×

EGFR cDNA ORF clone, Homo sapiens (human)

Gene Symbol EGFR
Entrez Gene ID 1956
Full Name epidermal growth factor receptor
Synonyms ERBB, ERBB1, HER1, NISBD2, PIG61, mENA
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

7

7p12

Summary The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. Multiple alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2010]. lac of sum
Disorder MIM:

131550

Disorder Html: Nonsmall cell lung cancer, response to tyrosine kinase inhibitor in,

mRNA and Protein(s)

mRNA Protein Name
NM_201282 NP_958439 epidermal growth factor receptor isoform b precursor
NM_201283 NP_958440 epidermal growth factor receptor isoform c precursor
NM_201284 NP_958441 epidermal growth factor receptor isoform d precursor
NM_005228 NP_005219 epidermal growth factor receptor isoform a precursor

KEGG
hsa04012 ErbB signaling pathway
hsa04060 Cytokine-cytokine receptor interaction
hsa04020 Calcium signaling pathway
hsa04510 Focal adhesion
hsa04010 MAPK signaling pathway
hsa04810 Regulation of actin cytoskeleton
hsa04520 Adherens junction
hsa04540 Gap junction
hsa04912 GnRH signaling pathway
hsa05212 Pancreatic cancer
hsa05214 Glioma
hsa05218 Melanoma
hsa05219 Bladder cancer
hsa05213 Endometrial cancer
hsa05120 Epithelial cell signaling in Helicobacter pylori infection
hsa05215 Prostate cancer
hsa05223 Non-small cell lung cancer
hsa05200 Pathways in cancer
hsa04144 Endocytosis
hsa04320 Dorso-ventral axis formation
hsa05160 Hepatitis C
hsa05205 Proteoglycans in cancer
hsa04151 PI3K-Akt signaling pathway
hsa04066 HIF-1 signaling pathway
hsa04915 Estrogen signaling pathway
hsa04068 FoxO signaling pathway
hsa04921 Oxytocin signaling pathway
hsa05231 Choline metabolism in cancer
hsa05230 Central carbon metabolism in cancer
hsa05206 MicroRNAs in cancer
hsa04014 Ras signaling pathway
hsa04015 Rap1 signaling pathway
Reactome
R-HSA-1236382 Constitutive Signaling by Ligand-Responsive EGFR Cancer Variants
R-HSA-5663202 Diseases of signal transduction
R-HSA-1643685 Disease
R-HSA-5637815 Signaling by Ligand-Responsive EGFR Variants in Cancer
R-HSA-5637812 Signaling by EGFRvIII in Cancer
R-HSA-5638302 Signaling by Overexpressed Wild-Type EGFR in Cancer
R-HSA-5637810 Constitutive Signaling by EGFRvIII
R-HSA-5638303 Inhibition of Signaling by Overexpressed EGFR
R-HSA-2219530 Constitutive Signaling by Aberrant PI3K in Cancer
R-HSA-1643713 Signaling by EGFR in Cancer
R-HSA-2219528 PI3K/AKT Signaling in Cancer
R-HSA-168256 Immune System
R-HSA-1280218 Adaptive Immune System
R-HSA-983705 Signaling by the B Cell Receptor (BCR)
R-HSA-1168372 Downstream signaling events of B Cell Receptor (BCR)
R-HSA-1257604 PIP3 activates AKT signaling
R-HSA-168249 Innate Immune System
R-HSA-2172127 DAP12 interactions
R-HSA-2424491 DAP12 signaling
R-HSA-2454202 Fc epsilon receptor (FCERI) signaling
R-HSA-2871796 FCERI mediated MAPK activation
R-HSA-1280215 Cytokine Signaling in Immune system
R-HSA-5673001 RAF/MAP kinase cascade
R-HSA-512988 Interleukin-3, 5 and GM-CSF signaling
R-HSA-449147 Signaling by Interleukins
R-HSA-2730905 Role of LAT2/NTAL/LAB on calcium mobilization
R-HSA-451927 Interleukin-2 signaling
R-HSA-912526 Interleukin receptor SHC signaling
R-HSA-162582 Signal Transduction
R-HSA-177929 Signaling by EGFR
R-HSA-179812 GRB2 events in EGFR signaling
R-HSA-180336 SHC1 events in EGFR signaling
R-HSA-180292 GAB1 signalosome
R-HSA-5654693 FRS-mediated FGFR1 signaling
R-HSA-5654687 Downstream signaling of activated FGFR1
R-HSA-5654736 Signaling by FGFR1
R-HSA-5654738 Signaling by FGFR2
R-HSA-182971 EGFR downregulation
R-HSA-190236 Signaling by FGFR
R-HSA-5654741 Signaling by FGFR3
R-HSA-212718 EGFR interacts with phospholipase C-gamma
R-HSA-5654708 Downstream signaling of activated FGFR3
R-HSA-5654700 FRS-mediated FGFR2 signaling
R-HSA-5654689 PI-3K cascade:FGFR1
R-HSA-5654695 PI-3K cascade:FGFR2
R-HSA-5654706 FRS-mediated FGFR3 signaling
R-HSA-5654743 Signaling by FGFR4
R-HSA-74751 Insulin receptor signalling cascade
R-HSA-112399 IRS-mediated signalling
R-HSA-5654712 FRS-mediated FGFR4 signaling
R-HSA-112412 SOS-mediated signalling
R-HSA-167044 Signalling to RAS
R-HSA-5654720 PI-3K cascade:FGFR4
R-HSA-74752 Signaling by Insulin receptor
R-HSA-166520 Signalling by NGF
R-HSA-187037 NGF signalling via TRKA from the plasma membrane
R-HSA-187687 Signalling to ERKs
R-HSA-5654716 Downstream signaling of activated FGFR4
R-HSA-5654696 Downstream signaling of activated FGFR2
R-HSA-186797 Signaling by PDGF
R-HSA-186763 Downstream signal transduction
R-HSA-4420097 VEGFA-VEGFR2 Pathway
R-HSA-198203 PI3K/AKT activation
R-HSA-194138 Signaling by VEGF
R-HSA-169893 Prolonged ERK activation events
R-HSA-170984 ARMS-mediated activation
R-HSA-170968 Frs2-mediated activation
R-HSA-5654710 PI-3K cascade:FGFR3
R-HSA-1250196 SHC1 events in ERBB2 signaling
R-HSA-1433557 Signaling by SCF-KIT
R-HSA-1250347 SHC1 events in ERBB4 signaling
R-HSA-1963640 GRB2 events in ERBB2 signaling
R-HSA-1227986 Signaling by ERBB2
R-HSA-1963642 PI3K events in ERBB2 signaling
R-HSA-5683057 MAPK family signaling cascades
R-HSA-5684996 MAPK1/MAPK3 signaling
R-HSA-187706 Signalling to p38 via RIT and RIN
R-HSA-5218921 VEGFR2 mediated cell proliferation
R-HSA-1236394 Signaling by ERBB4
R-HSA-1250342 PI3K events in ERBB4 signaling
R-HSA-372790 Signaling by GPCR
R-HSA-1251932 PLCG1 events in ERBB2 signaling
R-HSA-881907 Gastrin-CREB signalling pathway via PKC and MAPK
R-HSA-2179392 EGFR Transactivation by Gastrin
R-HSA-2428928 IRS-related events triggered by IGF1R
R-HSA-2586552 Signaling by Leptin
R-HSA-2404192 Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
R-HSA-2428924 IGF1R signaling cascade
R-HSA-1266738 Developmental Biology
R-HSA-375165 NCAM signaling for neurite out-growth
R-HSA-373760 L1CAM interactions
R-HSA-422475 Axon guidance
R-HSA-445144 Signal transduction by L1
Pathway Interaction Database
tcptp_pathway Signaling events mediated by TCPTP
syndecan_3_pathway Syndecan-3-mediated signaling events
ecadherin_stabilization_pathway Stabilization and expansion of the E-cadherin adherens junction
lysophospholipid_pathway LPA receptor mediated events
telomerasepathway Regulation of Telomerase
erbb1_receptor_proximal_pathway EGF receptor (ErbB1) signaling pathway
et_egfrpathway EGFR-dependent Endothelin signaling events
a6b1_a6b4_integrin_pathway a6b1 and a6b4 Integrin signaling
erbb1_internalization_pathway Internalization of ErbB1
txa2pathway Thromboxane A2 receptor signaling
ecadherin_keratinocyte_pathway E-cadherin signaling in keratinocytes
erbb_network_pathway ErbB receptor signaling network
arf6_pathway Arf6 signaling events
ptp1bpathway Signaling events mediated by PTP1B
p53downstreampathway Direct p53 effectors
erbb1_downstream_pathway ErbB1 downstream signaling
WikiPathways
WP382 MAPK signaling pathway
WP138 Androgen receptor signaling pathway
WP673 ErbB signaling pathway
WP437 EGFR1 Signaling Pathway
WP51 Regulation of Actin Cytoskeleton
WP61 Delta-Notch Signaling Pathway
WP244 Alpha6-Beta4 Integrin Signaling Pathway
WP1984 Integrated Breast Cancer Pathway
WP2377 Integrated Pancreatic Cancer Pathway
WP2100 AhR pathway
WP2261 Signaling Pathways in Glioblastoma
WP2431 Spinal Cord Injury
WP2363 Gastric cancer network 2
WP2324 AGE/RAGE pathway


Homo sapiens (human) EGFR NP_005219.2
Pan troglodytes (chimpanzee) EGFR XP_519102.3
Macaca mulatta (Rhesus monkey) EGFR XP_001107305.1
Canis lupus familiaris (dog) EGFR XP_533073.3
Bos taurus (cattle) EGFR XP_002696936.2
Mus musculus (house mouse) Egfr NP_997538.1
Rattus norvegicus (Norway rat) Egfr NP_113695.1
Gallus gallus (chicken) EGFR NP_990828.2
Danio rerio (zebrafish) egfra NP_919405.1
Xenopus (Silurana) tropicalis (western clawed frog) egfr XP_002939960.2

Component

ID Name Evidence
GO:0000139 Golgi membrane IEA
GO:0005576 extracellular region IEA
GO:0005615 extracellular space NAS
GO:0005622 intracellular IEA
GO:0005634 nucleus IDA
GO:0005737 cytoplasm IDA
GO:0005768 endosome IDA
GO:0005783 endoplasmic reticulum IEA
GO:0005789 endoplasmic reticulum membrane IEA
GO:0005794 Golgi apparatus IEA
GO:0005886 plasma membrane EXP
GO:0005886 plasma membrane IDA
GO:0005886 plasma membrane TAS
GO:0016020 membrane IDA
GO:0016021 integral to membrane IEA
GO:0016323 basolateral plasma membrane IDA
GO:0030122 AP-2 adaptor complex TAS
GO:0030139 endocytic vesicle IEA
GO:0031965 nuclear membrane IEA
GO:0070435 Shc-EGFR complex ISS

Function

ID Name Evidence
GO:0000166 nucleotide binding IEA
GO:0003690 double-stranded DNA binding NAS
GO:0004710 MAP/ERK kinase kinase activity NAS
GO:0004713 protein tyrosine kinase activity IDA
GO:0004713 protein tyrosine kinase activity IMP
GO:0004713 protein tyrosine kinase activity TAS
GO:0004714 transmembrane receptor protein tyrosine kinase activity TAS
GO:0004716 receptor signaling protein tyrosine kinase activity IEA
GO:0004888 transmembrane receptor activity IDA
GO:0005006 epidermal growth factor receptor activity IDA
GO:0005006 epidermal growth factor receptor activity NAS
GO:0005515 protein binding IPI
GO:0005524 ATP binding IEA
GO:0019903 protein phosphatase binding IPI
GO:0030235 nitric-oxide synthase regulator activity IDA
GO:0042802 identical protein binding IPI
GO:0046982 protein heterodimerization activity IDA
GO:0051015 actin filament binding IDA

Process

ID Name Evidence
GO:0000902 cell morphogenesis IEA
GO:0001503 ossification NAS
GO:0001892 embryonic placenta development IEA
GO:0001942 hair follicle development IEA
GO:0006950 response to stress NAS
GO:0007165 signal transduction EXP
GO:0007165 signal transduction IDA
GO:0007166 cell surface receptor linked signaling pathway IDA
GO:0007173 epidermal growth factor receptor signaling pathway IDA
GO:0007173 epidermal growth factor receptor signaling pathway NAS
GO:0007173 epidermal growth factor receptor signaling pathway TAS
GO:0007202 activation of phospholipase C activity TAS
GO:0007411 axon guidance TAS
GO:0007435 salivary gland morphogenesis IEA
GO:0008283 cell proliferation TAS
GO:0008284 positive regulation of cell proliferation IDA
GO:0016337 cell-cell adhesion IMP
GO:0021795 cerebral cortex cell migration IEA
GO:0030335 positive regulation of cell migration IMP
GO:0031659 positive regulation of cyclin-dependent protein kinase activity involved in G1/S IDA
GO:0035413 positive regulation of catenin import into nucleus IMP
GO:0042059 negative regulation of epidermal growth factor receptor signaling pathway TAS
GO:0042327 positive regulation of phosphorylation IDA
GO:0043006 activation of phospholipase A2 activity by calcium-mediated signaling TAS
GO:0043066 negative regulation of apoptosis IMP
GO:0043406 positive regulation of MAP kinase activity IDA
GO:0045429 positive regulation of nitric oxide biosynthetic process IDA
GO:0046777 protein autophosphorylation IMP
GO:0048546 digestive tract morphogenesis IEA
GO:0050679 positive regulation of epithelial cell proliferation IDA
GO:0050730 regulation of peptidyl-tyrosine phosphorylation IMP
GO:0050999 regulation of nitric-oxide synthase activity IDA
GO:0051205 protein insertion into membrane TAS
GO:0051897 positive regulation of protein kinase B signaling cascade IMP
GO:0060571 morphogenesis of an epithelial fold IEA
GO:0070141 response to UV-A IDA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following EGFR gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the EGFR cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu25365
NM_201282 Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
$69.30
$99.00
OHu25409
NM_201283 Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
$237.30
$339.00
OHu25398 NM_201284 Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu25437
NM_005228 Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
$853.30
$1219.00

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.


CloneID OHu25365
Accession Version NM_201282.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1887bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product epidermal growth factor receptor isoform b precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AW163038.1, X00588.1, AF125253.1 and AF277897.1. Summary: The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. Multiple alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2010]. Transcript Variant: This variant (2) uses a different 3' terminal exon when compared to variant 1. The resulting isoform (b) has a shorter and distinct C-terminus. Only the extracellular domain is present in isoform b. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support SAMEA1968189, SAMEA1968540 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
ATGCGACCCT CCGGGACGGC CGGGGCAGCG CTCCTGGCGC TGCTGGCTGC GCTCTGCCCG 
GCGAGTCGGG CTCTGGAGGA AAAGAAAGTT TGCCAAGGCA CGAGTAACAA GCTCACGCAG
TTGGGCACTT TTGAAGATCA TTTTCTCAGC CTCCAGAGGA TGTTCAATAA CTGTGAGGTG
GTCCTTGGGA ATTTGGAAAT TACCTATGTG CAGAGGAATT ATGATCTTTC CTTCTTAAAG
ACCATCCAGG AGGTGGCTGG TTATGTCCTC ATTGCCCTCA ACACAGTGGA GCGAATTCCT
TTGGAAAACC TGCAGATCAT CAGAGGAAAT ATGTACTACG AAAATTCCTA TGCCTTAGCA
GTCTTATCTA ACTATGATGC AAATAAAACC GGACTGAAGG AGCTGCCCAT GAGAAATTTA
CAGGAAATCC TGCATGGCGC CGTGCGGTTC AGCAACAACC CTGCCCTGTG CAACGTGGAG
AGCATCCAGT GGCGGGACAT AGTCAGCAGT GACTTTCTCA GCAACATGTC GATGGACTTC
CAGAACCACC TGGGCAGCTG CCAAAAGTGT GATCCAAGCT GTCCCAATGG GAGCTGCTGG
GGTGCAGGAG AGGAGAACTG CCAGAAACTG ACCAAAATCA TCTGTGCCCA GCAGTGCTCC
GGGCGCTGCC GTGGCAAGTC CCCCAGTGAC TGCTGCCACA ACCAGTGTGC TGCAGGCTGC
ACAGGCCCCC GGGAGAGCGA CTGCCTGGTC TGCCGCAAAT TCCGAGACGA AGCCACGTGC
AAGGACACCT GCCCCCCACT CATGCTCTAC AACCCCACCA CGTACCAGAT GGATGTGAAC
CCCGAGGGCA AATACAGCTT TGGTGCCACC TGCGTGAAGA AGTGTCCCCG TAATTATGTG
GTGACAGATC ACGGCTCGTG CGTCCGAGCC TGTGGGGCCG ACAGCTATGA GATGGAGGAA
GACGGCGTCC GCAAGTGTAA GAAGTGCGAA GGGCCTTGCC GCAAAGTGTG TAACGGAATA
GGTATTGGTG AATTTAAAGA CTCACTCTCC ATAAATGCTA CGAATATTAA ACACTTCAAA
AACTGCACCT CCATCAGTGG CGATCTCCAC ATCCTGCCGG TGGCATTTAG GGGTGACTCC
TTCACACATA CTCCTCCTCT GGATCCACAG GAACTGGATA TTCTGAAAAC CGTAAAGGAA
ATCACAGGGT TTTTGCTGAT TCAGGCTTGG CCTGAAAACA GGACGGACCT CCATGCCTTT
GAGAACCTAG AAATCATACG CGGCAGGACC AAGCAACATG GTCAGTTTTC TCTTGCAGTC
GTCAGCCTGA ACATAACATC CTTGGGATTA CGCTCCCTCA AGGAGATAAG TGATGGAGAT
GTGATAATTT CAGGAAACAA AAATTTGTGC TATGCAAATA CAATAAACTG GAAAAAACTG
TTTGGGACCT CCGGTCAGAA AACCAAAATT ATAAGCAACA GAGGTGAAAA CAGCTGCAAG
GCCACAGGCC AGGTCTGCCA TGCCTTGTGC TCCCCCGAGG GCTGCTGGGG CCCGGAGCCC
AGGGACTGCG TCTCTTGCCG GAATGTCAGC CGAGGCAGGG AATGCGTGGA CAAGTGCAAC
CTTCTGGAGG GTGAGCCAAG GGAGTTTGTG GAGAACTCTG AGTGCATACA GTGCCACCCA
GAGTGCCTGC CTCAGGCCAT GAACATCACC TGCACAGGAC GGGGACCAGA CAACTGTATC
CAGTGTGCCC ACTACATTGA CGGCCCCCAC TGCGTCAAGA CCTGCCCGGC AGGAGTCATG
GGAGAAAACA ACACCCTGGT CTGGAAGTAC GCAGACGCCG GCCATGTGTG CCACCTGTGC
CATCCAAACT GCACCTACGG GTCCTAA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

