSNP:397517121
2595 2595 a, c, t dbSNP:397517122
2601 2601 c, t dbSNP:148188503
2602 2602 a, g dbSNP:762672864
2604 2604 a, g dbSNP:766193740
2607 2607 a, g dbSNP:1050171
2610 2610 c, t dbSNP:201469865
2611 2611 a, c dbSNP:767674013
2615 2615 c, t dbSNP:121434569
2616 2616 a, g dbSNP:376452156
2626 2626 a, c dbSNP:370289230
2631 2631 c, t dbSNP:375332959
2632 2632 a, g dbSNP:754426793
2639 2639 a, t dbSNP:483352807
2647 2647 c, t dbSNP:757642107
2648 2648 a, g dbSNP:779394350
2655 2655 a, g dbSNP:397517123
2656 2656 a, g dbSNP:552733360
2658 2658 a, g dbSNP:746272455
2662 2662 a, g dbSNP:754652044
2670 2670 c, t dbSNP:780768227
2673 2673 c, t dbSNP:571225968
2674 2674 a, g dbSNP:121913230
2675 2675 a, g dbSNP:121913431
2685 2685 c, t dbSNP:397517124
2688 2688 g, t dbSNP:769195278
2694 2694 c, t dbSNP:544240809
2703 2703 a, g dbSNP:56183713
2709 2709 c, g, t dbSNP:367859869
2710 2710 a, g dbSNP:397517125
2717 2717 a, g dbSNP:483352808
2726 2726 a, t dbSNP:150749913
2730 2730 a, g dbSNP:727504312
2733 2733 a, g dbSNP:41420046
2737 2737 c, t dbSNP:371228501
2738 2738 a, g dbSNP:150036236
2739 2739 c, g, t dbSNP:182196240
2740 2740 c, t dbSNP:745812480
2741 2741 a, g dbSNP:772091823
2743 2743 g, t dbSNP:397517126
2746 2746 c, g, t dbSNP:397517127
2750 2750 a, t dbSNP:397517128
2752 2752 c, t dbSNP:374952732
2753 2753 a, g dbSNP:146121458
2754 2754 c, g, t dbSNP:2229066
2755 2755 a, g dbSNP:761920220
2764 2764 a, g dbSNP:143884981
2769 2769 c, g dbSNP:773720036
2773 2773 a, g dbSNP:146795390
2789 2789 c, t dbSNP:148934350
2790 2790 a, g, t dbSNP:104886012
2814 2814 c, t dbSNP:774578719
2818 2818 a, c, t dbSNP:121913443
2819 2819 g, t dbSNP:121434568
2820 2820 a, g, t dbSNP:397517129
2822 2822 c, t dbSNP:763666690
2826 2826 a, t dbSNP:397517130
2828 2828 a, g, t dbSNP:121913444
2838 2838 a, g dbSNP:397517131
2842 2842 a, g dbSNP:756703787
2843 2843 a, t dbSNP:397517132
2844 2844 a, g dbSNP:397517133
2848 2848 a, g dbSNP:104886013
2858 2858 c, g dbSNP:397517134
2865 2865 a, t dbSNP:764700695
2880 2880 c, t dbSNP:757939047
2883 2883 c, g dbSNP:766161581
2888 2888 c, t dbSNP:397517136
2889 2889 g, t dbSNP:751549547
2897 2897 a, g dbSNP:754772262
2900 2900 c, t dbSNP:397517137
2901 2901 a, c dbSNP:781112955
2909 2909 a, g dbSNP:748000023
2910 2910 c, g dbSNP:756403828
2921 2921 c, t dbSNP:151064287
2928 2928 g, t dbSNP:749270913
2945 2945 a, t dbSNP:376176117
2946 2946 c, t dbSNP:530256683
2950 2950 g, t dbSNP:779015469
2955 2955 a, c, t dbSNP:1140475
2956 2956 a, g dbSNP:538497054
2973 2973 c, t dbSNP:747305344
2992 2992 a, g dbSNP:376822837
2994 2994 c, t dbSNP:41396448
2995 2995 a, g dbSNP:775695605
3009 3009 c, t dbSNP:770529788
3011 3011 a, t dbSNP:773998239
3021 3021 c, t dbSNP:727504306
3022 3022 a, c dbSNP:759179459
3023 3023 a, t dbSNP:767507216
3025 3025 c, t dbSNP:374672672
3046 3046 c, t dbSNP:575565383
3060 3060 a, g dbSNP:763924711
3064 3064 a, g dbSNP:753612121
3069 3069 c, g dbSNP:757493321
3079 3079 a, g dbSNP:779164024
3085 3085 a, c, g dbSNP:368698152
3088 3088 a, g dbSNP:542967903
3101 3101 -, gatagacg dbSNP:773001497
3108 3108 c, t dbSNP:397517138
3109 3109 a, g dbSNP:201830126
3112 3112 a, g dbSNP:104886026
3130 3130 a, c, g, t dbSNP:17337451
3131 3131 a, g dbSNP:144496976
3134 3134 a, g dbSNP:751632602
3144 3144 c, t dbSNP:142305759
3155 3155 a, g dbSNP:755504552
3158 3158 c, t dbSNP:781609053
3163 3163 c, g dbSNP:748491031
3164 3164 a, g dbSNP:756554871
3171 3171 c, g dbSNP:778672343
