Email to GenScript

ACSF3 acyl-CoA synthetase family member 3 [Homo sapiens (human)]

Gene Symbol ACSF3
Entrez Gene ID 197322
Full Name acyl-CoA synthetase family member 3
Synonyms
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

16

16q24.3

Summary This gene encodes a member of the acyl-CoA synthetase family of enzymes that activate fatty acids by catalyzing the formation of a thioester linkage between fatty acids and coenzyme A. The encoded protein is localized to mitochondria, has high specificity for malonate and methylmalonate and possesses malonyl-CoA synthetase activity. Mutations in this gene are a cause of combined malonic and methylmalonic aciduria. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Sep 2013]. lac of sum
Disorder MIM:

614245

Disorder Html:





The following ACSF3 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the ACSF3 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu01574 NM_001127214 Homo sapiens acyl-CoA synthetase family member 3 (ACSF3), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $379
OHu01574 NM_001243279 Homo sapiens acyl-CoA synthetase family member 3 (ACSF3), transcript variant 4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu08539 NM_001284316 Homo sapiens acyl-CoA synthetase family member 3 (ACSF3), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $199
OHu01574 NM_174917 Homo sapiens acyl-CoA synthetase family member 3 (ACSF3), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $379
OHu49300 XM_005256293 PREDICTED: Homo sapiens acyl-CoA synthetase family member 3 (ACSF3), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu49300 XM_011522942 PREDICTED: Homo sapiens acyl-CoA synthetase family member 3 (ACSF3), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu49300 XM_011522943 PREDICTED: Homo sapiens acyl-CoA synthetase family member 3 (ACSF3), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu77541 XM_011522944 PREDICTED: Homo sapiens acyl-CoA synthetase family member 3 (ACSF3), transcript variant X7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.