RefSeqNP_958439.1
CDS247..2133
Misc Feature(1)208..210(+)
Misc Feature(2)337..420(+)
Misc Feature(3)412..414(+)
Misc Feature(4)415..750(+)
Misc Feature(5)469..1146(+)
Misc Feature(6)628..630(+)
Misc Feature(7)715..807(+)
Misc Feature(8)769..771(+)
Misc Feature(9)799..1257(+)
Misc Feature(10)814..843(+)
Misc Feature(11)826..867(+)
Misc Feature(12)832..834(+)
Misc Feature(13)889..915(+)
Misc Feature(14)901..939(+)
Misc Feature(15)931..933(+)
Misc Feature(16)937..1068(+)
Misc Feature(17)940..966(+)
Misc Feature(18)952..990(+)
Misc Feature(19)997..1026(+)
Misc Feature(20)1036..1119(+)
Misc Feature(21)1129..1167(+)
Misc Feature(22)1177..1224(+)
Misc Feature(23)1231..1245(+)
Misc Feature(24)1255..1332(+)
Misc Feature(25)1300..1302(+)
Misc Feature(26)1327..1689(+)
Misc Feature(27)1327..1329(+)
Misc Feature(28)1414..2046(+)
Misc Feature(29)1483..1485(+)
Misc Feature(30)1576..1578(+)
Misc Feature(31)1654..1743(+)
Misc Feature(32)1759..2127(+)
Misc Feature(33)1762..1923(+)
Misc Feature(34)1762..1791(+)
Misc Feature(35)1774..1815(+)
Misc Feature(36)1822..1851(+)
Misc Feature(37)1828..1830(+)
Misc Feature(38)1861..1911(+)
Misc Feature(39)1918..>2040(+)
Misc Feature(40)1918..1959(+)
Misc Feature(41)1930..1983(+)
Misc Feature(42)1948..1950(+)
Misc Feature(43)1990..2019(+)
Misc Feature(44)2029..2097(+)
Misc Feature(45)2053..2055(+)
Misc Feature(46)2113..2115(+)
Exon (1)1..334
Gene:EGFR
Gene Synonym:
Exon (2)335..486
Gene:EGFR
Gene Synonym:
Exon (3)487..670
Gene:EGFR
Gene Synonym:
Exon (4)671..805
Gene:EGFR
Gene Synonym:
Exon (5)806..874
Gene:EGFR
Gene Synonym:
Exon (6)875..993
Gene:EGFR
Gene Synonym:
Exon (7)994..1135
Gene:EGFR
Gene Synonym:
Exon (8)1136..1252
Gene:EGFR
Gene Synonym:
Exon (9)1253..1379
Gene:EGFR
Gene Synonym:
Exon (10)1380..1453
Gene:EGFR
Gene Synonym:
Exon (11)1454..1544
Gene:EGFR
Gene Synonym:
Exon (12)1545..1744
Gene:EGFR
Gene Synonym:
Exon (13)1745..1877
Gene:EGFR
Gene Synonym:
Exon (14)1878..1968
Gene:EGFR
Gene Synonym:
Exon (15)1969..2126
Gene:EGFR
Gene Synonym:
Exon (16)2127..2239
Gene:EGFR
Gene Synonym:
Translation
Position Chain Variation Link
31 31 g, t dbSNP:712829
37 37 c, t dbSNP:566284155
56 56 a, c dbSNP:712830
113 113 c, t dbSNP:551488510
171 171 c, t dbSNP:570107879
178 178 c, t dbSNP:537165657
184 184 c, g dbSNP:555477367
203 203 a, t dbSNP:17288945
209 209 g, t dbSNP:746536427
215 215 c, g, t dbSNP:375923119
226 226 c, t dbSNP:781240283
244 244 a, g dbSNP:748159429
245 245 c, t dbSNP:769658183
253 253 a, c dbSNP:773069229
254 254 c, t dbSNP:749433287
257 257 c, t dbSNP:771210838
259 259 c, g dbSNP:774487133
260 260 a, g dbSNP:759582787
262 262 a, g dbSNP:767651648
264 264 c, g dbSNP:775964175
265 265 c, g, t dbSNP:761183109
267 267 c, t dbSNP:369581368
268 268 a, g dbSNP:754259847
276 276 g, t dbSNP:757936561
279 279 c, t dbSNP:766029589
284 284 c, t dbSNP:567894670
298 298 c, t dbSNP:754527029
302 302 c, g dbSNP:780865931
307 307 a, g, t dbSNP:373129709
324 324 a, g dbSNP:777385414
328 328 a, g dbSNP:749088691
330 330 a, g dbSNP:770673046
332 332 a, c dbSNP:774551548
339 339 c, t dbSNP:372917131
341 341 a, g dbSNP:746023542
343 343 a, g dbSNP:772311777
347 347 c, g dbSNP:144158123
348 348 a, g, t dbSNP:148679319
362 362 c, t dbSNP:375919121
363 363 a, g dbSNP:777186292
367 367 c, t dbSNP:762281800
373 373 a, g dbSNP:147740818
396 396 c, t dbSNP:770133522
399 399 c, t dbSNP:773745636
404 404 a, g dbSNP:759219499
413 413 a, g dbSNP:767259994
420 420 c, t dbSNP:752438083
421 421 a, g dbSNP:760228905
422 422 a, c dbSNP:763572530
458 458 a, g dbSNP:369580836
468 468 c, t dbSNP:200383389
472 472 a, c dbSNP:778638117
477 477 c, g dbSNP:61731794
487 487 a, g dbSNP:374986786
496 496 a, c, g dbSNP:753319070
509 509 a, g dbSNP:765137528
514 514 c, t dbSNP:750399097
515 515 a, t dbSNP:142061256
521 521 c, t dbSNP:779879611
529 529 a, c dbSNP:35515689
534 534 a, g dbSNP:751744275
535 535 c, g dbSNP:755189573
539 539 a, g, t dbSNP:17289589
545 545 a, c dbSNP:376963968
556 556 c, t dbSNP:756305742
561 561 a, c, g dbSNP:141271101
562 562 a, g dbSNP:771366736
572 572 c, g dbSNP:145113601
578 578 c, t dbSNP:746631025
585 585 c, t dbSNP:374582814
591 591 a, t dbSNP:773596817
600 600 c, t dbSNP:147726446
618 618 c, t dbSNP:142553829
625 625 a, g dbSNP:377444977
632 632 a, c dbSNP:762889647
636 636 c, t dbSNP:766093262
646 646 a, g dbSNP:751337426
655 655 a, g dbSNP:754854319
669 669 g, t dbSNP:767608234
680 680 a, g dbSNP:780476417
684 684 c, g, t dbSNP:199637112
685 685 a, g dbSNP:532655845
687 687 c, g, t dbSNP:138946543
691 691 c, t dbSNP:774146556
692 692 a, g dbSNP:759532524
701 701 a, g dbSNP:551591429
714 714 a, g, t dbSNP:149006234
720 720 c, t dbSNP:2072454
739 739 c, t dbSNP:587778252
740 740 a, g dbSNP:761795138
746 746 c, t dbSNP:765416003
748 748 c, g dbSNP:530692924
755 755 a, g, t dbSNP:758945260
759 759 a, c, t dbSNP:17289686
765 765 c, t dbSNP:777401847
771 771 c, t dbSNP:749002473
776 776 c, t dbSNP:770290445
777 777 a, g dbSNP:17336437
780 780 a, g dbSNP:745755245
793 793 a, c, g dbSNP:772071414
804 804 c, t dbSNP:375037710
807 807 c, t dbSNP:776568205
813 813 a, g dbSNP:748275089
820 820 a, c dbSNP:770074413
825 825 c, t dbSNP:773349388
828 828 c, t dbSNP:763086693
833 833 a, g dbSNP:766507267
840 840 c, t dbSNP:370376501
852 852 a, c dbSNP:748320322
856 856 a, g dbSNP:767829342
870 870 a, g dbSNP:753129657
878 878 c, g dbSNP:779156097
879 879 c, t dbSNP:373970245
880 880 a, c dbSNP:750423932
900 900 g, t dbSNP:776050604
904 904 c, t dbSNP:761098433
906 906 c, t dbSNP:45621033
907 907 a, g, t dbSNP:776886714
909 909 a, g dbSNP:766104143
911 911 a, g dbSNP:751295137
917 917 a, g dbSNP:759106015
921 921 -, c dbSNP:145506643
925 925 c, t dbSNP:766952405
929 929 a, c dbSNP:752616839
937 937 g, t dbSNP:756040606
938 938 c, g dbSNP:777575581
945 945 c, t dbSNP:763962907
968 968 c, t dbSNP:370744986
972 972 c, g, t dbSNP:374561933
976 976 c, t dbSNP:554981236
977 977 a, g dbSNP:200664836
984 984 c, t dbSNP:772130986
985 985 a, c, g dbSNP:780001754
992 992 c, t dbSNP:765893589
1000 1000 c, g dbSNP:775252718
1001 1001 a, g dbSNP:760101437
1004 1004 a, g dbSNP:374084791
1009 1009 c, t dbSNP:776490661
1010 1010 a, g dbSNP:372202099
1014 1014 c, t dbSNP:146098757
1015 1015 a, g dbSNP:138847501
1020 1020 c, t dbSNP:142569931
1022 1022 c, t dbSNP:766478921
1023 1023 a, g dbSNP:751873368
1032 1032 c, t dbSNP:754997451
1038 1038 c, t dbSNP:781427942
1040 1040 a, c dbSNP:748627278
1043 1043 a, c, g dbSNP:17336639
1068 1068 a, g dbSNP:749588554
1073 1073 a, g dbSNP:771396903
1080 1080 c, t dbSNP:774995708
1089 1089 c, t dbSNP:746685847
1090 1090 a, g dbSNP:199796955
1099 1099 c, t dbSNP:776146284
1107 1107 c, t dbSNP:761685805
1111 1111 a, g dbSNP:769696078
1112 1112 c, t dbSNP:149840192
1119 1119 c, t dbSNP:570790705
1120 1120 a, g dbSNP:150549265
1121 1121 c, t dbSNP:762649354
1125 1125 a, g dbSNP:766252686
1135 1135 c, t dbSNP:751667358
1147 1147 g, t dbSNP:779094647
1158 1158 a, c, t dbSNP:182002674
1161 1161 a, c, t dbSNP:566001525
1164 1164 a, c, g dbSNP:202182545
1167 1167 c, t dbSNP:17289893
1168 1168 a, g dbSNP:749132706
1181 1181 c, g dbSNP:770879879
1184 1184 c, t dbSNP:149321481
1186 1186 a, g dbSNP:552062864
1190 1190 a, g dbSNP:745658347
1191 1191 c, t dbSNP:772053702
1200 1200 g, t dbSNP:775800262
1206 1206 a, g dbSNP:760984499
1209 1209 c, t dbSNP:764038041
1210 1210 a, g dbSNP:776791214
1213 1213 a, g dbSNP:761844164
1214 1214 c, t dbSNP:367680488
1215 1215 a, c dbSNP:201040971
1217 1217 a, g dbSNP:758748662
1219 1219 a, c dbSNP:766740458
1221 1221 a, g dbSNP:752278049
1228 1228 a, c dbSNP:144460286
1231 1231 c, t dbSNP:777342222
1233 1233 c, t dbSNP:748801348
1234 1234 a, g dbSNP:139429793
1235 1235 a, g, t dbSNP:778901010
1247 1247 a, g dbSNP:771929085
1274 1274 g, t dbSNP:771398183
1275 1275 c, t dbSNP:774905136
1289 1289 c, t dbSNP:371234907
1293 1293 c, g dbSNP:759932677
1297 1297 a, g dbSNP:767790289
1307 1307 c, t dbSNP:753466844
1332 1332 c, t dbSNP:547057636
1347 1347 c, t dbSNP:185327606
1348 1348 c, g dbSNP:749927550
1349 1349 a, t dbSNP:758017949
1351 1351 a, c dbSNP:780131926
1356 1356 c, t dbSNP:539077864
1365 1365 a, g dbSNP:2302536
1371 1371 a, c dbSNP:780851909
1393 1393 a, c dbSNP:755972013
1413 1413 a, g dbSNP:777959179
1420 1420 c, t dbSNP:749526261
1423 1423 c, g dbSNP:587778246
1438 1438 a, g dbSNP:757265130
1456 1456 a, t dbSNP:777165081
1461 1461 a, g dbSNP:748900962
1484 1484 a, g dbSNP:770466526
1491 1491 g, t dbSNP:774121381
1494 1494 c, g dbSNP:758956103
1497 1497 a, c, t dbSNP:767070097
1507 1507 a, g dbSNP:760639592
1515 1515 a, g dbSNP:763830096
1519 1519 a, g dbSNP:558565565
1522 1522 a, g dbSNP:201364864
1527 1527 c, t dbSNP:367896493
1529 1529 a, g dbSNP:606231253
1535 1535 a, c dbSNP:765369188
1544 1544 a, g dbSNP:750713244
1563 1563 a, g dbSNP:17290005
1566 1566 c, t dbSNP:761495014
1571 1571 a, g dbSNP:765091640
1579 1579 a, g dbSNP:372990493
1588 1588 c, t dbSNP:750541010
1590 1590 a, c, g dbSNP:763266323
1597 1597 c, t dbSNP:377567759
1598 1598 a, g dbSNP:751667594
1617 1617 c, t dbSNP:755147377
1620 1620 c, g, t dbSNP:146711874
1624 1624 a, g dbSNP:753269876
1628 1628 c, t dbSNP:200592648
1636 1636 a, g, t dbSNP:746763556
1641 1641 a, c dbSNP:199754312
1659 1659 c, t dbSNP:771736232
1668 1668 a, c dbSNP:779726192
1673 1673 a, g dbSNP:746521110
1683 1683 a, c dbSNP:768208443
1684 1684 c, t dbSNP:147732025
1689 1689 g, t dbSNP:587778247
1698 1698 c, t dbSNP:568681121
1699 1699 a, g dbSNP:769434273
1710 1710 a, c dbSNP:773079786
1716 1716 a, t dbSNP:762704534
1717 1717 a, g dbSNP:768500612
1730 1730 a, g dbSNP:766676440
1737 1737 c, t dbSNP:774773441
1753 1753 a, g dbSNP:760711480
1755 1755 c, t dbSNP:17336800
1778 1778 a, c dbSNP:371114444
1780 1780 c, t dbSNP:587778248
1782 1782 a, c, t dbSNP:374670788
1783 1783 a, g, t dbSNP:754646330
1798 1798 c, t dbSNP:368484180
1799 1799 c, t dbSNP:564398642
1800 1800 a, g dbSNP:142429250
1802 1802 a, g dbSNP:749186957
1803 1803 g, t dbSNP:116057045
1808 1808 a, c, g, t dbSNP:2227983
1809 1809 a, g dbSNP:745709532
1815 1815 c, t dbSNP:761127339
1816 1816 a, g dbSNP:587778249
1818 1818 c, t dbSNP:760800224
1825 1825 c, t dbSNP:768627073
1826 1826 a, g dbSNP:150477666
1828 1828 a, g dbSNP:762336338
1830 1830 c, t dbSNP:765534683
1848 1848 a, g dbSNP:529355260
1851 1851 c, t dbSNP:763346690
1852 1852 a, g dbSNP:767193132
1853 1853 c, t dbSNP:752350337
1876 1876 a, g dbSNP:755584255
1877 1877 a, g dbSNP:764356379
1878 1878 c, t dbSNP:17290103
1879 1879 a, g dbSNP:778985185
1893 1893 c, t dbSNP:750403646
1902 1902 c, t dbSNP:758141603
1907 1907 a, g dbSNP:779741928
1914 1914 a, g dbSNP:747203424
1917 1917 a, g dbSNP:768735314
1920 1920 c, t dbSNP:781514400
1924 1924 a, c dbSNP:748219780
1927 1927 c, g dbSNP:769918274
1933 1933 c, t dbSNP:775394093
1936 1936 a, c, t dbSNP:773651001
1945 1945 a, g dbSNP:771278492
1955 1955 c, g dbSNP:774558548
1961 1961 c, g dbSNP:759987693
1966 1966 c, t dbSNP:760471492
1967 1967 a, g dbSNP:370810719
1974 1974 a, t dbSNP:538447477
1979 1979 a, g dbSNP:556794990
1983 1983 c, t dbSNP:776359891
1985 1985 c, t dbSNP:761585117
1987 1987 a, c dbSNP:764787649
1995 1995 c, t dbSNP:141232284
2003 2003 c, t dbSNP:542237406
2007 2007 c, t dbSNP:766220964
2012 2012 a, c dbSNP:751570775
2013 2013 c, t dbSNP:754671343
2019 2019 c, t dbSNP:767304301
2020 2020 a, g dbSNP:144943614
2021 2021 c, t dbSNP:28384375
2023 2023 a, c dbSNP:371483915
2025 2025 c, g dbSNP:756307243
2027 2027 a, c dbSNP:778011429
2034 2034 a, g dbSNP:17290162
2035 2035 g, t dbSNP:757419349
2039 2039 g, t dbSNP:139236063
2044 2044 a, g, t dbSNP:746395542
2045 2045 c, t dbSNP:149375515
2048 2048 a, g dbSNP:201498575
2052 2052 a, g dbSNP:747423535
2055 2055 c, t dbSNP:769537072
2058 2058 c, t dbSNP:773064203
2062 2062 c, g dbSNP:143152775
2064 2064 a, g, t dbSNP:148242307
2067 2067 c, t dbSNP:377048120
2076 2076 c, t dbSNP:115350205
2077 2077 a, g dbSNP:201061916
2082 2082 c, t dbSNP:150803480
2083 2083 a, g dbSNP:764290273
2085 2085 a, c, t dbSNP:17290169
2086 2086 a, g dbSNP:779076899
2087 2087 a, g dbSNP:750850720
2093 2093 c, t dbSNP:756534868
2097 2097 c, t dbSNP:143422127
2105 2105 a, g dbSNP:150899403
2113 2113 a, t dbSNP:747376358
2117 2117 g, t dbSNP:28384376
2118 2118 c, t dbSNP:769203592
2124 2124 c, t dbSNP:533525993
2125 2125 a, g dbSNP:753315940
2133 2133 a, g dbSNP:763070862
2145 2145 c, t dbSNP:766573897
2146 2146 a, g dbSNP:752073858
2147 2147 c, t dbSNP:755564991
2150 2150 a, g dbSNP:767948457
2151 2151 a, t dbSNP:561485334
2155 2155 c, t dbSNP:756492455
2161 2161 a, c dbSNP:528886309
2168 2168 a, c dbSNP:140321332
2173 2173 a, g dbSNP:757860312
2176 2176 c, t dbSNP:199683814
2180 2180 c, t dbSNP:746567781
2220 2220 c, t dbSNP:758575919

