Email to GenScript

ELAVL1 ELAV like RNA binding protein 1 [Homo sapiens (human)]

Gene Symbol ELAVL1
Entrez Gene ID 1994
Full Name ELAV like RNA binding protein 1
Synonyms ELAV1, HUR, Hua, MelG
General protein information
Preferred Names
ELAV-like protein 1
Names
ELAV-like protein 1
Hu antigen R
hu-antigen R
embryonic lethal, abnormal vision, drosophila, homolog-like 1
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

19

19p13.2

Summary The protein encoded by this gene is a member of the ELAVL family of RNA-binding proteins that contain several RNA recognition motifs, and selectively bind AU-rich elements (AREs) found in the 3' untranslated regions of mRNAs. AREs signal degradation of mRNAs as a means to regulate gene expression, thus by binding AREs, the ELAVL family of proteins play a role in stabilizing ARE-containing mRNAs. This gene has been implicated in a variety of biological processes and has been linked to a number of diseases, including cancer. It is highly expressed in many cancers, and could be potentially useful in cancer diagnosis, prognosis, and therapy. [provided by RefSeq, Sep 2012]. lac of sum
Disorder MIM:

603466

Disorder Html:





The following ELAVL1 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the ELAVL1 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu57461 XM_011527777 PREDICTED: Homo sapiens ELAV like RNA binding protein 1 (ELAVL1), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319
OHu23723 NM_001419 Homo sapiens ELAV like RNA binding protein 1 (ELAVL1), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
$309

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.