3173 3173 a, g dbSNP:773034947
3175 3175 c, t dbSNP:1140476
3176 3176 a, g dbSNP:745490627
3188 3188 c, t dbSNP:771888227
3191 3191 a, t dbSNP:775131364
3196 3196 a, g dbSNP:750582201
3203 3203 a, g dbSNP:779583988
3209 3209 a, c, g dbSNP:17290699
3214 3214 c, t dbSNP:781134348
3217 3217 a, c, g dbSNP:748011710
3227 3227 act, gtg dbSNP:587778251
3228 3228 c, t dbSNP:2293347
3233 3233 a, g dbSNP:762795214
3234 3234 a, c dbSNP:771085105
3242 3242 a, g dbSNP:149248025
3243 3243 c, t dbSNP:759622671
3256 3256 -, gaa dbSNP:760292181
3261 3261 a, g dbSNP:55737335
3263 3263 a, c dbSNP:752859687
3270 3270 a, c, t dbSNP:747143752
3271 3271 a, g dbSNP:148019583
3273 3273 c, t dbSNP:754193639
3274 3274 a, g dbSNP:757699239
3283 3283 a, g dbSNP:779716935
3286 3286 a, g dbSNP:751192280
3288 3288 c, t dbSNP:754707212
3297 3297 c, t dbSNP:780539015
3311 3311 a, g dbSNP:747726185
3312 3312 c, g dbSNP:769706147
3315 3315 c, t dbSNP:147381148
3321 3321 c, g dbSNP:777701385
3327 3327 c, t dbSNP:565720057
3332 3332 c, t dbSNP:182857647
3333 3333 a, g dbSNP:141489713
3338 3338 a, g dbSNP:570295933
3339 3339 g, t dbSNP:772400743
3340 3340 a, g dbSNP:775415330
3345 3345 c, t dbSNP:370198879
3346 3346 a, c dbSNP:764626121
3347 3347 c, g, t dbSNP:34352568
3355 3355 a, t dbSNP:762218653
3356 3356 a, c dbSNP:765496858
3358 3358 c, t dbSNP:138104726
3374 3374 a, g dbSNP:375035197
3383 3383 a, c dbSNP:773437153
3385 3385 a, g dbSNP:142442994
3387 3387 -, g dbSNP:148997565
3389 3389 c, t dbSNP:78244461
3395 3395 c, t dbSNP:529174941
3398 3398 a, c, g dbSNP:755574890
3399 3399 c, t dbSNP:753390240
3414 3414 a, c, g dbSNP:758314765
3416 3416 a, g dbSNP:751466686
3421 3421 c, t dbSNP:755238987
3423 3423 c, t dbSNP:781578964
3427 3427 a, c dbSNP:748111724
3439 3439 a, t dbSNP:769949680
3445 3445 a, c dbSNP:778095401
3448 3448 c, t dbSNP:749783044
3449 3449 a, g dbSNP:374501041
3455 3455 a, c, g dbSNP:771471723
3456 3456 c, t dbSNP:41494749
3463 3463 a, c dbSNP:768226783
3469 3469 a, g dbSNP:776375114
3471 3471 c, t dbSNP:140117937
3472 3472 a, c, g dbSNP:764780987
3473 3473 c, t dbSNP:755868272
3477 3477 a, g dbSNP:367750834
3478 3478 a, t dbSNP:751342391
3483 3483 a, c, g dbSNP:184614596
3490 3490 a, g, t dbSNP:371229748
3495 3495 a, c, t dbSNP:373990043
3496 3496 a, g dbSNP:535060253
3506 3506 g, t dbSNP:749400221
3509 3509 c, t dbSNP:771418435
3510 3510 a, g dbSNP:779392990
3514 3514 c, t dbSNP:367870311
3519 3519 a, g dbSNP:759517695
3534 3534 c, t dbSNP:143770509
3535 3535 a, g dbSNP:775345513
3542 3542 a, c dbSNP:760404029
3548 3548 c, g dbSNP:764332519
3549 3549 c, g, t dbSNP:55796214
3553 3553 a, g dbSNP:139388758
3555 3555 c, t dbSNP:750567851
3556 3556 c, t dbSNP:376598259
3563 3563 a, g dbSNP:780439043
3570 3570 c, t dbSNP:113361141
3580 3580 a, c dbSNP:369498625
3581 3581 a, g dbSNP:755330584
3595 3595 a, c dbSNP:777435609
3597 3597 c, t dbSNP:149995949
3598 3598 a, g dbSNP:770749711
3599 3599 c, t dbSNP:773996588
3600 3600 a, g dbSNP:199838215
3612 3612 c, t dbSNP:771991966
3614 3614 c, t dbSNP:775317295
3621 3621 c, t dbSNP:760466207
3629 3629 c, t dbSNP:199738264
3639 3639 g, t dbSNP:768310160
3644 3644 a, t dbSNP:776448547
3646 3646 a, g dbSNP:762016851
3651 3651 a, c, t dbSNP:765499904
3654 3654 c, g, t dbSNP:762946118
3655 3655 a, g dbSNP:780967013
3660 3660 c, t dbSNP:755559525
3669 3669 c, t dbSNP:781668422
3672 3672 c, t dbSNP:753181929
3673 3673 c, g dbSNP:145189325
3690 3690 c, g dbSNP:778725594
3695 3695 c, t dbSNP:745321541