Target ORF information:

RefSeq Version NM_201282
Organism Homo sapiens (human)
Definition Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 2, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_201282

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
ATGCGACCCT CCGGGACGGC CGGGGCAGCG CTCCTGGCGC TGCTGGCTGC GCTCTGCCCG 
GCGAGTCGGG CTCTGGAGGA AAAGAAAGTT TGCCAAGGCA CGAGTAACAA GCTCACGCAG
TTGGGCACTT TTGAAGATCA TTTTCTCAGC CTCCAGAGGA TGTTCAATAA CTGTGAGGTG
GTCCTTGGGA ATTTGGAAAT TACCTATGTG CAGAGGAATT ATGATCTTTC CTTCTTAAAG
ACCATCCAGG AGGTGGCTGG TTATGTCCTC ATTGCCCTCA ACACAGTGGA GCGAATTCCT
TTGGAAAACC TGCAGATCAT CAGAGGAAAT ATGTACTACG AAAATTCCTA TGCCTTAGCA
GTCTTATCTA ACTATGATGC AAATAAAACC GGACTGAAGG AGCTGCCCAT GAGAAATTTA
CAGGAAATCC TGCATGGCGC CGTGCGGTTC AGCAACAACC CTGCCCTGTG CAACGTGGAG
AGCATCCAGT GGCGGGACAT AGTCAGCAGT GACTTTCTCA GCAACATGTC GATGGACTTC
CAGAACCACC TGGGCAGCTG CCAAAAGTGT GATCCAAGCT GTCCCAATGG GAGCTGCTGG
GGTGCAGGAG AGGAGAACTG CCAGAAACTG ACCAAAATCA TCTGTGCCCA GCAGTGCTCC
GGGCGCTGCC GTGGCAAGTC CCCCAGTGAC TGCTGCCACA ACCAGTGTGC TGCAGGCTGC
ACAGGCCCCC GGGAGAGCGA CTGCCTGGTC TGCCGCAAAT TCCGAGACGA AGCCACGTGC
AAGGACACCT GCCCCCCACT CATGCTCTAC AACCCCACCA CGTACCAGAT GGATGTGAAC
CCCGAGGGCA AATACAGCTT TGGTGCCACC TGCGTGAAGA AGTGTCCCCG TAATTATGTG
GTGACAGATC ACGGCTCGTG CGTCCGAGCC TGTGGGGCCG ACAGCTATGA GATGGAGGAA
GACGGCGTCC GCAAGTGTAA GAAGTGCGAA GGGCCTTGCC GCAAAGTGTG TAACGGAATA
GGTATTGGTG AATTTAAAGA CTCACTCTCC ATAAATGCTA CGAATATTAA ACACTTCAAA
AACTGCACCT CCATCAGTGG CGATCTCCAC ATCCTGCCGG TGGCATTTAG GGGTGACTCC
TTCACACATA CTCCTCCTCT GGATCCACAG GAACTGGATA TTCTGAAAAC CGTAAAGGAA
ATCACAGGGT TTTTGCTGAT TCAGGCTTGG CCTGAAAACA GGACGGACCT CCATGCCTTT
GAGAACCTAG AAATCATACG CGGCAGGACC AAGCAACATG GTCAGTTTTC TCTTGCAGTC
GTCAGCCTGA ACATAACATC CTTGGGATTA CGCTCCCTCA AGGAGATAAG TGATGGAGAT
GTGATAATTT CAGGAAACAA AAATTTGTGC TATGCAAATA CAATAAACTG GAAAAAACTG
TTTGGGACCT CCGGTCAGAA AACCAAAATT ATAAGCAACA GAGGTGAAAA CAGCTGCAAG
GCCACAGGCC AGGTCTGCCA TGCCTTGTGC TCCCCCGAGG GCTGCTGGGG CCCGGAGCCC
AGGGACTGCG TCTCTTGCCG GAATGTCAGC CGAGGCAGGG AATGCGTGGA CAAGTGCAAC
CTTCTGGAGG GTGAGCCAAG GGAGTTTGTG GAGAACTCTG AGTGCATACA GTGCCACCCA
GAGTGCCTGC CTCAGGCCAT GAACATCACC TGCACAGGAC GGGGACCAGA CAACTGTATC
CAGTGTGCCC ACTACATTGA CGGCCCCCAC TGCGTCAAGA CCTGCCCGGC AGGAGTCATG
GGAGAAAACA ACACCCTGGT CTGGAAGTAC GCAGACGCCG GCCATGTGTG CCACCTGTGC
CATCCAAACT GCACCTACGG GTCCTAA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu25409
Accession Version NM_201283.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1218bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product epidermal growth factor receptor isoform c precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AW163038.1, X00588.1 and U48722.1. Summary: The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. Multiple alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2010]. Transcript Variant: This variant (3) uses a different 3' terminal exon when compared to variant 1. The resulting isoform (c) has a shorter and distinct C-terminus. Only the extracellular domain is present in isoform c. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: U48722.1, AY698024.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968189, SAMEA1968540 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
ATGCGACCCT CCGGGACGGC CGGGGCAGCG CTCCTGGCGC TGCTGGCTGC GCTCTGCCCG 
GCGAGTCGGG CTCTGGAGGA AAAGAAAGTT TGCCAAGGCA CGAGTAACAA GCTCACGCAG
TTGGGCACTT TTGAAGATCA TTTTCTCAGC CTCCAGAGGA TGTTCAATAA CTGTGAGGTG
GTCCTTGGGA ATTTGGAAAT TACCTATGTG CAGAGGAATT ATGATCTTTC CTTCTTAAAG
ACCATCCAGG AGGTGGCTGG TTATGTCCTC ATTGCCCTCA ACACAGTGGA GCGAATTCCT
TTGGAAAACC TGCAGATCAT CAGAGGAAAT ATGTACTACG AAAATTCCTA TGCCTTAGCA
GTCTTATCTA ACTATGATGC AAATAAAACC GGACTGAAGG AGCTGCCCAT GAGAAATTTA
CAGGAAATCC TGCATGGCGC CGTGCGGTTC AGCAACAACC CTGCCCTGTG CAACGTGGAG
AGCATCCAGT GGCGGGACAT AGTCAGCAGT GACTTTCTCA GCAACATGTC GATGGACTTC
CAGAACCACC TGGGCAGCTG CCAAAAGTGT GATCCAAGCT GTCCCAATGG GAGCTGCTGG
GGTGCAGGAG AGGAGAACTG CCAGAAACTG ACCAAAATCA TCTGTGCCCA GCAGTGCTCC
GGGCGCTGCC GTGGCAAGTC CCCCAGTGAC TGCTGCCACA ACCAGTGTGC TGCAGGCTGC
ACAGGCCCCC GGGAGAGCGA CTGCCTGGTC TGCCGCAAAT TCCGAGACGA AGCCACGTGC
AAGGACACCT GCCCCCCACT CATGCTCTAC AACCCCACCA CGTACCAGAT GGATGTGAAC
CCCGAGGGCA AATACAGCTT TGGTGCCACC TGCGTGAAGA AGTGTCCCCG TAATTATGTG
GTGACAGATC ACGGCTCGTG CGTCCGAGCC TGTGGGGCCG ACAGCTATGA GATGGAGGAA
GACGGCGTCC GCAAGTGTAA GAAGTGCGAA GGGCCTTGCC GCAAAGTGTG TAACGGAATA
GGTATTGGTG AATTTAAAGA CTCACTCTCC ATAAATGCTA CGAATATTAA ACACTTCAAA
AACTGCACCT CCATCAGTGG CGATCTCCAC ATCCTGCCGG TGGCATTTAG GGGTGACTCC
TTCACACATA CTCCTCCTCT GGATCCACAG GAACTGGATA TTCTGAAAAC CGTAAAGGAA
ATCACAGGTT TGAGCTGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