CloneID OHu57461
Accession Version XM_011527777.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1062bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product ELAV-like protein 1 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011295.12) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
ATGGGTAGTG GTGGCAGGAG TGCTCAGGTG TCCACTGGGC AGAGGGCTTG GCTGTTACCC 
TGCAGATTTT TGAAAAATAC AATGTCTAAT GGTTATGAAG ACCACATGGC CGAAGACTGC
AGGGGTGACA TCGGGAGAAC GAATTTGATC GTCAACTACC TCCCTCAGAA CATGACCCAG
GATGAGTTAC GAAGCCTGTT CAGCAGCATT GGTGAAGTTG AATCTGCAAA ACTTATTCGG
GATAAAGTAG CAGGACACAG CTTGGGCTAT GGCTTTGTGA ACTACGTGAC CGCGAAGGAT
GCAGAGAGAG CGATCAACAC GCTGAACGGC TTGAGGCTCC AGTCAAAAAC CATTAAGGTG
TCGTATGCTC GCCCGAGCTC AGAGGTGATC AAAGACGCCA ACTTGTACAT CAGCGGGCTC
CCGCGGACCA TGACCCAGAA GGACGTAGAA GACATGTTCT CTCGGTTTGG GCGGATCATC
AACTCGCGGG TCCTCGTGGA TCAGACTACA GGTTTGTCCA GAGGGGTTGC GTTTATCCGG
TTTGACAAAC GGTCGGAGGC AGAAGAGGCA ATTACCAGTT TCAATGGTCA TAAACCCCCA
GGTTCCTCTG AGCCCATCAC AGTGAAGTTT GCAGCCAACC CCAACCAGAA CAAAAACGTG
GCACTCCTCT CGCAGCTGTA CCACTCGCCA GCGCGACGGT TCGGAGGCCC CGTTCACCAC
CAGGCGCAGA GATTCAGGTT CTCCCCCATG GGCGTCGATC ACATGAGCGG GCTCTCTGGC
GTCAACGTGC CAGGAAACGC CTCCTCCGGC TGGTGCATTT TCATCTACAA CCTGGGGCAG
GATGCCGACG AGGGGATCCT CTGGCAGATG TTTGGGCCGT TTGGTGCCGT CACCAATGTG
AAAGTGATCC GCGACTTCAA CACCAACAAG TGCAAAGGGT TTGGCTTTGT GACCATGACA
AACTATGAAG AAGCCGCGAT GGCCATAGCC AGCCTGAACG GCTACCGCCT GGGGGACAAA
ATCTTACAGG TTTCCTTCAA AACCAACAAG TCCCACAAAT AA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_011526079.1
CDS88..1149
Misc Feature(1)223..1146(+)
Misc Feature(2)223..456(+)
Misc Feature(3)229..456(+)
Misc Feature(4)484..735(+)
Misc Feature(5)487..723(+)
Misc Feature(6)895..1146(+)
Translation
Position Chain Variation Link
6 6 c, g dbSNP:776759807
7 7 a, g dbSNP:186263820
30 30 c, g dbSNP:549633169
59 59 a, g dbSNP:545460085
73 73 a, g dbSNP:763651310
113 113 a, c dbSNP:760339979
138 138 c, g dbSNP:149857084
157 157 c, t dbSNP:537650261
164 164 a, g dbSNP:749189050
165 165 a, t dbSNP:2113116
174 174 c, t dbSNP:777569343
179 179 -, gttatg dbSNP:754379885
180 180 a, t dbSNP:755998205
183 183 c, t dbSNP:752362089
185 185 a, g dbSNP:767314853
191 191 a, g dbSNP:754511831
193 193 a, g dbSNP:751134984
198 198 c, t dbSNP:766789609
199 199 a, g dbSNP:368659692
209 209 a, g dbSNP:773607076
211 211 a, g dbSNP:765588626
214 214 g, t dbSNP:183919265
217 217 a, g dbSNP:762197301
219 219 c, g, t dbSNP:370966971
228 228 a, g dbSNP:142415817
237 237 c, t dbSNP:747086495
249 249 c, t dbSNP:775570537
264 264 c, t dbSNP:377661419
274 274 c, t dbSNP:772056418
280 280 a, c dbSNP:749196794
282 282 c, t dbSNP:777599409
313 313 g, t dbSNP:755938476
325 325 c, t dbSNP:748009879
327 327 c, g dbSNP:138730200
339 339 a, g dbSNP:754747499
342 342 a, g dbSNP:529073283
357 357 c, t dbSNP:1127943
372 372 c, t dbSNP:767301210
373 373 a, g dbSNP:757894457
377 377 c, t dbSNP:749959468
378 378 c, t dbSNP:779387165
380 380 c, t dbSNP:757692680
381 381 a, g dbSNP:754355375
390 390 a, g dbSNP:764390657
399 399 a, g dbSNP:188279033
407 407 c, t dbSNP:752929356
408 408 a, g dbSNP:767677745
414 414 c, t dbSNP:201603573
423 423 a, g dbSNP:774642905
426 426 c, g dbSNP:771142031
462 462 a, g dbSNP:367796896
483 483 c, t dbSNP:114408443
495 495 c, t dbSNP:745472016
501 501 c, t dbSNP:774020554
507 507 c, t dbSNP:192725189
510 510 a, c, g dbSNP:41379445
512 512 a, g dbSNP:748842783
528 528 a, g dbSNP:45483997
541 541 a, t dbSNP:756651324
549 549 c, t dbSNP:549532291
551 551 a, g dbSNP:140179606
560 560 a, g dbSNP:201280427
561 561 a, g dbSNP:751794284
564 564 c, t dbSNP:766749858
573 573 a, g, t dbSNP:750589491
574 574 a, c dbSNP:765363563
576 576 c, g dbSNP:760471250
579 579 a, c dbSNP:775519115
582 582 c, t dbSNP:767175101
583 583 a, g dbSNP:759364043
597 597 a, g dbSNP:773966006
613 613 a, g dbSNP:11542499
627 627 c, g dbSNP:147459374
639 639 a, g, t dbSNP:149337587
641 641 c, t dbSNP:761216666
642 642 a, g dbSNP:776273273
671 671 a, g dbSNP:768294547
685 685 c, t dbSNP:376219740
696 696 c, t dbSNP:773801685
723 723 c, t dbSNP:772518127
726 726 c, t dbSNP:201498939
744 744 c, t dbSNP:772532543
745 745 a, g dbSNP:746289699
750 750 a, t dbSNP:778988164
759 759 a, g, t dbSNP:762271808
768 768 c, t dbSNP:774920988
774 774 a, g dbSNP:372959704
778 778 g, t dbSNP:756212952
779 779 c, t dbSNP:370407808
789 789 c, t dbSNP:377051094
798 798 c, g dbSNP:758108261
799 799 a, g dbSNP:750293457