CloneID OHu01574
Accession Version NM_001127214.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1731bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product acyl-CoA synthetase family member 3, mitochondrial isoform 1 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BM148793.1, AK290963.1 and AC009113.8. On Sep 27, 2013 this sequence version replaced gi:343168764. Summary: This gene encodes a member of the acyl-CoA synthetase family of enzymes that activate fatty acids by catalyzing the formation of a thioester linkage between fatty acids and coenzyme A. The encoded protein is localized to mitochondria, has high specificity for malonate and methylmalonate and possesses malonyl-CoA synthetase activity. Mutations in this gene are a cause of combined malonic and methylmalonic aciduria. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Sep 2013]. Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 4 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## ##Evidence-Data-START## Transcript exon combination :: AK290963.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2142348, SAMEA2142680 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
ATGCTGCCCC ATGTGGTGCT CACCTTCCGG CGCCTGGGCT GCGCCTTGGC GTCCTGCCGG 
CTGGCGCCTG CGAGACACAG AGGAAGTGGT CTTCTGCACA CAGCCCCAGT GGCCCGCTCG
GACAGGAGCG CCCCGGTGTT CACCCGTGCC CTGGCCTTTG GGGACAGAAT CGCCCTGGTT
GACCAGCACG GCCGCCACAC GTACAGGGAG CTTTATTCCC GCAGCCTTCG CCTGTCCCAG
GAGATCTGCA GGCTCTGCGG GTGTGTCGGC GGGGACCTCC GGGAGGAGAG GGTCTCCTTC
CTATGCGCTA ACGATGCCTC CTACGTCGTG GCCCAGTGGG CGTCATGGAT GAGTGGCGGT
GTGGCAGTCC CCCTCTACAG GAAGCATCCC GCGGCCCAGC TGGAGTATGT CATCTGCGAC
TCCCAGAGCT CTGTGGTCCT TGCCAGCCAG GAGTACCTGG AGCTCCTGAG CCCGGTGGTC
AGGAAGCTGG GGGTCCCGCT GCTGCCGCTC ACACCAGCCA TCTACACTGG AGCAGTAGAG
GAACCGGCAG AGGTCCCGGT CCCAGAGCAG GGATGGAGGA ACAAGGGCGC CATGATCATC
TACACCAGTG GGACCACGGG GAGGCCCAAG GGCGTGCTGA GCACGCACCA AAACATCAGG
GCTGTGGTGA CCGGGCTGGT CCACAAGTGG GCATGGACCA AAGACGACGT GATCCTCCAC
GTGCTCCCGC TGCACCACGT CCATGGTGTG GTCAACGCGC TGCTCTGTCC TCTCTGGGTG
GGAGCCACCT GTGTGATGAT GCCTGAGTTC AGCCCTCAGC AGGTTTGGGA AAAGTTCTTA
AGTTCTGAAA CGCCGCGGAT CAATGTCTTT ATGGCAGTGC CTACAATATA CACCAAGCTG
ATGGAGTACT ACGACAGGCA TTTTACCCAG CCGCACGCCC AGGATTTCTT GCGTGCAGTT
TGTGAAGAAA AAATTAGGCT GATGGTCTCA GGCTCAGCTG CCCTGCCCCT CCCAGTGCTG
GAGAAGTGGA AGAACATCAC GGGCCACACC CTGCTGGAGC GGTATGGCAT GACCGAGATC
GGCATGGCTC TGTCCGGGCC CCTGACCACT GCCGTGCGCC TGCCAGGTTC CGTGGGGACC
CCACTGCCTG GAGTACAGGT GCGCATTGTC TCAGAAAACC CACAGAGGGA AGCCTGCTCC
TACACCATCC ACGCAGAGGG AGACGAGAGG GGGACCAAGG TGACCCCAGG GTTTGAAGAA
AAGGAGGGGG AGCTGCTGGT GAGGGGACCC TCCGTGTTTC GAGAATACTG GAATAAACCA
GAAGAAACTA AGAGTGCATT CACCCTGGAT GGCTGGTTTA AGACAGGGGA CACCGTGGTG
TTTAAGGATG GCCAGTACTG GATCCGAGGC CGGACCTCAG TGGACATCAT CAAGACTGGA
GGCTACAAGG TCAGCGCCCT GGAGGTGGAG TGGCACCTGC TGGCCCACCC CAGCATCACA
GATGTGGCTG TGATTGGAGT TCCGGATATG ACATGGGGCC AGCGGGTCAC TGCTGTGGTG
ACCCTCCGAG AAGGACACTC ACTGTCCCAC AGGGAGCTCA AAGAGTGGGC CAGAAATGTC
CTGGCCCCGT ACGCGGTGCC CTCGGAGCTG GTGCTGGTGG AGGAGATCCC GCGGAACCAG
ATGGGCAAGA TTGACAAGAA GGCGCTCATC AGGCACTTCC ACCCCTCATG A
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqNP_001120686.1
CDS209..1939
Misc Feature(1)350..1915(+)
Misc Feature(2)371..1906(+)
Misc Feature(3)803..838(+)
Misc Feature(4)812..1852(+)
Misc Feature(5)812..1657(+)
Misc Feature(6)932..1852(+)
Exon (1)1..188
Gene:ACSF3
Gene Synonym:
Exon (2)189..874
Gene:ACSF3
Gene Synonym:
Exon (3)875..1030
Gene:ACSF3
Gene Synonym:
Exon (4)1031..1185
Gene:ACSF3
Gene Synonym:
Exon (5)1186..1334
Gene:ACSF3
Gene Synonym:
Exon (6)1335..1447
Gene:ACSF3
Gene Synonym:
Exon (7)1448..1574
Gene:ACSF3
Gene Synonym:
Exon (8)1575..1709
Gene:ACSF3
Gene Synonym:
Exon (9)1710..1821
Gene:ACSF3
Gene Synonym:
Exon (10)1822..3578
Gene:ACSF3
Gene Synonym:
Translation
Position Chain Variation Link
41 41 a, g dbSNP:747952887
47 47 -, g dbSNP:773436445
65 65 c, g dbSNP:769771344
66 66 a, g, t dbSNP:543425407
67 67 c, g dbSNP:562092702
68 68 c, g dbSNP:529306939
87 87 g, t dbSNP:774510978
102 102 c, t dbSNP:759618916
113 113 c, g dbSNP:145228567
115 115 -, gc dbSNP:749018575
139 139 a, c dbSNP:775751925
171 171 a, g dbSNP:559637211
189 189 c, g dbSNP:753488764
190 190 c, t dbSNP:757051211
191 191 -, agccccagga dbSNP:767399752
191 191 c, g, t dbSNP:539069474
193 193 a, g dbSNP:141490092
194 194 c, g dbSNP:115469156
196 196 -, gaggctc dbSNP:771110203
196 196 a, c, g dbSNP:551417698
197 197 -, t dbSNP:778741714
197 197 c, g dbSNP:751637826
198 198 a, c dbSNP:755071079
199 199 a, g, t dbSNP:781454948
204 204 a, g dbSNP:770158205
209 209 a, g dbSNP:370382601
212 212 c, t dbSNP:749751522
213 213 c, t dbSNP:7188200
214 214 a, g dbSNP:775060040
216 216 c, t dbSNP:537218566
223 223 a, g, t dbSNP:760248047
224 224 c, g dbSNP:776314400
225 225 c, t dbSNP:761400921
226 226 a, g dbSNP:375071176
227 227 c, g dbSNP:750225037
236 236 a, c, t dbSNP:202182978
237 237 a, g, t dbSNP:751551226
240 240 g, t dbSNP:781163359
245 245 a, g dbSNP:752913078
250 250 c, t dbSNP:756300619
251 251 a, g dbSNP:375374971
252 252 a, c dbSNP:749661738
253 253 c, g dbSNP:771481057
257 257 c, g dbSNP:11547019
258 258 c, t dbSNP:746400895
259 259 c, g, t dbSNP:7201122
261 261 c, t dbSNP:534594073
264 264 a, g dbSNP:552894451
266 266 c, t dbSNP:772907663
267 267 a, g dbSNP:762719449
273 273 c, t dbSNP:572357895
274 274 a, g, t dbSNP:751461445
277 277 c, t dbSNP:767573178
280 280 a, g dbSNP:752720474
288 288 a, g dbSNP:756279730
291 291 a, g dbSNP:764393364
294 294 c, g dbSNP:754161182
307 307 c, t dbSNP:757664305
313 313 c, t dbSNP:779450250
316 316 a, g dbSNP:746334624
318 318 a, t dbSNP:549664473
323 323 c, t dbSNP:779775679
324 324 a, g dbSNP:144711526
327 327 c, t dbSNP:747598756
328 328 a, g dbSNP:34972688
330 330 a, g, t dbSNP:545886514
332 332 a, t dbSNP:564576843
337 337 a, c, t dbSNP:147915828
338 338 a, g dbSNP:759448696
342 342 c, t dbSNP:767348758
343 343 a, g dbSNP:775551806
353 353 c, t dbSNP:141518662
354 354 a, c, g dbSNP:369499144
360 360 -, tggcctt dbSNP:745684193
364 364 c, t dbSNP:746564011
366 366 a, t dbSNP:373274928
367 367 g, t dbSNP:765633249
379 379 c, t dbSNP:147044602
380 380 a, g dbSNP:758856054
387 387 g, t dbSNP:780402535
391 391 c, g dbSNP:202121474
397 397 c, t dbSNP:562260243
398 398 a, g dbSNP:200536797
399 399 a, g dbSNP:748883934
400 400 a, c dbSNP:770572252
401 401 c, t dbSNP:774117419
402 402 a, g dbSNP:745633046
408 408 c, t dbSNP:771946908
416 416 a, g dbSNP:775259772
419 419 a, c, g dbSNP:529560098
425 425 c, t dbSNP:776862565
426 426 c, g, t dbSNP:762053293
429 429 a, g dbSNP:750707295
433 433 a, c dbSNP:763197756
435 435 c, t dbSNP:766802453
438 438 a, c, g dbSNP:746501634
444 444 c, t dbSNP:755491777
446 446 c, t dbSNP:138156311
447 447 a, g dbSNP:753339356
454 454 -, c dbSNP:772073893
459 459 a, g dbSNP:373476048
461 461 c, t dbSNP:778403709
466 466 c, t dbSNP:560101290
467 467 a, g dbSNP:771723461
467 467 -, g dbSNP:775569136
469 469 c, g dbSNP:779919537
475 475 c, t dbSNP:746883692
476 476 a, g dbSNP:532903196
477 477 a, g dbSNP:148895267
478 478 c, t dbSNP:201113468
485 485 c, t dbSNP:769957763
486 486 a, t dbSNP:143605434
488 488 c, t dbSNP:530503915
489 489 a, g dbSNP:766597613
491 491 a, c, g dbSNP:751929678
493 493 a, g dbSNP:187962814
497 497 a, g dbSNP:753248595
505 505 c, t dbSNP:59213357
513 513 -, g dbSNP:760759040
514 514 c, t dbSNP:6500526
520 520 c, g, t dbSNP:749994320
521 521 a, g dbSNP:145969050
522 522 a, g dbSNP:746787960
523 523 c, t dbSNP:7193255
524 524 a, g dbSNP:781244439
525 525 c, g dbSNP:748128555
528 528 c, g, t dbSNP:769716004
532 532 c, t dbSNP:763021932
533 533 a, g dbSNP:771182485
534 534 a, t dbSNP:571472953
535 535 -, a dbSNP:768265862
535 535 c, t dbSNP:141517318
536 536 a, g, t dbSNP:189821127
548 548 g, t dbSNP:761267255
549 549 c, t dbSNP:764592417
550 550 c, g dbSNP:6500527
556 556 a, g dbSNP:757905943
561 561 c, g dbSNP:766109997
562 562 c, t dbSNP:6500528
564 564 a, g dbSNP:754782061
565 565 c, t dbSNP:182147718
566 566 a, g dbSNP:200703917
569 569 a, g dbSNP:756085657
571 571 a, g dbSNP:777642279
574 574 a, g dbSNP:749371364
576 576 -, ac dbSNP:142006073
577 577 -, ac dbSNP:543359504
577 577 a, c, g, t dbSNP:6500529
581 581 c, t dbSNP:772372919
586 586 c, t dbSNP:775845691
587 587 a, g dbSNP:761018548
592 592 a, g dbSNP:541662926
593 593 c, t dbSNP:777054379
595 595 c, t dbSNP:150050697
598 598 c, t dbSNP:368192538
599 599 a, g dbSNP:144411003
600 600 c, t dbSNP:148768970
607 607 a, g dbSNP:370968781
611 611 a, g dbSNP:752534981
613 613 c, g dbSNP:755923777
619 619 c, t dbSNP:148969539
620 620 a, g dbSNP:749221511
622 622 a, c, g dbSNP:568882749
624 624 a, g, t dbSNP:746031913
625 625 c, t dbSNP:775755554
626 626 a, g dbSNP:371131543
632 632 c, t dbSNP:142575695
634 634 a, c, g dbSNP:777155632
638 638 a, t dbSNP:770510583
639 639 c, g dbSNP:774006659
643 643 c, g dbSNP:759185741
656 656 c, g dbSNP:767268139
659 659 g, t dbSNP:752338222
664 664 c, t dbSNP:147899198
666 666 a, t dbSNP:760484658
681 681 c, g, t dbSNP:763823186
682 682 a, c, g dbSNP:757199694
687 687 -, t dbSNP:776328277
688 688 c, t dbSNP:375671065
689 689 a, c dbSNP:758530787
696 696 c, t dbSNP:780292666
699 699 g, t dbSNP:747228733
703 703 c, t dbSNP:769016647
705 705 c, t dbSNP:781425127
706 706 a, g dbSNP:748625786
709 709 a, g dbSNP:770424587
711 711 g, t dbSNP:773917081
714 714 c, g, t dbSNP:377732201
715 715 a, g dbSNP:775166866
716 716 a, c dbSNP:760264574
722 722 c, g dbSNP:763887961
723 723 -, cagccat dbSNP:761494200
725 725 a, g dbSNP:753579434
726 726 c, g dbSNP:761661334
731 731 c, t dbSNP:141612994
735 735 a, c dbSNP:368696141
740 740 a, g dbSNP:758434859
744 744 g, t dbSNP:374765592
753 753 c, t dbSNP:145470870
754 754 a, g dbSNP:755163107
765 765 c, g, t dbSNP:376098216
766 766 a, c, g dbSNP:756599875
769 769 c, t dbSNP:113731967
784 784 a, g dbSNP:771558691
787 787 a, g dbSNP:528237336
790 790 a, c dbSNP:746604282
795 795 a, g dbSNP:768187405
796 796 c, t dbSNP:373441358
797 797 a, g dbSNP:761573352
801 801 a, g, t dbSNP:387907121
802 802 c, g dbSNP:762893783
806 806 a, t dbSNP:766416378
808 808 c, g dbSNP:147597284
822 822 a, c dbSNP:755145710
825 825 c, t dbSNP:142038371
826 826 a, g, t dbSNP:753012038
827 827 g, t dbSNP:778300528
831 831 a, g dbSNP:749751646
833 833 c, g dbSNP:201953109
836 836 a, c dbSNP:538548478
839 839 a, g, t dbSNP:746488552
841 841 c, t dbSNP:140941507
842 842 c, g dbSNP:747820684
850 850 c, t dbSNP:769523070
853 853 a, g dbSNP:772996642
855 855 a, c dbSNP:776596368
856 856 c, t dbSNP:377553361
863 863 a, t dbSNP:774400928
866 866 a, c dbSNP:759506680
875 875 c, g dbSNP:745722909
877 877 a, g dbSNP:772127402
879 879 c, g dbSNP:775624630
880 880 c, t dbSNP:150374081
881 881 a, g dbSNP:775694971
893 893 a, c dbSNP:776677384
897 897 a, g dbSNP:145583876
899 899 a, g dbSNP:765454020
901 901 a, g dbSNP:750797204
909 909 a, t dbSNP:763367217
913 913 c, t dbSNP:766852572
914 914 a, g dbSNP:752104014
916 916 c, t dbSNP:550622194
917 917 a, c, g dbSNP:763619768
922 922 c, t dbSNP:756934667
928 928 c, t dbSNP:778493922
929 929 a, g dbSNP:145141190
932 932 c, t dbSNP:758316386
934 934 c, t dbSNP:377354800
936 936 c, t dbSNP:140986055
937 937 g, t dbSNP:768799062
946 946 a, c, t dbSNP:112722289
947 947 a, g dbSNP:370666715
949 949 a, c dbSNP:773357766
951 951 a, g dbSNP:144818342
963 963 a, g dbSNP:373246881
964 964 c, t dbSNP:147718091
965 965 a, g dbSNP:534495046
966 966 c, t dbSNP:762286480
967 967 a, g, t dbSNP:765643653
968 968 c, t dbSNP:764919377
973 973 c, g dbSNP:750139721
976 976 c, t dbSNP:758226472
988 988 a, g dbSNP:780017088
989 989 g, t dbSNP:746877433
1004 1004 a, g dbSNP:141607995
1007 1007 a, g dbSNP:538442044
1010 1010 -, c dbSNP:767946490
1010 1010 c, t dbSNP:748239351
1018 1018 c, t dbSNP:143501853
1022 1022 c, t dbSNP:773446262
1025 1025 c, t dbSNP:749538361
1030 1030 a, g dbSNP:751264771
1033 1033 c, t dbSNP:751299343
1035 1035 a, c, g, t dbSNP:759338401
1036 1036 g, t dbSNP:570233664
1038 1038 a, t dbSNP:756013969
1053 1053 c, g dbSNP:777750370
1059 1059 a, c, t dbSNP:373794208
1060 1060 a, g dbSNP:183159791
1062 1062 a, c, t dbSNP:143793502
1063 1063 a, g dbSNP:780294227
1064 1064 c, t dbSNP:148146761
1065 1065 a, g dbSNP:371654377
1069 1069 c, t dbSNP:777328549
1072 1072 c, t dbSNP:762523304
1074 1074 -, t dbSNP:758740850
1085 1085 a, g dbSNP:770598442
1087 1087 a, g dbSNP:774100742
1091 1091 a, g dbSNP:759127853
1094 1094 a, g dbSNP:540601698
1105 1105 c, g dbSNP:775139106
1106 1106 c, t dbSNP:760572443
1115 1115 -, tac dbSNP:779961848
1116 1116 a, t dbSNP:763993699
1120 1120 c, t dbSNP:753810945
1121 1121 a, g dbSNP:757285634
1123 1123 c, g dbSNP:765321738
1124 1124 a, g dbSNP:750599448
1140 1140 c, t dbSNP:758552654
1141 1141 a, g dbSNP:150686471
1143 1143 a, g, t dbSNP:759181215
1144 1144 a, c, t dbSNP:202119269
1147 1147 c, t dbSNP:770510501
1151 1151 a, g dbSNP:774006607
1160 1160 a, c dbSNP:745453668
1161 1161 a, g, t dbSNP:200352879
1164 1164 c, t dbSNP:775253189
1173 1173 a, g dbSNP:760352896
1176 1176 a, g dbSNP:763905646
1178 1178 a, g dbSNP:776500851
1203 1203 c, t dbSNP:373670668
1204 1204 a, t dbSNP:75591977
1219 1219 c, t dbSNP:757799912
1221 1221 c, t dbSNP:779630954
1223 1223 a, g dbSNP:746598781
1224 1224 c, t dbSNP:768294145
1226 1226 -, agatactgaattcctcatt dbSNP:754913196
1232 1232 a, g dbSNP:780881397
1240 1240 a, g dbSNP:747906365
1242 1242 a, c dbSNP:769660715
1248 1248 c, t dbSNP:772972837
1249 1249 a, g dbSNP:376153659
1251 1251 a, g, t dbSNP:371034681
1255 1255 c, t dbSNP:759743557
1257 1257 c, g dbSNP:767834738
1260 1260 c, t dbSNP:753012117
1268 1268 a, c, t dbSNP:761084443
1269 1269 a, c, g dbSNP:544775512
1275 1275 c, g, t dbSNP:779356779
1279 1279 c, g dbSNP:562979085
1281 1281 c, t dbSNP:387907120
1282 1282 c, g, t dbSNP:374451559
1283 1283 a, g dbSNP:150487794
1285 1285 a, g dbSNP:376416767
1288 1288 a, c, t dbSNP:749101905
1289 1289 a, g dbSNP:145285434
1291 1291 c, t dbSNP:745916029
1292 1292 a, t dbSNP:560149696
1300 1300 a, c, g, t dbSNP:775808630
1302 1302 -, ccgggc dbSNP:781005262
1303 1303 c, t dbSNP:148716626
1304 1304 a, g dbSNP:142288136
1308 1308 c, g dbSNP:151006784
1309 1309 c, g dbSNP:765752531
1310 1310 c, t dbSNP:758709987
1311 1311 -, t dbSNP:747628196
1312 1312 -, g dbSNP:769183050
1315 1315 a, c dbSNP:750959933
1316 1316 a, g dbSNP:754435301
1320 1320 c, t dbSNP:767026438
1321 1321 c, g, t dbSNP:201792144
1322 1322 a, g dbSNP:3743979
1325 1325 a, c, g dbSNP:144907664
1326 1326 c, g dbSNP:778956932
1328 1328 c, t dbSNP:745825913
1339 1339 c, t dbSNP:138395741
1340 1340 a, g dbSNP:369854705
1342 1342 a, g dbSNP:141088268
1345 1345 g, t dbSNP:755027191
1353 1353 c, t dbSNP:781134234
1366 1366 c, g dbSNP:748325350
1370 1370 c, t dbSNP:769987195
1371 1371 a, g, t dbSNP:559765310
1400 1400 a, c, g dbSNP:771312218
1402 1402 c, t dbSNP:371890371
1405 1405 c, t dbSNP:768148002
1411 1411 c, t dbSNP:776003939
1412 1412 a, c, t dbSNP:367891462
1418 1418 c, t dbSNP:374810485
1420 1420 c, t dbSNP:750140114
1421 1421 a, g dbSNP:189568082
1423 1423 a, g dbSNP:766100388
1431 1431 a, c dbSNP:751447350
1433 1433 g, t dbSNP:754865511
1435 1435 a, g dbSNP:781247397
1436 1436 a, g dbSNP:752748120
1437 1437 a, g dbSNP:756223488
1441 1441 a, g dbSNP:777928520
1446 1446 a, t dbSNP:201003194
1447 1447 c, g dbSNP:757563817
1448 1448 c, g dbSNP:770503655
1450 1450 a, g dbSNP:766713747
1453 1453 c, t dbSNP:374578722
1454 1454 c, g dbSNP:745543610
1458 1458 c, g dbSNP:771701041
1459 1459 g, t dbSNP:3743984
1465 1465 a, g dbSNP:760524726
1471 1471 a, g dbSNP:768562298
1474 1474 a, g dbSNP:150322170
1474 1474 -, g dbSNP:775794698
1476 1476 a, c, g dbSNP:370783227
1478 1478 a, g dbSNP:765382177
1486 1486 g, t dbSNP:750555101
1500 1500 -, c dbSNP:761054207
1502 1502 a, g dbSNP:763231512
1504 1504 -, g dbSNP:764608253
1508 1508 a, c, t dbSNP:766764090
1509 1509 a, c, g dbSNP:137995833
1513 1513 a, t dbSNP:375414491
1536 1536 -, t dbSNP:776995095
1536 1536 c, g dbSNP:756661716
1542 1542 a, g dbSNP:142092069
1545 1545 c, t dbSNP:745439171
1546 1546 a, g dbSNP:771704373
1551 1551 c, g, t dbSNP:554194567
1555 1555 a, g, t dbSNP:12447947
1557 1557 a, c dbSNP:776385863
1563 1563 g, t dbSNP:761825392
1575 1575 a, g dbSNP:760278262
1577 1577 a, g dbSNP:535695991
1580 1580 -, c dbSNP:766729559
1580 1580 a, c dbSNP:776457804
1582 1582 c, t dbSNP:761654873
1583 1583 a, g dbSNP:200029061
1584 1584 -, g dbSNP:751342087
1584 1584 c, t dbSNP:750309846
1588 1588 g, t dbSNP:554032555
1592 1592 a, c dbSNP:370106289
1599 1599 g, t dbSNP:751560437
1600 1600 a, c dbSNP:200661983
1602 1602 a, g dbSNP:200971130
1606 1606 c, t dbSNP:200146632
1613 1613 c, g, t dbSNP:748382994
1614 1614 a, c, g dbSNP:144681140
1619 1619 c, t dbSNP:138680796
1620 1620 a, g dbSNP:387907119
1634 1634 a, g, t dbSNP:373315212
1638 1638 -, caagactggaggcta dbSNP:754825326
1644 1644 a, c dbSNP:187733270
1651 1651 c, g dbSNP:768307195
1652 1652 c, t dbSNP:776369896
1660 1660 c, t dbSNP:761562613
1663 1663 c, t dbSNP:377487769
1664 1664 a, g dbSNP:192339782
1672 1672 c, g dbSNP:748589982
1673 1673 a, c, g, t dbSNP:377596983
1675 1675 c, g dbSNP:115776284
1677 1677 a, t dbSNP:770351070
1678 1678 a, c, g dbSNP:147538370
1691 1691 a, g dbSNP:756311395
1692 1692 a, c dbSNP:778101996
1694 1694 c, t dbSNP:529097844
1697 1697 c, t dbSNP:757673639
1698 1698 c, g dbSNP:779242373
1702 1702 c, g dbSNP:746403921
1707 1707 c, g dbSNP:768219025
1713 1713 g, t dbSNP:758875975
1719 1719 g, t dbSNP:76528704
1721 1721 a, g dbSNP:752124851
1724 1724 a, g dbSNP:141971462
1726 1726 a, g dbSNP:777333021
1731 1731 c, t dbSNP:748802669
1732 1732 a, g, t dbSNP:375187216
1736 1736 a, g dbSNP:745619996
1737 1737 g, t dbSNP:771878457
1739 1739 a, g dbSNP:150635495
1750 1750 a, g dbSNP:746953848
1751 1751 c, t dbSNP:563580010
1752 1752 a, g dbSNP:776762660
1761 1761 a, c dbSNP:761852278
1768 1768 c, g dbSNP:765469862
1770 1770 c, g dbSNP:201022212
1772 1772 a, c dbSNP:763350039
1773 1773 g, t dbSNP:766851262
1775 1775 c, t dbSNP:387907118
1776 1776 a, g dbSNP:369726475
1779 1779 a, g dbSNP:755493108
1781 1781 a, g dbSNP:767958353
1789 1789 a, g dbSNP:753356664
1791 1791 c, t dbSNP:756747691
1795 1795 c, t dbSNP:778486871
1806 1806 c, t dbSNP:745534420
1813 1813 a, g dbSNP:139813770
1815 1815 a, c, g dbSNP:779820462
1816 1816 a, g dbSNP:201954387
1825 1825 c, t dbSNP:777157827
1826 1826 a, c, g dbSNP:570670205
1829 1829 c, t dbSNP:149803422
1831 1831 -, cagat dbSNP:777119534
1833 1833 c, t dbSNP:531823925
1834 1834 -, cccgta dbSNP:748830812
1836 1836 c, g, t dbSNP:767244317
1837 1837 a, g dbSNP:146779456
1838 1838 g, t dbSNP:764074145
1839 1839 a, g dbSNP:568696869
1840 1840 c, t dbSNP:757338614
1851 1851 c, t dbSNP:139520739
1852 1852 a, g dbSNP:746019334
1859 1859 g, t dbSNP:143472008
1867 1867 -, gga dbSNP:770525323
1878 1878 c, t dbSNP:780364085
1879 1879 a, g dbSNP:747338200
1880 1880 c, t dbSNP:141090143
1881 1881 a, c, g dbSNP:140328142
1887 1887 a, g dbSNP:770387258
1890 1890 -, t dbSNP:778554510
1891 1891 g, t dbSNP:773707422
1902 1902 a, c dbSNP:759121331
1903 1903 a, c dbSNP:767036317
1911 1911 c, t dbSNP:142633119
1912 1912 a, g dbSNP:539500659
1915 1915 a, c dbSNP:763984193
1918 1918 c, g dbSNP:753754672
1925 1925 -, t dbSNP:745583292
1928 1928 -, a dbSNP:768886326
1930 1930 c, t dbSNP:757130082
1931 1931 a, c, t dbSNP:370947288
1933 1933 c, t dbSNP:373741441
1942 1942 c, t dbSNP:758540655
1943 1943 a, g dbSNP:184912682
1946 1946 a, c dbSNP:192297922
1949 1949 c, t dbSNP:199783009
1952 1952 -, ggactgc dbSNP:777100130
1953 1953 a, g dbSNP:781520797
1956 1956 c, t dbSNP:748558790
1958 1958 c, t dbSNP:555619981
1959 1959 a, g dbSNP:544916313
1961 1961 a, g dbSNP:745313912
1973 1973 c, g dbSNP:183713754
1979 1979 a, g dbSNP:775213355
1981 1981 c, t dbSNP:760397428
1982 1982 a, g dbSNP:111251955
1986 1986 c, t dbSNP:201698539
1988 1988 a, t dbSNP:761708790
1996 1996 a, g dbSNP:560238561
2002 2002 c, g, t dbSNP:750400083
2003 2003 a, g dbSNP:766453650
2005 2005 a, g, t dbSNP:146927450
2007 2007 a, g dbSNP:545881133
2010 2010 c, g dbSNP:564285004
2012 2012 c, t dbSNP:79800328
2013 2013 a, g dbSNP:756522850
2015 2015 c, t dbSNP:778084679
2016 2016 c, t dbSNP:749803884
2022 2022 c, g dbSNP:771406704
2023 2023 c, t dbSNP:779698408
2027 2027 c, t dbSNP:549931337
2031 2031 c, g dbSNP:768392807
2036 2036 a, t dbSNP:568661692
2040 2040 c, g dbSNP:761470249
2042 2042 -, c dbSNP:745945296
2048 2048 a, c dbSNP:769648459
2055 2055 a, g dbSNP:529517844
2056 2056 c, g dbSNP:762947407
2060 2060 c, t dbSNP:779039096
2061 2061 a, g dbSNP:751605042
2071 2071 c, g dbSNP:759639713
2074 2074 c, t dbSNP:767674227
2075 2075 -, tgtt dbSNP:770362714
2075 2075 g, t dbSNP:752976454
2084 2084 g, t dbSNP:756366072
2094 2094 a, g dbSNP:778193654
2106 2106 a, c dbSNP:754211738
2109 2109 c, g dbSNP:560284480
2133 2133 a, g dbSNP:565532227
2135 2135 g, t dbSNP:539487504
2140 2140 c, g dbSNP:199740112
2141 2141 a, g dbSNP:569800761
2143 2143 c, g dbSNP:747846272
2144 2144 c, t dbSNP:769401678
2148 2148 a, c, g dbSNP:750513124
2169 2169 c, t dbSNP:762693999
2170 2170 a, g dbSNP:1054747
2189 2189 c, t dbSNP:555241833
2190 2190 a, g dbSNP:534171319
2204 2204 a, c dbSNP:113165822
2206 2206 c, t dbSNP:775497277
2227 2227 c, t dbSNP:760937192
2230 2230 c, t dbSNP:764273652
2232 2232 c, t dbSNP:376600438
2233 2233 a, g dbSNP:572102231
2236 2236 c, g dbSNP:545830225
2242 2242 g, t dbSNP:757727795
2251 2251 g, t dbSNP:765790849
2280 2280 a, g dbSNP:750983260
2297 2297 c, t dbSNP:80327222
2298 2298 -, aaat dbSNP:71712635
2300 2300 -, taaa dbSNP:60450866
2301 2301 g, t dbSNP:76726674
2310 2310 a, g dbSNP:72819317
2336 2336 c, t dbSNP:780752171
2342 2342 c, t dbSNP:188803327
2344 2344 c, t dbSNP:151018123
2369 2369 a, g dbSNP:140883127
2378 2378 a, c, g dbSNP:76940692
2385 2385 a, g dbSNP:749899553
2391 2391 c, g dbSNP:574904171
2425 2425 a, g dbSNP:745801768
2435 2435 a, g dbSNP:772053974
2442 2442 a, g dbSNP:775617068
2463 2463 a, t dbSNP:774207125
2468 2468 c, t dbSNP:377221075
2476 2476 a, g dbSNP:150142198
2488 2488 c, g dbSNP:754344467
2491 2491 c, t dbSNP:776741056
2496 2496 a, c, t dbSNP:762212556
2503 2503 a, g dbSNP:34208235
2507 2507 c, g dbSNP:532941690
2574 2574 a, g dbSNP:774836548
2578 2578 c, t dbSNP:760680530
2579 2579 a, g dbSNP:758962875
2580 2580 c, t dbSNP:766847976
2581 2581 a, g dbSNP:752208081
2584 2584 a, g dbSNP:192866240
2586 2586 c, t dbSNP:569688994
2587 2587 a, g dbSNP:537095633
2596 2596 c, t dbSNP:777421848
2608 2608 a, g dbSNP:62068502
2611 2611 c, g dbSNP:78403542
2612 2612 a, t dbSNP:372923963
2624 2624 -, c dbSNP:559462915
2633 2633 c, t dbSNP:756970720
2634 2634 a, g dbSNP:567337830
2640 2640 a, g dbSNP:745711851
2644 2644 c, t dbSNP:534861834
2645 2645 c, g dbSNP:775321460
2646 2646 c, t dbSNP:552968363
2652 2652 a, g dbSNP:768632997
2718 2718 a, c dbSNP:776848925
2737 2737 c, t dbSNP:761536787
2748 2748 a, g dbSNP:577483942
2753 2753 c, g dbSNP:770203720
2769 2769 c, t dbSNP:750686064
2771 2771 c, g dbSNP:773694176
2790 2790 c, t dbSNP:552295665
2791 2791 a, g dbSNP:763438711
2796 2796 c, t dbSNP:766855883
2797 2797 a, g dbSNP:538571738
2818 2818 g, t dbSNP:557685749
2819 2819 a, g dbSNP:752019138
2830 2830 a, g dbSNP:760161678
2841 2841 c, t dbSNP:576040339
2845 2845 a, g dbSNP:543543586
2846 2846 c, t dbSNP:527334181
2855 2855 c, t dbSNP:35730151
2860 2860 c, t dbSNP:778575190
2861 2861 a, g dbSNP:564804966
2862 2862 c, g dbSNP:758151085
2874 2874 a, t dbSNP:574130459
2884 2884 a, g dbSNP:770954824
2891 2891 a, g dbSNP:541646020
2894 2894 a, g dbSNP:768708234
2900 2900 a, g dbSNP:748655690
2920 2920 c, t dbSNP:560003776
2921 2921 -, aga dbSNP:751827304
2925 2925 a, g dbSNP:533639754
2927 2927 a, g dbSNP:532201871
2939 2939 c, g dbSNP:781409702
2941 2941 c, t dbSNP:756616225
2944 2944 c, t dbSNP:552105203
2952 2952 c, g dbSNP:75531939
2956 2956 a, c, g dbSNP:142870821
2963 2963 -, cagt dbSNP:533583404
2968 2968 a, g dbSNP:771202132
2970 2970 c, t dbSNP:548800065
2971 2971 a, g dbSNP:567380897
2972 2972 c, t dbSNP:778249345
2977 2977 c, t dbSNP:145040503
2980 2980 c, t dbSNP:759945819
2986 2986 a, g dbSNP:550418684
2998 2998 a, c dbSNP:571115288
3009 3009 a, t dbSNP:753314646
3012 3012 c, t dbSNP:761344708
3055 3055 c, t dbSNP:538507875
3056 3056 a, g dbSNP:556878525
3057 3057 a, g dbSNP:758147557
3060 3060 a, t dbSNP:779711693
3076 3076 c, g dbSNP:144674022
3086 3086 c, t dbSNP:148597914
3087 3087 a, g dbSNP:369327572
3089 3089 a, g dbSNP:775095765
3090 3090 a, c, g dbSNP:574044196
3096 3096 a, t dbSNP:770004268
3097 3097 c, t dbSNP:778071871
3099 3099 a, g dbSNP:749463921
3103 3103 a, c dbSNP:141974248
3112 3112 a, c dbSNP:61507207
3119 3119 a, g dbSNP:12597637
3132 3132 a, g dbSNP:772527375
3133 3133 c, t dbSNP:776605721
3134 3134 a, g dbSNP:776000906
3140 3140 g, t dbSNP:761256519
3145 3145 c, t dbSNP:761710234
3147 3147 c, t dbSNP:764733554
3174 3174 a, g, t dbSNP:765067984
3178 3178 -, tga dbSNP:767195619
3179 3179 a, g dbSNP:545703737
3180 3180 c, g dbSNP:766107084
3194 3194 c, t dbSNP:73256087
3202 3202 a, t dbSNP:530401061
3212 3212 a, g dbSNP:754837787
3214 3214 a, c dbSNP:370125652
3240 3240 a, g dbSNP:767501074
3247 3247 c, g dbSNP:187126304
3254 3254 c, t dbSNP:763268336
3255 3255 a, g dbSNP:560746166
3265 3265 c, g dbSNP:777984551
3270 3270 a, g dbSNP:749432771
3273 3273 c, t dbSNP:757390249
3284 3284 c, t dbSNP:528144983
3285 3285 a, g dbSNP:546300411
3299 3299 c, t dbSNP:571103213
3300 3300 a, g dbSNP:374608817
3312 3312 c, t dbSNP:772439886
3318 3318 c, g dbSNP:775911088
3319 3319 a, g dbSNP:747512145
3328 3328 -, cagaggaaggggtcccgccctcccgc dbSNP:752579797
3344 3344 a, g dbSNP:769212458
3350 3350 c, g dbSNP:766449799
3352 3352 a, g dbSNP:116985242
3377 3377 a, g dbSNP:376912020
3380 3380 a, g dbSNP:755169652
3382 3382 g, t dbSNP:550440129
3406 3406 a, g dbSNP:568846394
3467 3467 -, at dbSNP:774061481
3469 3469 a, g dbSNP:774062471
3474 3474 a, c dbSNP:568699624
3494 3494 a, g dbSNP:534115735
3509 3509 -, tc dbSNP:72262430
3515 3515 -, tc dbSNP:560192698
3515 3515 -, t dbSNP:57776625
3522 3522 a, t dbSNP:548814651
3539 3539 g, t dbSNP:555704269
3552 3552 a, g dbSNP:191644580
3558 3558 c, t dbSNP:150669250