RefSeqNP_958440.1
CDS247..1464
Misc Feature(1)208..210(+)
Misc Feature(2)337..420(+)
Misc Feature(3)412..414(+)
Misc Feature(4)415..750(+)
Misc Feature(5)469..1146(+)
Misc Feature(6)628..630(+)
Misc Feature(7)715..807(+)
Misc Feature(8)769..771(+)
Misc Feature(9)799..1257(+)
Misc Feature(10)814..843(+)
Misc Feature(11)826..867(+)
Misc Feature(12)832..834(+)
Misc Feature(13)889..915(+)
Misc Feature(14)901..939(+)
Misc Feature(15)931..933(+)
Misc Feature(16)937..1068(+)
Misc Feature(17)940..966(+)
Misc Feature(18)952..990(+)
Misc Feature(19)997..1026(+)
Misc Feature(20)1036..1119(+)
Misc Feature(21)1129..1167(+)
Misc Feature(22)1177..1224(+)
Misc Feature(23)1231..1245(+)
Misc Feature(24)1255..1332(+)
Misc Feature(25)1300..1302(+)
Misc Feature(26)1327..>1455(+)
Misc Feature(27)1327..1329(+)
Exon (1)1..334
Gene:EGFR
Gene Synonym:
Exon (2)335..486
Gene:EGFR
Gene Synonym:
Exon (3)487..670
Gene:EGFR
Gene Synonym:
Exon (4)671..805
Gene:EGFR
Gene Synonym:
Exon (5)806..874
Gene:EGFR
Gene Synonym:
Exon (6)875..993
Gene:EGFR
Gene Synonym:
Exon (7)994..1135
Gene:EGFR
Gene Synonym:
Exon (8)1136..1252
Gene:EGFR
Gene Synonym:
Exon (9)1253..1379
Gene:EGFR
Gene Synonym:
Exon (10)1380..1572
Gene:EGFR
Gene Synonym:
Translation
Position Chain Variation Link
31 31 g, t dbSNP:712829
37 37 c, t dbSNP:566284155
56 56 a, c dbSNP:712830
113 113 c, t dbSNP:551488510
171 171 c, t dbSNP:570107879
178 178 c, t dbSNP:537165657
184 184 c, g dbSNP:555477367
203 203 a, t dbSNP:17288945
209 209 g, t dbSNP:746536427
215 215 c, g, t dbSNP:375923119
226 226 c, t dbSNP:781240283
244 244 a, g dbSNP:748159429
245 245 c, t dbSNP:769658183
253 253 a, c dbSNP:773069229
254 254 c, t dbSNP:749433287
257 257 c, t dbSNP:771210838
259 259 c, g dbSNP:774487133
260 260 a, g dbSNP:759582787
262 262 a, g dbSNP:767651648
264 264 c, g dbSNP:775964175
265 265 c, g, t dbSNP:761183109
267 267 c, t dbSNP:369581368
268 268 a, g dbSNP:754259847
276 276 g, t dbSNP:757936561
279 279 c, t dbSNP:766029589
284 284 c, t dbSNP:567894670
298 298 c, t dbSNP:754527029
302 302 c, g dbSNP:780865931
307 307 a, g, t dbSNP:373129709
324 324 a, g dbSNP:777385414
328 328 a, g dbSNP:749088691
330 330 a, g dbSNP:770673046
332 332 a, c dbSNP:774551548
339 339 c, t dbSNP:372917131
341 341 a, g dbSNP:746023542
343 343 a, g dbSNP:772311777
347 347 c, g dbSNP:144158123
348 348 a, g, t dbSNP:148679319
362 362 c, t dbSNP:375919121
363 363 a, g dbSNP:777186292
367 367 c, t dbSNP:762281800
373 373 a, g dbSNP:147740818
396 396 c, t dbSNP:770133522
399 399 c, t dbSNP:773745636
404 404 a, g dbSNP:759219499
413 413 a, g dbSNP:767259994
420 420 c, t dbSNP:752438083
421 421 a, g dbSNP:760228905
422 422 a, c dbSNP:763572530
458 458 a, g dbSNP:369580836
468 468 c, t dbSNP:200383389
472 472 a, c dbSNP:778638117
477 477 c, g dbSNP:61731794
487 487 a, g dbSNP:374986786
496 496 a, c, g dbSNP:753319070
509 509 a, g dbSNP:765137528
514 514 c, t dbSNP:750399097
515 515 a, t dbSNP:142061256
521 521 c, t dbSNP:779879611
529 529 a, c dbSNP:35515689
534 534 a, g dbSNP:751744275
535 535 c, g dbSNP:755189573
539 539 a, g, t dbSNP:17289589
545 545 a, c dbSNP:376963968
556 556 c, t dbSNP:756305742
561 561 a, c, g dbSNP:141271101
562 562 a, g dbSNP:771366736
572 572 c, g dbSNP:145113601
578 578 c, t dbSNP:746631025
585 585 c, t dbSNP:374582814
591 591 a, t dbSNP:773596817
600 600 c, t dbSNP:147726446
618 618 c, t dbSNP:142553829
625 625 a, g dbSNP:377444977
632 632 a, c dbSNP:762889647
636 636 c, t dbSNP:766093262
646 646 a, g dbSNP:751337426
655 655 a, g dbSNP:754854319
669 669 g, t dbSNP:767608234
680 680 a, g dbSNP:780476417
684 684 c, g, t dbSNP:199637112
685 685 a, g dbSNP:532655845
687 687 c, g, t dbSNP:138946543
691 691 c, t dbSNP:774146556
692 692 a, g dbSNP:759532524
701 701 a, g dbSNP:551591429
714 714 a, g, t dbSNP:149006234
720 720 c, t dbSNP:2072454
739 739 c, t dbSNP:587778252
740 740 a, g dbSNP:761795138
746 746 c, t dbSNP:765416003
748 748 c, g dbSNP:530692924
755 755 a, g, t dbSNP:758945260
759 759 a, c, t dbSNP:17289686
765 765 c, t dbSNP:777401847
771 771 c, t dbSNP:749002473
776 776 c, t dbSNP:770290445
777 777 a, g dbSNP:17336437
780 780 a, g dbSNP:745755245
793 793 a, c, g dbSNP:772071414
804 804 c, t dbSNP:375037710
807 807 c, t dbSNP:776568205
813 813 a, g dbSNP:748275089
820 820 a, c dbSNP:770074413
825 825 c, t dbSNP:773349388
828 828 c, t dbSNP:763086693
833 833 a, g dbSNP:766507267
840 840 c, t dbSNP:370376501
852 852 a, c dbSNP:748320322
856 856 a, g dbSNP:767829342
870 870 a, g dbSNP:753129657
878 878 c, g dbSNP:779156097
879 879 c, t dbSNP:373970245
880 880 a, c dbSNP:750423932
900 900 g, t dbSNP:776050604
904 904 c, t dbSNP:761098433
906 906 c, t dbSNP:45621033
907 907 a, g, t dbSNP:776886714
909 909 a, g dbSNP:766104143
911 911 a, g dbSNP:751295137
917 917 a, g dbSNP:759106015
921 921 -, c dbSNP:145506643
925 925 c, t dbSNP:766952405
929 929 a, c dbSNP:752616839
937 937 g, t dbSNP:756040606
938 938 c, g dbSNP:777575581
945 945 c, t dbSNP:763962907
968 968 c, t dbSNP:370744986
972 972 c, g, t dbSNP:374561933
976 976 c, t dbSNP:554981236
977 977 a, g dbSNP:200664836
984 984 c, t dbSNP:772130986
985 985 a, c, g dbSNP:780001754
992 992 c, t dbSNP:765893589
1000 1000 c, g dbSNP:775252718
1001 1001 a, g dbSNP:760101437
1004 1004 a, g dbSNP:374084791
1009 1009 c, t dbSNP:776490661
1010 1010 a, g dbSNP:372202099
1014 1014 c, t dbSNP:146098757
1015 1015 a, g dbSNP:138847501
1020 1020 c, t dbSNP:142569931
1022 1022 c, t dbSNP:766478921
1023 1023 a, g dbSNP:751873368
1032 1032 c, t dbSNP:754997451
1038 1038 c, t dbSNP:781427942
1040 1040 a, c dbSNP:748627278
1043 1043 a, c, g dbSNP:17336639
1068 1068 a, g dbSNP:749588554
1073 1073 a, g dbSNP:771396903
1080 1080 c, t dbSNP:774995708
1089 1089 c, t dbSNP:746685847
1090 1090 a, g dbSNP:199796955
1099 1099 c, t dbSNP:776146284
1107 1107 c, t dbSNP:761685805
1111 1111 a, g dbSNP:769696078
1112 1112 c, t dbSNP:149840192
1119 1119 c, t dbSNP:570790705
1120 1120 a, g dbSNP:150549265
1121 1121 c, t dbSNP:762649354
1125 1125 a, g dbSNP:766252686
1135 1135 c, t dbSNP:751667358
1147 1147 g, t dbSNP:779094647
1158 1158 a, c, t dbSNP:182002674
1161 1161 a, c, t dbSNP:566001525
1164 1164 a, c, g dbSNP:202182545
1167 1167 c, t dbSNP:17289893
1168 1168 a, g dbSNP:749132706
1181 1181 c, g dbSNP:770879879
1184 1184 c, t dbSNP:149321481
1186 1186 a, g dbSNP:552062864
1190 1190 a, g dbSNP:745658347
1191 1191 c, t dbSNP:772053702
1200 1200 g, t dbSNP:775800262
1206 1206 a, g dbSNP:760984499
1209 1209 c, t dbSNP:764038041
1210 1210 a, g dbSNP:776791214
1213 1213 a, g dbSNP:761844164
1214 1214 c, t dbSNP:367680488
1215 1215 a, c dbSNP:201040971
1217 1217 a, g dbSNP:758748662
1219 1219 a, c dbSNP:766740458
1221 1221 a, g dbSNP:752278049
1228 1228 a, c dbSNP:144460286
1231 1231 c, t dbSNP:777342222
1233 1233 c, t dbSNP:748801348
1234 1234 a, g dbSNP:139429793
1235 1235 a, g, t dbSNP:778901010
1247 1247 a, g dbSNP:771929085
1274 1274 g, t dbSNP:771398183
1275 1275 c, t dbSNP:774905136
1289 1289 c, t dbSNP:371234907
1293 1293 c, g dbSNP:759932677
1297 1297 a, g dbSNP:767790289
1307 1307 c, t dbSNP:753466844
1332 1332 c, t dbSNP:547057636
1347 1347 c, t dbSNP:185327606
1348 1348 c, g dbSNP:749927550
1349 1349 a, t dbSNP:758017949
1351 1351 a, c dbSNP:780131926
1356 1356 c, t dbSNP:539077864
1365 1365 a, g dbSNP:2302536
1371 1371 a, c dbSNP:780851909
1393 1393 a, c dbSNP:755972013
1413 1413 a, g dbSNP:777959179
1420 1420 c, t dbSNP:749526261
1423 1423 c, g dbSNP:587778246
1438 1438 a, g dbSNP:757265130
1457 1457 -, aa dbSNP:747216672
1457 1457 a, t dbSNP:778894573
1458 1458 a, g dbSNP:746340466
1459 1459 a, c dbSNP:772432421
1463 1463 a, g dbSNP:776101904
1468 1468 a, c dbSNP:747326696
1472 1472 c, t dbSNP:769197565
1483 1483 a, g dbSNP:772941542
1484 1484 c, t dbSNP:375700897
1486 1486 c, g, t dbSNP:765945520
1489 1489 a, g dbSNP:369596578
1496 1496 c, g dbSNP:747291686
1504 1504 a, g dbSNP:767353126
1505 1505 -, ggtct dbSNP:776681846
1508 1508 a, g dbSNP:41522547
1510 1510 a, g dbSNP:781151300
1511 1511 c, t dbSNP:755846976
1567 1567 c, t dbSNP:555584059

Target ORF information:

RefSeq Version NM_201283
Organism Homo sapiens (human)
Definition Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 3, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_201283

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
ATGCGACCCT CCGGGACGGC CGGGGCAGCG CTCCTGGCGC TGCTGGCTGC GCTCTGCCCG 
GCGAGTCGGG CTCTGGAGGA AAAGAAAGTT TGCCAAGGCA CGAGTAACAA GCTCACGCAG
TTGGGCACTT TTGAAGATCA TTTTCTCAGC CTCCAGAGGA TGTTCAATAA CTGTGAGGTG
GTCCTTGGGA ATTTGGAAAT TACCTATGTG CAGAGGAATT ATGATCTTTC CTTCTTAAAG
ACCATCCAGG AGGTGGCTGG TTATGTCCTC ATTGCCCTCA ACACAGTGGA GCGAATTCCT
TTGGAAAACC TGCAGATCAT CAGAGGAAAT ATGTACTACG AAAATTCCTA TGCCTTAGCA
GTCTTATCTA ACTATGATGC AAATAAAACC GGACTGAAGG AGCTGCCCAT GAGAAATTTA
CAGGAAATCC TGCATGGCGC CGTGCGGTTC AGCAACAACC CTGCCCTGTG CAACGTGGAG
AGCATCCAGT GGCGGGACAT AGTCAGCAGT GACTTTCTCA GCAACATGTC GATGGACTTC
CAGAACCACC TGGGCAGCTG CCAAAAGTGT GATCCAAGCT GTCCCAATGG GAGCTGCTGG
GGTGCAGGAG AGGAGAACTG CCAGAAACTG ACCAAAATCA TCTGTGCCCA GCAGTGCTCC
GGGCGCTGCC GTGGCAAGTC CCCCAGTGAC TGCTGCCACA ACCAGTGTGC TGCAGGCTGC
ACAGGCCCCC GGGAGAGCGA CTGCCTGGTC TGCCGCAAAT TCCGAGACGA AGCCACGTGC
AAGGACACCT GCCCCCCACT CATGCTCTAC AACCCCACCA CGTACCAGAT GGATGTGAAC
CCCGAGGGCA AATACAGCTT TGGTGCCACC TGCGTGAAGA AGTGTCCCCG TAATTATGTG
GTGACAGATC ACGGCTCGTG CGTCCGAGCC TGTGGGGCCG ACAGCTATGA GATGGAGGAA
GACGGCGTCC GCAAGTGTAA GAAGTGCGAA GGGCCTTGCC GCAAAGTGTG TAACGGAATA
GGTATTGGTG AATTTAAAGA CTCACTCTCC ATAAATGCTA CGAATATTAA ACACTTCAAA
AACTGCACCT CCATCAGTGG CGATCTCCAC ATCCTGCCGG TGGCATTTAG GGGTGACTCC
TTCACACATA CTCCTCCTCT GGATCCACAG GAACTGGATA TTCTGAAAAC CGTAAAGGAA
ATCACAGGTT TGAGCTGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu25398
Accession Version NM_201284.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2118bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product epidermal growth factor receptor isoform d precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AW163038.1, X00588.1 and AF125253.1. Summary: The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. Multiple alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2010]. Transcript Variant: This variant (4) uses a different 3' terminal exon when compared to variant 1. The resulting isoform (d) has a shorter and distinct C-terminus. Only the extracellular domain is present in isoform d. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF125253.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2149398 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
ATGCGACCCT CCGGGACGGC CGGGGCAGCG CTCCTGGCGC TGCTGGCTGC GCTCTGCCCG 
GCGAGTCGGG CTCTGGAGGA AAAGAAAGTT TGCCAAGGCA CGAGTAACAA GCTCACGCAG
TTGGGCACTT TTGAAGATCA TTTTCTCAGC CTCCAGAGGA TGTTCAATAA CTGTGAGGTG
GTCCTTGGGA ATTTGGAAAT TACCTATGTG CAGAGGAATT ATGATCTTTC CTTCTTAAAG
ACCATCCAGG AGGTGGCTGG TTATGTCCTC ATTGCCCTCA ACACAGTGGA GCGAATTCCT
TTGGAAAACC TGCAGATCAT CAGAGGAAAT ATGTACTACG AAAATTCCTA TGCCTTAGCA
GTCTTATCTA ACTATGATGC AAATAAAACC GGACTGAAGG AGCTGCCCAT GAGAAATTTA
CAGGAAATCC TGCATGGCGC CGTGCGGTTC AGCAACAACC CTGCCCTGTG CAACGTGGAG
AGCATCCAGT GGCGGGACAT AGTCAGCAGT GACTTTCTCA GCAACATGTC GATGGACTTC
CAGAACCACC TGGGCAGCTG CCAAAAGTGT GATCCAAGCT GTCCCAATGG GAGCTGCTGG
GGTGCAGGAG AGGAGAACTG CCAGAAACTG ACCAAAATCA TCTGTGCCCA GCAGTGCTCC
GGGCGCTGCC GTGGCAAGTC CCCCAGTGAC TGCTGCCACA ACCAGTGTGC TGCAGGCTGC
ACAGGCCCCC GGGAGAGCGA CTGCCTGGTC TGCCGCAAAT TCCGAGACGA AGCCACGTGC
AAGGACACCT GCCCCCCACT CATGCTCTAC AACCCCACCA CGTACCAGAT GGATGTGAAC
CCCGAGGGCA AATACAGCTT TGGTGCCACC TGCGTGAAGA AGTGTCCCCG TAATTATGTG
GTGACAGATC ACGGCTCGTG CGTCCGAGCC TGTGGGGCCG ACAGCTATGA GATGGAGGAA
GACGGCGTCC GCAAGTGTAA GAAGTGCGAA GGGCCTTGCC GCAAAGTGTG TAACGGAATA
GGTATTGGTG AATTTAAAGA CTCACTCTCC ATAAATGCTA CGAATATTAA ACACTTCAAA
AACTGCACCT CCATCAGTGG CGATCTCCAC ATCCTGCCGG TGGCATTTAG GGGTGACTCC
TTCACACATA CTCCTCCTCT GGATCCACAG GAACTGGATA TTCTGAAAAC CGTAAAGGAA
ATCACAGGGT TTTTGCTGAT TCAGGCTTGG CCTGAAAACA GGACGGACCT CCATGCCTTT
GAGAACCTAG AAATCATACG CGGCAGGACC AAGCAACATG GTCAGTTTTC TCTTGCAGTC
GTCAGCCTGA ACATAACATC CTTGGGATTA CGCTCCCTCA AGGAGATAAG TGATGGAGAT
GTGATAATTT CAGGAAACAA AAATTTGTGC TATGCAAATA CAATAAACTG GAAAAAACTG
TTTGGGACCT CCGGTCAGAA AACCAAAATT ATAAGCAACA GAGGTGAAAA CAGCTGCAAG
GCCACAGGCC AGGTCTGCCA TGCCTTGTGC TCCCCCGAGG GCTGCTGGGG CCCGGAGCCC
AGGGACTGCG TCTCTTGCCG GAATGTCAGC CGAGGCAGGG AATGCGTGGA CAAGTGCAAC
CTTCTGGAGG GTGAGCCAAG GGAGTTTGTG GAGAACTCTG AGTGCATACA GTGCCACCCA
GAGTGCCTGC CTCAGGCCAT GAACATCACC TGCACAGGAC GGGGACCAGA CAACTGTATC
CAGTGTGCCC ACTACATTGA CGGCCCCCAC TGCGTCAAGA CCTGCCCGGC AGGAGTCATG
GGAGAAAACA ACACCCTGGT CTGGAAGTAC GCAGACGCCG GCCATGTGTG CCACCTGTGC
CATCCAAACT GCACCTACGG GCCAGGAAAT GAGAGTCTCA AAGCCATGTT ATTCTGCCTT
TTTAAACTAT CATCCTGTAA TCAAAGTAAT GATGGCAGCG TGTCCCACCA GAGCGGGAGC
CCAGCTGCTC AGGAGTCATG CTTAGGATGG ATCCCTTCTC TTCTGCCGTC AGAGTTTCAG
CTGGGTTGGG GTGGATGCAG CCACCTCCAT GCCTGGCCTT CTGCATCTGT GATCATCACG
GCCTCCTCCT GCCACTGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