811 811 c, g dbSNP:138823708
812 812 c, t dbSNP:756868982
813 813 a, g dbSNP:576719241
834 834 a, c dbSNP:774746507
840 840 c, t dbSNP:186814941
841 841 a, g dbSNP:763270784
849 849 c, t dbSNP:773403765
851 851 -, tga dbSNP:753326877
855 855 c, t dbSNP:770061141
858 858 a, g dbSNP:772030792
867 867 c, t dbSNP:200745899
868 868 a, g dbSNP:776625986
870 870 c, t dbSNP:549438204
872 872 a, g dbSNP:768632820
873 873 c, t dbSNP:761703524
885 885 c, t dbSNP:202134359
886 886 a, g dbSNP:770736507
888 888 c, t dbSNP:150631425
890 890 c, t dbSNP:267605770
894 894 -, tcc dbSNP:765763421
894 894 c, t dbSNP:182490610
897 897 a, c dbSNP:755758429
901 901 g, t dbSNP:752407235
927 927 a, g dbSNP:780701157
932 932 c, t dbSNP:754481468
933 933 c, t dbSNP:141885519
934 934 a, g dbSNP:148254612
936 936 c, t dbSNP:145371492
948 948 c, t dbSNP:750853913
966 966 a, g dbSNP:765592146
972 972 c, t dbSNP:14394
975 975 c, t dbSNP:141157314
999 999 c, t dbSNP:768748811
1008 1008 c, t dbSNP:760717037
1010 1010 c, t dbSNP:774331648
1025 1025 a, g dbSNP:770836572
1026 1026 a, g dbSNP:749238784
1056 1056 a, g dbSNP:777651478
1059 1059 a, c dbSNP:769730671
1062 1062 c, t dbSNP:138089315
1065 1065 a, g dbSNP:780749922
1066 1066 a, t dbSNP:199976454
1074 1074 a, t dbSNP:117307819
1086 1086 c, t dbSNP:751092258
1093 1093 c, t dbSNP:780607258
1116 1116 a, g dbSNP:758836541
1151 1151 c, t dbSNP:750943630
1152 1152 c, t dbSNP:186880346
1153 1153 a, g dbSNP:369199659
1168 1168 -, t dbSNP:574434409
1168 1168 -, t dbSNP:760233337
1172 1172 c, t dbSNP:538636870
1175 1175 a, g dbSNP:566502419
1204 1204 a, g dbSNP:183528970
1375 1375 -, t dbSNP:34785543
1403 1403 a, g dbSNP:779861874
1407 1407 g, t dbSNP:769359250
1490 1490 a, g dbSNP:529982198
1574 1574 c, t dbSNP:79721943
1584 1584 -, a dbSNP:554497979
1587 1587 a, g dbSNP:550706699
1603 1603 c, t dbSNP:570470011
1604 1604 a, g dbSNP:192158618
1611 1611 a, g dbSNP:545216841
1658 1658 c, t dbSNP:780627291
1677 1677 a, g dbSNP:528443909
1687 1687 a, g dbSNP:375510775
1706 1706 a, g dbSNP:556936000
1709 1709 a, g dbSNP:542627350
1714 1714 c, t dbSNP:573967242
1732 1732 a, c dbSNP:75744398
1749 1749 c, t dbSNP:543953498
1754 1754 c, t dbSNP:4804056
1762 1762 g, t dbSNP:12982225
1766 1766 a, g dbSNP:754002229
1769 1769 c, t dbSNP:186475212
1790 1790 c, t dbSNP:766594910
1836 1836 c, g dbSNP:566587236
1883 1883 a, g dbSNP:760956269
1890 1890 a, g dbSNP:552979194
1913 1913 a, c dbSNP:74369359
1943 1943 c, t dbSNP:767532858
1953 1953 a, g dbSNP:761770088
1971 1971 c, t dbSNP:567513830
1984 1984 c, t dbSNP:550643406
2015 2015 a, g dbSNP:559791373
2016 2016 c, t dbSNP:774177480
2105 2105 a, g dbSNP:537343937
2114 2114 a, g dbSNP:541290639
2115 2115 g, t dbSNP:768440155
2124 2124 g, t dbSNP:762844866
2125 2125 c, t dbSNP:768488551
2199 2199 g, t dbSNP:10818
2235 2235 c, t dbSNP:376162509
2283 2283 c, t dbSNP:14610
2317 2317 g, t dbSNP:538300956
2357 2357 a, g dbSNP:760451218
2405 2405 a, g dbSNP:777425732
2440 2440 c, g dbSNP:180688056
2451 2451 a, g dbSNP:112243720
2461 2461 a, c dbSNP:4804244
2466 2466 c, t dbSNP:548917916
2496 2496 c, t dbSNP:371024460
2576 2576 g, t dbSNP:188282540
2584 2584 c, g dbSNP:529258081
2620 2620 a, g dbSNP:12973935
2636 2636 -, t dbSNP:370894254
2641 2641 a, g dbSNP:143118673
2697 2697 a, g dbSNP:745399012
2711 2711 a, g dbSNP:148611610
2717 2717 c, t dbSNP:185439379
2730 2730 c, t dbSNP:564488531
2734 2734 g, t dbSNP:145885267
2735 2735 c, g dbSNP:572931589
2736 2736 c, t dbSNP:780723568
2752 2752 c, g dbSNP:553116111
2792 2792 a, g dbSNP:770378775
2814 2814 g, t dbSNP:536246649
2828 2828 a, c, t dbSNP:181204020
2838 2838 a, g dbSNP:557196943
2848 2848 a, g dbSNP:535452067
2927 2927 a, g dbSNP:571531444
2954 2954 g, t dbSNP:551133212
2964 2964 a, g dbSNP:534512151
2967 2967 c, t dbSNP:12985234
2984 2984 a, g dbSNP:546447688
3064 3064 a, g dbSNP:754200220
3070 3070 a, g dbSNP:10402477
3091 3091 -, t dbSNP:748984813
3095 3095 a, t dbSNP:777541350
3098 3098 c, t dbSNP:35986520
3149 3149 c, t dbSNP:550164559
3167 3167 a, g dbSNP:533430541
3174 3174 -, cttctgatggaaggtgggagccaacacc dbSNP:71165244
3319 3319 c, t dbSNP:73008891
3329 3329 c, t dbSNP:542212554
3338 3338 c, t dbSNP:541600311
3339 3339 a, g dbSNP:750637297
3346 3346 a, g dbSNP:78548450
3350 3350 -, c dbSNP:34406115
3351 3351 c, g dbSNP:767581196
3353 3353 c, t dbSNP:149846894
3374 3374 c, g dbSNP:550487803
3382 3382 c, t dbSNP:761811728
3395 3395 a, g dbSNP:573564297