Target ORF information:

RefSeq Version NM_001127214
Organism Homo sapiens (human)
Definition Homo sapiens acyl-CoA synthetase family member 3 (ACSF3), transcript variant 2, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_001127214

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
ATGCTGCCCC ATGTGGTGCT CACCTTCCGG CGCCTGGGCT GCGCCTTGGC GTCCTGCCGG 
CTGGCGCCTG CGAGACACAG AGGAAGTGGT CTTCTGCACA CAGCCCCAGT GGCCCGCTCG
GACAGGAGCG CCCCGGTGTT CACCCGTGCC CTGGCCTTTG GGGACAGAAT CGCCCTGGTT
GACCAGCACG GCCGCCACAC GTACAGGGAG CTTTATTCCC GCAGCCTTCG CCTGTCCCAG
GAGATCTGCA GGCTCTGCGG GTGTGTCGGC GGGGACCTCC GGGAGGAGAG GGTCTCCTTC
CTATGCGCTA ACGATGCCTC CTACGTCGTG GCCCAGTGGG CGTCATGGAT GAGTGGCGGT
GTGGCAGTCC CCCTCTACAG GAAGCATCCC GCGGCCCAGC TGGAGTATGT CATCTGCGAC
TCCCAGAGCT CTGTGGTCCT TGCCAGCCAG GAGTACCTGG AGCTCCTGAG CCCGGTGGTC
AGGAAGCTGG GGGTCCCGCT GCTGCCGCTC ACACCAGCCA TCTACACTGG AGCAGTAGAG
GAACCGGCAG AGGTCCCGGT CCCAGAGCAG GGATGGAGGA ACAAGGGCGC CATGATCATC
TACACCAGTG GGACCACGGG GAGGCCCAAG GGCGTGCTGA GCACGCACCA AAACATCAGG
GCTGTGGTGA CCGGGCTGGT CCACAAGTGG GCATGGACCA AAGACGACGT GATCCTCCAC
GTGCTCCCGC TGCACCACGT CCATGGTGTG GTCAACGCGC TGCTCTGTCC TCTCTGGGTG
GGAGCCACCT GTGTGATGAT GCCTGAGTTC AGCCCTCAGC AGGTTTGGGA AAAGTTCTTA
AGTTCTGAAA CGCCGCGGAT CAATGTCTTT ATGGCAGTGC CTACAATATA CACCAAGCTG
ATGGAGTACT ACGACAGGCA TTTTACCCAG CCGCACGCCC AGGATTTCTT GCGTGCAGTT
TGTGAAGAAA AAATTAGGCT GATGGTCTCA GGCTCAGCTG CCCTGCCCCT CCCAGTGCTG
GAGAAGTGGA AGAACATCAC GGGCCACACC CTGCTGGAGC GGTATGGCAT GACCGAGATC
GGCATGGCTC TGTCCGGGCC CCTGACCACT GCCGTGCGCC TGCCAGGTTC CGTGGGGACC
CCACTGCCTG GAGTACAGGT GCGCATTGTC TCAGAAAACC CACAGAGGGA AGCCTGCTCC
TACACCATCC ACGCAGAGGG AGACGAGAGG GGGACCAAGG TGACCCCAGG GTTTGAAGAA
AAGGAGGGGG AGCTGCTGGT GAGGGGACCC TCCGTGTTTC GAGAATACTG GAATAAACCA
GAAGAAACTA AGAGTGCATT CACCCTGGAT GGCTGGTTTA AGACAGGGGA CACCGTGGTG
TTTAAGGATG GCCAGTACTG GATCCGAGGC CGGACCTCAG TGGACATCAT CAAGACTGGA
GGCTACAAGG TCAGCGCCCT GGAGGTGGAG TGGCACCTGC TGGCCCACCC CAGCATCACA
GATGTGGCTG TGATTGGAGT TCCGGATATG ACATGGGGCC AGCGGGTCAC TGCTGTGGTG
ACCCTCCGAG AAGGACACTC ACTGTCCCAC AGGGAGCTCA AAGAGTGGGC CAGAAATGTC
CTGGCCCCGT ACGCGGTGCC CTCGGAGCTG GTGCTGGTGG AGGAGATCCC GCGGAACCAG
ATGGGCAAGA TTGACAAGAA GGCGCTCATC AGGCACTTCC ACCCCTCATG A