RefSeqNP_958441.1
CDS247..2364
Misc Feature(1)208..210(+)
Misc Feature(2)337..420(+)
Misc Feature(3)412..414(+)
Misc Feature(4)415..750(+)
Misc Feature(5)469..1146(+)
Misc Feature(6)628..630(+)
Misc Feature(7)715..807(+)
Misc Feature(8)769..771(+)
Misc Feature(9)799..1257(+)
Misc Feature(10)814..843(+)
Misc Feature(11)826..867(+)
Misc Feature(12)832..834(+)
Misc Feature(13)889..915(+)
Misc Feature(14)901..939(+)
Misc Feature(15)931..933(+)
Misc Feature(16)937..1068(+)
Misc Feature(17)940..966(+)
Misc Feature(18)952..990(+)
Misc Feature(19)997..1026(+)
Misc Feature(20)1036..1119(+)
Misc Feature(21)1129..1167(+)
Misc Feature(22)1177..1224(+)
Misc Feature(23)1231..1245(+)
Misc Feature(24)1255..1332(+)
Misc Feature(25)1300..1302(+)
Misc Feature(26)1327..1689(+)
Misc Feature(27)1327..1329(+)
Misc Feature(28)1414..2046(+)
Misc Feature(29)1483..1485(+)
Misc Feature(30)1576..1578(+)
Misc Feature(31)1654..1743(+)
Misc Feature(32)1759..2127(+)
Misc Feature(33)1762..1923(+)
Misc Feature(34)1762..1791(+)
Misc Feature(35)1774..1815(+)
Misc Feature(36)1822..1851(+)
Misc Feature(37)1828..1830(+)
Misc Feature(38)1861..1911(+)
Misc Feature(39)1918..>2040(+)
Misc Feature(40)1918..1959(+)
Misc Feature(41)1930..1983(+)
Misc Feature(42)1948..1950(+)
Misc Feature(43)1990..2019(+)
Misc Feature(44)2029..2097(+)
Misc Feature(45)2053..2055(+)
Misc Feature(46)2113..2115(+)
Misc Feature(47)2323..2325(+)
Exon (1)1..334
Gene:EGFR
Gene Synonym:
Exon (2)335..486
Gene:EGFR
Gene Synonym:
Exon (3)487..670
Gene:EGFR
Gene Synonym:
Exon (4)671..805
Gene:EGFR
Gene Synonym:
Exon (5)806..874
Gene:EGFR
Gene Synonym:
Exon (6)875..993
Gene:EGFR
Gene Synonym:
Exon (7)994..1135
Gene:EGFR
Gene Synonym:
Exon (8)1136..1252
Gene:EGFR
Gene Synonym:
Exon (9)1253..1379
Gene:EGFR
Gene Synonym:
Exon (10)1380..1453
Gene:EGFR
Gene Synonym:
Exon (11)1454..1544
Gene:EGFR
Gene Synonym:
Exon (12)1545..1744
Gene:EGFR
Gene Synonym:
Exon (13)1745..1877
Gene:EGFR
Gene Synonym:
Exon (14)1878..1968
Gene:EGFR
Gene Synonym:
Exon (15)1969..2126
Gene:EGFR
Gene Synonym:
Exon (16)2127..2865
Gene:EGFR
Gene Synonym:
Translation
Position Chain Variation Link
31 31 g, t dbSNP:712829
37 37 c, t dbSNP:566284155
56 56 a, c dbSNP:712830
113 113 c, t dbSNP:551488510
171 171 c, t dbSNP:570107879
178 178 c, t dbSNP:537165657
184 184 c, g dbSNP:555477367
203 203 a, t dbSNP:17288945
209 209 g, t dbSNP:746536427
215 215 c, g, t dbSNP:375923119
226 226 c, t dbSNP:781240283
244 244 a, g dbSNP:748159429
245 245 c, t dbSNP:769658183
253 253 a, c dbSNP:773069229
254 254 c, t dbSNP:749433287
257 257 c, t dbSNP:771210838
259 259 c, g dbSNP:774487133
260 260 a, g dbSNP:759582787
262 262 a, g dbSNP:767651648
264 264 c, g dbSNP:775964175
265 265 c, g, t dbSNP:761183109
267 267 c, t dbSNP:369581368
268 268 a, g dbSNP:754259847
276 276 g, t dbSNP:757936561
279 279 c, t dbSNP:766029589
284 284 c, t dbSNP:567894670
298 298 c, t dbSNP:754527029
302 302 c, g dbSNP:780865931
307 307 a, g, t dbSNP:373129709
324 324 a, g dbSNP:777385414
328 328 a, g dbSNP:749088691
330 330 a, g dbSNP:770673046
332 332 a, c dbSNP:774551548
339 339 c, t dbSNP:372917131
341 341 a, g dbSNP:746023542
343 343 a, g dbSNP:772311777
347 347 c, g dbSNP:144158123
348 348 a, g, t dbSNP:148679319
362 362 c, t dbSNP:375919121
363 363 a, g dbSNP:777186292
367 367 c, t dbSNP:762281800
373 373 a, g dbSNP:147740818
396 396 c, t dbSNP:770133522
399 399 c, t dbSNP:773745636
404 404 a, g dbSNP:759219499
413 413 a, g dbSNP:767259994
420 420 c, t dbSNP:752438083
421 421 a, g dbSNP:760228905
422 422 a, c dbSNP:763572530
458 458 a, g dbSNP:369580836
468 468 c, t dbSNP:200383389
472 472 a, c dbSNP:778638117
477 477 c, g dbSNP:61731794
487 487 a, g dbSNP:374986786
496 496 a, c, g dbSNP:753319070
509 509 a, g dbSNP:765137528
514 514 c, t dbSNP:750399097
515 515 a, t dbSNP:142061256
521 521 c, t dbSNP:779879611
529 529 a, c dbSNP:35515689
534 534 a, g dbSNP:751744275
535 535 c, g dbSNP:755189573
539 539 a, g, t dbSNP:17289589
545 545 a, c dbSNP:376963968
556 556 c, t dbSNP:756305742
561 561 a, c, g dbSNP:141271101
562 562 a, g dbSNP:771366736
572 572 c, g dbSNP:145113601
578 578 c, t dbSNP:746631025
585 585 c, t dbSNP:374582814
591 591 a, t dbSNP:773596817
600 600 c, t dbSNP:147726446
618 618 c, t dbSNP:142553829
625 625 a, g dbSNP:377444977
632 632 a, c dbSNP:762889647
636 636 c, t dbSNP:766093262
646 646 a, g dbSNP:751337426
655 655 a, g dbSNP:754854319
669 669 g, t dbSNP:767608234
680 680 a, g dbSNP:780476417
684 684 c, g, t dbSNP:199637112
685 685 a, g dbSNP:532655845
687 687 c, g, t dbSNP:138946543
691 691 c, t dbSNP:774146556
692 692 a, g dbSNP:759532524
701 701 a, g dbSNP:551591429
714 714 a, g, t dbSNP:149006234
720 720 c, t dbSNP:2072454
739 739 c, t dbSNP:587778252
740 740 a, g dbSNP:761795138
746 746 c, t dbSNP:765416003
748 748 c, g dbSNP:530692924
755 755 a, g, t dbSNP:758945260
759 759 a, c, t dbSNP:17289686
765 765 c, t dbSNP:777401847
771 771 c, t dbSNP:749002473
776 776 c, t dbSNP:770290445
777 777 a, g dbSNP:17336437
780 780 a, g dbSNP:745755245
793 793 a, c, g dbSNP:772071414
804 804 c, t dbSNP:375037710
807 807 c, t dbSNP:776568205
813 813 a, g dbSNP:748275089
820 820 a, c dbSNP:770074413
825 825 c, t dbSNP:773349388
828 828 c, t dbSNP:763086693
833 833 a, g dbSNP:766507267
840 840 c, t dbSNP:370376501
852 852 a, c dbSNP:748320322
856 856 a, g dbSNP:767829342
870 870 a, g dbSNP:753129657
878 878 c, g dbSNP:779156097
879 879 c, t dbSNP:373970245
880 880 a, c dbSNP:750423932
900 900 g, t dbSNP:776050604
904 904 c, t dbSNP:761098433
906 906 c, t dbSNP:45621033
907 907 a, g, t dbSNP:776886714
909 909 a, g dbSNP:766104143
911 911 a, g dbSNP:751295137
917 917 a, g dbSNP:759106015
921 921 -, c dbSNP:145506643
925 925 c, t dbSNP:766952405
929 929 a, c dbSNP:752616839
937 937 g, t dbSNP:756040606
938 938 c, g dbSNP:777575581
945 945 c, t dbSNP:763962907
968 968 c, t dbSNP:370744986
972 972 c, g, t dbSNP:374561933
976 976 c, t dbSNP:554981236
977 977 a, g dbSNP:200664836
984 984 c, t dbSNP:772130986
985 985 a, c, g dbSNP:780001754
992 992 c, t dbSNP:765893589
1000 1000 c, g dbSNP:775252718
1001 1001 a, g dbSNP:760101437
1004 1004 a, g dbSNP:374084791
1009 1009 c, t dbSNP:776490661
1010 1010 a, g dbSNP:372202099
1014 1014 c, t dbSNP:146098757
1015 1015 a, g dbSNP:138847501
1020 1020 c, t dbSNP:142569931
1022 1022 c, t dbSNP:766478921
1023 1023 a, g dbSNP:751873368
1032 1032 c, t dbSNP:754997451
1038 1038 c, t dbSNP:781427942
1040 1040 a, c dbSNP:748627278
1043 1043 a, c, g dbSNP:17336639
1068 1068 a, g dbSNP:749588554
1073 1073 a, g dbSNP:771396903
1080 1080 c, t dbSNP:774995708
1089 1089 c, t dbSNP:746685847
1090 1090 a, g dbSNP:199796955
1099 1099 c, t dbSNP:776146284
1107 1107 c, t dbSNP:761685805
1111 1111 a, g dbSNP:769696078
1112 1112 c, t dbSNP:149840192
1119 1119 c, t dbSNP:570790705
1120 1120 a, g dbSNP:150549265
1121 1121 c, t dbSNP:762649354
1125 1125 a, g dbSNP:766252686
1135 1135 c, t dbSNP:751667358
1147 1147 g, t dbSNP:779094647
1158 1158 a, c, t dbSNP:182002674
1161 1161 a, c, t dbSNP:566001525
1164 1164 a, c, g dbSNP:202182545
1167 1167 c, t dbSNP:17289893
1168 1168 a, g dbSNP:749132706
1181 1181 c, g dbSNP:770879879
1184 1184 c, t dbSNP:149321481
1186 1186 a, g dbSNP:552062864
1190 1190 a, g dbSNP:745658347
1191 1191 c, t dbSNP:772053702
1200 1200 g, t dbSNP:775800262
1206 1206 a, g dbSNP:760984499
1209 1209 c, t dbSNP:764038041
1210 1210 a, g dbSNP:776791214
1213 1213 a, g dbSNP:761844164
1214 1214 c, t dbSNP:367680488
1215 1215 a, c dbSNP:201040971
1217 1217 a, g dbSNP:758748662
1219 1219 a, c dbSNP:766740458
1221 1221 a, g dbSNP:752278049
1228 1228 a, c dbSNP:144460286
1231 1231 c, t dbSNP:777342222
1233 1233 c, t dbSNP:748801348
1234 1234 a, g dbSNP:139429793
1235 1235 a, g, t dbSNP:778901010
1247 1247 a, g dbSNP:771929085
1274 1274 g, t dbSNP:771398183
1275 1275 c, t dbSNP:774905136
1289 1289 c, t dbSNP:371234907
1293 1293 c, g dbSNP:759932677
1297 1297 a, g dbSNP:767790289
1307 1307 c, t dbSNP:753466844
1332 1332 c, t dbSNP:547057636
1347 1347 c, t dbSNP:185327606
1348 1348 c, g dbSNP:749927550
1349 1349 a, t dbSNP:758017949
1351 1351 a, c dbSNP:780131926
1356 1356 c, t dbSNP:539077864
1365 1365 a, g dbSNP:2302536
1371 1371 a, c dbSNP:780851909
1393 1393 a, c dbSNP:755972013
1413 1413 a, g dbSNP:777959179
1420 1420 c, t dbSNP:749526261
1423 1423 c, g dbSNP:587778246
1438 1438 a, g dbSNP:757265130
1456 1456 a, t dbSNP:777165081
1461 1461 a, g dbSNP:748900962
1484 1484 a, g dbSNP:770466526
1491 1491 g, t dbSNP:774121381
1494 1494 c, g dbSNP:758956103
1497 1497 a, c, t dbSNP:767070097
1507 1507 a, g dbSNP:760639592
1515 1515 a, g dbSNP:763830096
1519 1519 a, g dbSNP:558565565
1522 1522 a, g dbSNP:201364864
1527 1527 c, t dbSNP:367896493
1529 1529 a, g dbSNP:606231253
1535 1535 a, c dbSNP:765369188
1544 1544 a, g dbSNP:750713244
1563 1563 a, g dbSNP:17290005
1566 1566 c, t dbSNP:761495014
1571 1571 a, g dbSNP:765091640
1579 1579 a, g dbSNP:372990493
1588 1588 c, t dbSNP:750541010
1590 1590 a, c, g dbSNP:763266323
1597 1597 c, t dbSNP:377567759
1598 1598 a, g dbSNP:751667594
1617 1617 c, t dbSNP:755147377
1620 1620 c, g, t dbSNP:146711874
1624 1624 a, g dbSNP:753269876
1628 1628 c, t dbSNP:200592648
1636 1636 a, g, t dbSNP:746763556
1641 1641 a, c dbSNP:199754312
1659 1659 c, t dbSNP:771736232
1668 1668 a, c dbSNP:779726192
1673 1673 a, g dbSNP:746521110
1683 1683 a, c dbSNP:768208443
1684 1684 c, t dbSNP:147732025
1689 1689 g, t dbSNP:587778247
1698 1698 c, t dbSNP:568681121
1699 1699 a, g dbSNP:769434273
1710 1710 a, c dbSNP:773079786
1716 1716 a, t dbSNP:762704534
1717 1717 a, g dbSNP:768500612
1730 1730 a, g dbSNP:766676440
1737 1737 c, t dbSNP:774773441
1753 1753 a, g dbSNP:760711480
1755 1755 c, t dbSNP:17336800
1778 1778 a, c dbSNP:371114444
1780 1780 c, t dbSNP:587778248
1782 1782 a, c, t dbSNP:374670788
1783 1783 a, g, t dbSNP:754646330
1798 1798 c, t dbSNP:368484180
1799 1799 c, t dbSNP:564398642
1800 1800 a, g dbSNP:142429250
1802 1802 a, g dbSNP:749186957
1803 1803 g, t dbSNP:116057045
1808 1808 a, c, g, t dbSNP:2227983
1809 1809 a, g dbSNP:745709532
1815 1815 c, t dbSNP:761127339
1816 1816 a, g dbSNP:587778249
1818 1818 c, t dbSNP:760800224
1825 1825 c, t dbSNP:768627073
1826 1826 a, g dbSNP:150477666
1828 1828 a, g dbSNP:762336338
1830 1830 c, t dbSNP:765534683
1848 1848 a, g dbSNP:529355260
1851 1851 c, t dbSNP:763346690
1852 1852 a, g dbSNP:767193132
1853 1853 c, t dbSNP:752350337
1876 1876 a, g dbSNP:755584255
1877 1877 a, g dbSNP:764356379
1878 1878 c, t dbSNP:17290103
1879 1879 a, g dbSNP:778985185
1893 1893 c, t dbSNP:750403646
1902 1902 c, t dbSNP:758141603
1907 1907 a, g dbSNP:779741928
1914 1914 a, g dbSNP:747203424
1917 1917 a, g dbSNP:768735314
1920 1920 c, t dbSNP:781514400
1924 1924 a, c dbSNP:748219780
1927 1927 c, g dbSNP:769918274
1933 1933 c, t dbSNP:775394093
1936 1936 a, c, t dbSNP:773651001
1945 1945 a, g dbSNP:771278492
1955 1955 c, g dbSNP:774558548
1961 1961 c, g dbSNP:759987693
1966 1966 c, t dbSNP:760471492
1967 1967 a, g dbSNP:370810719
1974 1974 a, t dbSNP:538447477
1979 1979 a, g dbSNP:556794990
1983 1983 c, t dbSNP:776359891
1985 1985 c, t dbSNP:761585117
1987 1987 a, c dbSNP:764787649
1995 1995 c, t dbSNP:141232284
2003 2003 c, t dbSNP:542237406
2007 2007 c, t dbSNP:766220964
2012 2012 a, c dbSNP:751570775
2013 2013 c, t dbSNP:754671343
2019 2019 c, t dbSNP:767304301
2020 2020 a, g dbSNP:144943614
2021 2021 c, t dbSNP:28384375
2023 2023 a, c dbSNP:371483915
2025 2025 c, g dbSNP:756307243
2027 2027 a, c dbSNP:778011429
2034 2034 a, g dbSNP:17290162
2035 2035 g, t dbSNP:757419349
2039 2039 g, t dbSNP:139236063
2044 2044 a, g, t dbSNP:746395542
2045 2045 c, t dbSNP:149375515
2048 2048 a, g dbSNP:201498575
2052 2052 a, g dbSNP:747423535
2055 2055 c, t dbSNP:769537072
2058 2058 c, t dbSNP:773064203
2062 2062 c, g dbSNP:143152775
2064 2064 a, g, t dbSNP:148242307
2067 2067 c, t dbSNP:377048120
2076 2076 c, t dbSNP:115350205
2077 2077 a, g dbSNP:201061916
2082 2082 c, t dbSNP:150803480
2083 2083 a, g dbSNP:764290273
2085 2085 a, c, t dbSNP:17290169
2086 2086 a, g dbSNP:779076899
2087 2087 a, g dbSNP:750850720
2093 2093 c, t dbSNP:756534868
2097 2097 c, t dbSNP:143422127
2105 2105 a, g dbSNP:150899403
2113 2113 a, t dbSNP:747376358
2117 2117 g, t dbSNP:28384376
2118 2118 c, t dbSNP:769203592
2124 2124 c, t dbSNP:533525993
2125 2125 a, g dbSNP:753315940
2132 2132 a, g dbSNP:371814116
2137 2137 -, ga dbSNP:758925495
2139 2139 a, c, g dbSNP:567073985
2140 2140 a, g dbSNP:750024622
2143 2143 a, c dbSNP:369826866
2144 2144 c, t dbSNP:779726134
2149 2149 g, t dbSNP:147139524
2152 2152 a, g dbSNP:754507771
2162 2162 c, g dbSNP:781128508
2164 2164 a, c dbSNP:140443314
2169 2169 a, t dbSNP:769593091
2177 2177 c, t dbSNP:777733466
2180 2180 c, t dbSNP:749145316
2183 2183 g, t dbSNP:771274615
2186 2186 a, c dbSNP:774771530
2190 2190 a, g dbSNP:759602022
2201 2201 a, g, t dbSNP:371909721
2206 2206 a, g dbSNP:761106266
2212 2212 c, t dbSNP:764631638
2214 2214 c, t dbSNP:10258429
2215 2215 c, t dbSNP:578183026
2219 2219 a, g dbSNP:762236315
2220 2220 c, t dbSNP:376733874
2221 2221 a, g dbSNP:145830434
2223 2223 a, g dbSNP:370071208
2225 2225 c, g dbSNP:754446310
2233 2233 g, t dbSNP:780600637
2247 2247 c, t dbSNP:369256206
2256 2256 g, t dbSNP:374459674
2269 2269 a, c, g dbSNP:138963326
2271 2271 a, g dbSNP:749080156
2273 2273 a, c dbSNP:770861870
2274 2274 a, g dbSNP:17336988
2280 2280 a, g dbSNP:746105512
2282 2282 c, t dbSNP:772139095
2286 2286 c, g dbSNP:201419843
2291 2291 g, t dbSNP:775407038
2294 2294 a, g dbSNP:760845355
2295 2295 a, g dbSNP:769151043
2297 2297 a, g dbSNP:777184524
2301 2301 a, t dbSNP:762109788
2303 2303 a, g dbSNP:111275056
2306 2306 g, t dbSNP:751185812
2314 2314 c, t dbSNP:759135866
2332 2332 a, t dbSNP:767248396
2334 2334 c, t dbSNP:752117680
2339 2339 c, t dbSNP:755742111
2343 2343 c, t dbSNP:183216180
2344 2344 a, c dbSNP:753828905
2345 2345 c, t dbSNP:368763603
2346 2346 a, g dbSNP:778870778
2350 2350 c, t dbSNP:745721490
2353 2353 c, t dbSNP:77402685
2354 2354 c, t dbSNP:10258568
2358 2358 c, t dbSNP:747050636
2373 2373 c, t dbSNP:768740350
2374 2374 c, t dbSNP:777057963
2378 2378 a, c dbSNP:748687776
2379 2379 c, t dbSNP:565556314
2380 2380 a, c, g, t dbSNP:17290225
2386 2386 g, t dbSNP:775222124
2393 2393 c, t dbSNP:760194723
2394 2394 a, c, g, t dbSNP:530043155
2395 2395 a, g, t dbSNP:10228436
2403 2403 c, t dbSNP:758274673
2413 2413 c, t dbSNP:780086345
2421 2421 a, g dbSNP:17290239
2428 2428 a, g dbSNP:187324734
2440 2440 a, g dbSNP:146390049
2443 2443 c, g dbSNP:779270612
2491 2491 a, c dbSNP:113869003
2492 2492 c, t dbSNP:752776901
2507 2507 a, g dbSNP:17336995
2514 2514 -, c dbSNP:781307402
2533 2533 c, t dbSNP:538888597
2534 2534 c, t dbSNP:561407812
2545 2545 c, g dbSNP:565105141
2575 2575 a, g dbSNP:531636345
2583 2583 g, t dbSNP:575149033
2586 2586 a, g dbSNP:75529744
2588 2588 c, g dbSNP:554690485
2591 2591 g, t dbSNP:10277413
2604 2604 c, g dbSNP:373533282
2612 2612 a, g dbSNP:540824714
2638 2638 c, t dbSNP:565519908
2640 2640 c, g dbSNP:532436033
2663 2663 -, t dbSNP:758872139
2724 2724 a, g dbSNP:112565702
2742 2742 a, t dbSNP:149659398
2769 2769 a, c, t dbSNP:17337009
2770 2770 a, g dbSNP:17337016
2807 2807 -, gt dbSNP:374202229
2807 2807 a, g dbSNP:563058557
2834 2834 a, g dbSNP:768686299
2841 2841 a, g dbSNP:530069761