3399 3399 agaact, ctag dbSNP:386806523
3403 3403 c, t dbSNP:556646963
3448 3448 acc, tct dbSNP:386806522
3448 3448 a, t dbSNP:572075001
3450 3450 c, t dbSNP:116398041
3466 3466 a, g dbSNP:568452884
3479 3479 g, t dbSNP:372859905
3579 3579 -, ctcattg dbSNP:561764445
3581 3581 c, t dbSNP:534498504
3585 3585 a, g dbSNP:77312432
3596 3596 c, t dbSNP:139908588
3597 3597 c, t dbSNP:147291118
3608 3608 c, t dbSNP:775405602
3635 3635 a, c dbSNP:570154849
3661 3661 a, g dbSNP:765165606
3709 3709 c, t dbSNP:571393250
3742 3742 c, g dbSNP:776171497
3759 3759 c, t dbSNP:189658634
3766 3766 c, t dbSNP:533374602
3768 3768 -, tat dbSNP:758772658
3794 3794 c, t dbSNP:571152560
3801 3801 c, t dbSNP:112011167
3841 3841 a, c dbSNP:548157433
3868 3868 a, g dbSNP:527867670
3891 3891 c, t dbSNP:562300297
3892 3892 a, t dbSNP:542422643
3901 3901 c, g dbSNP:143921406
3908 3908 c, t dbSNP:563400250
3909 3909 g, t dbSNP:770421779
3912 3912 g, t dbSNP:376389317
4025 4025 a, g dbSNP:12983784
4028 4028 a, c dbSNP:572838171
4066 4066 c, g dbSNP:577606658
4087 4087 g, t dbSNP:73923951
4090 4090 c, t dbSNP:369819401
4104 4104 c, t dbSNP:557626641
4126 4126 g, t dbSNP:78577110
4131 4131 a, g dbSNP:780352485
4157 4157 g, t dbSNP:185133870
4159 4159 c, t dbSNP:555114795
4182 4182 c, t dbSNP:535643192
4184 4184 c, t dbSNP:756489108
4188 4188 g, t dbSNP:746043879
4204 4204 c, t dbSNP:781275372
4218 4218 c, t dbSNP:570015746
4230 4230 a, g dbSNP:556662201
4252 4252 g, t dbSNP:774004034
4253 4253 c, g dbSNP:539448086
4256 4256 c, t dbSNP:757565136
4261 4261 a, g dbSNP:570889529
4264 4264 -, g dbSNP:34888054
4282 4282 c, t dbSNP:540896476
4283 4283 c, t dbSNP:764321426
4288 4288 a, c dbSNP:527953121
4293 4293 c, t dbSNP:568789099
4297 4297 a, g dbSNP:548445793
4321 4321 a, g dbSNP:531941875
4348 4348 -, ct dbSNP:559432675
4404 4404 c, t dbSNP:563228104
4416 4416 a, c dbSNP:77775659
4418 4418 c, t dbSNP:192920526
4432 4432 c, t dbSNP:758380250
4433 4433 a, g dbSNP:752713887
4461 4461 a, g dbSNP:532744882
4477 4477 a, g dbSNP:765075951
4482 4482 c, t dbSNP:377207480
4483 4483 a, g dbSNP:759267368
4498 4498 -, ctt dbSNP:200747424
4505 4505 c, t dbSNP:3745391
4506 4506 a, g dbSNP:776283805
4532 4532 g, t dbSNP:540649524
4537 4537 c, g dbSNP:765946658
4570 4570 a, g dbSNP:571963611
4590 4590 a, g dbSNP:189143756
4614 4614 c, t dbSNP:541653144
4621 4621 c, t dbSNP:368346724
4634 4634 a, c dbSNP:147458010
4636 4636 c, t dbSNP:184690108
4715 4715 a, g dbSNP:556362520
4739 4739 c, t dbSNP:192658356
4746 4746 a, g dbSNP:570971403
4831 4831 c, g dbSNP:186610101
4832 4832 g, t dbSNP:2042920
4857 4857 a, g dbSNP:568729970
4862 4862 c, t dbSNP:141440324
4867 4867 c, g dbSNP:538050408
4891 4891 c, t dbSNP:775211736
4917 4917 c, t dbSNP:17160080
4965 4965 c, t dbSNP:775986592
4990 4990 c, t dbSNP:552513123
4994 4994 c, g dbSNP:73008886
4999 4999 c, g dbSNP:532836657
5015 5015 a, g dbSNP:770077493
5027 5027 c, t dbSNP:116715205
5041 5041 c, t dbSNP:182688677
5045 5045 a, c dbSNP:148294983
5077 5077 a, t dbSNP:548746208
5078 5078 a, t dbSNP:192857836
5100 5100 c, t dbSNP:200286505
5104 5104 c, t dbSNP:555430038
5128 5128 a, g dbSNP:144173354
5148 5148 a, g dbSNP:781662946
5180 5180 a, c, g dbSNP:535465575
5182 5182 c, t dbSNP:778231627
5200 5200 -, tt dbSNP:148070294
5209 5209 a, c dbSNP:7254797
5224 5224 a, g dbSNP:546593710
5229 5229 c, t dbSNP:149529344
5298 5298 a, c dbSNP:747297759
5355 5355 c, t dbSNP:62123115
5361 5361 a, g dbSNP:758573648
5423 5423 g, t dbSNP:752623949
5441 5441 c, t dbSNP:765274292
5454 5454 a, g dbSNP:577361601
5475 5475 c, t dbSNP:755012988
5510 5510 a, g dbSNP:554314008
5517 5517 -, aaaa dbSNP:569523335
5520 5520 -, a dbSNP:199580649
5528 5528 c, t dbSNP:188045007
5561 5561 a, t dbSNP:547834065
5563 5563 a, t dbSNP:12975506
5563 5563 -, t dbSNP:398040862
5568 5568 a, t dbSNP:76513943
5574 5574 -, t dbSNP:5826992
5582 5582 a, g dbSNP:574932815
5601 5601 g, t dbSNP:753761164
5606 5606 g, t dbSNP:554941332
5644 5644 a, g dbSNP:538564156
5678 5678 a, g dbSNP:753565074
5783 5783 a, g dbSNP:376556291
5829 5829 c, t dbSNP:138043782
5831 5831 a, g dbSNP:191598501
5873 5873 c, g dbSNP:750096197
5885 5885 c, t dbSNP:766951002
5897 5897 a, g dbSNP:570204298
5901 5901 a, g dbSNP:761890573
5916 5916 c, g dbSNP:761316192
5944 5944 a, g dbSNP:773916736
5945 5945 a, g dbSNP:117179851
5957 5957 c, t dbSNP:527275249
5984 5984 c, t dbSNP:145411192
5993 5993 c, t dbSNP:547895945
5994 5994 a, g dbSNP:531603175