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu01574
Accession Version NM_001243279.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1731bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product acyl-CoA synthetase family member 3, mitochondrial isoform 1 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BM148793.1, BC028399.1, AC135782.4 and AC009113.8. On Sep 27, 2013 this sequence version replaced gi:343168766. Summary: This gene encodes a member of the acyl-CoA synthetase family of enzymes that activate fatty acids by catalyzing the formation of a thioester linkage between fatty acids and coenzyme A. The encoded protein is localized to mitochondria, has high specificity for malonate and methylmalonate and possesses malonyl-CoA synthetase activity. Mutations in this gene are a cause of combined malonic and methylmalonic aciduria. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Sep 2013]. Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 4 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## ##Evidence-Data-START## Transcript exon combination :: BC028399.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968189, SAMEA1968832 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
ATGCTGCCCC ATGTGGTGCT CACCTTCCGG CGCCTGGGCT GCGCCTTGGC GTCCTGCCGG 
CTGGCGCCTG CGAGACACAG AGGAAGTGGT CTTCTGCACA CAGCCCCAGT GGCCCGCTCG
GACAGGAGCG CCCCGGTGTT CACCCGTGCC CTGGCCTTTG GGGACAGAAT CGCCCTGGTT
GACCAGCACG GCCGCCACAC GTACAGGGAG CTTTATTCCC GCAGCCTTCG CCTGTCCCAG
GAGATCTGCA GGCTCTGCGG GTGTGTCGGC GGGGACCTCC GGGAGGAGAG GGTCTCCTTC
CTATGCGCTA ACGATGCCTC CTACGTCGTG GCCCAGTGGG CGTCATGGAT GAGTGGCGGT
GTGGCAGTCC CCCTCTACAG GAAGCATCCC GCGGCCCAGC TGGAGTATGT CATCTGCGAC
TCCCAGAGCT CTGTGGTCCT TGCCAGCCAG GAGTACCTGG AGCTCCTGAG CCCGGTGGTC
AGGAAGCTGG GGGTCCCGCT GCTGCCGCTC ACACCAGCCA TCTACACTGG AGCAGTAGAG
GAACCGGCAG AGGTCCCGGT CCCAGAGCAG GGATGGAGGA ACAAGGGCGC CATGATCATC
TACACCAGTG GGACCACGGG GAGGCCCAAG GGCGTGCTGA GCACGCACCA AAACATCAGG
GCTGTGGTGA CCGGGCTGGT CCACAAGTGG GCATGGACCA AAGACGACGT GATCCTCCAC
GTGCTCCCGC TGCACCACGT CCATGGTGTG GTCAACGCGC TGCTCTGTCC TCTCTGGGTG
GGAGCCACCT GTGTGATGAT GCCTGAGTTC AGCCCTCAGC AGGTTTGGGA AAAGTTCTTA
AGTTCTGAAA CGCCGCGGAT CAATGTCTTT ATGGCAGTGC CTACAATATA CACCAAGCTG
ATGGAGTACT ACGACAGGCA TTTTACCCAG CCGCACGCCC AGGATTTCTT GCGTGCAGTT
TGTGAAGAAA AAATTAGGCT GATGGTCTCA GGCTCAGCTG CCCTGCCCCT CCCAGTGCTG
GAGAAGTGGA AGAACATCAC GGGCCACACC CTGCTGGAGC GGTATGGCAT GACCGAGATC
GGCATGGCTC TGTCCGGGCC CCTGACCACT GCCGTGCGCC TGCCAGGTTC CGTGGGGACC
CCACTGCCTG GAGTACAGGT GCGCATTGTC TCAGAAAACC CACAGAGGGA AGCCTGCTCC
TACACCATCC ACGCAGAGGG AGACGAGAGG GGGACCAAGG TGACCCCAGG GTTTGAAGAA
AAGGAGGGGG AGCTGCTGGT GAGGGGACCC TCCGTGTTTC GAGAATACTG GAATAAACCA
GAAGAAACTA AGAGTGCATT CACCCTGGAT GGCTGGTTTA AGACAGGGGA CACCGTGGTG
TTTAAGGATG GCCAGTACTG GATCCGAGGC CGGACCTCAG TGGACATCAT CAAGACTGGA
GGCTACAAGG TCAGCGCCCT GGAGGTGGAG TGGCACCTGC TGGCCCACCC CAGCATCACA
GATGTGGCTG TGATTGGAGT TCCGGATATG ACATGGGGCC AGCGGGTCAC TGCTGTGGTG
ACCCTCCGAG AAGGACACTC ACTGTCCCAC AGGGAGCTCA AAGAGTGGGC CAGAAATGTC
CTGGCCCCGT ACGCGGTGCC CTCGGAGCTG GTGCTGGTGG AGGAGATCCC GCGGAACCAG
ATGGGCAAGA TTGACAAGAA GGCGCTCATC AGGCACTTCC ACCCCTCATG A
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqNP_001230208.1
CDS382..2112
Misc Feature(1)289..291(+)
Misc Feature(2)523..2088(+)
Misc Feature(3)544..2079(+)
Misc Feature(4)976..1011(+)
Misc Feature(5)985..2025(+)
Misc Feature(6)985..1830(+)
Misc Feature(7)1105..2025(+)
Exon (1)1..188
Gene:ACSF3
Gene Synonym:
Exon (2)189..361
Gene:ACSF3
Gene Synonym:
Exon (3)362..1047
Gene:ACSF3
Gene Synonym:
Exon (4)1048..1203
Gene:ACSF3
Gene Synonym:
Exon (5)1204..1358
Gene:ACSF3
Gene Synonym:
Exon (6)1359..1507
Gene:ACSF3
Gene Synonym:
Exon (7)1508..1620
Gene:ACSF3
Gene Synonym:
Exon (8)1621..1747
Gene:ACSF3
Gene Synonym:
Exon (9)1748..1882
Gene:ACSF3
Gene Synonym:
Exon (10)1883..1994
Gene:ACSF3
Gene Synonym:
Exon (11)1995..3751
Gene:ACSF3
Gene Synonym:
Translation
Position Chain Variation Link
41 41 a, g dbSNP:747952887
47 47 -, g dbSNP:773436445
65 65 c, g dbSNP:769771344
66 66 a, g, t dbSNP:543425407
67 67 c, g dbSNP:562092702
68 68 c, g dbSNP:529306939
87 87 g, t dbSNP:774510978
102 102 c, t dbSNP:759618916
113 113 c, g dbSNP:145228567
115 115 -, gc dbSNP:749018575
139 139 a, c dbSNP:775751925
171 171 a, g dbSNP:559637211
195 195 c, t dbSNP:577925407
199 199 a, g dbSNP:371292822
206 206 c, t dbSNP:184589439
216 216 c, t dbSNP:545395061
217 217 a, g dbSNP:576815618
246 246 a, g dbSNP:749130601
264 264 c, t dbSNP:543967889
272 272 c, t dbSNP:778787971
282 282 c, t dbSNP:745951848
297 297 c, t dbSNP:562604822
307 307 a, c dbSNP:757372814
308 308 a, g dbSNP:772194969
311 311 c, t dbSNP:775664048
331 331 c, t dbSNP:529807641
340 340 -, ctct dbSNP:759497869
352 352 c, t dbSNP:548417953
353 353 a, c, g dbSNP:148444044
359 359 c, t dbSNP:189625890
360 360 c, g dbSNP:575978814
362 362 c, g dbSNP:753488764
363 363 c, t dbSNP:757051211
364 364 -, agccccagga dbSNP:767399752
364 364 c, g, t dbSNP:539069474
366 366 a, g dbSNP:141490092
367 367 c, g dbSNP:115469156
369 369 -, gaggctc dbSNP:771110203
369 369 a, c, g dbSNP:551417698
370 370 -, t dbSNP:778741714
370 370 c, g dbSNP:751637826
371 371 a, c dbSNP:755071079
372 372 a, g, t dbSNP:781454948
377 377 a, g dbSNP:770158205
382 382 a, g dbSNP:370382601
385 385 c, t dbSNP:749751522
386 386 c, t dbSNP:7188200
387 387 a, g dbSNP:775060040
389 389 c, t dbSNP:537218566
396 396 a, g, t dbSNP:760248047
397 397 c, g dbSNP:776314400
398 398 c, t dbSNP:761400921
399 399 a, g dbSNP:375071176
400 400 c, g dbSNP:750225037
409 409 a, c, t dbSNP:202182978
410 410 a, g, t dbSNP:751551226
413 413 g, t dbSNP:781163359
418 418 a, g dbSNP:752913078
423 423 c, t dbSNP:756300619
424 424 a, g dbSNP:375374971
425 425 a, c dbSNP:749661738
426 426 c, g dbSNP:771481057
430 430 c, g dbSNP:11547019
431 431 c, t dbSNP:746400895
432 432 c, g, t dbSNP:7201122
434 434 c, t dbSNP:534594073
437 437 a, g dbSNP:552894451
439 439 c, t dbSNP:772907663
440 440 a, g dbSNP:762719449
446 446 c, t dbSNP:572357895
447 447 a, g, t dbSNP:751461445
450 450 c, t dbSNP:767573178
453 453 a, g dbSNP:752720474
461 461 a, g dbSNP:756279730
464 464 a, g dbSNP:764393364
467 467 c, g dbSNP:754161182
480 480 c, t dbSNP:757664305
486 486 c, t dbSNP:779450250
489 489 a, g dbSNP:746334624
491 491 a, t dbSNP:549664473
496 496 c, t dbSNP:779775679
497 497 a, g dbSNP:144711526
500 500 c, t dbSNP:747598756
501 501 a, g dbSNP:34972688
503 503 a, g, t dbSNP:545886514
505 505 a, t dbSNP:564576843
510 510 a, c, t dbSNP:147915828
511 511 a, g dbSNP:759448696
515 515 c, t dbSNP:767348758
516 516 a, g dbSNP:775551806
526 526 c, t dbSNP:141518662
527 527 a, c, g dbSNP:369499144
533 533 -, tggcctt dbSNP:745684193
537 537 c, t dbSNP:746564011
539 539 a, t dbSNP:373274928
540 540 g, t dbSNP:765633249
552 552 c, t dbSNP:147044602
553 553 a, g dbSNP:758856054
560 560 g, t dbSNP:780402535
564 564 c, g dbSNP:202121474
570 570 c, t dbSNP:562260243
571 571 a, g dbSNP:200536797
572 572 a, g dbSNP:748883934
573 573 a, c dbSNP:770572252
574 574 c, t dbSNP:774117419
575 575 a, g dbSNP:745633046
581 581 c, t dbSNP:771946908
589 589 a, g dbSNP:775259772
592 592 a, c, g dbSNP:529560098
598 598 c, t dbSNP:776862565
599 599 c, g, t dbSNP:762053293
602 602 a, g dbSNP:750707295
606 606 a, c dbSNP:763197756
608 608 c, t dbSNP:766802453
611 611 a, c, g dbSNP:746501634
617 617 c, t dbSNP:755491777
619 619 c, t dbSNP:138156311
620 620 a, g dbSNP:753339356
627 627 -, c dbSNP:772073893
632 632 a, g dbSNP:373476048
634 634 c, t dbSNP:778403709
639 639 c, t dbSNP:560101290
640 640 a, g dbSNP:771723461
640 640 -, g dbSNP:775569136
642 642 c, g dbSNP:779919537
648 648 c, t dbSNP:746883692
649 649 a, g dbSNP:532903196
650 650 a, g dbSNP:148895267
651 651 c, t dbSNP:201113468
658 658 c, t dbSNP:769957763
659 659 a, t dbSNP:143605434
661 661 c, t dbSNP:530503915
662 662 a, g dbSNP:766597613
664 664 a, c, g dbSNP:751929678
666 666 a, g dbSNP:187962814
670 670 a, g dbSNP:753248595
678 678 c, t dbSNP:59213357
686 686 -, g dbSNP:760759040
687 687 c, t dbSNP:6500526
693 693 c, g, t dbSNP:749994320
694 694 a, g dbSNP:145969050
695 695 a, g dbSNP:746787960
696 696 c, t dbSNP:7193255
697 697 a, g dbSNP:781244439
698 698 c, g dbSNP:748128555
701 701 c, g, t dbSNP:769716004
705 705 c, t dbSNP:763021932
706 706 a, g dbSNP:771182485
707 707 a, t dbSNP:571472953
708 708 -, a dbSNP:768265862
708 708 c, t dbSNP:141517318
709 709 a, g, t dbSNP:189821127
721 721 g, t dbSNP:761267255
722 722 c, t dbSNP:764592417
723 723 c, g dbSNP:6500527
729 729 a, g dbSNP:757905943
734 734 c, g dbSNP:766109997
735 735 c, t dbSNP:6500528
737 737 a, g dbSNP:754782061
738 738 c, t dbSNP:182147718
739 739 a, g dbSNP:200703917
742 742 a, g dbSNP:756085657
744 744 a, g dbSNP:777642279
747 747 a, g dbSNP:749371364
749 749 -, ac dbSNP:142006073
750 750 -, ac dbSNP:543359504
750 750 a, c, g, t dbSNP:6500529
754 754 c, t dbSNP:772372919
759 759 c, t dbSNP:775845691
760 760 a, g dbSNP:761018548
765 765 a, g dbSNP:541662926
766 766 c, t dbSNP:777054379
768 768 c, t dbSNP:150050697
771 771 c, t dbSNP:368192538
772 772 a, g dbSNP:144411003
773 773 c, t dbSNP:148768970
780 780 a, g dbSNP:370968781
784 784 a, g dbSNP:752534981
786 786 c, g dbSNP:755923777
792 792 c, t dbSNP:148969539
793 793 a, g dbSNP:749221511
795 795 a, c, g dbSNP:568882749
797 797 a, g, t dbSNP:746031913
798 798 c, t dbSNP:775755554
799 799 a, g dbSNP:371131543
805 805 c, t dbSNP:142575695
807 807 a, c, g dbSNP:777155632
811 811 a, t dbSNP:770510583
812 812 c, g dbSNP:774006659
816 816 c, g dbSNP:759185741
829 829 c, g dbSNP:767268139
832 832 g, t dbSNP:752338222
837 837 c, t dbSNP:147899198
839 839 a, t dbSNP:760484658
854 854 c, g, t dbSNP:763823186
855 855 a, c, g dbSNP:757199694
860 860 -, t dbSNP:776328277
861 861 c, t dbSNP:375671065
862 862 a, c dbSNP:758530787
869 869 c, t dbSNP:780292666
872 872 g, t dbSNP:747228733
876 876 c, t dbSNP:769016647
878 878 c, t dbSNP:781425127
879 879 a, g dbSNP:748625786
882 882 a, g dbSNP:770424587
884 884 g, t dbSNP:773917081
887 887 c, g, t dbSNP:377732201
888 888 a, g dbSNP:775166866
889 889 a, c dbSNP:760264574
895 895 c, g dbSNP:763887961
896 896 -, cagccat dbSNP:761494200
898 898 a, g dbSNP:753579434
899 899 c, g dbSNP:761661334
904 904 c, t dbSNP:141612994
908 908 a, c dbSNP:368696141
913 913 a, g dbSNP:758434859
917 917 g, t dbSNP:374765592
926 926 c, t dbSNP:145470870
927 927 a, g dbSNP:755163107
938 938 c, g, t dbSNP:376098216
939 939 a, c, g dbSNP:756599875
942 942 c, t dbSNP:113731967
957 957 a, g dbSNP:771558691
960 960 a, g dbSNP:528237336
963 963 a, c dbSNP:746604282
968 968 a, g dbSNP:768187405
969 969 c, t dbSNP:373441358
970 970 a, g dbSNP:761573352
974 974 a, g, t dbSNP:387907121
975 975 c, g dbSNP:762893783
979 979 a, t dbSNP:766416378
981 981 c, g dbSNP:147597284
995 995 a, c dbSNP:755145710
998 998 c, t dbSNP:142038371
999 999 a, g, t dbSNP:753012038
1000 1000 g, t dbSNP:778300528
1004 1004 a, g dbSNP:749751646
1006 1006 c, g dbSNP:201953109
1009 1009 a, c dbSNP:538548478
1012 1012 a, g, t dbSNP:746488552
1014 1014 c, t dbSNP:140941507
1015 1015 c, g dbSNP:747820684
1023 1023 c, t dbSNP:769523070
1026 1026 a, g dbSNP:772996642
1028 1028 a, c dbSNP:776596368
1029 1029 c, t dbSNP:377553361
1036 1036 a, t dbSNP:774400928
1039 1039 a, c dbSNP:759506680
1048 1048 c, g dbSNP:745722909
1050 1050 a, g dbSNP:772127402
1052 1052 c, g dbSNP:775624630
1053 1053 c, t dbSNP:150374081
1054 1054 a, g dbSNP:775694971
1066 1066 a, c dbSNP:776677384
1070 1070 a, g dbSNP:145583876
1072 1072 a, g dbSNP:765454020
1074 1074 a, g dbSNP:750797204
1082 1082 a, t dbSNP:763367217
1086 1086 c, t dbSNP:766852572
1087 1087 a, g dbSNP:752104014
1089 1089 c, t dbSNP:550622194
1090 1090 a, c, g dbSNP:763619768
1095 1095 c, t dbSNP:756934667
1101 1101 c, t dbSNP:778493922
1102 1102 a, g dbSNP:145141190
1105 1105 c, t dbSNP:758316386
1107 1107 c, t dbSNP:377354800
1109 1109 c, t dbSNP:140986055
1110 1110 g, t dbSNP:768799062
1119 1119 a, c, t dbSNP:112722289
1120 1120 a, g dbSNP:370666715
1122 1122 a, c dbSNP:773357766
1124 1124 a, g dbSNP:144818342
1136 1136 a, g dbSNP:373246881
1137 1137 c, t dbSNP:147718091
1138 1138 a, g dbSNP:534495046
1139 1139 c, t dbSNP:762286480
1140 1140 a, g, t dbSNP:765643653
1141 1141 c, t dbSNP:764919377
1146 1146 c, g dbSNP:750139721
1149 1149 c, t dbSNP:758226472
1161 1161 a, g dbSNP:780017088
1162 1162 g, t dbSNP:746877433
1177 1177 a, g dbSNP:141607995
1180 1180 a, g dbSNP:538442044
1183 1183 -, c dbSNP:767946490
1183 1183 c, t dbSNP:748239351
1191 1191 c, t dbSNP:143501853
1195 1195 c, t dbSNP:773446262
1198 1198 c, t dbSNP:749538361
1203 1203 a, g dbSNP:751264771
1206 1206 c, t dbSNP:751299343
1208 1208 a, c, g, t dbSNP:759338401
1209 1209 g, t dbSNP:570233664
1211 1211 a, t dbSNP:756013969
1226 1226 c, g dbSNP:777750370
1232 1232 a, c, t dbSNP:373794208
1233 1233 a, g dbSNP:183159791
1235 1235 a, c, t dbSNP:143793502
1236 1236 a, g dbSNP:780294227
1237 1237 c, t dbSNP:148146761
1238 1238 a, g dbSNP:371654377
1242 1242 c, t dbSNP:777328549
1245 1245 c, t dbSNP:762523304
1247 1247 -, t dbSNP:758740850
1258 1258 a, g dbSNP:770598442
1260 1260 a, g dbSNP:774100742
1264 1264 a, g dbSNP:759127853
1267 1267 a, g dbSNP:540601698
1278 1278 c, g dbSNP:775139106
1279 1279 c, t dbSNP:760572443
1288 1288 -, tac dbSNP:779961848
1289 1289 a, t dbSNP:763993699
1293 1293 c, t dbSNP:753810945
1294 1294 a, g dbSNP:757285634
1296 1296 c, g dbSNP:765321738
1297 1297 a, g dbSNP:750599448