Target ORF information:

RefSeq Version NM_201284
Organism Homo sapiens (human)
Definition Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 4, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_201284

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
ATGCGACCCT CCGGGACGGC CGGGGCAGCG CTCCTGGCGC TGCTGGCTGC GCTCTGCCCG 
GCGAGTCGGG CTCTGGAGGA AAAGAAAGTT TGCCAAGGCA CGAGTAACAA GCTCACGCAG
TTGGGCACTT TTGAAGATCA TTTTCTCAGC CTCCAGAGGA TGTTCAATAA CTGTGAGGTG
GTCCTTGGGA ATTTGGAAAT TACCTATGTG CAGAGGAATT ATGATCTTTC CTTCTTAAAG
ACCATCCAGG AGGTGGCTGG TTATGTCCTC ATTGCCCTCA ACACAGTGGA GCGAATTCCT
TTGGAAAACC TGCAGATCAT CAGAGGAAAT ATGTACTACG AAAATTCCTA TGCCTTAGCA
GTCTTATCTA ACTATGATGC AAATAAAACC GGACTGAAGG AGCTGCCCAT GAGAAATTTA
CAGGAAATCC TGCATGGCGC CGTGCGGTTC AGCAACAACC CTGCCCTGTG CAACGTGGAG
AGCATCCAGT GGCGGGACAT AGTCAGCAGT GACTTTCTCA GCAACATGTC GATGGACTTC
CAGAACCACC TGGGCAGCTG CCAAAAGTGT GATCCAAGCT GTCCCAATGG GAGCTGCTGG
GGTGCAGGAG AGGAGAACTG CCAGAAACTG ACCAAAATCA TCTGTGCCCA GCAGTGCTCC
GGGCGCTGCC GTGGCAAGTC CCCCAGTGAC TGCTGCCACA ACCAGTGTGC TGCAGGCTGC
ACAGGCCCCC GGGAGAGCGA CTGCCTGGTC TGCCGCAAAT TCCGAGACGA AGCCACGTGC
AAGGACACCT GCCCCCCACT CATGCTCTAC AACCCCACCA CGTACCAGAT GGATGTGAAC
CCCGAGGGCA AATACAGCTT TGGTGCCACC TGCGTGAAGA AGTGTCCCCG TAATTATGTG
GTGACAGATC ACGGCTCGTG CGTCCGAGCC TGTGGGGCCG ACAGCTATGA GATGGAGGAA
GACGGCGTCC GCAAGTGTAA GAAGTGCGAA GGGCCTTGCC GCAAAGTGTG TAACGGAATA
GGTATTGGTG AATTTAAAGA CTCACTCTCC ATAAATGCTA CGAATATTAA ACACTTCAAA
AACTGCACCT CCATCAGTGG CGATCTCCAC ATCCTGCCGG TGGCATTTAG GGGTGACTCC
TTCACACATA CTCCTCCTCT GGATCCACAG GAACTGGATA TTCTGAAAAC CGTAAAGGAA
ATCACAGGGT TTTTGCTGAT TCAGGCTTGG CCTGAAAACA GGACGGACCT CCATGCCTTT
GAGAACCTAG AAATCATACG CGGCAGGACC AAGCAACATG GTCAGTTTTC TCTTGCAGTC
GTCAGCCTGA ACATAACATC CTTGGGATTA CGCTCCCTCA AGGAGATAAG TGATGGAGAT
GTGATAATTT CAGGAAACAA AAATTTGTGC TATGCAAATA CAATAAACTG GAAAAAACTG
TTTGGGACCT CCGGTCAGAA AACCAAAATT ATAAGCAACA GAGGTGAAAA CAGCTGCAAG
GCCACAGGCC AGGTCTGCCA TGCCTTGTGC TCCCCCGAGG GCTGCTGGGG CCCGGAGCCC
AGGGACTGCG TCTCTTGCCG GAATGTCAGC CGAGGCAGGG AATGCGTGGA CAAGTGCAAC
CTTCTGGAGG GTGAGCCAAG GGAGTTTGTG GAGAACTCTG AGTGCATACA GTGCCACCCA
GAGTGCCTGC CTCAGGCCAT GAACATCACC TGCACAGGAC GGGGACCAGA CAACTGTATC
CAGTGTGCCC ACTACATTGA CGGCCCCCAC TGCGTCAAGA CCTGCCCGGC AGGAGTCATG
GGAGAAAACA ACACCCTGGT CTGGAAGTAC GCAGACGCCG GCCATGTGTG CCACCTGTGC
CATCCAAACT GCACCTACGG GCCAGGAAAT GAGAGTCTCA AAGCCATGTT ATTCTGCCTT
TTTAAACTAT CATCCTGTAA TCAAAGTAAT GATGGCAGCG TGTCCCACCA GAGCGGGAGC
CCAGCTGCTC AGGAGTCATG CTTAGGATGG ATCCCTTCTC TTCTGCCGTC AGAGTTTCAG
CTGGGTTGGG GTGGATGCAG CCACCTCCAT GCCTGGCCTT CTGCATCTGT GATCATCACG
GCCTCCTCCT GCCACTGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu25437
Accession Version NM_005228.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 3633bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product epidermal growth factor receptor isoform a precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AW163038.1, X00588.1, AF125253.1, AU137334.1, CB160831.1, AL598260.1, AI217671.1 and AW295229.1. This sequence is a reference standard in the RefSeqGene project. On Jan 26, 2004 this sequence version replaced gi:29725608. Summary: The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. Multiple alternatively spliced transcript variants that encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2010]. Transcript Variant: This variant (1) is the longest transcript and it encodes the longest isoform (a). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: X00588.1, BC070081.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968189, SAMEA1968540 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
1801
1861
1921
1981
2041
2101
2161
2221
2281
2341
2401
2461
2521
2581
2641
2701
2761
2821
2881
2941
3001
3061
3121
3181
3241
3301
3361
3421
3481
3541
3601
ATGCGACCCT CCGGGACGGC CGGGGCAGCG CTCCTGGCGC TGCTGGCTGC GCTCTGCCCG 
GCGAGTCGGG CTCTGGAGGA AAAGAAAGTT TGCCAAGGCA CGAGTAACAA GCTCACGCAG
TTGGGCACTT TTGAAGATCA TTTTCTCAGC CTCCAGAGGA TGTTCAATAA CTGTGAGGTG
GTCCTTGGGA ATTTGGAAAT TACCTATGTG CAGAGGAATT ATGATCTTTC CTTCTTAAAG
ACCATCCAGG AGGTGGCTGG TTATGTCCTC ATTGCCCTCA ACACAGTGGA GCGAATTCCT
TTGGAAAACC TGCAGATCAT CAGAGGAAAT ATGTACTACG AAAATTCCTA TGCCTTAGCA
GTCTTATCTA ACTATGATGC AAATAAAACC GGACTGAAGG AGCTGCCCAT GAGAAATTTA
CAGGAAATCC TGCATGGCGC CGTGCGGTTC AGCAACAACC CTGCCCTGTG CAACGTGGAG
AGCATCCAGT GGCGGGACAT AGTCAGCAGT GACTTTCTCA GCAACATGTC GATGGACTTC
CAGAACCACC TGGGCAGCTG CCAAAAGTGT GATCCAAGCT GTCCCAATGG GAGCTGCTGG
GGTGCAGGAG AGGAGAACTG CCAGAAACTG ACCAAAATCA TCTGTGCCCA GCAGTGCTCC
GGGCGCTGCC GTGGCAAGTC CCCCAGTGAC TGCTGCCACA ACCAGTGTGC TGCAGGCTGC
ACAGGCCCCC GGGAGAGCGA CTGCCTGGTC TGCCGCAAAT TCCGAGACGA AGCCACGTGC
AAGGACACCT GCCCCCCACT CATGCTCTAC AACCCCACCA CGTACCAGAT GGATGTGAAC
CCCGAGGGCA AATACAGCTT TGGTGCCACC TGCGTGAAGA AGTGTCCCCG TAATTATGTG
GTGACAGATC ACGGCTCGTG CGTCCGAGCC TGTGGGGCCG ACAGCTATGA GATGGAGGAA
GACGGCGTCC GCAAGTGTAA GAAGTGCGAA GGGCCTTGCC GCAAAGTGTG TAACGGAATA
GGTATTGGTG AATTTAAAGA CTCACTCTCC ATAAATGCTA CGAATATTAA ACACTTCAAA
AACTGCACCT CCATCAGTGG CGATCTCCAC ATCCTGCCGG TGGCATTTAG GGGTGACTCC
TTCACACATA CTCCTCCTCT GGATCCACAG GAACTGGATA TTCTGAAAAC CGTAAAGGAA
ATCACAGGGT TTTTGCTGAT TCAGGCTTGG CCTGAAAACA GGACGGACCT CCATGCCTTT
GAGAACCTAG AAATCATACG CGGCAGGACC AAGCAACATG GTCAGTTTTC TCTTGCAGTC
GTCAGCCTGA ACATAACATC CTTGGGATTA CGCTCCCTCA AGGAGATAAG TGATGGAGAT
GTGATAATTT CAGGAAACAA AAATTTGTGC TATGCAAATA CAATAAACTG GAAAAAACTG
TTTGGGACCT CCGGTCAGAA AACCAAAATT ATAAGCAACA GAGGTGAAAA CAGCTGCAAG
GCCACAGGCC AGGTCTGCCA TGCCTTGTGC TCCCCCGAGG GCTGCTGGGG CCCGGAGCCC
AGGGACTGCG TCTCTTGCCG GAATGTCAGC CGAGGCAGGG AATGCGTGGA CAAGTGCAAC
CTTCTGGAGG GTGAGCCAAG GGAGTTTGTG GAGAACTCTG AGTGCATACA GTGCCACCCA
GAGTGCCTGC CTCAGGCCAT GAACATCACC TGCACAGGAC GGGGACCAGA CAACTGTATC
CAGTGTGCCC ACTACATTGA CGGCCCCCAC TGCGTCAAGA CCTGCCCGGC AGGAGTCATG
GGAGAAAACA ACACCCTGGT CTGGAAGTAC GCAGACGCCG GCCATGTGTG CCACCTGTGC
CATCCAAACT GCACCTACGG ATGCACTGGG CCAGGTCTTG AAGGCTGTCC AACGAATGGG
CCTAAGATCC CGTCCATCGC CACTGGGATG GTGGGGGCCC TCCTCTTGCT GCTGGTGGTG
GCCCTGGGGA TCGGCCTCTT CATGCGAAGG CGCCACATCG TTCGGAAGCG CACGCTGCGG
AGGCTGCTGC AGGAGAGGGA GCTTGTGGAG CCTCTTACAC CCAGTGGAGA AGCTCCCAAC
CAAGCTCTCT TGAGGATCTT GAAGGAAACT GAATTCAAAA AGATCAAAGT GCTGGGCTCC
GGTGCGTTCG GCACGGTGTA TAAGGGACTC TGGATCCCAG AAGGTGAGAA AGTTAAAATT
CCCGTCGCTA TCAAGGAATT AAGAGAAGCA ACATCTCCGA AAGCCAACAA GGAAATCCTC
GATGAAGCCT ACGTGATGGC CAGCGTGGAC AACCCCCACG TGTGCCGCCT GCTGGGCATC
TGCCTCACCT CCACCGTGCA GCTCATCACG CAGCTCATGC CCTTCGGCTG CCTCCTGGAC
TATGTCCGGG AACACAAAGA CAATATTGGC TCCCAGTACC TGCTCAACTG GTGTGTGCAG
ATCGCAAAGG GCATGAACTA CTTGGAGGAC CGTCGCTTGG TGCACCGCGA CCTGGCAGCC
AGGAACGTAC TGGTGAAAAC ACCGCAGCAT GTCAAGATCA CAGATTTTGG GCTGGCCAAA
CTGCTGGGTG CGGAAGAGAA AGAATACCAT GCAGAAGGAG GCAAAGTGCC TATCAAGTGG
ATGGCATTGG AATCAATTTT ACACAGAATC TATACCCACC AGAGTGATGT CTGGAGCTAC
GGGGTGACCG TTTGGGAGTT GATGACCTTT GGATCCAAGC CATATGACGG AATCCCTGCC
AGCGAGATCT CCTCCATCCT GGAGAAAGGA GAACGCCTCC CTCAGCCACC CATATGTACC
ATCGATGTCT ACATGATCAT GGTCAAGTGC TGGATGATAG ACGCAGATAG TCGCCCAAAG
TTCCGTGAGT TGATCATCGA ATTCTCCAAA ATGGCCCGAG ACCCCCAGCG CTACCTTGTC
ATTCAGGGGG ATGAAAGAAT GCATTTGCCA AGTCCTACAG ACTCCAACTT CTACCGTGCC
CTGATGGATG AAGAAGACAT GGACGACGTG GTGGATGCCG ACGAGTACCT CATCCCACAG
CAGGGCTTCT TCAGCAGCCC CTCCACGTCA CGGACTCCCC TCCTGAGCTC TCTGAGTGCA
ACCAGCAACA ATTCCACCGT GGCTTGCATT GATAGAAATG GGCTGCAAAG CTGTCCCATC
AAGGAAGACA GCTTCTTGCA GCGATACAGC TCAGACCCCA CAGGCGCCTT GACTGAGGAC
AGCATAGACG ACACCTTCCT CCCAGTGCCT GAATACATAA ACCAGTCCGT TCCCAAAAGG
CCCGCTGGCT CTGTGCAGAA TCCTGTCTAT CACAATCAGC CTCTGAACCC CGCGCCCAGC
AGAGACCCAC ACTACCAGGA CCCCCACAGC ACTGCAGTGG GCAACCCCGA GTATCTCAAC
ACTGTCCAGC CCACCTGTGT CAACAGCACA TTCGACAGCC CTGCCCACTG GGCCCAGAAA
GGCAGCCACC AAATTAGCCT GGACAACCCT GACTACCAGC AGGACTTCTT TCCCAAGGAA
GCCAAGCCAA ATGGCATCTT TAAGGGCTCC ACAGCTGAAA ATGCAGAATA CCTAAGGGTC
GCGCCACAAA GCAGTGAATT TATTGGAGCA TGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