Target ORF information:

RefSeq Version XM_011527777
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens ELAV like RNA binding protein 1 (ELAVL1), transcript variant X1, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_011527777

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
ATGGGTAGTG GTGGCAGGAG TGCTCAGGTG TCCACTGGGC AGAGGGCTTG GCTGTTACCC 
TGCAGATTTT TGAAAAATAC AATGTCTAAT GGTTATGAAG ACCACATGGC CGAAGACTGC
AGGGGTGACA TCGGGAGAAC GAATTTGATC GTCAACTACC TCCCTCAGAA CATGACCCAG
GATGAGTTAC GAAGCCTGTT CAGCAGCATT GGTGAAGTTG AATCTGCAAA ACTTATTCGG
GATAAAGTAG CAGGACACAG CTTGGGCTAT GGCTTTGTGA ACTACGTGAC CGCGAAGGAT
GCAGAGAGAG CGATCAACAC GCTGAACGGC TTGAGGCTCC AGTCAAAAAC CATTAAGGTG
TCGTATGCTC GCCCGAGCTC AGAGGTGATC AAAGACGCCA ACTTGTACAT CAGCGGGCTC
CCGCGGACCA TGACCCAGAA GGACGTAGAA GACATGTTCT CTCGGTTTGG GCGGATCATC
AACTCGCGGG TCCTCGTGGA TCAGACTACA GGTTTGTCCA GAGGGGTTGC GTTTATCCGG
TTTGACAAAC GGTCGGAGGC AGAAGAGGCA ATTACCAGTT TCAATGGTCA TAAACCCCCA
GGTTCCTCTG AGCCCATCAC AGTGAAGTTT GCAGCCAACC CCAACCAGAA CAAAAACGTG
GCACTCCTCT CGCAGCTGTA CCACTCGCCA GCGCGACGGT TCGGAGGCCC CGTTCACCAC
CAGGCGCAGA GATTCAGGTT CTCCCCCATG GGCGTCGATC ACATGAGCGG GCTCTCTGGC
GTCAACGTGC CAGGAAACGC CTCCTCCGGC TGGTGCATTT TCATCTACAA CCTGGGGCAG
GATGCCGACG AGGGGATCCT CTGGCAGATG TTTGGGCCGT TTGGTGCCGT CACCAATGTG
AAAGTGATCC GCGACTTCAA CACCAACAAG TGCAAAGGGT TTGGCTTTGT GACCATGACA
AACTATGAAG AAGCCGCGAT GGCCATAGCC AGCCTGAACG GCTACCGCCT GGGGGACAAA
ATCTTACAGG TTTCCTTCAA AACCAACAAG TCCCACAAAT AA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu23723
Accession Version NM_001419.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 981bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector Document: User manual_GenEZ ORF Clone Products.pdf (pdf)
Clone information Clone Map
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags Document: MSDS_GenEZ ORF Clone Products.pdf (pdf)
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear Document: OHu23723D_COA.pdf (pdf)
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product ELAV-like protein 1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BU542524.1, BC003376.2, W37464.1, AI375368.1, AL713686.1, AW139417.1, BM696191.1 and BM664469.1. On Nov 7, 2003 this sequence version replaced gi:4503550. Summary: The protein encoded by this gene is a member of the ELAVL family of RNA-binding proteins that contain several RNA recognition motifs, and selectively bind AU-rich elements (AREs) found in the 3' untranslated regions of mRNAs. AREs signal degradation of mRNAs as a means to regulate gene expression, thus by binding AREs, the ELAVL family of proteins play a role in stabilizing ARE-containing mRNAs. This gene has been implicated in a variety of biological processes and has been linked to a number of diseases, including cancer. It is highly expressed in many cancers, and could be potentially useful in cancer diagnosis, prognosis, and therapy. [provided by RefSeq, Sep 2012]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BU542524.1, BC003376.2 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA962342, SAMEA962347 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
ATGTCTAATG GTTATGAAGA CCACATGGCC GAAGACTGCA GGGGTGACAT CGGGAGAACG 
AATTTGATCG TCAACTACCT CCCTCAGAAC ATGACCCAGG ATGAGTTACG AAGCCTGTTC
AGCAGCATTG GTGAAGTTGA ATCTGCAAAA CTTATTCGGG ATAAAGTAGC AGGACACAGC
TTGGGCTATG GCTTTGTGAA CTACGTGACC GCGAAGGATG CAGAGAGAGC GATCAACACG
CTGAACGGCT TGAGGCTCCA GTCAAAAACC ATTAAGGTGT CGTATGCTCG CCCGAGCTCA
GAGGTGATCA AAGACGCCAA CTTGTACATC AGCGGGCTCC CGCGGACCAT GACCCAGAAG
GACGTAGAAG ACATGTTCTC TCGGTTTGGG CGGATCATCA ACTCGCGGGT CCTCGTGGAT
CAGACTACAG GTTTGTCCAG AGGGGTTGCG TTTATCCGGT TTGACAAACG GTCGGAGGCA
GAAGAGGCAA TTACCAGTTT CAATGGTCAT AAACCCCCAG GTTCCTCTGA GCCCATCACA
GTGAAGTTTG CAGCCAACCC CAACCAGAAC AAAAACGTGG CACTCCTCTC GCAGCTGTAC
CACTCGCCAG CGCGACGGTT CGGAGGCCCC GTTCACCACC AGGCGCAGAG ATTCAGGTTC
TCCCCCATGG GCGTCGATCA CATGAGCGGG CTCTCTGGCG TCAACGTGCC AGGAAACGCC
TCCTCCGGCT GGTGCATTTT CATCTACAAC CTGGGGCAGG ATGCCGACGA GGGGATCCTC
TGGCAGATGT TTGGGCCGTT TGGTGCCGTC ACCAATGTGA AAGTGATCCG CGACTTCAAC
ACCAACAAGT GCAAAGGGTT TGGCTTTGTG ACCATGACAA ACTATGAAGA AGCCGCGATG
GCCATAGCCA GCCTGAACGG CTACCGCCTG GGGGACAAAA TCTTACAGGT TTCCTTCAAA
ACCAACAAGT CCCACAAATA A
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqNP_001410.2
CDS168..1148
Misc Feature(1)171..173(+)
Misc Feature(2)171..173(+)
Misc Feature(3)222..1145(+)
Misc Feature(4)222..455(+)
Misc Feature(5)228..455(+)
Misc Feature(6)483..734(+)
Misc Feature(7)486..722(+)
Misc Feature(8)756..758(+)
Misc Feature(9)765..767(+)
Misc Feature(10)765..767(+)
Misc Feature(11)771..773(+)
Misc Feature(12)771..773(+)
Misc Feature(13)816..818(+)
Misc Feature(14)816..818(+)
Misc Feature(15)894..1145(+)
Exon (1)1..151
Gene:ELAVL1
Gene Synonym:
Exon (2)152..339
Gene:ELAVL1
Gene Synonym:
Exon (3)340..443
Gene:ELAVL1
Gene Synonym:
Exon (4)444..597
Gene:ELAVL1
Gene Synonym:
Exon (5)598..823
Gene:ELAVL1
Gene Synonym:
Exon (6)824..6058
Gene:ELAVL1
Gene Synonym:
Translation
Position Chain Variation Link
49 49 a, c dbSNP:189171866
54 54 c, t dbSNP:533961658
112 112 c, t dbSNP:568386183
156 156 c, t dbSNP:537650261
163 163 a, g dbSNP:749189050
164 164 a, t dbSNP:2113116
173 173 c, t dbSNP:777569343
178 178 -, gttatg dbSNP:754379885
179 179 a, t dbSNP:755998205
182 182 c, t dbSNP:752362089
184 184 a, g dbSNP:767314853
190 190 a, g dbSNP:754511831
192 192 a, g dbSNP:751134984
197 197 c, t dbSNP:766789609
198 198 a, g dbSNP:368659692
208 208 a, g dbSNP:773607076
210 210 a, g dbSNP:765588626