1313 1313 c, t dbSNP:758552654
1314 1314 a, g dbSNP:150686471
1316 1316 a, g, t dbSNP:759181215
1317 1317 a, c, t dbSNP:202119269
1320 1320 c, t dbSNP:770510501
1324 1324 a, g dbSNP:774006607
1333 1333 a, c dbSNP:745453668
1334 1334 a, g, t dbSNP:200352879
1337 1337 c, t dbSNP:775253189
1346 1346 a, g dbSNP:760352896
1349 1349 a, g dbSNP:763905646
1351 1351 a, g dbSNP:776500851
1376 1376 c, t dbSNP:373670668
1377 1377 a, t dbSNP:75591977
1392 1392 c, t dbSNP:757799912
1394 1394 c, t dbSNP:779630954
1396 1396 a, g dbSNP:746598781
1397 1397 c, t dbSNP:768294145
1399 1399 -, agatactgaattcctcatt dbSNP:754913196
1405 1405 a, g dbSNP:780881397
1413 1413 a, g dbSNP:747906365
1415 1415 a, c dbSNP:769660715
1421 1421 c, t dbSNP:772972837
1422 1422 a, g dbSNP:376153659
1424 1424 a, g, t dbSNP:371034681
1428 1428 c, t dbSNP:759743557
1430 1430 c, g dbSNP:767834738
1433 1433 c, t dbSNP:753012117
1441 1441 a, c, t dbSNP:761084443
1442 1442 a, c, g dbSNP:544775512
1448 1448 c, g, t dbSNP:779356779
1452 1452 c, g dbSNP:562979085
1454 1454 c, t dbSNP:387907120
1455 1455 c, g, t dbSNP:374451559
1456 1456 a, g dbSNP:150487794
1458 1458 a, g dbSNP:376416767
1461 1461 a, c, t dbSNP:749101905
1462 1462 a, g dbSNP:145285434
1464 1464 c, t dbSNP:745916029
1465 1465 a, t dbSNP:560149696
1473 1473 a, c, g, t dbSNP:775808630
1475 1475 -, ccgggc dbSNP:781005262
1476 1476 c, t dbSNP:148716626
1477 1477 a, g dbSNP:142288136
1481 1481 c, g dbSNP:151006784
1482 1482 c, g dbSNP:765752531
1483 1483 c, t dbSNP:758709987
1484 1484 -, t dbSNP:747628196
1485 1485 -, g dbSNP:769183050
1488 1488 a, c dbSNP:750959933
1489 1489 a, g dbSNP:754435301
1493 1493 c, t dbSNP:767026438
1494 1494 c, g, t dbSNP:201792144
1495 1495 a, g dbSNP:3743979
1498 1498 a, c, g dbSNP:144907664
1499 1499 c, g dbSNP:778956932
1501 1501 c, t dbSNP:745825913
1512 1512 c, t dbSNP:138395741
1513 1513 a, g dbSNP:369854705
1515 1515 a, g dbSNP:141088268
1518 1518 g, t dbSNP:755027191
1526 1526 c, t dbSNP:781134234
1539 1539 c, g dbSNP:748325350
1543 1543 c, t dbSNP:769987195
1544 1544 a, g, t dbSNP:559765310
1573 1573 a, c, g dbSNP:771312218
1575 1575 c, t dbSNP:371890371
1578 1578 c, t dbSNP:768148002
1584 1584 c, t dbSNP:776003939
1585 1585 a, c, t dbSNP:367891462
1591 1591 c, t dbSNP:374810485
1593 1593 c, t dbSNP:750140114
1594 1594 a, g dbSNP:189568082
1596 1596 a, g dbSNP:766100388
1604 1604 a, c dbSNP:751447350
1606 1606 g, t dbSNP:754865511
1608 1608 a, g dbSNP:781247397
1609 1609 a, g dbSNP:752748120
1610 1610 a, g dbSNP:756223488
1614 1614 a, g dbSNP:777928520
1619 1619 a, t dbSNP:201003194
1620 1620 c, g dbSNP:757563817
1621 1621 c, g dbSNP:770503655
1623 1623 a, g dbSNP:766713747
1626 1626 c, t dbSNP:374578722
1627 1627 c, g dbSNP:745543610
1631 1631 c, g dbSNP:771701041
1632 1632 g, t dbSNP:3743984
1638 1638 a, g dbSNP:760524726
1644 1644 a, g dbSNP:768562298
1647 1647 a, g dbSNP:150322170
1647 1647 -, g dbSNP:775794698
1649 1649 a, c, g dbSNP:370783227
1651 1651 a, g dbSNP:765382177
1659 1659 g, t dbSNP:750555101
1673 1673 -, c dbSNP:761054207
1675 1675 a, g dbSNP:763231512
1677 1677 -, g dbSNP:764608253
1681 1681 a, c, t dbSNP:766764090
1682 1682 a, c, g dbSNP:137995833
1686 1686 a, t dbSNP:375414491
1709 1709 -, t dbSNP:776995095
1709 1709 c, g dbSNP:756661716
1715 1715 a, g dbSNP:142092069
1718 1718 c, t dbSNP:745439171
1719 1719 a, g dbSNP:771704373
1724 1724 c, g, t dbSNP:554194567
1728 1728 a, g, t dbSNP:12447947
1730 1730 a, c dbSNP:776385863
1736 1736 g, t dbSNP:761825392
1748 1748 a, g dbSNP:760278262
1750 1750 a, g dbSNP:535695991
1753 1753 -, c dbSNP:766729559
1753 1753 a, c dbSNP:776457804
1755 1755 c, t dbSNP:761654873
1756 1756 a, g dbSNP:200029061
1757 1757 -, g dbSNP:751342087
1757 1757 c, t dbSNP:750309846
1761 1761 g, t dbSNP:554032555
1765 1765 a, c dbSNP:370106289
1772 1772 g, t dbSNP:751560437
1773 1773 a, c dbSNP:200661983
1775 1775 a, g dbSNP:200971130
1779 1779 c, t dbSNP:200146632
1786 1786 c, g, t dbSNP:748382994
1787 1787 a, c, g dbSNP:144681140
1792 1792 c, t dbSNP:138680796
1793 1793 a, g dbSNP:387907119
1807 1807 a, g, t dbSNP:373315212
1811 1811 -, caagactggaggcta dbSNP:754825326
1817 1817 a, c dbSNP:187733270
1824 1824 c, g dbSNP:768307195
1825 1825 c, t dbSNP:776369896
1833 1833 c, t dbSNP:761562613
1836 1836 c, t dbSNP:377487769
1837 1837 a, g dbSNP:192339782
1845 1845 c, g dbSNP:748589982
1846 1846 a, c, g, t dbSNP:377596983
1848 1848 c, g dbSNP:115776284
1850 1850 a, t dbSNP:770351070
1851 1851 a, c, g dbSNP:147538370
1864 1864 a, g dbSNP:756311395
1865 1865 a, c dbSNP:778101996
1867 1867 c, t dbSNP:529097844
1870 1870 c, t dbSNP:757673639
1871 1871 c, g dbSNP:779242373
1875 1875 c, g dbSNP:746403921
1880 1880 c, g dbSNP:768219025
1886 1886 g, t dbSNP:758875975
1892 1892 g, t dbSNP:76528704
1894 1894 a, g dbSNP:752124851
1897 1897 a, g dbSNP:141971462
1899 1899 a, g dbSNP:777333021
1904 1904 c, t dbSNP:748802669
1905 1905 a, g, t dbSNP:375187216
1909 1909 a, g dbSNP:745619996
1910 1910 g, t dbSNP:771878457
1912 1912 a, g dbSNP:150635495
1923 1923 a, g dbSNP:746953848
1924 1924 c, t dbSNP:563580010
1925 1925 a, g dbSNP:776762660
1934 1934 a, c dbSNP:761852278
1941 1941 c, g dbSNP:765469862
1943 1943 c, g dbSNP:201022212
1945 1945 a, c dbSNP:763350039
1946 1946 g, t dbSNP:766851262
1948 1948 c, t dbSNP:387907118
1949 1949 a, g dbSNP:369726475
1952 1952 a, g dbSNP:755493108
1954 1954 a, g dbSNP:767958353
1962 1962 a, g dbSNP:753356664
1964 1964 c, t dbSNP:756747691
1968 1968 c, t dbSNP:778486871
1979 1979 c, t dbSNP:745534420
1986 1986 a, g dbSNP:139813770
1988 1988 a, c, g dbSNP:779820462
1989 1989 a, g dbSNP:201954387
1998 1998 c, t dbSNP:777157827
1999 1999 a, c, g dbSNP:570670205
2002 2002 c, t dbSNP:149803422
2004 2004 -, cagat dbSNP:777119534
2006 2006 c, t dbSNP:531823925
2007 2007 -, cccgta dbSNP:748830812
2009 2009 c, g, t dbSNP:767244317
2010 2010 a, g dbSNP:146779456
2011 2011 g, t dbSNP:764074145
2012 2012 a, g dbSNP:568696869
2013 2013 c, t dbSNP:757338614
2024 2024 c, t dbSNP:139520739
2025 2025 a, g dbSNP:746019334
2032 2032 g, t dbSNP:143472008
2040 2040 -, gga dbSNP:770525323
2051 2051 c, t dbSNP:780364085
2052 2052 a, g dbSNP:747338200
2053 2053 c, t dbSNP:141090143
2054 2054 a, c, g dbSNP:140328142
2060 2060 a, g dbSNP:770387258
2063 2063 -, t dbSNP:778554510
2064 2064 g, t dbSNP:773707422
2075 2075 a, c dbSNP:759121331
2076 2076 a, c dbSNP:767036317
2084 2084 c, t dbSNP:142633119
2085 2085 a, g dbSNP:539500659
2088 2088 a, c dbSNP:763984193
2091 2091 c, g dbSNP:753754672
2098 2098 -, t dbSNP:745583292
2101 2101 -, a dbSNP:768886326
2103 2103 c, t dbSNP:757130082
2104 2104 a, c, t dbSNP:370947288
2106 2106 c, t dbSNP:373741441
2115 2115 c, t dbSNP:758540655
2116 2116 a, g dbSNP:184912682
2119 2119 a, c dbSNP:192297922
2122 2122 c, t dbSNP:199783009
2125 2125 -, ggactgc dbSNP:777100130
2126 2126 a, g dbSNP:781520797
2129 2129 c, t dbSNP:748558790
2131 2131 c, t dbSNP:555619981
2132 2132 a, g dbSNP:544916313
2134 2134 a, g dbSNP:745313912
2146 2146 c, g dbSNP:183713754
2152 2152 a, g dbSNP:775213355
2154 2154 c, t dbSNP:760397428
2155 2155 a, g dbSNP:111251955
2159 2159 c, t dbSNP:201698539
2161 2161 a, t dbSNP:761708790
2169 2169 a, g dbSNP:560238561
2175 2175 c, g, t dbSNP:750400083
2176 2176 a, g dbSNP:766453650
2178 2178 a, g, t dbSNP:146927450
2180 2180 a, g dbSNP:545881133
2183 2183 c, g dbSNP:564285004
2185 2185 c, t dbSNP:79800328
2186 2186 a, g dbSNP:756522850
2188 2188 c, t dbSNP:778084679
2189 2189 c, t dbSNP:749803884
2195 2195 c, g dbSNP:771406704
2196 2196 c, t dbSNP:779698408
2200 2200 c, t dbSNP:549931337
2204 2204 c, g dbSNP:768392807
2209 2209 a, t dbSNP:568661692
2213 2213 c, g dbSNP:761470249
2215 2215 -, c dbSNP:745945296
2221 2221 a, c dbSNP:769648459
2228 2228 a, g dbSNP:529517844
2229 2229 c, g dbSNP:762947407
2233 2233 c, t dbSNP:779039096
2234 2234 a, g dbSNP:751605042
2244 2244 c, g dbSNP:759639713
2247 2247 c, t dbSNP:767674227
2248 2248 -, tgtt dbSNP:770362714
2248 2248 g, t dbSNP:752976454
2257 2257 g, t dbSNP:756366072
2267 2267 a, g dbSNP:778193654
2279 2279 a, c dbSNP:754211738
2282 2282 c, g dbSNP:560284480
2306 2306 a, g dbSNP:565532227
2308 2308 g, t dbSNP:539487504
2313 2313 c, g dbSNP:199740112
2314 2314 a, g dbSNP:569800761
2316 2316 c, g dbSNP:747846272
2317 2317 c, t dbSNP:769401678
2321 2321 a, c, g dbSNP:750513124
2342 2342 c, t dbSNP:762693999
2343 2343 a, g dbSNP:1054747
2362 2362 c, t dbSNP:555241833
2363 2363 a, g dbSNP:534171319
2377 2377 a, c dbSNP:113165822
2379 2379 c, t dbSNP:775497277
2400 2400 c, t dbSNP:760937192
2403 2403 c, t dbSNP:764273652
2405 2405 c, t dbSNP:376600438
2406 2406 a, g dbSNP:572102231
2409 2409 c, g dbSNP:545830225
2415 2415 g, t dbSNP:757727795
2424 2424 g, t dbSNP:765790849
2453 2453 a, g dbSNP:750983260
2470 2470 c, t dbSNP:80327222
2471 2471 -, aaat dbSNP:71712635
2473 2473 -, taaa dbSNP:60450866
2474 2474 g, t dbSNP:76726674
2483 2483 a, g dbSNP:72819317
2509 2509 c, t dbSNP:780752171
2515 2515 c, t dbSNP:188803327
2517 2517 c, t dbSNP:151018123
2542 2542 a, g dbSNP:140883127
2551 2551 a, c, g dbSNP:76940692
2558 2558 a, g dbSNP:749899553
2564 2564 c, g dbSNP:574904171
2598 2598 a, g dbSNP:745801768
2608 2608 a, g dbSNP:772053974
2615 2615 a, g dbSNP:775617068
2636 2636 a, t dbSNP:774207125
2641 2641 c, t dbSNP:377221075
2649 2649 a, g dbSNP:150142198
2661 2661 c, g dbSNP:754344467
2664 2664 c, t dbSNP:776741056
2669 2669 a, c, t dbSNP:762212556
2676 2676 a, g dbSNP:34208235
2680 2680 c, g dbSNP:532941690
2747 2747 a, g dbSNP:774836548
2751 2751 c, t dbSNP:760680530
2752 2752 a, g dbSNP:758962875
2753 2753 c, t dbSNP:766847976
2754 2754 a, g dbSNP:752208081
2757 2757 a, g dbSNP:192866240
2759 2759 c, t dbSNP:569688994
2760 2760 a, g dbSNP:537095633
2769 2769 c, t dbSNP:777421848
2781 2781 a, g dbSNP:62068502
2784 2784 c, g dbSNP:78403542
2785 2785 a, t dbSNP:372923963
2797 2797 -, c dbSNP:559462915
2806 2806 c, t dbSNP:756970720
2807 2807 a, g dbSNP:567337830
2813 2813 a, g dbSNP:745711851
2817 2817 c, t dbSNP:534861834
2818 2818 c, g dbSNP:775321460
2819 2819 c, t dbSNP:552968363
2825 2825 a, g dbSNP:768632997
2891 2891 a, c dbSNP:776848925
2910 2910 c, t dbSNP:761536787
2921 2921 a, g dbSNP:577483942
2926 2926 c, g dbSNP:770203720
2942 2942 c, t dbSNP:750686064
2944 2944 c, g dbSNP:773694176
2963 2963 c, t dbSNP:552295665
2964 2964 a, g dbSNP:763438711
2969 2969 c, t dbSNP:766855883
2970 2970 a, g dbSNP:538571738
2991 2991 g, t dbSNP:557685749
2992 2992 a, g dbSNP:752019138
3003 3003 a, g dbSNP:760161678
3014 3014 c, t dbSNP:576040339
3018 3018 a, g dbSNP:543543586
3019 3019 c, t dbSNP:527334181
3028 3028 c, t dbSNP:35730151
3033 3033 c, t dbSNP:778575190
3034 3034 a, g dbSNP:564804966
3035 3035 c, g dbSNP:758151085
3047 3047 a, t dbSNP:574130459
3057 3057 a, g dbSNP:770954824
3064 3064 a, g dbSNP:541646020
3067 3067 a, g dbSNP:768708234
3073 3073 a, g dbSNP:748655690
3093 3093 c, t dbSNP:560003776
3094 3094 -, aga dbSNP:751827304
3098 3098 a, g dbSNP:533639754
3100 3100 a, g dbSNP:532201871
3112 3112 c, g dbSNP:781409702
3114 3114 c, t dbSNP:756616225
3117 3117 c, t dbSNP:552105203
3125 3125 c, g dbSNP:75531939
3129 3129 a, c, g dbSNP:142870821
3136 3136 -, cagt dbSNP:533583404
3141 3141 a, g dbSNP:771202132
3143 3143 c, t dbSNP:548800065
3144 3144 a, g dbSNP:567380897
3145 3145 c, t dbSNP:778249345
3150 3150 c, t dbSNP:145040503
3153 3153 c, t dbSNP:759945819
3159 3159 a, g dbSNP:550418684
3171 3171 a, c dbSNP:571115288
3182 3182 a, t dbSNP:753314646
3185 3185 c, t dbSNP:761344708
3228 3228 c, t dbSNP:538507875
3229 3229 a, g dbSNP:556878525
3230 3230 a, g dbSNP:758147557
3233 3233 a, t dbSNP:779711693
3249 3249 c, g dbSNP:144674022
3259 3259 c, t dbSNP:148597914
3260 3260 a, g dbSNP:369327572
3262 3262 a, g dbSNP:775095765
3263 3263 a, c, g dbSNP:574044196
3269 3269 a, t dbSNP:770004268
3270 3270 c, t dbSNP:778071871
3272 3272 a, g dbSNP:749463921
3276 3276 a, c dbSNP:141974248
3285 3285 a, c dbSNP:61507207
3292 3292 a, g dbSNP:12597637
3305 3305 a, g dbSNP:772527375
3306 3306 c, t dbSNP:776605721
3307 3307 a, g dbSNP:776000906
3313 3313 g, t dbSNP:761256519
3318 3318 c, t dbSNP:761710234
3320 3320 c, t dbSNP:764733554
3347 3347 a, g, t dbSNP:765067984
3351 3351 -, tga dbSNP:767195619
3352 3352 a, g dbSNP:545703737
3353 3353 c, g dbSNP:766107084
3367 3367 c, t dbSNP:73256087
3375 3375 a, t dbSNP:530401061
3385 3385 a, g dbSNP:754837787
3387 3387 a, c dbSNP:370125652
3413 3413 a, g dbSNP:767501074
3420 3420 c, g dbSNP:187126304
3427 3427 c, t dbSNP:763268336
3428 3428 a, g dbSNP:560746166
3438 3438 c, g dbSNP:777984551
3443 3443 a, g dbSNP:749432771
3446 3446 c, t dbSNP:757390249
3457 3457 c, t dbSNP:528144983
3458 3458 a, g dbSNP:546300411
3472 3472 c, t dbSNP:571103213
3473 3473 a, g dbSNP:374608817
3485 3485 c, t dbSNP:772439886
3491 3491 c, g dbSNP:775911088
3492 3492 a, g dbSNP:747512145
3501 3501 -, cagaggaaggggtcccgccctcccgc dbSNP:752579797
3517 3517 a, g dbSNP:769212458
3523 3523 c, g dbSNP:766449799
3525 3525 a, g dbSNP:116985242
3550 3550 a, g dbSNP:376912020
3553 3553 a, g dbSNP:755169652
3555 3555 g, t dbSNP:550440129
3579 3579 a, g dbSNP:568846394
3640 3640 -, at dbSNP:774061481
3642 3642 a, g dbSNP:774062471
3647 3647 a, c dbSNP:568699624
3667 3667 a, g dbSNP:534115735
3682 3682 -, tc dbSNP:72262430
3688 3688 -, tc dbSNP:560192698
3688 3688 -, t dbSNP:57776625
3695 3695 a, t dbSNP:548814651
3712 3712 g, t dbSNP:555704269
3725 3725 a, g dbSNP:191644580
3731 3731 c, t dbSNP:150669250