RefSeqNP_005219.2
CDS247..3879
Misc Feature(1)208..210(+)
Misc Feature(2)337..420(+)
Misc Feature(3)412..414(+)
Misc Feature(4)415..750(+)
Misc Feature(5)469..1146(+)
Misc Feature(6)628..630(+)
Misc Feature(7)715..807(+)
Misc Feature(8)769..771(+)
Misc Feature(9)799..1257(+)
Misc Feature(10)814..843(+)
Misc Feature(11)826..867(+)
Misc Feature(12)832..834(+)
Misc Feature(13)889..915(+)
Misc Feature(14)901..939(+)
Misc Feature(15)931..933(+)
Misc Feature(16)937..1068(+)
Misc Feature(17)940..966(+)
Misc Feature(18)952..990(+)
Misc Feature(19)997..1026(+)
Misc Feature(20)1036..1119(+)
Misc Feature(21)1129..1167(+)
Misc Feature(22)1177..1224(+)
Misc Feature(23)1231..1245(+)
Misc Feature(24)1255..1332(+)
Misc Feature(25)1300..1302(+)
Misc Feature(26)1327..1689(+)
Misc Feature(27)1327..1329(+)
Misc Feature(28)1414..2046(+)
Misc Feature(29)1483..1485(+)
Misc Feature(30)1576..1578(+)
Misc Feature(31)1654..1743(+)
Misc Feature(32)1759..2157(+)
Misc Feature(33)1762..1923(+)
Misc Feature(34)1762..1791(+)
Misc Feature(35)1774..1815(+)
Misc Feature(36)1822..1851(+)
Misc Feature(37)1828..1830(+)
Misc Feature(38)1861..1911(+)
Misc Feature(39)1918..>2040(+)
Misc Feature(40)1918..1959(+)
Misc Feature(41)1930..1983(+)
Misc Feature(42)1948..1950(+)
Misc Feature(43)1990..2019(+)
Misc Feature(44)2029..2097(+)
Misc Feature(45)2053..2055(+)
Misc Feature(46)2104..2130(+)
Misc Feature(47)2113..2115(+)
Misc Feature(48)2116..2154(+)
Misc Feature(49)2146..2277(+)
Misc Feature(50)2176..2217(+)
Misc Feature(51)2182..2250(+)
Misc Feature(52)2278..2280(+)
Misc Feature(53)2278..2280(+)
Misc Feature(54)2308..2358(+)
Misc Feature(55)2323..2325(+)
Misc Feature(56)2323..2325(+)
Misc Feature(57)2329..2331(+)
Misc Feature(58)2356..3294(+)
Misc Feature(59)2380..3150(+)
Misc Feature(60)2389..3276(+)
Misc Feature(61)2398..2913(+)
Misc Feature(62)2398..2811(+)
Misc Feature(63)2425..2427(+)
Misc Feature(64)2548..2550(+)
Misc Feature(65)2806..2883(+)
Misc Feature(66)2851..2853(+)
Misc Feature(67)2872..2913(+)
Misc Feature(68)2917..2919(+)
Misc Feature(69)2989..2991(+)
Misc Feature(70)3076..3078(+)
Misc Feature(71)3178..3180(+)
Misc Feature(72)3217..3219(+)
Misc Feature(73)3217..3219(+)
Misc Feature(74)3229..3231(+)
Misc Feature(75)3229..3231(+)
Misc Feature(76)3238..3240(+)
Misc Feature(77)3238..3240(+)
Misc Feature(78)3292..3294(+)
Misc Feature(79)3292..3294(+)
Misc Feature(80)3292..3294(+)
Misc Feature(81)3292..3294(+)
Misc Feature(82)3292..3294(+)
Misc Feature(83)3322..3324(+)
Misc Feature(84)3322..3324(+)
Misc Feature(85)3352..3354(+)
Misc Feature(86)3355..3357(+)
Misc Feature(87)3361..3363(+)
Misc Feature(88)3361..3363(+)
Misc Feature(89)3367..3369(+)
Misc Feature(90)3367..3369(+)
Misc Feature(91)3370..3372(+)
Misc Feature(92)3370..3372(+)
Misc Feature(93)3379..3381(+)
Misc Feature(94)3436..3438(+)
Misc Feature(95)3436..3438(+)
Misc Feature(96)3451..3453(+)
Misc Feature(97)3451..3453(+)
Misc Feature(98)3451..3453(+)
Misc Feature(99)3451..3453(+)
Misc Feature(100)3451..3453(+)
Misc Feature(101)3454..3456(+)
Misc Feature(102)3454..3456(+)
Misc Feature(103)3454..3456(+)
Misc Feature(104)3457..3459(+)
Misc Feature(105)3457..3459(+)
Misc Feature(106)3457..3459(+)
Misc Feature(107)3487..3489(+)
Misc Feature(108)3487..3489(+)
Misc Feature(109)3520..3522(+)
Misc Feature(110)3520..3522(+)
Misc Feature(111)3520..3522(+)
Misc Feature(112)3574..3576(+)
Misc Feature(113)3574..3576(+)
Misc Feature(114)3604..3606(+)
Misc Feature(115)3619..3621(+)
Misc Feature(116)3658..3660(+)
Misc Feature(117)3742..3744(+)
Misc Feature(118)3742..3744(+)
Misc Feature(119)3760..3762(+)
Misc Feature(120)3760..3762(+)
Misc Feature(121)3835..3837(+)
Misc Feature(122)3835..3837(+)
Misc Feature(123)3835..3837(+)
Misc Feature(124)3841..3843(+)
Exon (1)1..334
Gene:EGFR
Gene Synonym:
Exon (2)335..486
Gene:EGFR
Gene Synonym:
Exon (3)487..670
Gene:EGFR
Gene Synonym:
Exon (4)671..805
Gene:EGFR
Gene Synonym:
Exon (5)806..874
Gene:EGFR
Gene Synonym:
Exon (6)875..993
Gene:EGFR
Gene Synonym:
Exon (7)994..1135
Gene:EGFR
Gene Synonym:
Exon (8)1136..1252
Gene:EGFR
Gene Synonym:
Exon (9)1253..1379
Gene:EGFR
Gene Synonym:
Exon (10)1380..1453
Gene:EGFR
Gene Synonym:
Exon (11)1454..1544
Gene:EGFR
Gene Synonym:
Exon (12)1545..1744
Gene:EGFR
Gene Synonym:
Exon (13)1745..1877
Gene:EGFR
Gene Synonym:
Exon (14)1878..1968
Gene:EGFR
Gene Synonym:
Exon (15)1969..2126
Gene:EGFR
Gene Synonym:
Exon (16)2127..2165
Gene:EGFR
Gene Synonym:
Exon (17)2166..2307
Gene:EGFR
Gene Synonym:
Exon (18)2308..2430
Gene:EGFR
Gene Synonym:
Exon (19)2431..2529
Gene:EGFR
Gene Synonym:
Exon (20)2530..2715
Gene:EGFR
Gene Synonym:
Exon (21)2716..2871
Gene:EGFR
Gene Synonym:
Exon (22)2872..2947
Gene:EGFR
Gene Synonym:
Exon (23)2948..3094
Gene:EGFR
Gene Synonym:
Exon (24)3095..3192
Gene:EGFR
Gene Synonym:
Exon (25)3193..3360
Gene:EGFR
Gene Synonym:
Exon (26)3361..3408
Gene:EGFR
Gene Synonym:
Exon (27)3409..3517
Gene:EGFR
Gene Synonym:
Exon (28)3518..5600
Gene:EGFR
Gene Synonym:
Translation
Position Chain Variation Link
31 31 g, t dbSNP:712829
37 37 c, t dbSNP:566284155
56 56 a, c dbSNP:712830
113 113 c, t dbSNP:551488510
171 171 c, t dbSNP:570107879
178 178 c, t dbSNP:537165657
184 184 c, g dbSNP:555477367
203 203 a, t dbSNP:17288945
209 209 g, t dbSNP:746536427
215 215 c, g, t dbSNP:375923119
226 226 c, t dbSNP:781240283
244 244 a, g dbSNP:748159429
245 245 c, t dbSNP:769658183
253 253 a, c dbSNP:773069229
254 254 c, t dbSNP:749433287
257 257 c, t dbSNP:771210838
259 259 c, g dbSNP:774487133
260 260 a, g dbSNP:759582787
262 262 a, g dbSNP:767651648
264 264 c, g dbSNP:775964175
265 265 c, g, t dbSNP:761183109
267 267 c, t dbSNP:369581368
268 268 a, g dbSNP:754259847
276 276 g, t dbSNP:757936561
279 279 c, t dbSNP:766029589
284 284 c, t dbSNP:567894670
298 298 c, t dbSNP:754527029
302 302 c, g dbSNP:780865931
307 307 a, g, t dbSNP:373129709
324 324 a, g dbSNP:777385414
328 328 a, g dbSNP:749088691
330 330 a, g dbSNP:770673046
332 332 a, c dbSNP:774551548
339 339 c, t dbSNP:372917131
341 341 a, g dbSNP:746023542
343 343 a, g dbSNP:772311777
347 347 c, g dbSNP:144158123
348 348 a, g, t dbSNP:148679319
362 362 c, t dbSNP:375919121
363 363 a, g dbSNP:777186292
367 367 c, t dbSNP:762281800
373 373 a, g dbSNP:147740818
396 396 c, t dbSNP:770133522
399 399 c, t dbSNP:773745636
404 404 a, g dbSNP:759219499
413 413 a, g dbSNP:767259994
420 420 c, t dbSNP:752438083
421 421 a, g dbSNP:760228905
422 422 a, c dbSNP:763572530
458 458 a, g dbSNP:369580836
468 468 c, t dbSNP:200383389
472 472 a, c dbSNP:778638117
477 477 c, g dbSNP:61731794
487 487 a, g dbSNP:374986786
496 496 a, c, g dbSNP:753319070
509 509 a, g dbSNP:765137528
514 514 c, t dbSNP:750399097
515 515 a, t dbSNP:142061256
521 521 c, t dbSNP:779879611
529 529 a, c dbSNP:35515689
534 534 a, g dbSNP:751744275
535 535 c, g dbSNP:755189573
539 539 a, g, t dbSNP:17289589
545 545 a, c dbSNP:376963968
556 556 c, t dbSNP:756305742
561 561 a, c, g dbSNP:141271101
562 562 a, g dbSNP:771366736
572 572 c, g dbSNP:145113601
578 578 c, t dbSNP:746631025
585 585 c, t dbSNP:374582814
591 591 a, t dbSNP:773596817
600 600 c, t dbSNP:147726446
618 618 c, t dbSNP:142553829
625 625 a, g dbSNP:377444977
632 632 a, c dbSNP:762889647
636 636 c, t dbSNP:766093262
646 646 a, g dbSNP:751337426
655 655 a, g dbSNP:754854319
669 669 g, t dbSNP:767608234
680 680 a, g dbSNP:780476417
684 684 c, g, t dbSNP:199637112
685 685 a, g dbSNP:532655845
687 687 c, g, t dbSNP:138946543
691 691 c, t dbSNP:774146556
692 692 a, g dbSNP:759532524
701 701 a, g dbSNP:551591429
714 714 a, g, t dbSNP:149006234
720 720 c, t dbSNP:2072454
739 739 c, t dbSNP:587778252
740 740 a, g dbSNP:761795138
746 746 c, t dbSNP:765416003
748 748 c, g dbSNP:530692924
755 755 a, g, t dbSNP:758945260
759 759 a, c, t dbSNP:17289686
765 765 c, t dbSNP:777401847
771 771 c, t dbSNP:749002473
776 776 c, t dbSNP:770290445
777 777 a, g dbSNP:17336437
780 780 a, g dbSNP:745755245
793 793 a, c, g dbSNP:772071414
804 804 c, t dbSNP:375037710
807 807 c, t dbSNP:776568205
813 813 a, g dbSNP:748275089
820 820 a, c dbSNP:770074413
825 825 c, t dbSNP:773349388
828 828 c, t dbSNP:763086693
833 833 a, g dbSNP:766507267
840 840 c, t dbSNP:370376501
852 852 a, c dbSNP:748320322
856 856 a, g dbSNP:767829342
870 870 a, g dbSNP:753129657
878 878 c, g dbSNP:779156097
879 879 c, t dbSNP:373970245
880 880 a, c dbSNP:750423932
900 900 g, t dbSNP:776050604
904 904 c, t dbSNP:761098433
906 906 c, t dbSNP:45621033
907 907 a, g, t dbSNP:776886714
909 909 a, g dbSNP:766104143
911 911 a, g dbSNP:751295137
917 917 a, g dbSNP:759106015
921 921 -, c dbSNP:145506643
925 925 c, t dbSNP:766952405
929 929 a, c dbSNP:752616839
937 937 g, t dbSNP:756040606
938 938 c, g dbSNP:777575581
945 945 c, t dbSNP:763962907
968 968 c, t dbSNP:370744986
972 972 c, g, t dbSNP:374561933
976 976 c, t dbSNP:554981236
977 977 a, g dbSNP:200664836
984 984 c, t dbSNP:772130986
985 985 a, c, g dbSNP:780001754
992 992 c, t dbSNP:765893589
1000 1000 c, g dbSNP:775252718
1001 1001 a, g dbSNP:760101437
1004 1004 a, g dbSNP:374084791
1009 1009 c, t dbSNP:776490661
1010 1010 a, g dbSNP:372202099
1014 1014 c, t dbSNP:146098757
1015 1015 a, g dbSNP:138847501
1020 1020 c, t dbSNP:142569931
1022 1022 c, t dbSNP:766478921
1023 1023 a, g dbSNP:751873368
1032 1032 c, t dbSNP:754997451
1038 1038 c, t dbSNP:781427942
1040 1040 a, c dbSNP:748627278
1043 1043 a, c, g dbSNP:17336639
1068 1068 a, g dbSNP:749588554
1073 1073 a, g dbSNP:771396903
1080 1080 c, t dbSNP:774995708
1089 1089 c, t dbSNP:746685847
1090 1090 a, g dbSNP:199796955
1099 1099 c, t dbSNP:776146284
1107 1107 c, t dbSNP:761685805
1111 1111 a, g dbSNP:769696078
1112 1112 c, t dbSNP:149840192
1119 1119 c, t dbSNP:570790705
1120 1120 a, g dbSNP:150549265
1121 1121 c, t dbSNP:762649354
1125 1125 a, g dbSNP:766252686
1135 1135 c, t dbSNP:751667358
1147 1147 g, t dbSNP:779094647
1158 1158 a, c, t dbSNP:182002674
1161 1161 a, c, t dbSNP:566001525
1164 1164 a, c, g dbSNP:202182545
1167 1167 c, t dbSNP:17289893
1168 1168 a, g dbSNP:749132706
1181 1181 c, g dbSNP:770879879
1184 1184 c, t dbSNP:149321481
1186 1186 a, g dbSNP:552062864
1190 1190 a, g dbSNP:745658347
1191 1191 c, t dbSNP:772053702
1200 1200 g, t dbSNP:775800262
1206 1206 a, g dbSNP:760984499
1209 1209 c, t dbSNP:764038041
1210 1210 a, g dbSNP:776791214
1213 1213 a, g dbSNP:761844164
1214 1214 c, t dbSNP:367680488
1215 1215 a, c dbSNP:201040971
1217 1217 a, g dbSNP:758748662
1219 1219 a, c dbSNP:766740458
1221 1221 a, g dbSNP:752278049
1228 1228 a, c dbSNP:144460286
1231 1231 c, t dbSNP:777342222
1233 1233 c, t dbSNP:748801348
1234 1234 a, g dbSNP:139429793
1235 1235 a, g, t dbSNP:778901010
1247 1247 a, g dbSNP:771929085
1274 1274 g, t dbSNP:771398183
1275 1275 c, t dbSNP:774905136
1289 1289 c, t dbSNP:371234907
1293 1293 c, g dbSNP:759932677
1297 1297 a, g dbSNP:767790289
1307 1307 c, t dbSNP:753466844
1332 1332 c, t dbSNP:547057636
1347 1347 c, t dbSNP:185327606
1348 1348 c, g dbSNP:749927550
1349 1349 a, t dbSNP:758017949
1351 1351 a, c dbSNP:780131926