213 213 g, t dbSNP:183919265
216 216 a, g dbSNP:762197301
218 218 c, g, t dbSNP:370966971
227 227 a, g dbSNP:142415817
236 236 c, t dbSNP:747086495
248 248 c, t dbSNP:775570537
263 263 c, t dbSNP:377661419
273 273 c, t dbSNP:772056418
279 279 a, c dbSNP:749196794
281 281 c, t dbSNP:777599409
312 312 g, t dbSNP:755938476
324 324 c, t dbSNP:748009879
326 326 c, g dbSNP:138730200
338 338 a, g dbSNP:754747499
341 341 a, g dbSNP:529073283
356 356 c, t dbSNP:1127943
371 371 c, t dbSNP:767301210
372 372 a, g dbSNP:757894457
376 376 c, t dbSNP:749959468
377 377 c, t dbSNP:779387165
379 379 c, t dbSNP:757692680
380 380 a, g dbSNP:754355375
389 389 a, g dbSNP:764390657
398 398 a, g dbSNP:188279033
406 406 c, t dbSNP:752929356
407 407 a, g dbSNP:767677745
413 413 c, t dbSNP:201603573
422 422 a, g dbSNP:774642905
425 425 c, g dbSNP:771142031
461 461 a, g dbSNP:367796896
482 482 c, t dbSNP:114408443
494 494 c, t dbSNP:745472016
500 500 c, t dbSNP:774020554
506 506 c, t dbSNP:192725189
509 509 a, c, g dbSNP:41379445
511 511 a, g dbSNP:748842783
527 527 a, g dbSNP:45483997
540 540 a, t dbSNP:756651324
548 548 c, t dbSNP:549532291
550 550 a, g dbSNP:140179606
559 559 a, g dbSNP:201280427
560 560 a, g dbSNP:751794284
563 563 c, t dbSNP:766749858
572 572 a, g, t dbSNP:750589491
573 573 a, c dbSNP:765363563
575 575 c, g dbSNP:760471250
578 578 a, c dbSNP:775519115
581 581 c, t dbSNP:767175101
582 582 a, g dbSNP:759364043
596 596 a, g dbSNP:773966006
612 612 a, g dbSNP:11542499
626 626 c, g dbSNP:147459374
638 638 a, g, t dbSNP:149337587
640 640 c, t dbSNP:761216666
641 641 a, g dbSNP:776273273
670 670 a, g dbSNP:768294547
684 684 c, t dbSNP:376219740
695 695 c, t dbSNP:773801685
722 722 c, t dbSNP:772518127
725 725 c, t dbSNP:201498939
743 743 c, t dbSNP:772532543
744 744 a, g dbSNP:746289699
749 749 a, t dbSNP:778988164
758 758 a, g, t dbSNP:762271808
767 767 c, t dbSNP:774920988
773 773 a, g dbSNP:372959704
777 777 g, t dbSNP:756212952
778 778 c, t dbSNP:370407808
788 788 c, t dbSNP:377051094
797 797 c, g dbSNP:758108261
798 798 a, g dbSNP:750293457
810 810 c, g dbSNP:138823708
811 811 c, t dbSNP:756868982
812 812 a, g dbSNP:576719241
833 833 a, c dbSNP:774746507
839 839 c, t dbSNP:186814941
840 840 a, g dbSNP:763270784
848 848 c, t dbSNP:773403765
850 850 -, tga dbSNP:753326877
854 854 c, t dbSNP:770061141
857 857 a, g dbSNP:772030792
866 866 c, t dbSNP:200745899
867 867 a, g dbSNP:776625986
869 869 c, t dbSNP:549438204
871 871 a, g dbSNP:768632820
872 872 c, t dbSNP:761703524
884 884 c, t dbSNP:202134359
885 885 a, g dbSNP:770736507
887 887 c, t dbSNP:150631425
889 889 c, t dbSNP:267605770
893 893 -, tcc dbSNP:765763421
893 893 c, t dbSNP:182490610
896 896 a, c dbSNP:755758429
900 900 g, t dbSNP:752407235
926 926 a, g dbSNP:780701157
931 931 c, t dbSNP:754481468
932 932 c, t dbSNP:141885519
933 933 a, g dbSNP:148254612
935 935 c, t dbSNP:145371492
947 947 c, t dbSNP:750853913
965 965 a, g dbSNP:765592146
971 971 c, t dbSNP:14394
974 974 c, t dbSNP:141157314
998 998 c, t dbSNP:768748811
1007 1007 c, t dbSNP:760717037
1009 1009 c, t dbSNP:774331648
1024 1024 a, g dbSNP:770836572
1025 1025 a, g dbSNP:749238784
1055 1055 a, g dbSNP:777651478
1058 1058 a, c dbSNP:769730671
1061 1061 c, t dbSNP:138089315
1064 1064 a, g dbSNP:780749922
1065 1065 a, t dbSNP:199976454
1073 1073 a, t dbSNP:117307819
1085 1085 c, t dbSNP:751092258
1092 1092 c, t dbSNP:780607258
1115 1115 a, g dbSNP:758836541
1150 1150 c, t dbSNP:750943630
1151 1151 c, t dbSNP:186880346
1152 1152 a, g dbSNP:369199659
1167 1167 -, t dbSNP:574434409
1167 1167 -, t dbSNP:760233337
1171 1171 c, t dbSNP:538636870
1174 1174 a, g dbSNP:566502419
1203 1203 a, g dbSNP:183528970
1374 1374 -, t dbSNP:34785543
1402 1402 a, g dbSNP:779861874
1406 1406 g, t dbSNP:769359250
1489 1489 a, g dbSNP:529982198
1573 1573 c, t dbSNP:79721943
1583 1583 -, a dbSNP:554497979
1586 1586 a, g dbSNP:550706699
1602 1602 c, t dbSNP:570470011
1603 1603 a, g dbSNP:192158618
1610 1610 a, g dbSNP:545216841
1657 1657 c, t dbSNP:780627291
1676 1676 a, g dbSNP:528443909
1686 1686 a, g dbSNP:375510775
1705 1705 a, g dbSNP:556936000
1708 1708 a, g dbSNP:542627350
1713 1713 c, t dbSNP:573967242
1731 1731 a, c dbSNP:75744398
1748 1748 c, t dbSNP:543953498
1753 1753 c, t dbSNP:4804056
1761 1761 g, t dbSNP:12982225
1765 1765 a, g dbSNP:754002229
1768 1768 c, t dbSNP:186475212
1789 1789 c, t dbSNP:766594910
1835 1835 c, g dbSNP:566587236
1882 1882 a, g dbSNP:760956269
1889 1889 a, g dbSNP:552979194
1912 1912 a, c dbSNP:74369359
1942 1942 c, t dbSNP:767532858
1952 1952 a, g dbSNP:761770088
1970 1970 c, t dbSNP:567513830
1983 1983 c, t dbSNP:550643406
2014 2014 a, g dbSNP:559791373
2015 2015 c, t dbSNP:774177480
2104 2104 a, g dbSNP:537343937
2113 2113 a, g dbSNP:541290639
2114 2114 g, t dbSNP:768440155
2123 2123 g, t dbSNP:762844866
2124 2124 c, t dbSNP:768488551
2198 2198 g, t dbSNP:10818
2234 2234 c, t dbSNP:376162509
2282 2282 c, t dbSNP:14610
2316 2316 g, t dbSNP:538300956
2356 2356 a, g dbSNP:760451218
2404 2404 a, g dbSNP:777425732
2439 2439 c, g dbSNP:180688056
2450 2450 a, g dbSNP:112243720
2460 2460 a, c dbSNP:4804244
2465 2465 c, t dbSNP:548917916
2495 2495 c, t dbSNP:371024460
2575 2575 g, t dbSNP:188282540
2583 2583 c, g dbSNP:529258081
2619 2619 a, g dbSNP:12973935
2635 2635 -, t dbSNP:370894254
2640 2640 a, g dbSNP:143118673
2696 2696 a, g dbSNP:745399012
2710 2710 a, g dbSNP:148611610
2716 2716 c, t dbSNP:185439379
2729 2729 c, t dbSNP:564488531