Target ORF information:

RefSeq Version NM_001243279
Organism Homo sapiens (human)
Definition Homo sapiens acyl-CoA synthetase family member 3 (ACSF3), transcript variant 4, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_001243279

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
ATGCTGCCCC ATGTGGTGCT CACCTTCCGG CGCCTGGGCT GCGCCTTGGC GTCCTGCCGG 
CTGGCGCCTG CGAGACACAG AGGAAGTGGT CTTCTGCACA CAGCCCCAGT GGCCCGCTCG
GACAGGAGCG CCCCGGTGTT CACCCGTGCC CTGGCCTTTG GGGACAGAAT CGCCCTGGTT
GACCAGCACG GCCGCCACAC GTACAGGGAG CTTTATTCCC GCAGCCTTCG CCTGTCCCAG
GAGATCTGCA GGCTCTGCGG GTGTGTCGGC GGGGACCTCC GGGAGGAGAG GGTCTCCTTC
CTATGCGCTA ACGATGCCTC CTACGTCGTG GCCCAGTGGG CGTCATGGAT GAGTGGCGGT
GTGGCAGTCC CCCTCTACAG GAAGCATCCC GCGGCCCAGC TGGAGTATGT CATCTGCGAC
TCCCAGAGCT CTGTGGTCCT TGCCAGCCAG GAGTACCTGG AGCTCCTGAG CCCGGTGGTC
AGGAAGCTGG GGGTCCCGCT GCTGCCGCTC ACACCAGCCA TCTACACTGG AGCAGTAGAG
GAACCGGCAG AGGTCCCGGT CCCAGAGCAG GGATGGAGGA ACAAGGGCGC CATGATCATC
TACACCAGTG GGACCACGGG GAGGCCCAAG GGCGTGCTGA GCACGCACCA AAACATCAGG
GCTGTGGTGA CCGGGCTGGT CCACAAGTGG GCATGGACCA AAGACGACGT GATCCTCCAC
GTGCTCCCGC TGCACCACGT CCATGGTGTG GTCAACGCGC TGCTCTGTCC TCTCTGGGTG
GGAGCCACCT GTGTGATGAT GCCTGAGTTC AGCCCTCAGC AGGTTTGGGA AAAGTTCTTA
AGTTCTGAAA CGCCGCGGAT CAATGTCTTT ATGGCAGTGC CTACAATATA CACCAAGCTG
ATGGAGTACT ACGACAGGCA TTTTACCCAG CCGCACGCCC AGGATTTCTT GCGTGCAGTT
TGTGAAGAAA AAATTAGGCT GATGGTCTCA GGCTCAGCTG CCCTGCCCCT CCCAGTGCTG
GAGAAGTGGA AGAACATCAC GGGCCACACC CTGCTGGAGC GGTATGGCAT GACCGAGATC
GGCATGGCTC TGTCCGGGCC CCTGACCACT GCCGTGCGCC TGCCAGGTTC CGTGGGGACC
CCACTGCCTG GAGTACAGGT GCGCATTGTC TCAGAAAACC CACAGAGGGA AGCCTGCTCC
TACACCATCC ACGCAGAGGG AGACGAGAGG GGGACCAAGG TGACCCCAGG GTTTGAAGAA
AAGGAGGGGG AGCTGCTGGT GAGGGGACCC TCCGTGTTTC GAGAATACTG GAATAAACCA
GAAGAAACTA AGAGTGCATT CACCCTGGAT GGCTGGTTTA AGACAGGGGA CACCGTGGTG
TTTAAGGATG GCCAGTACTG GATCCGAGGC CGGACCTCAG TGGACATCAT CAAGACTGGA
GGCTACAAGG TCAGCGCCCT GGAGGTGGAG TGGCACCTGC TGGCCCACCC CAGCATCACA
GATGTGGCTG TGATTGGAGT TCCGGATATG ACATGGGGCC AGCGGGTCAC TGCTGTGGTG
ACCCTCCGAG AAGGACACTC ACTGTCCCAC AGGGAGCTCA AAGAGTGGGC CAGAAATGTC
CTGGCCCCGT ACGCGGTGCC CTCGGAGCTG GTGCTGGTGG AGGAGATCCC GCGGAACCAG
ATGGGCAAGA TTGACAAGAA GGCGCTCATC AGGCACTTCC ACCCCTCATG A