1356 1356 c, t dbSNP:539077864
1365 1365 a, g dbSNP:2302536
1371 1371 a, c dbSNP:780851909
1393 1393 a, c dbSNP:755972013
1413 1413 a, g dbSNP:777959179
1420 1420 c, t dbSNP:749526261
1423 1423 c, g dbSNP:587778246
1438 1438 a, g dbSNP:757265130
1456 1456 a, t dbSNP:777165081
1461 1461 a, g dbSNP:748900962
1484 1484 a, g dbSNP:770466526
1491 1491 g, t dbSNP:774121381
1494 1494 c, g dbSNP:758956103
1497 1497 a, c, t dbSNP:767070097
1507 1507 a, g dbSNP:760639592
1515 1515 a, g dbSNP:763830096
1519 1519 a, g dbSNP:558565565
1522 1522 a, g dbSNP:201364864
1527 1527 c, t dbSNP:367896493
1529 1529 a, g dbSNP:606231253
1535 1535 a, c dbSNP:765369188
1544 1544 a, g dbSNP:750713244
1563 1563 a, g dbSNP:17290005
1566 1566 c, t dbSNP:761495014
1571 1571 a, g dbSNP:765091640
1579 1579 a, g dbSNP:372990493
1588 1588 c, t dbSNP:750541010
1590 1590 a, c, g dbSNP:763266323
1597 1597 c, t dbSNP:377567759
1598 1598 a, g dbSNP:751667594
1617 1617 c, t dbSNP:755147377
1620 1620 c, g, t dbSNP:146711874
1624 1624 a, g dbSNP:753269876
1628 1628 c, t dbSNP:200592648
1636 1636 a, g, t dbSNP:746763556
1641 1641 a, c dbSNP:199754312
1659 1659 c, t dbSNP:771736232
1668 1668 a, c dbSNP:779726192
1673 1673 a, g dbSNP:746521110
1683 1683 a, c dbSNP:768208443
1684 1684 c, t dbSNP:147732025
1689 1689 g, t dbSNP:587778247
1698 1698 c, t dbSNP:568681121
1699 1699 a, g dbSNP:769434273
1710 1710 a, c dbSNP:773079786
1716 1716 a, t dbSNP:762704534
1717 1717 a, g dbSNP:768500612
1730 1730 a, g dbSNP:766676440
1737 1737 c, t dbSNP:774773441
1753 1753 a, g dbSNP:760711480
1755 1755 c, t dbSNP:17336800
1778 1778 a, c dbSNP:371114444
1780 1780 c, t dbSNP:587778248
1782 1782 a, c, t dbSNP:374670788
1783 1783 a, g, t dbSNP:754646330
1798 1798 c, t dbSNP:368484180
1799 1799 c, t dbSNP:564398642
1800 1800 a, g dbSNP:142429250
1802 1802 a, g dbSNP:749186957
1803 1803 g, t dbSNP:116057045
1808 1808 a, c, g, t dbSNP:2227983
1809 1809 a, g dbSNP:745709532
1815 1815 c, t dbSNP:761127339
1816 1816 a, g dbSNP:587778249
1818 1818 c, t dbSNP:760800224
1825 1825 c, t dbSNP:768627073
1826 1826 a, g dbSNP:150477666
1828 1828 a, g dbSNP:762336338
1830 1830 c, t dbSNP:765534683
1848 1848 a, g dbSNP:529355260
1851 1851 c, t dbSNP:763346690
1852 1852 a, g dbSNP:767193132
1853 1853 c, t dbSNP:752350337
1876 1876 a, g dbSNP:755584255
1877 1877 a, g dbSNP:764356379
1878 1878 c, t dbSNP:17290103
1879 1879 a, g dbSNP:778985185
1893 1893 c, t dbSNP:750403646
1902 1902 c, t dbSNP:758141603
1907 1907 a, g dbSNP:779741928
1914 1914 a, g dbSNP:747203424
1917 1917 a, g dbSNP:768735314
1920 1920 c, t dbSNP:781514400
1924 1924 a, c dbSNP:748219780
1927 1927 c, g dbSNP:769918274
1933 1933 c, t dbSNP:775394093
1936 1936 a, c, t dbSNP:773651001
1945 1945 a, g dbSNP:771278492
1955 1955 c, g dbSNP:774558548
1961 1961 c, g dbSNP:759987693
1966 1966 c, t dbSNP:760471492
1967 1967 a, g dbSNP:370810719
1974 1974 a, t dbSNP:538447477
1979 1979 a, g dbSNP:556794990
1983 1983 c, t dbSNP:776359891
1985 1985 c, t dbSNP:761585117
1987 1987 a, c dbSNP:764787649
1995 1995 c, t dbSNP:141232284
2003 2003 c, t dbSNP:542237406
2007 2007 c, t dbSNP:766220964
2012 2012 a, c dbSNP:751570775
2013 2013 c, t dbSNP:754671343
2019 2019 c, t dbSNP:767304301
2020 2020 a, g dbSNP:144943614
2021 2021 c, t dbSNP:28384375
2023 2023 a, c dbSNP:371483915
2025 2025 c, g dbSNP:756307243
2027 2027 a, c dbSNP:778011429
2034 2034 a, g dbSNP:17290162
2035 2035 g, t dbSNP:757419349
2039 2039 g, t dbSNP:139236063
2044 2044 a, g, t dbSNP:746395542
2045 2045 c, t dbSNP:149375515
2048 2048 a, g dbSNP:201498575
2052 2052 a, g dbSNP:747423535
2055 2055 c, t dbSNP:769537072
2058 2058 c, t dbSNP:773064203
2062 2062 c, g dbSNP:143152775
2064 2064 a, g, t dbSNP:148242307
2067 2067 c, t dbSNP:377048120
2076 2076 c, t dbSNP:115350205
2077 2077 a, g dbSNP:201061916
2082 2082 c, t dbSNP:150803480
2083 2083 a, g dbSNP:764290273
2085 2085 a, c, t dbSNP:17290169
2086 2086 a, g dbSNP:779076899
2087 2087 a, g dbSNP:750850720
2093 2093 c, t dbSNP:756534868
2097 2097 c, t dbSNP:143422127
2105 2105 a, g dbSNP:150899403
2113 2113 a, t dbSNP:747376358
2117 2117 g, t dbSNP:28384376
2118 2118 c, t dbSNP:769203592
2124 2124 c, t dbSNP:533525993
2125 2125 a, g dbSNP:753315940
2133 2133 a, g, t dbSNP:2227984
2137 2137 c, t dbSNP:552265738
2146 2146 a, g dbSNP:765068810
2151 2151 c, t dbSNP:371148125
2158 2158 a, g dbSNP:762592162
2159 2159 c, t dbSNP:571064657
2160 2160 a, g dbSNP:146783627
2164 2164 g, t dbSNP:200989322
2177 2177 c, t dbSNP:770443325
2178 2178 a, g, t dbSNP:367909827
2180 2180 c, g dbSNP:772046081
2182 2182 a, c dbSNP:140516819
2184 2184 c, t dbSNP:760450694
2185 2185 a, g dbSNP:764359156
2189 2189 c, g, t dbSNP:776728879
2190 2190 c, t dbSNP:765441420
2193 2193 c, g dbSNP:531361756
2198 2198 g, t dbSNP:758954817
2209 2209 c, g dbSNP:767037049
2217 2217 g, t dbSNP:751948988
2221 2221 c, g dbSNP:201580890
2222 2222 c, t dbSNP:755356995
2232 2232 g, t dbSNP:377187758
2235 2235 a, g dbSNP:748898746
2236 2236 a, t dbSNP:756705853
2238 2238 c, t dbSNP:200855539
2239 2239 a, g dbSNP:745422316
2242 2242 c, t dbSNP:771988878
2244 2244 c, g dbSNP:779909747
2248 2248 a, g dbSNP:746757722
2249 2249 g, t dbSNP:76946721
2252 2252 a, g dbSNP:768336804
2256 2256 a, g, t dbSNP:776875545
2257 2257 c, t dbSNP:770193776
2259 2259 a, c dbSNP:773398218
2265 2265 c, t dbSNP:763193362
2266 2266 a, g, t dbSNP:17337079
2270 2270 a, g dbSNP:150423237
2271 2271 a, c, g dbSNP:372471129
2276 2276 a, g dbSNP:756870976
2279 2279 c, t dbSNP:138193597
2280 2280 a, g, t dbSNP:780214453
2281 2281 c, t dbSNP:374117790
2284 2284 c, t dbSNP:369399038
2285 2285 a, g dbSNP:373336251
2289 2289 a, g dbSNP:746948587
2293 2293 c, t dbSNP:55669340
2308 2308 c, t dbSNP:749554270
2311 2311 c, g dbSNP:397517083
2340 2340 c, t dbSNP:370409092
2347 2347 a, c dbSNP:774261340
2351 2351 c, t dbSNP:549015965
2355 2355 c, g dbSNP:746027140
2363 2363 c, t dbSNP:397517084
2371 2371 a, g dbSNP:727504256
2372 2372 a, c, g, t dbSNP:397517085
2373 2373 aact, c dbSNP:397517087
2373 2373 -, aac dbSNP:397517086
2376 2376 c, t dbSNP:775986651
2384 2384 a, c dbSNP:373578289
2391 2391 c, t dbSNP:764470595
2400 2400 a, g, t dbSNP:397517088
2401 2401 a, c, g, t dbSNP:28929495
2402 2402 a, c, g dbSNP:121913428
2405 2405 c, g dbSNP:772799315
2411 2411 c, t dbSNP:762494280
2412 2412 a, c, g dbSNP:367694667
2415 2415 c, t dbSNP:370590012
2418 2418 c, t dbSNP:754578411
2420 2420 c, t dbSNP:767505234
2421 2421 a, c, g dbSNP:55959834
2422 2422 a, g dbSNP:483352805
2424 2424 a, g dbSNP:777735216
2426 2426 a, g dbSNP:138240620
2434 2434 c, g, t dbSNP:121913434
2435 2435 c, g, t dbSNP:771995749
2436 2436 c, g dbSNP:758357735
2438 2438 a, g dbSNP:397517089
2439 2439 a, g dbSNP:121913467
2444 2444 c, t dbSNP:121913446
2446 2446 a, g dbSNP:121913420
2449 2449 a, g dbSNP:121913430
2463 2463 a, t dbSNP:780083331
2464 2464 a, g dbSNP:747133806
2465 2465 c, t dbSNP:397517092
2466 2466 c, t dbSNP:769149292
2469 2469 a, c, t dbSNP:372772241
2470 2470 a, g dbSNP:587778250
2471 2471 c, t dbSNP:121913466
2472 2472 c, t dbSNP:773835994
2473 2473 a, g dbSNP:759256622
2476 2476 atcaaggaattaagagaagc, gtcaa dbSNP:727503014
2477 2477 -, aaaattcccgtcgcta dbSNP:727504326
2478 2478 aaagtt, caaggaattaagagaagcaac dbSNP:727504428
2478 2478 -, caaggaattaagagaagca dbSNP:727504324
2478 2478 aaa, caaggaattaagagaagc dbSNP:397517094
2478 2478 -, aaaattcccgtcgctatc dbSNP:397517090
2478 2478 c, t dbSNP:397517093
2480 2480 -, aattcccgtcgctatcaa dbSNP:397517091
2480 2480 a, g dbSNP:121913433
2481 2481 aattc, ggaattaagagaagcaa dbSNP:727504332
2481 2481 -, ggaattaagagaagc dbSNP:121913421
2481 2481 aattc, ggaattaagagaag dbSNP:727504281
2481 2481 -, ggaattaag dbSNP:727504266
2482 2482 -, gaattaagagaagcaaca dbSNP:121913426
2482 2482 at, gaattaagagaagcaac dbSNP:727504402
2482 2482 -, gaattaagagaagca dbSNP:727504233
2482 2482 a, c, g dbSNP:121913427
2483 2483 aattaagagaagcaacatctc, tct dbSNP:727504282
2483 2483 aattaagagaagcaacatct, tc dbSNP:121913424
2483 2483 aattaagagaagcaacatc, t dbSNP:727504258
2483 2483 -, aattaagagaagcaacat dbSNP:121913422
2483 2483 -, aattaagagaagcaa dbSNP:121913425
2483 2483 aattaagagaagcaa, ttc dbSNP:727503016
2483 2483 aattaagagaag, cac, ccc dbSNP:727503015
2483 2483 aattaagaga, c dbSNP:727504444
2484 2484 -, attaagagaagcaacatc dbSNP:121913423
2484 2484 attaagagaagcaa, gc dbSNP:727504257
2484 2484 attaagagaag, gc dbSNP:121913435
2485 2485 acgagaga, ttaagagaagcaacatctccgaaagc dbSNP:727504414
2485 2485 ca, ttaagagaagcaacatctcc dbSNP:121913437
2485 2485 a, caat, ttaagagaagcaacatctc dbSNP:727504339
2485 2485 -, ttaagagaagcaacatct dbSNP:121913440
2485 2485 c, ttaagagaagcaa dbSNP:397509368
2485 2485 c, ttaagagaag dbSNP:727504278
2485 2485 -, ttaagagaa dbSNP:121913436
2485 2485 cc, tt dbSNP:397517096
2485 2485 c, t dbSNP:397517095
2486 2486 -, taagagaagcaacatctc dbSNP:121913438
2486 2486 -, taagagaagcaacat dbSNP:121913442
2486 2486 -, taagagaagcaa dbSNP:121913441
2486 2486 -, taagagaag dbSNP:397517098
2486 2486 c, t dbSNP:397517097
2487 2487 aaga, cccg dbSNP:121913439
2493 2493 -, agcaacatctccgaaagc dbSNP:397517099
2494 2494 c, g dbSNP:121913229
2497 2497 acatctccgaaagccaacaaggaaatc, gat dbSNP:727504395
2497 2497 -, acatctccgaaagccaacaaggaaa dbSNP:727504284
2498 2498 aa, catctccgaaagccaacaaggaaatc dbSNP:397517100
2498 2498 c, t dbSNP:727504316
2499 2499 -, atctccgaaagccaacaaggaaat dbSNP:727504232
2500 2500 -, tctccgaaagccaacaaggaaatc dbSNP:121913463
2501 2501 a, c dbSNP:121913464
2503 2503 c, t dbSNP:121913231
2504 2504 c, t dbSNP:559717059
2505 2505 a, g dbSNP:764064214
2506 2506 a, g dbSNP:397517101
2511 2511 c, g dbSNP:727503017
2516 2516 a, g, t dbSNP:397517102
2519 2519 a, g dbSNP:761470472
2523 2523 -, t dbSNP:727503018
2526 2526 c, t dbSNP:397517103
2527 2527 a, g, t dbSNP:121913418
2535 2535 c, g dbSNP:117420095
2536 2536 -, accatc, tccaggaagcct dbSNP:397517106
2538 2538 c, t dbSNP:755011268
2539 2539 a, c, g dbSNP:374873413
2545 2545 g, t dbSNP:759418157
2546 2546 c, t dbSNP:397517107
2548 2548 a, g dbSNP:756614898
2549 2549 -, gcgtggaca dbSNP:146024686
2549 2549 gc, tt dbSNP:397517108
2549 2549 g, t dbSNP:121913465
2550 2550 c, t dbSNP:778199483
2551 2551 -, tggccagcg dbSNP:730880339
2551 2551 a, c, g, t dbSNP:147149347
2552 2552 -, ggccagcgt dbSNP:730880334
2553 2553 a, g dbSNP:757699292
2554 2554 gac, tggg dbSNP:727503019
2555 2555 -, cagcgtgga dbSNP:727503012
2556 2556 -, gggttg dbSNP:397517111
2556 2556 c, t dbSNP:397517110
2557 2557 -, cac, gcgtggaca, gtt dbSNP:397517109
2557 2557 a, g dbSNP:727503020
2558 2558 accc, gcgtggacaaccg dbSNP:121913445
2558 2558 -, tgt dbSNP:727503021
2560 2560 -, acc dbSNP:397517112
2560 2560 c, g dbSNP:746677478
2561 2561 -, ggacaaccc dbSNP:730880333
2562 2562 c, g dbSNP:761020556
2563 2563 -, acaaccccc, cgaaccccc dbSNP:727503013
2563 2563 c, g dbSNP:767075090
2564 2564 a, g dbSNP:121913432
2565 2565 c, t dbSNP:768468531
2566 2566 a, c, g dbSNP:567477136
2567 2567 -, cccccacgt dbSNP:397517113
2568 2568