2733 2733 g, t dbSNP:145885267
2734 2734 c, g dbSNP:572931589
2735 2735 c, t dbSNP:780723568
2751 2751 c, g dbSNP:553116111
2791 2791 a, g dbSNP:770378775
2813 2813 g, t dbSNP:536246649
2827 2827 a, c, t dbSNP:181204020
2837 2837 a, g dbSNP:557196943
2847 2847 a, g dbSNP:535452067
2926 2926 a, g dbSNP:571531444
2953 2953 g, t dbSNP:551133212
2963 2963 a, g dbSNP:534512151
2966 2966 c, t dbSNP:12985234
2983 2983 a, g dbSNP:546447688
3063 3063 a, g dbSNP:754200220
3069 3069 a, g dbSNP:10402477
3090 3090 -, t dbSNP:748984813
3094 3094 a, t dbSNP:777541350
3097 3097 c, t dbSNP:35986520
3148 3148 c, t dbSNP:550164559
3166 3166 a, g dbSNP:533430541
3173 3173 -, cttctgatggaaggtgggagccaacacc dbSNP:71165244
3318 3318 c, t dbSNP:73008891
3328 3328 c, t dbSNP:542212554
3337 3337 c, t dbSNP:541600311
3338 3338 a, g dbSNP:750637297
3345 3345 a, g dbSNP:78548450
3349 3349 -, c dbSNP:34406115
3350 3350 c, g dbSNP:767581196
3352 3352 c, t dbSNP:149846894
3373 3373 c, g dbSNP:550487803
3381 3381 c, t dbSNP:761811728
3394 3394 a, g dbSNP:573564297
3398 3398 agaact, ctag dbSNP:386806523
3402 3402 c, t dbSNP:556646963
3447 3447 acc, tct dbSNP:386806522
3447 3447 a, t dbSNP:572075001
3449 3449 c, t dbSNP:116398041
3465 3465 a, g dbSNP:568452884
3478 3478 g, t dbSNP:372859905
3578 3578 -, ctcattg dbSNP:561764445
3580 3580 c, t dbSNP:534498504
3584 3584 a, g dbSNP:77312432
3595 3595 c, t dbSNP:139908588
3596 3596 c, t dbSNP:147291118
3607 3607 c, t dbSNP:775405602
3634 3634 a, c dbSNP:570154849
3660 3660 a, g dbSNP:765165606
3708 3708 c, t dbSNP:571393250
3741 3741 c, g dbSNP:776171497
3758 3758 c, t dbSNP:189658634
3765 3765 c, t dbSNP:533374602
3767 3767 -, tat dbSNP:758772658
3793 3793 c, t dbSNP:571152560
3800 3800 c, t dbSNP:112011167
3840 3840 a, c dbSNP:548157433
3867 3867 a, g dbSNP:527867670
3890 3890 c, t dbSNP:562300297
3891 3891 a, t dbSNP:542422643
3900 3900 c, g dbSNP:143921406
3907 3907 c, t dbSNP:563400250
3908 3908 g, t dbSNP:770421779
3911 3911 g, t dbSNP:376389317
4024 4024 a, g dbSNP:12983784
4027 4027 a, c dbSNP:572838171
4065 4065 c, g dbSNP:577606658
4086 4086 g, t dbSNP:73923951
4089 4089 c, t dbSNP:369819401
4103 4103 c, t dbSNP:557626641
4125 4125 g, t dbSNP:78577110
4130 4130 a, g dbSNP:780352485
4156 4156 g, t dbSNP:185133870
4158 4158 c, t dbSNP:555114795
4181 4181 c, t dbSNP:535643192
4183 4183 c, t dbSNP:756489108
4187 4187 g, t dbSNP:746043879
4203 4203 c, t dbSNP:781275372
4217 4217 c, t dbSNP:570015746
4229 4229 a, g dbSNP:556662201
4251 4251 g, t dbSNP:774004034
4252 4252 c, g dbSNP:539448086
4255 4255 c, t dbSNP:757565136
4260 4260 a, g dbSNP:570889529
4263 4263 -, g dbSNP:34888054
4281 4281 c, t dbSNP:540896476
4282 4282 c, t dbSNP:764321426
4287 4287 a, c dbSNP:527953121
4292 4292 c, t dbSNP:568789099
4296 4296 a, g dbSNP:548445793
4320 4320 a, g dbSNP:531941875
4347 4347 -, ct dbSNP:559432675
4403 4403 c, t dbSNP:563228104
4415 4415 a, c dbSNP:77775659
4417 4417 c, t dbSNP:192920526
4431 4431 c, t dbSNP:758380250
4432 4432 a, g dbSNP:752713887
4460 4460 a, g dbSNP:532744882
4476 4476 a, g dbSNP:765075951
4481 4481 c, t dbSNP:377207480
4482 4482 a, g dbSNP:759267368
4497 4497 -, ctt dbSNP:200747424
4504 4504 c, t dbSNP:3745391
4505 4505 a, g dbSNP:776283805
4531 4531 g, t dbSNP:540649524
4536 4536 c, g dbSNP:765946658
4569 4569 a, g dbSNP:571963611
4589 4589 a, g dbSNP:189143756
4613 4613 c, t dbSNP:541653144
4620 4620 c, t dbSNP:368346724
4633 4633 a, c dbSNP:147458010
4635 4635 c, t dbSNP:184690108
4714 4714 a, g dbSNP:556362520
4738 4738 c, t dbSNP:192658356
4745 4745 a, g dbSNP:570971403
4830 4830 c, g dbSNP:186610101
4831 4831 g, t dbSNP:2042920
4856 4856 a, g dbSNP:568729970
4861 4861 c, t dbSNP:141440324
4866 4866 c, g dbSNP:538050408
4890 4890 c, t dbSNP:775211736
4916 4916 c, t dbSNP:17160080
4964 4964 c, t dbSNP:775986592
4989 4989 c, t dbSNP:552513123
4993 4993 c, g dbSNP:73008886
4998 4998 c, g dbSNP:532836657
5014 5014 a, g dbSNP:770077493
5026 5026 c, t dbSNP:116715205
5040 5040 c, t dbSNP:182688677
5044 5044 a, c dbSNP:148294983
5076 5076 a, t dbSNP:548746208
5077 5077 a, t dbSNP:192857836
5099 5099 c, t dbSNP:200286505
5103 5103 c, t dbSNP:555430038
5127 5127 a, g dbSNP:144173354
5147 5147 a, g dbSNP:781662946
5179 5179 a, c, g dbSNP:535465575
5181 5181 c, t dbSNP:778231627
5199 5199 -, tt dbSNP:148070294
5208 5208 a, c dbSNP:7254797
5223 5223 a, g dbSNP:546593710
5228 5228 c, t dbSNP:149529344
5297 5297 a, c dbSNP:747297759
5354 5354 c, t dbSNP:62123115
5360 5360 a, g dbSNP:758573648
5422 5422 g, t dbSNP:752623949
5440 5440 c, t dbSNP:765274292
5453 5453 a, g dbSNP:577361601
5474 5474 c, t dbSNP:755012988
5509 5509 a, g dbSNP:554314008
5516 5516 -, aaaa dbSNP:569523335
5519 5519 -, a dbSNP:199580649
5527 5527 c, t dbSNP:188045007
5560 5560 a, t dbSNP:547834065
5562 5562 a, t dbSNP:12975506
5562 5562 -, t dbSNP:398040862
5567 5567 a, t dbSNP:76513943
5573 5573 -, t dbSNP:5826992
5581 5581 a, g dbSNP:574932815
5600 5600 g, t dbSNP:753761164
5605 5605 g, t dbSNP:554941332
5643 5643 a, g dbSNP:538564156
5677 5677 a, g dbSNP:753565074
5782 5782 a, g dbSNP:376556291
5828 5828 c, t dbSNP:138043782
5830 5830 a, g dbSNP:191598501
5872 5872 c, g dbSNP:750096197
5884 5884 c, t dbSNP:766951002
5896 5896 a, g dbSNP:570204298
5900 5900 a, g dbSNP:761890573
5915 5915 c, g dbSNP:761316192
5943 5943 a, g dbSNP:773916736
5944 5944 a, g dbSNP:117179851
5956 5956 c, t dbSNP:527275249
5983 5983 c, t dbSNP:145411192
5992 5992 c, t dbSNP:547895945
5993 5993 a, g dbSNP:531603175