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu08539
Accession Version NM_001284316.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 936bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product acyl-CoA synthetase family member 3, mitochondrial isoform 2
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BM148793.1, BX402632.2, BQ953430.1, BX325026.2, AC009113.8 and BI837487.1. On Sep 27, 2013 this sequence version replaced gi:343168763. Summary: This gene encodes a member of the acyl-CoA synthetase family of enzymes that activate fatty acids by catalyzing the formation of a thioester linkage between fatty acids and coenzyme A. The encoded protein is localized to mitochondria, has high specificity for malonate and methylmalonate and possesses malonyl-CoA synthetase activity. Mutations in this gene are a cause of combined malonic and methylmalonic aciduria. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Sep 2013]. Transcript Variant: This variant (3) lacks two exons, one of which contains a portion of the 5' UTR and the other which contains a portion of the 5' coding region including the start codon, compared to variant 1. These differences cause translation initiation at a downstream start codon and result in an isoform (2) with a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## ##Evidence-Data-START## Transcript exon combination :: BC064609.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1965299, SAMEA1968540 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
ATGATGCCTG AGTTCAGCCC TCAGCAGGTT TGGGAAAAGT TCTTAAGTTC TGAAACGCCG 
CGGATCAATG TCTTTATGGC AGTGCCTACA ATATACACCA AGCTGATGGA GTACTACGAC
AGGCATTTTA CCCAGCCGCA CGCCCAGGAT TTCTTGCGTG CAGTTTGTGA AGAAAAAATT
AGGCTGATGG TCTCAGGCTC AGCTGCCCTG CCCCTCCCAG TGCTGGAGAA GTGGAAGAAC
ATCACGGGCC ACACCCTGCT GGAGCGGTAT GGCATGACCG AGATCGGCAT GGCTCTGTCC
GGGCCCCTGA CCACTGCCGT GCGCCTGCCA GGTTCCGTGG GGACCCCACT GCCTGGAGTA
CAGGTGCGCA TTGTCTCAGA AAACCCACAG AGGGAAGCCT GCTCCTACAC CATCCACGCA
GAGGGAGACG AGAGGGGGAC CAAGGTGACC CCAGGGTTTG AAGAAAAGGA GGGGGAGCTG
CTGGTGAGGG GACCCTCCGT GTTTCGAGAA TACTGGAATA AACCAGAAGA AACTAAGAGT
GCATTCACCC TGGATGGCTG GTTTAAGACA GGGGACACCG TGGTGTTTAA GGATGGCCAG
TACTGGATCC GAGGCCGGAC CTCAGTGGAC ATCATCAAGA CTGGAGGCTA CAAGGTCAGC
GCCCTGGAGG TGGAGTGGCA CCTGCTGGCC CACCCCAGCA TCACAGATGT GGCTGTGATT
GGAGTTCCGG ATATGACATG GGGCCAGCGG GTCACTGCTG TGGTGACCCT CCGAGAAGGA
CACTCACTGT CCCACAGGGA GCTCAAAGAG TGGGCCAGAA ATGTCCTGGC CCCGTACGCG
GTGCCCTCGG AGCTGGTGCT GGTGGAGGAG ATCCCGCGGA ACCAGATGGG CAAGATTGAC
AAGAAGGCGC TCATCAGGCA CTTCCACCCC TCATGA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqNP_001271245.1
CDS314..1249
Misc Feature(1)314..1216(+)
Misc Feature(2)326..1225(+)
Misc Feature(3)395..1150(+)
Misc Feature(4)401..1150(+)
Misc Feature(5)509..1207(+)
Exon (1)1..184
Gene:ACSF3
Gene Synonym:
Exon (2)185..340
Gene:ACSF3
Gene Synonym:
Exon (3)341..495
Gene:ACSF3
Gene Synonym:
Exon (4)496..644
Gene:ACSF3
Gene Synonym:
Exon (5)645..757
Gene:ACSF3
Gene Synonym:
Exon (6)758..884
Gene:ACSF3
Gene Synonym:
Exon (7)885..1019
Gene:ACSF3
Gene Synonym:
Exon (8)1020..1131
Gene:ACSF3
Gene Synonym:
Exon (9)1132..2888
Gene:ACSF3
Gene Synonym:
Translation
Position Chain Variation Link
41 41 a, g dbSNP:747952887
47 47 -, g dbSNP:773436445
65 65 c, g dbSNP:769771344
66 66 a, g, t dbSNP:543425407
67 67 c, g dbSNP:562092702
68 68 c, g dbSNP:529306939
87 87 g, t dbSNP:774510978
102 102 c, t dbSNP:759618916
113 113 c, g dbSNP:145228567
115 115 -, gc dbSNP:749018575
139 139 a, c dbSNP:775751925
171 171 a, g dbSNP:559637211
185 185 c, g dbSNP:745722909
187 187 a, g dbSNP:772127402
189 189 c, g dbSNP:775624630
190 190 c, t dbSNP:150374081
191 191 a, g dbSNP:775694971
203 203 a, c dbSNP:776677384
207 207 a, g dbSNP:145583876
209 209 a, g dbSNP:765454020
211 211 a, g dbSNP:750797204
219 219 a, t dbSNP:763367217
223 223 c, t dbSNP:766852572
224 224 a, g dbSNP:752104014
226 226 c, t dbSNP:550622194
227 227 a, c, g dbSNP:763619768
232 232 c, t dbSNP:756934667
238 238 c, t dbSNP:778493922
239 239 a, g dbSNP:145141190
242 242 c, t dbSNP:758316386
244 244 c, t dbSNP:377354800
246 246 c, t dbSNP:140986055
247 247 g, t dbSNP:768799062
256 256 a, c, t dbSNP:112722289
257 257 a, g dbSNP:370666715
259 259 a, c dbSNP:773357766
261 261 a, g dbSNP:144818342
273 273 a, g dbSNP:373246881
274 274 c, t dbSNP:147718091
275 275 a, g dbSNP:534495046
276 276 c, t dbSNP:762286480
277 277 a, g, t dbSNP:765643653
278 278 c, t dbSNP:764919377
283 283 c, g dbSNP:750139721
286 286 c, t dbSNP:758226472
298 298 a, g dbSNP:780017088
299 299 g, t dbSNP:746877433
314 314 a, g dbSNP:141607995
317 317 a, g dbSNP:538442044
320 320 -, c dbSNP:767946490
320 320 c, t dbSNP:748239351
328 328 c, t dbSNP:143501853
332 332 c, t dbSNP:773446262
335 335 c, t dbSNP:749538361
340 340 a, g dbSNP:751264771
343 343 c, t dbSNP:751299343
345 345 a, c, g, t dbSNP:759338401
346 346 g, t dbSNP:570233664
348 348 a, t dbSNP:756013969
363 363 c, g dbSNP:777750370
369 369 a, c, t dbSNP:373794208
370 370 a, g dbSNP:183159791
372 372 a, c, t dbSNP:143793502
373 373 a, g dbSNP:780294227
374 374 c, t dbSNP:148146761
375 375 a, g dbSNP:371654377
379 379 c, t dbSNP:777328549
382 382 c, t dbSNP:762523304
384 384 -, t dbSNP:758740850
395 395 a, g dbSNP:770598442
397 397 a, g dbSNP:774100742
401 401 a, g dbSNP:759127853
404 404 a, g dbSNP:540601698
415 415 c, g dbSNP:775139106
416 416 c, t dbSNP:760572443
425 425 -, tac dbSNP:779961848
426 426 a, t dbSNP:763993699
430 430 c, t dbSNP:753810945
431 431 a, g dbSNP:757285634
433 433 c, g dbSNP:765321738
434 434 a, g dbSNP:750599448
450 450 c, t dbSNP:758552654
451 451 a, g dbSNP:150686471
453 453 a, g, t dbSNP:759181215
454 454 a, c, t dbSNP:202119269
457 457 c, t dbSNP:770510501
461 461 a, g dbSNP:774006607
470 470 a, c dbSNP:745453668
471 471 a, g, t dbSNP:200352879
474 474 c, t dbSNP:775253189
483 483 a, g dbSNP:760352896
486 486 a, g dbSNP:763905646
488 488 a, g dbSNP:776500851
513 513 c, t dbSNP:373670668
514 514 a, t dbSNP:75591977
529 529 c, t dbSNP:757799912
531 531 c, t dbSNP:779630954
533 533 a, g dbSNP:746598781
534 534 c, t dbSNP:768294145
536 536 -, agatactgaattcctcatt dbSNP:754913196
542 542 a, g dbSNP:780881397
550 550 a, g dbSNP:747906365
552 552 a, c dbSNP:769660715
558 558 c, t dbSNP:772972837
559 559 a, g dbSNP:376153659
561 561 a, g, t dbSNP:371034681
565 565 c, t dbSNP:759743557
567 567 c, g dbSNP:767834738
570 570 c, t dbSNP:753012117
578 578 a, c, t dbSNP:761084443
579 579 a, c, g dbSNP:544775512
585 585 c, g, t dbSNP:779356779
589 589 c, g dbSNP:562979085
591 591 c, t dbSNP:387907120
592 592 c, g, t dbSNP:374451559
593 593 a, g dbSNP:150487794
595 595 a, g dbSNP:376416767
598 598 a, c, t dbSNP:749101905
599 599 a, g dbSNP:145285434
601 601 c, t dbSNP:745916029
602 602 a, t dbSNP:560149696
610 610 a, c, g, t dbSNP:775808630
612 612 -, ccgggc dbSNP:781005262
613 613 c, t dbSNP:148716626
614 614 a, g dbSNP:142288136
618 618 c, g dbSNP:151006784
619 619 c, g dbSNP:765752531
620 620 c, t dbSNP:758709987
621 621 -, t dbSNP:747628196
622 622 -, g dbSNP:769183050
625 625 a, c dbSNP:750959933
626 626 a, g dbSNP:754435301
630 630 c, t dbSNP:767026438
631 631 c, g, t dbSNP:201792144
632 632 a, g dbSNP:3743979
635 635 a, c, g dbSNP:144907664
636 636 c, g dbSNP:778956932
638 638 c, t dbSNP:745825913
649 649 c, t dbSNP:138395741
650 650 a, g dbSNP:369854705
652 652 a, g dbSNP:141088268
655 655 g, t dbSNP:755027191
663 663 c, t dbSNP:781134234
676 676 c, g dbSNP:748325350
680 680 c, t dbSNP:769987195
681 681 a, g, t dbSNP:559765310
710 710 a, c, g dbSNP:771312218
712 712 c, t dbSNP:371890371
715 715 c, t dbSNP:768148002
721 721 c, t dbSNP:776003939
722 722 a, c, t dbSNP:367891462
728 728 c, t dbSNP:374810485
730 730 c, t dbSNP:750140114
731 731 a, g dbSNP:189568082
733 733 a, g dbSNP:766100388
741 741 a, c dbSNP:751447350
743 743 g, t dbSNP:754865511
745 745 a, g dbSNP:781247397
746 746 a, g dbSNP:752748120
747 747 a, g dbSNP:756223488
751 751 a, g dbSNP:777928520
756 756 a, t dbSNP:201003194
757 757 c, g dbSNP:757563817
758 758 c, g dbSNP:770503655
760 760 a, g dbSNP:766713747
763 763 c, t dbSNP:374578722
764 764 c, g dbSNP:745543610
768 768 c, g dbSNP:771701041
769 769 g, t dbSNP:3743984
775 775 a, g dbSNP:760524726
781 781 a, g dbSNP:768562298
784 784 a, g dbSNP:150322170
784 784 -, g dbSNP:775794698
786 786 a, c, g dbSNP:370783227
788 788 a, g dbSNP:765382177
796 796 g, t dbSNP:750555101
810 810 -, c dbSNP:761054207
812 812 a, g dbSNP:763231512
814 814 -, g dbSNP:764608253
818 818 a, c, t dbSNP:766764090
819 819 a, c, g dbSNP:137995833
823 823 a, t dbSNP:375414491
846 846 -, t dbSNP:776995095
846 846 c, g dbSNP:756661716
852 852 a, g dbSNP:142092069
855 855 c, t dbSNP:745439171
856 856 a, g dbSNP:771704373
861 861 c, g, t dbSNP:554194567
865 865 a, g, t dbSNP:12447947
867 867 a, c dbSNP:776385863
873 873 g, t dbSNP:761825392
885 885 a, g dbSNP:760278262
887 887 a, g dbSNP:535695991
890 890 -, c dbSNP:766729559
890 890 a, c dbSNP:776457804
892 892 c, t dbSNP:761654873
893 893 a, g dbSNP:200029061
894 894 -, g dbSNP:751342087
894 894 c, t dbSNP:750309846
898 898 g, t dbSNP:554032555
902 902 a, c dbSNP:370106289
909 909 g, t dbSNP:751560437
910 910 a, c dbSNP:200661983
912 912 a, g dbSNP:200971130
916 916 c, t dbSNP:200146632
923 923 c, g, t dbSNP:748382994
924 924 a, c, g dbSNP:144681140
929 929 c, t dbSNP:138680796
930 930 a, g dbSNP:387907119
944 944 a, g, t dbSNP:373315212
948 948 -, caagactggaggcta dbSNP:754825326
954 954 a, c dbSNP:187733270
961 961 c, g dbSNP:768307195
962 962 c, t dbSNP:776369896
970 970 c, t dbSNP:761562613
973 973 c, t dbSNP:377487769
974 974 a, g dbSNP:192339782
982 982 c, g dbSNP:748589982
983 983 a, c, g, t dbSNP:377596983
985 985 c, g dbSNP:115776284
987 987 a, t dbSNP:770351070
988 988 a, c, g dbSNP:147538370
1001 1001 a, g dbSNP:756311395
1002 1002 a, c dbSNP:778101996
1004 1004 c, t dbSNP:529097844
1007 1007 c, t dbSNP:757673639
1008 1008 c, g dbSNP:779242373
1012 1012 c, g dbSNP:746403921
1017 1017 c, g dbSNP:768219025
1023 1023 g, t dbSNP:758875975
1029 1029 g, t dbSNP:76528704
1031 1031 a, g dbSNP:752124851
1034 1034 a, g dbSNP:141971462
1036 1036 a, g dbSNP:777333021
1041 1041 c, t dbSNP:748802669
1042 1042 a, g, t dbSNP:375187216
1046 1046 a, g dbSNP:745619996
1047 1047 g, t dbSNP:771878457
1049 1049 a, g dbSNP:150635495
1060 1060 a, g dbSNP:746953848
1061 1061 c, t dbSNP:563580010
1062 1062 a, g dbSNP:776762660
1071 1071 a, c dbSNP:761852278
1078 1078 c, g dbSNP:765469862
1080 1080 c, g dbSNP:201022212
1082 1082 a, c dbSNP:763350039
1083 1083 g, t dbSNP:766851262
1085 1085 c, t dbSNP:387907118
1086 1086 a, g dbSNP:369726475
1089 1089 a, g dbSNP:755493108
1091 1091 a, g dbSNP:767958353
1099 1099 a, g dbSNP:753356664
1101 1101 c, t dbSNP:756747691
1105 1105 c, t dbSNP:778486871
1116 1116 c, t dbSNP:745534420
1123 1123 a, g dbSNP:139813770
1125 1125 a, c, g dbSNP:779820462
1126 1126 a, g dbSNP:201954387
1135 1135 c, t dbSNP:777157827
1136 1136 a, c, g dbSNP:570670205
1139 1139 c, t dbSNP:149803422
1141 1141 -, cagat dbSNP:777119534
1143 1143 c, t dbSNP:531823925
1144 1144 -, cccgta dbSNP:748830812
1146 1146 c, g, t dbSNP:767244317
1147 1147 a, g dbSNP:146779456
1148 1148 g, t dbSNP:764074145
1149 1149 a, g dbSNP:568696869
1150 1150 c, t dbSNP:757338614
1161 1161 c, t dbSNP:139520739
1162 1162 a, g dbSNP:746019334
1169 1169 g, t dbSNP:143472008
1177 1177 -, gga dbSNP:770525323
1188 1188 c, t dbSNP:780364085
1189 1189 a, g dbSNP:747338200
1190 1190 c, t dbSNP:141090143
1191 1191 a, c, g dbSNP:140328142
1197 1197 a, g dbSNP:770387258
1200 1200 -, t dbSNP:778554510
1201 1201 g, t dbSNP:773707422
1212 1212 a, c dbSNP:759121331
1213 1213 a, c dbSNP:767036317
1221 1221 c, t dbSNP:142633119
1222 1222 a, g dbSNP:539500659
1225 1225 a, c dbSNP:763984193
1228 1228 c, g dbSNP:753754672
1235 1235 -, t dbSNP:745583292
1238 1238 -, a dbSNP:768886326
1240 1240 c, t dbSNP:757130082
1241 1241 a, c, t dbSNP:370947288
1243 1243 c, t dbSNP:373741441
1252 1252 c, t dbSNP:758540655
1253 1253 a, g dbSNP:184912682
1256 1256 a, c dbSNP:192297922
1259 1259 c, t dbSNP:199783009
1262 1262 -, ggactgc dbSNP:777100130
1263 1263 a, g dbSNP:781520797
1266 1266 c, t dbSNP:748558790
1268 1268 c, t dbSNP:555619981
1269 1269 a, g dbSNP:544916313
1271 1271 a, g dbSNP:745313912
1283 1283 c, g dbSNP:183713754
1289 1289 a, g dbSNP:775213355
1291 1291 c, t dbSNP:760397428
1292 1292 a, g dbSNP:111251955
1296 1296 c, t dbSNP:201698539
1298 1298 a, t dbSNP:761708790
1306 1306 a, g dbSNP:560238561
1312 1312 c, g, t dbSNP:750400083
1313 1313 a, g dbSNP:766453650
1315 1315 a, g, t dbSNP:146927450
1317 1317 a, g dbSNP:545881133
1320 1320 c, g dbSNP:564285004
1322 1322 c, t dbSNP:79800328
1323 1323 a, g dbSNP:756522850
1325 1325 c, t dbSNP:778084679
1326 1326 c, t dbSNP:749803884
1332 1332 c, g dbSNP:771406704
1333 1333 c, t dbSNP:779698408
1337 1337 c, t dbSNP:549931337
1341 1341 c, g dbSNP:768392807
1346 1346 a, t dbSNP:568661692
1350 1350 c, g dbSNP:761470249
1352 1352 -, c dbSNP:745945296
1358 1358 a, c dbSNP:769648459
1365 1365 a, g dbSNP:529517844
1366 1366 c, g dbSNP:762947407
1370 1370 c, t dbSNP:779039096
1371 1371 a, g dbSNP:751605042
1381 1381 c, g dbSNP:759639713
1384 1384 c, t dbSNP:767674227
1385 1385 -, tgtt dbSNP:770362714
1385 1385 g, t dbSNP:752976454
1394 1394 g, t dbSNP:756366072
1404 1404 a, g dbSNP:778193654
1416 1416 a, c dbSNP:754211738
1419 1419 c, g dbSNP:560284480
1443 1443 a, g dbSNP:565532227
1445 1445 g, t dbSNP:539487504
1450 1450 c, g dbSNP:199740112
1451 1451 a, g dbSNP:569800761
1453 1453 c, g dbSNP:747846272
1454 1454 c, t dbSNP:769401678
1458 1458 a, c, g dbSNP:750513124
1479 1479 c, t dbSNP:762693999
1480 1480 a, g dbSNP:1054747
1499 1499 c, t dbSNP:555241833
1500 1500 a, g dbSNP:534171319
1514 1514 a, c dbSNP:113165822
1516 1516 c, t dbSNP:775497277
1537 1537 c, t dbSNP:760937192
1540 1540 c, t dbSNP:764273652
1542 1542 c, t dbSNP:376600438
1543 1543 a, g dbSNP:572102231
1546 1546 c, g dbSNP:545830225
1552 1552 g, t dbSNP:757727795
1561 1561 g, t dbSNP:765790849
1590 1590 a, g dbSNP:750983260
1607 1607 c, t dbSNP:80327222
1608 1608 -, aaat dbSNP:71712635
1610 1610 -, taaa dbSNP:60450866
1611 1611 g, t dbSNP:76726674
1620 1620 a, g dbSNP:72819317
1646 1646 c, t dbSNP:780752171
1652 1652 c, t dbSNP:188803327
1654 1654 c, t dbSNP:151018123
1679 1679 a, g dbSNP:140883127
1688 1688 a, c, g dbSNP:76940692
1695 1695 a, g dbSNP:749899553
1701 1701 c, g dbSNP:574904171
1735 1735 a, g dbSNP:745801768
1745 1745 a, g dbSNP:772053974
1752 1752 a, g dbSNP:775617068
1773 1773 a, t dbSNP:774207125
1778 1778 c, t dbSNP:377221075
1786 1786 a, g dbSNP:150142198
1798 1798 c, g dbSNP:754344467
1801 1801 c, t dbSNP:776741056
1806 1806 a, c, t dbSNP:762212556
1813 1813 a, g dbSNP:34208235
1817 1817 c, g dbSNP:532941690
1884 1884 a, g dbSNP:774836548
1888 1888 c, t dbSNP:760680530
1889 1889 a, g dbSNP:758962875
1890 1890 c, t dbSNP:766847976
1891 1891 a, g dbSNP:752208081
1894 1894 a, g dbSNP:192866240
1896 1896 c, t dbSNP:569688994
1897 1897 a, g dbSNP:537095633
1906 1906 c, t dbSNP:777421848
1918 1918 a, g dbSNP:62068502
1921 1921 c, g dbSNP:78403542
1922 1922 a, t dbSNP:372923963
1934 1934 -, c dbSNP:559462915
1943 1943 c, t dbSNP:756970720
1944 1944 a, g dbSNP:567337830
1950 1950 a, g dbSNP:745711851
1954 1954 c, t dbSNP:534861834
1955 1955 c, g dbSNP:775321460
1956 1956 c, t dbSNP:552968363
1962 1962 a, g dbSNP:768632997
2028 2028 a, c dbSNP:776848925
2047 2047 c, t dbSNP:761536787
2058 2058 a, g dbSNP:577483942
2063 2063 c, g dbSNP:770203720
2079 2079 c, t dbSNP:750686064
2081 2081 c, g dbSNP:773694176
2100 2100 c, t dbSNP:552295665
2101 2101 a, g dbSNP:763438711
2106 2106 c, t dbSNP:766855883
2107 2107 a, g dbSNP:538571738
2128 2128 g, t dbSNP:557685749
2129 2129 a, g dbSNP:752019138
2140 2140 a, g dbSNP:760161678
2151 2151 c, t dbSNP:576040339
2155 2155 a, g dbSNP:543543586
2156 2156 c, t dbSNP:527334181
2165 2165 c, t dbSNP:35730151
2170 2170 c, t dbSNP:778575190
2171 2171 a, g dbSNP:564804966
2172 2172 c, g dbSNP:758151085
2184 2184 a, t dbSNP:574130459
2194 2194 a, g dbSNP:770954824
2201 2201 a, g dbSNP:541646020
2204 2204 a, g dbSNP:768708234
2210 2210 a, g dbSNP:748655690
2230 2230 c, t dbSNP:560003776
2231 2231 -, aga dbSNP:751827304
2235 2235 a, g dbSNP:533639754
2237 2237 a, g dbSNP:532201871
2249 2249 c, g dbSNP:781409702
2251 2251 c, t dbSNP:756616225
2254 2254 c, t dbSNP:552105203
2262 2262 c, g dbSNP:75531939
2266 2266 a, c, g dbSNP:142870821
2273 2273 -, cagt dbSNP:533583404
2278 2278 a, g dbSNP:771202132
2280 2280 c, t dbSNP:548800065
2281 2281 a, g dbSNP:567380897
2282 2282 c, t dbSNP:778249345
2287 2287 c, t dbSNP:145040503
2290 2290 c, t dbSNP:759945819
2296 2296 a, g dbSNP:550418684
2308 2308 a, c dbSNP:571115288
2319 2319 a, t dbSNP:753314646
2322 2322 c, t dbSNP:761344708
2365 2365 c, t dbSNP:538507875
2366 2366 a, g dbSNP:556878525
2367 2367 a, g dbSNP:758147557
2370 2370 a, t dbSNP:779711693
2386 2386 c, g dbSNP:144674022
2396 2396 c, t dbSNP:148597914
2397 2397 a, g dbSNP:369327572
2399 2399 a, g dbSNP:775095765
2400 2400 a, c, g dbSNP:574044196
2406 2406 a, t dbSNP:770004268
2407 2407 c, t dbSNP:778071871
2409 2409 a, g dbSNP:749463921
2413 2413 a, c dbSNP:141974248
2422 2422 a, c dbSNP:61507207
2429 2429 a, g dbSNP:12597637
2442 2442 a, g dbSNP:772527375
2443 2443 c, t dbSNP:776605721
2444 2444 a, g dbSNP:776000906
2450 2450 g, t dbSNP:761256519
2455 2455 c, t dbSNP:761710234
2457 2457 c, t dbSNP:764733554
2484 2484 a, g, t dbSNP:765067984
2488 2488 -, tga dbSNP:767195619
2489 2489 a, g dbSNP:545703737
2490 2490 c, g dbSNP:766107084
2504 2504 c, t dbSNP:73256087
2512 2512 a, t dbSNP:530401061
2522 2522 a, g dbSNP:754837787
2524 2524 a, c dbSNP:370125652
2550 2550 a, g dbSNP:767501074
2557 2557 c, g dbSNP:187126304
2564 2564 c, t dbSNP:763268336
2565 2565 a, g dbSNP:560746166
2575 2575 c, g dbSNP:777984551
2580 2580 a, g dbSNP:749432771
2583 2583 c, t dbSNP:757390249
2594 2594 c, t dbSNP:528144983
2595 2595 a, g dbSNP:546300411
2609 2609 c, t dbSNP:571103213
2610 2610 a, g dbSNP:374608817
2622 2622 c, t dbSNP:772439886
2628 2628 c, g dbSNP:775911088
2629 2629 a, g dbSNP:747512145
2638 2638 -, cagaggaaggggtcccgccctcccgc dbSNP:752579797
2654 2654 a, g dbSNP:769212458
2660 2660 c, g dbSNP:766449799
2662 2662 a, g dbSNP:116985242
2687 2687 a, g dbSNP:376912020
2690 2690 a, g dbSNP:755169652
2692 2692 g, t dbSNP:550440129
2716 2716 a, g dbSNP:568846394
2777 2777 -, at dbSNP:774061481
2779 2779 a, g dbSNP:774062471
2784 2784 a, c dbSNP:568699624
2804 2804 a, g dbSNP:534115735
2819 2819 -, tc dbSNP:72262430
2825 2825 -, tc dbSNP:560192698
2825 2825 -, t dbSNP:57776625
2832 2832 a, t dbSNP:548814651
2849 2849 g, t dbSNP:555704269
2862 2862 a, g dbSNP:191644580
2868 2868 c, t dbSNP:150669250