Target ORF information:

RefSeq Version NM_001419
Organism Homo sapiens (human)
Definition Homo sapiens ELAV like RNA binding protein 1 (ELAVL1), mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_001419

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
ATGTCTAATG GTTATGAAGA CCACATGGCC GAAGACTGCA GGGGTGACAT CGGGAGAACG 
AATTTGATCG TCAACTACCT CCCTCAGAAC ATGACCCAGG ATGAGTTACG AAGCCTGTTC
AGCAGCATTG GTGAAGTTGA ATCTGCAAAA CTTATTCGGG ATAAAGTAGC AGGACACAGC
TTGGGCTATG GCTTTGTGAA CTACGTGACC GCGAAGGATG CAGAGAGAGC GATCAACACG
CTGAACGGCT TGAGGCTCCA GTCAAAAACC ATTAAGGTGT CGTATGCTCG CCCGAGCTCA
GAGGTGATCA AAGACGCCAA CTTGTACATC AGCGGGCTCC CGCGGACCAT GACCCAGAAG
GACGTAGAAG ACATGTTCTC TCGGTTTGGG CGGATCATCA ACTCGCGGGT CCTCGTGGAT
CAGACTACAG GTTTGTCCAG AGGGGTTGCG TTTATCCGGT TTGACAAACG GTCGGAGGCA
GAAGAGGCAA TTACCAGTTT CAATGGTCAT AAACCCCCAG GTTCCTCTGA GCCCATCACA
GTGAAGTTTG CAGCCAACCC CAACCAGAAC AAAAACGTGG CACTCCTCTC GCAGCTGTAC
CACTCGCCAG CGCGACGGTT CGGAGGCCCC GTTCACCACC AGGCGCAGAG ATTCAGGTTC
TCCCCCATGG GCGTCGATCA CATGAGCGGG CTCTCTGGCG TCAACGTGCC AGGAAACGCC
TCCTCCGGCT GGTGCATTTT CATCTACAAC CTGGGGCAGG ATGCCGACGA GGGGATCCTC
TGGCAGATGT TTGGGCCGTT TGGTGCCGTC ACCAATGTGA AAGTGATCCG CGACTTCAAC
ACCAACAAGT GCAAAGGGTT TGGCTTTGTG ACCATGACAA ACTATGAAGA AGCCGCGATG
GCCATAGCCA GCCTGAACGG CTACCGCCTG GGGGACAAAA TCTTACAGGT TTCCTTCAAA
ACCAACAAGT CCCACAAATA A

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.