Target ORF information:

RefSeq Version NM_001284316
Organism Homo sapiens (human)
Definition Homo sapiens acyl-CoA synthetase family member 3 (ACSF3), transcript variant 3, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_001284316

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
ATGATGCCTG AGTTCAGCCC TCAGCAGGTT TGGGAAAAGT TCTTAAGTTC TGAAACGCCG 
CGGATCAATG TCTTTATGGC AGTGCCTACA ATATACACCA AGCTGATGGA GTACTACGAC
AGGCATTTTA CCCAGCCGCA CGCCCAGGAT TTCTTGCGTG CAGTTTGTGA AGAAAAAATT
AGGCTGATGG TCTCAGGCTC AGCTGCCCTG CCCCTCCCAG TGCTGGAGAA GTGGAAGAAC
ATCACGGGCC ACACCCTGCT GGAGCGGTAT GGCATGACCG AGATCGGCAT GGCTCTGTCC
GGGCCCCTGA CCACTGCCGT GCGCCTGCCA GGTTCCGTGG GGACCCCACT GCCTGGAGTA
CAGGTGCGCA TTGTCTCAGA AAACCCACAG AGGGAAGCCT GCTCCTACAC CATCCACGCA
GAGGGAGACG AGAGGGGGAC CAAGGTGACC CCAGGGTTTG AAGAAAAGGA GGGGGAGCTG
CTGGTGAGGG GACCCTCCGT GTTTCGAGAA TACTGGAATA AACCAGAAGA AACTAAGAGT
GCATTCACCC TGGATGGCTG GTTTAAGACA GGGGACACCG TGGTGTTTAA GGATGGCCAG
TACTGGATCC GAGGCCGGAC CTCAGTGGAC ATCATCAAGA CTGGAGGCTA CAAGGTCAGC
GCCCTGGAGG TGGAGTGGCA CCTGCTGGCC CACCCCAGCA TCACAGATGT GGCTGTGATT
GGAGTTCCGG ATATGACATG GGGCCAGCGG GTCACTGCTG TGGTGACCCT CCGAGAAGGA
CACTCACTGT CCCACAGGGA GCTCAAAGAG TGGGCCAGAA ATGTCCTGGC CCCGTACGCG
GTGCCCTCGG AGCTGGTGCT GGTGGAGGAG ATCCCGCGGA ACCAGATGGG CAAGATTGAC
AAGAAGGCGC TCATCAGGCA CTTCCACCCC TCATGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu01574
Accession Version NM_174917.4 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1731bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product acyl-CoA synthetase family member 3, mitochondrial isoform 1 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BM148793.1, DA062861.1, AK075499.1, AC135782.4 and AC009113.8. This sequence is a reference standard in the RefSeqGene project. On Sep 27, 2013 this sequence version replaced gi:343168765. Summary: This gene encodes a member of the acyl-CoA synthetase family of enzymes that activate fatty acids by catalyzing the formation of a thioester linkage between fatty acids and coenzyme A. The encoded protein is localized to mitochondria, has high specificity for malonate and methylmalonate and possesses malonyl-CoA synthetase activity. Mutations in this gene are a cause of combined malonic and methylmalonic aciduria. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Sep 2013]. Transcript Variant: This variant (1) encodes the longer isoform (1). Variants 1, 2 and 4 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##RefSeq-Attributes-START## gene product(s) localized to mito. :: reported by MitoCarta ##RefSeq-Attributes-END## ##Evidence-Data-START## Transcript exon combination :: AK075499.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA2142348, SAMEA2142680 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
ATGCTGCCCC ATGTGGTGCT CACCTTCCGG CGCCTGGGCT GCGCCTTGGC GTCCTGCCGG 
CTGGCGCCTG CGAGACACAG AGGAAGTGGT CTTCTGCACA CAGCCCCAGT GGCCCGCTCG
GACAGGAGCG CCCCGGTGTT CACCCGTGCC CTGGCCTTTG GGGACAGAAT CGCCCTGGTT
GACCAGCACG GCCGCCACAC GTACAGGGAG CTTTATTCCC GCAGCCTTCG CCTGTCCCAG
GAGATCTGCA GGCTCTGCGG GTGTGTCGGC GGGGACCTCC GGGAGGAGAG GGTCTCCTTC
CTATGCGCTA ACGATGCCTC CTACGTCGTG GCCCAGTGGG CGTCATGGAT GAGTGGCGGT
GTGGCAGTCC CCCTCTACAG GAAGCATCCC GCGGCCCAGC TGGAGTATGT CATCTGCGAC
TCCCAGAGCT CTGTGGTCCT TGCCAGCCAG GAGTACCTGG AGCTCCTGAG CCCGGTGGTC
AGGAAGCTGG GGGTCCCGCT GCTGCCGCTC ACACCAGCCA TCTACACTGG AGCAGTAGAG
GAACCGGCAG AGGTCCCGGT CCCAGAGCAG GGATGGAGGA ACAAGGGCGC CATGATCATC
TACACCAGTG GGACCACGGG GAGGCCCAAG GGCGTGCTGA GCACGCACCA AAACATCAGG
GCTGTGGTGA CCGGGCTGGT CCACAAGTGG GCATGGACCA AAGACGACGT GATCCTCCAC
GTGCTCCCGC TGCACCACGT CCATGGTGTG GTCAACGCGC TGCTCTGTCC TCTCTGGGTG
GGAGCCACCT GTGTGATGAT GCCTGAGTTC AGCCCTCAGC AGGTTTGGGA AAAGTTCTTA
AGTTCTGAAA CGCCGCGGAT CAATGTCTTT ATGGCAGTGC CTACAATATA CACCAAGCTG
ATGGAGTACT ACGACAGGCA TTTTACCCAG CCGCACGCCC AGGATTTCTT GCGTGCAGTT
TGTGAAGAAA AAATTAGGCT GATGGTCTCA GGCTCAGCTG CCCTGCCCCT CCCAGTGCTG
GAGAAGTGGA AGAACATCAC GGGCCACACC CTGCTGGAGC GGTATGGCAT GACCGAGATC
GGCATGGCTC TGTCCGGGCC CCTGACCACT GCCGTGCGCC TGCCAGGTTC CGTGGGGACC
CCACTGCCTG GAGTACAGGT GCGCATTGTC TCAGAAAACC CACAGAGGGA AGCCTGCTCC
TACACCATCC ACGCAGAGGG AGACGAGAGG GGGACCAAGG TGACCCCAGG GTTTGAAGAA
AAGGAGGGGG AGCTGCTGGT GAGGGGACCC TCCGTGTTTC GAGAATACTG GAATAAACCA
GAAGAAACTA AGAGTGCATT CACCCTGGAT GGCTGGTTTA AGACAGGGGA CACCGTGGTG
TTTAAGGATG GCCAGTACTG GATCCGAGGC CGGACCTCAG TGGACATCAT CAAGACTGGA
GGCTACAAGG TCAGCGCCCT GGAGGTGGAG TGGCACCTGC TGGCCCACCC CAGCATCACA
GATGTGGCTG TGATTGGAGT TCCGGATATG ACATGGGGCC AGCGGGTCAC TGCTGTGGTG
ACCCTCCGAG AAGGACACTC ACTGTCCCAC AGGGAGCTCA AAGAGTGGGC CAGAAATGTC
CTGGCCCCGT ACGCGGTGCC CTCGGAGCTG GTGCTGGTGG AGGAGATCCC GCGGAACCAG
ATGGGCAAGA TTGACAAGAA GGCGCTCATC AGGCACTTCC ACCCCTCATG A
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqNP_777577.2
CDS378..2108
Misc Feature(1)285..287(+)
Misc Feature(2)519..2084(+)
Misc Feature(3)540..2075(+)
Misc Feature(4)972..1007(+)
Misc Feature(5)981..2021(+)
Misc Feature(6)981..1826(+)
Misc Feature(7)1101..2021(+)
Exon (1)1..184
Gene:ACSF3
Gene Synonym:
Exon (2)185..357
Gene:ACSF3
Gene Synonym:
Exon (3)358..1043
Gene:ACSF3
Gene Synonym:
Exon (4)1044..1199
Gene:ACSF3
Gene Synonym:
Exon (5)1200..1354
Gene:ACSF3
Gene Synonym:
Exon (6)1355..1503
Gene:ACSF3
Gene Synonym:
Exon (7)1504..1616
Gene:ACSF3
Gene Synonym:
Exon (8)1617..1743
Gene:ACSF3
Gene Synonym:
Exon (9)1744..1878
Gene:ACSF3
Gene Synonym:
Exon (10)1879..1990
Gene:ACSF3
Gene Synonym:
Exon (11)1991..3747
Gene:ACSF3
Gene Synonym:
Translation
Position Chain Variation Link
41 41 a, g dbSNP:747952887
47 47 -, g dbSNP:773436445
65 65 c, g dbSNP:769771344
66 66 a, g, t dbSNP:543425407
67 67 c, g dbSNP:562092702
68 68 c, g dbSNP:529306939
87 87 g, t dbSNP:774510978
102 102 c, t dbSNP:759618916
113 113 c, g dbSNP:145228567
115 115 -, gc dbSNP:749018575
139 139 a, c dbSNP:775751925
171 171 a, g dbSNP: