Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

FLCN folliculin [Homo sapiens (human)]

Gene Symbol FLCN
Entrez Gene ID 201163
Full Name folliculin
Synonyms BHD, FLCL
General protein information
Preferred Names
birt-Hogg-Dube syndrome protein
BHD skin lesion fibrofolliculoma protein
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene is located within the Smith-Magenis syndrome region on chromosome 17. Mutations in this gene are associated with Birt-Hogg-Dube syndrome, which is characterized by fibrofolliculomas, renal tumors, lung cysts, and pneumothorax. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Birt-Hogg-Dube syndrome, 135150 (3); Pneumothorax, primary
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu77698 XM_011523714 PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu77698 XM_011523715 PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu77698 XM_011523716 PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu77698 XM_011523717 PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X4, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu77698 XM_011523718 PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X5, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu77699 XM_011523719 PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X6, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu77700 XM_011523720 PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X7, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu77698 XM_011523721 PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X8, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu18989 NM_144997 Homo sapiens folliculin (FLCN), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu19027 NM_144606 Homo sapiens folliculin (FLCN), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu77698D
Sequence Information ORF Nucleotide Sequence (Length: 1794bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product folliculin isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010718.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)814..1359(+)
Position Chain Variation Link
18 18 c, g dbSNP:1736209
24 24 a, g dbSNP:207476321
25 25 c, g dbSNP:564584154
37 37 a, c dbSNP:207476320
39 39 c, t dbSNP:575905361
53 53 a, c dbSNP:562310783
60 60 a, g dbSNP:542327641
74 74 c, t dbSNP:138847774
75 75 c, t dbSNP:553452028
78 78 a, g dbSNP:539415254
130 130 c, t dbSNP:577176265
164 164 g, t dbSNP:528481171
167 167 c, g dbSNP:557719136
168 168 a, g dbSNP:537792180
187 187 c, t dbSNP:180900492
203 203 a, g dbSNP:41345949
205 205 c, g dbSNP:548796445
206 206 c, t dbSNP:1708629
221 221 c, g dbSNP:78262456
223 223 c, g dbSNP:78918950
225 225 g, t dbSNP:75014442
248 248 a, g dbSNP:370286675
276 276 -, ggtaggcgggggtctgagg dbSNP:370486376
329 329 a, g dbSNP:117215381
362 362 a, c, t dbSNP:560968516
364 364 g, t dbSNP:541105214
371 371 c, t dbSNP:116581458
408 408 c, t dbSNP:114481741
412 412 c, t dbSNP:115413827
413 413 a, g dbSNP:756416340
415 415 a, g dbSNP:8069957
426 426 a, g dbSNP:535864585
427 427 c, g dbSNP:147598893
440 440 a, g dbSNP:145125741
447 447 c, t dbSNP:140144170
460 460 a, g dbSNP:571154058
476 476 a, g dbSNP:151144873
493 493 c, t dbSNP:779391001
497 497 a, g dbSNP:369632481
516 516 c, t dbSNP:752123350
517 517 a, g dbSNP:767235709
537 537 c, t dbSNP:754616167
538 538 a, g dbSNP:751171641
546 546 c, t dbSNP:766288960
547 547 a, g dbSNP:539468848
549 549 c, t dbSNP:773349151
553 553 -, c dbSNP:758385503
553 553 c, t dbSNP:765251703
554 554 c, g dbSNP:398124537
556 556 a, g dbSNP:761993256
564 564 c, t dbSNP:776605909
569 569 c, t dbSNP:768734584
570 570 a, g dbSNP:747210367
574 574 g, t dbSNP:775626774
579 579 a, g dbSNP:200350612
582 582 c, t dbSNP:746222481
583 583 a, g dbSNP:779449668
584 584 c, t dbSNP:757670898
586 586 c, t dbSNP:749758787
587 587 -, c dbSNP:398124540
587 587 c, g dbSNP:780588085
588 588 a, g dbSNP:754450145
590 590 c, t dbSNP:150051278
594 594 c, t dbSNP:766122649
597 597 a, g dbSNP:758326533
598 598 c, g dbSNP:750221380
599 599 a, g dbSNP:587778366
601 601 c, g dbSNP:386833401
603 603 a, t dbSNP:375348725
617 617 g, t dbSNP:139418842
633 633 c, g dbSNP:760808366
638 638 c, g, t dbSNP:556510460
639 639 a, g dbSNP:759930161
643 643 c, g dbSNP:369115472
662 662 a, g dbSNP:771056209
672 672 c, t dbSNP:774725046
673 673 c, t dbSNP:746507528
674 674 a, g dbSNP:749770193
679 679 c, t dbSNP:778275358
680 680 a, g, t dbSNP:374969279
683 683 c, t dbSNP:779900587
685 685 c, g dbSNP:758156813
693 693 c, t dbSNP:750047828
694 694 a, g dbSNP:778587763
698 698 a, c dbSNP:757012294
701 701 a, g dbSNP:753787458
705 705 c, g dbSNP:764082089
706 706 a, g dbSNP:587778365
708 708 c, t dbSNP:371947198
709 709 a, g dbSNP:567617762
711 711 c, t dbSNP:759772780
712 712 a, g dbSNP:554247745
714 714 a, g dbSNP:771202158
715 715 c, t dbSNP:763369657
725 725 c, t dbSNP:773648142
726 726 a, g dbSNP:770311645
734 734 a, c dbSNP:746556970
739 739 -, tcgg dbSNP:750146811
739 739 g, t dbSNP:779733014
740 740 c, g dbSNP:137852930
741 741 a, g dbSNP:771650940
745 745 a, g dbSNP:745521431
750 750 c, t dbSNP:150712346
751 751 a, g dbSNP:757060348
761 761 a, g dbSNP:765550303
772 772 g, t dbSNP:141140415
775 775 a, g dbSNP:781100382
778 778 c, t dbSNP:755107067
779 779 a, g dbSNP:751634275
782 782 c, t dbSNP:766548696
783 783 a, g dbSNP:138688941
786 786 a, g dbSNP:750553308
800 800 -, a dbSNP:398124534
809 809 a, c dbSNP:765702734
810 810 c, t dbSNP:762265819
812 812 a, c dbSNP:777336970
815 815 c, t dbSNP:764679174
819 819 a, g dbSNP:759011359
822 822 c, t dbSNP:773946854
823 823 cac, gt dbSNP:398124535
850 850 a, c, t dbSNP:398124536
851 851 -, a dbSNP:776896550
869 869 c, g dbSNP:748979393
939 939 c, t dbSNP:140220661
946 946 a, t dbSNP:752261491
953 953 a, g dbSNP:539457096
960 960 c, t dbSNP:756563416
979 979 a, g dbSNP:375921200
985 985 -, ttc dbSNP:764153620
987 987 c, t dbSNP:773792624
988 988 a, g dbSNP:372918705
1002 1002 c, t dbSNP:376825814
1003 1003 a, g dbSNP:752014050
1004 1004 -, g dbSNP:727504645
1008 1008 c, t dbSNP:200672897
1009 1009 a, g dbSNP:147164515
1010 1010 c, t dbSNP:373794943
1014 1014 c, t dbSNP:763630763
1027 1027 -, ttc dbSNP:786203218
1040 1040 a, g dbSNP:760556162
1047 1047 a, c dbSNP:775176038
1053 1053 c, t dbSNP:767290984
1057 1057 c, t dbSNP:587782069
1059 1059 c, g dbSNP:772775816
1060 1060 c, t dbSNP:587778367
1061 1061 a, g dbSNP:759556434
1093 1093 c, t dbSNP:774358971
1094 1094 g, t dbSNP:369906553
1096 1096 a, c dbSNP:771205573
1102 1102 c, t dbSNP:749368513
1104 1104 c, t dbSNP:773535830
1110 1110 a, c dbSNP:143525924
1113 1113 c, t dbSNP:748363919
1123 1123 c, t dbSNP:781433539
1125 1125 a, g dbSNP:755278796
1127 1127 -, g dbSNP:34867548
1129 1129 a, g dbSNP:747581757
1138 1138 c, t dbSNP:138070947
1139 1139 a, g dbSNP:756807584
1144 1144 a, g dbSNP:201078144
1149 1149 c, t dbSNP:763617124
1150 1150 a, c, g dbSNP:200168437
1161 1161 c, g, t dbSNP:759405317
1162 1162 a, g dbSNP:774491699
1168 1168 gc, ta dbSNP:398124538
1169 1169 c, t dbSNP:766401197
1170 1170 a, g dbSNP:763168749
1192 1192 a, c dbSNP:558699420
1202 1202 a, g dbSNP:370074267
1203 1203 c, t dbSNP:772360950
1205 1205 -, c dbSNP:772407910
1211 1211 a, g dbSNP:367843558
1226 1226 a, g dbSNP:779467022
1231 1231 a, g dbSNP:769250170
1238 1238 c, t dbSNP:747675386
1239 1239 a, g dbSNP:781035304
1245 1245 c, t dbSNP:754710935
1248 1248 a, c dbSNP:373977390
1254 1254 g, t dbSNP:780010668
1261 1261 a, g dbSNP:200693409
1266 1266 c, t dbSNP:750394475
1269 1269 c, t dbSNP:111258744
1273 1273 c, t dbSNP:78683075
1274 1274 a, g dbSNP:753948488
1278 1278 a, g dbSNP:186366202
1283 1283 c, t dbSNP:536249722
1284 1284 a, t dbSNP:113938514
1287 1287 a, g dbSNP:377261933
1289 1289 c, t dbSNP:759928360
1292 1292 a, c dbSNP:371401039
1293 1293 a, c, g, t dbSNP:150175875
1294 1294 a, g dbSNP:768225327
1303 1303 a, c dbSNP:747429545
1314 1314 a, g dbSNP:746664975
1316 1316 a, g dbSNP:779849453
1337 1337 a, g dbSNP:368778627
1339 1339 c, t dbSNP:751677461
1349 1349 c, t dbSNP:372304384
1350 1350 a, g dbSNP:140500421
1359 1359 c, g, t dbSNP:765807221
1360 1360 c, t dbSNP:762370059
1361 1361 a, g dbSNP:775085512
1362 1362 g, t dbSNP:771424902
1368 1368 a, c, g, t dbSNP:372342796
1377 1377 c, t dbSNP:749057444
1380 1380 a, g dbSNP:777731843
1383 1383 a, g dbSNP:769758699
1387 1387 -, tg dbSNP:398124539
1391 1391 c, t dbSNP:748031634
1392 1392 a, g, t dbSNP:146801028
1395 1395 c, t dbSNP:751877389
1400 1400 a, g dbSNP:780125534
1403 1403 c, t dbSNP:758884167
1404 1404 c, t dbSNP:750848964
1410 1410 c, t dbSNP:765647841
1412 1412 -, tcca dbSNP:771374314
1425 1425 a, c, t dbSNP:367562964
1426 1426 a, g dbSNP:767119281
1431 1431 c, t dbSNP:767527483
1432 1432 c, t dbSNP:759503601
1446 1446 a, g dbSNP:774591810
1448 1448 -, aaag dbSNP:398124541
1448 1448 a, g dbSNP:770988236
1453 1453 g, t dbSNP:763092545
1464 1464 -, t dbSNP:757111995
1466 1466 a, g dbSNP:773482946
1473 1473 a, g dbSNP:551034228
1486 1486 a, g dbSNP:748491270
1489 1489 c, t dbSNP:140246224
1491 1491 c, t dbSNP:769183979
1497 1497 a, g dbSNP:558365108
1499 1499 a, c dbSNP:747467294
1501 1501 g, t dbSNP:587781952
1507 1507 a, g dbSNP:147142086
1510 1510 a, g dbSNP:756787389
1512 1512 -, agcccctgtgttgccagagagtacagaa dbSNP:398124542
1513 1513 c, g dbSNP:753491072
1516 1516 c, t dbSNP:777456756
1517 1517 a, g dbSNP:143483053
1529 1529 a, c, g dbSNP:767368450
1533 1533 c, t dbSNP:530884373
1534 1534 c, t dbSNP:751478971
1535 1535 c, t dbSNP:138031155
1539 1539 a, g dbSNP:763078516
1542 1542 a, g dbSNP:773355729
1544 1544 c, t dbSNP:770027312
1548 1548 c, t dbSNP:761984486
1550 1550 c, t dbSNP:202215080
1551 1551 c, t dbSNP:768940625
1560 1560 c, t dbSNP:747579747
1562 1562 a, g dbSNP:780597146
1579 1579 c, t dbSNP:770396757
1580 1580 a, g dbSNP:375352888
1584 1584 c, g dbSNP:777103374
1593 1593 c, g dbSNP:755850825
1598 1598 a, g dbSNP:752337482
1602 1602 c, t dbSNP:200224064
1607 1607 a, g dbSNP:190786280
1617 1617 a, g dbSNP:751513488
1618 1618 c, t dbSNP:398124523
1624 1624 c, g dbSNP:757313788
1626 1626 g, t dbSNP:534904034
1633 1633 c, t dbSNP:184718358
1642 1642 c, t dbSNP:557336321
1643 1643 g, t dbSNP:559055296
1660 1660 a, g dbSNP:767714543
1665 1665 c, t dbSNP:786202175
1667 1667 c, t dbSNP:200877872
1675 1675 a, c, t dbSNP:398124524
1691 1691 a, g dbSNP:769489773
1693 1693 a, g dbSNP:747644007
1696 1696 c, g dbSNP:776467886
1698 1698 c, t dbSNP:768454196
1707 1707 c, t dbSNP:150752548
1708 1708 a, g dbSNP:779913370
1712 1712 a, t dbSNP:758063582
1713 1713 g, t dbSNP:141250189
1733 1733 a, g dbSNP:570066243
1737 1737 a, c dbSNP:755413587
1737 1737 -, c dbSNP:398124525
1747 1747 a, g dbSNP:752006809
1751 1751 c, g dbSNP:766801011
1752 1752 c, t dbSNP:763569367
1755 1755 c, t dbSNP:750894316
1756 1756 a, g, t dbSNP:148257120
1757 1757 c, t dbSNP:760079073
1759 1759 c, t dbSNP:143183215
1760 1760 a, g dbSNP:771653740
1761 1761 -, c dbSNP:398124526
1773 1773 c, g dbSNP:786202541
1774 1774 a, g dbSNP:528541881
1782 1782 g, t dbSNP:774142829
1785 1785 c, t dbSNP:561236067
1786 1786 a, g dbSNP:763591386
1788 1788 a, g dbSNP:749287631
1791 1791 a, g dbSNP:61750032
1794 1794 c, t dbSNP:769968368
1800 1800 g, t dbSNP:376836624
1803 1803 c, t dbSNP:748148728
1805 1805 a, g dbSNP:781295687
1813 1813 a, g dbSNP:527859185
1814 1814 g, t dbSNP:755177473
1815 1815 a, g dbSNP:747171802
1818 1818 c, t dbSNP:780571501
1820 1820 a, g dbSNP:368175757
1823 1823 c, t dbSNP:565447853
1824 1824 a, g dbSNP:751013842
1825 1825 c, t dbSNP:765628527
1827 1827 c, t dbSNP:41464156
1829 1829 c, t dbSNP:752170592
1832 1832 a, g dbSNP:786203348
1835 1835 c, t dbSNP:766990565
1836 1836 c, t dbSNP:41459448
1837 1837 a, c dbSNP:773986076
1838 1838 a, c dbSNP:766218250
1839 1839 c, g dbSNP:372207262
1840 1840 c, g dbSNP:368880414
1841 1841 a, c, g, t dbSNP:199889477
1843 1843 -, c dbSNP:80338682
1843 1843 a, c, t dbSNP:375082054
1843 1843 -, c dbSNP:80338683
1845 1845 c, t dbSNP:374707789
1850 1850 c, t dbSNP:758871984
1854 1854 -, ctc dbSNP:763354508
1863 1863 -, t dbSNP:398124527
1866 1866 g, t dbSNP:775722367
1867 1867 a, c, g dbSNP:772207015
1870 1870 a, t dbSNP:759743111
1872 1872 a, c, t dbSNP:771247255
1873 1873 a, g dbSNP:112980409
1884 1884 c, t dbSNP:145004158
1885 1885 a, g dbSNP:535236784
1890 1890 a, c, t dbSNP:141283741
1891 1891 a, g dbSNP:41419545
1894 1894 c, t dbSNP:200724468
1895 1895 a, g dbSNP:750104212
1896 1896 c, t dbSNP:569587785
1908 1908 a, c, t dbSNP:753685944
1912 1912 a, g dbSNP:763920904
1914 1914 a, g dbSNP:760690745
1917 1917 a, g dbSNP:752677061
1918 1918 c, t dbSNP:767762804
1921 1921 a, g dbSNP:759637055
1922 1922 a, g dbSNP:199786696
1931 1931 a, g dbSNP:150439088
1934 1934 c, t dbSNP:377468280
1937 1937 c, t dbSNP:112196863
1938 1938 c, t dbSNP:773581294
1941 1941 c, t dbSNP:772310968
1945 1945 c, t dbSNP:770077517
1947 1947 c, g, t dbSNP:137852929
1962 1962 c, t dbSNP:777113065
1972 1972 c, g dbSNP:151312899
1976 1976 c, t dbSNP:144883828
1977 1977 a, c dbSNP:141036419
1986 1986 c, g dbSNP:756944795
1988 1988 a, g dbSNP:748878853
1990 1990 c, g dbSNP:777774091
1997 1997 c, t dbSNP:745720578
2000 2000 c, g dbSNP:781081891
2016 2016 -, ataagatt dbSNP:757197845
2017 2017 g, t dbSNP:786202475
2021 2021 c, t dbSNP:200660337
2022 2022 a, g dbSNP:747029882
2023 2023 a, g dbSNP:757222242
2034 2034 c, t dbSNP:779837933
2037 2037 a, g dbSNP:758516602
2045 2045 c, g dbSNP:750535468
2066 2066 c, g dbSNP:778904029
2070 2070 c, t dbSNP:757471403
2071 2071 a, g dbSNP:376715412
2080 2080 -, aag dbSNP:398124529
2081 2081 a, g dbSNP:199643834
2088 2088 a, g dbSNP:531459106
2091 2091 a, g dbSNP:398124530
2117 2117 a, g dbSNP:142288285
2137 2137 -, a dbSNP:753009073
2138 2138 a, g dbSNP:777826268
2148 2148 c, g dbSNP:756318617
2152 2152 a, c dbSNP:753023144
2155 2155 c, t dbSNP:398124532
2157 2157 c, g dbSNP:190965235
2178 2178 c, t dbSNP:755548579
2179 2179 a, g dbSNP:752108683
2180 2180 c, t dbSNP:764899882
2181 2181 a, g dbSNP:185419942
2185 2185 a, g dbSNP:776389684
2190 2190 a, g dbSNP:763688092
2193 2193 c, g dbSNP:760329266
2195 2195 a, g dbSNP:775149348
2202 2202 c, g dbSNP:771847652
2211 2211 a, g dbSNP:745859406
2225 2225 -, a dbSNP:767479616
2225 2225 c, g dbSNP:774247151
2235 2235 a, g dbSNP:771038343
2243 2243 a, g dbSNP:749359334
2250 2250 c, t dbSNP:201810397
2255 2255 c, t dbSNP:756302545
2260 2260 a, g dbSNP:748337450
2261 2261 c, t dbSNP:781733528
2262 2262 a, g dbSNP:147554296
2266 2266 c, t dbSNP:752161850
2267 2267 a, g dbSNP:201056799
2275 2275 a, t dbSNP:758901704
2276 2276 c, t dbSNP:753313171
2282 2282 c, t dbSNP:763604691
2283 2283 a, g dbSNP:760307957
2290 2290 c, t dbSNP:775107483
2295 2295 c, t dbSNP:767345167
2299 2299 c, t dbSNP:759292330
2301 2301 c, t dbSNP:774091922
2302 2302 a, g dbSNP:770795599
2306 2306 a, c, t dbSNP:773168989
2312 2312 a, c, t dbSNP:748379299
2315 2315 g, t dbSNP:115885284
2316 2316 c, t dbSNP:370269600
2328 2328 a, g dbSNP:747413239
2330 2330 c, t dbSNP:780520253
2333 2333 c, t dbSNP:149134801
2340 2340 c, t dbSNP:750934121
2349 2349 c, t dbSNP:777203555
2351 2351 a, t dbSNP:111861140
2356 2356 c, t dbSNP:535022712
2385 2385 a, c dbSNP:778606717
2386 2386 a, g dbSNP:754626617
2389 2389 g, t dbSNP:564383830
2476 2476 a, g dbSNP:145430714
2491 2491 a, g dbSNP:144507152
2496 2496 a, c dbSNP:771890381
2518 2518 a, t dbSNP:541599658
2521 2521 c, t dbSNP:76272341
2522 2522 a, g dbSNP:541003301
2551 2551 a, g dbSNP:774288275
2553 2553 c, g dbSNP:564245440
2566 2566 c, t dbSNP:180873537
2619 2619 c, t dbSNP:139734855
2621 2621 a, g dbSNP:571999061
2631 2631 c, t dbSNP:750896108
2642 2642 c, g dbSNP:554190238
2654 2654 g, t dbSNP:7224474
2677 2677 a, g dbSNP:117436649
2691 2691 a, g dbSNP:12602675
2701 2701 c, t dbSNP:188840802
2723 2723 a, g dbSNP:7224335
2740 2740 c, t dbSNP:7224213
2778 2778 a, c dbSNP:146851795
2780 2780 a, c dbSNP:574471240
2794 2794 -, gtga dbSNP:778371655
2808 2808 g, t dbSNP:537259057
2824 2824 c, t dbSNP:574547835
2826 2826 a, g dbSNP:184006653
2838 2838 g, t dbSNP:181935335
2855 2855 c, t dbSNP:3803761
2878 2878 c, t dbSNP:566100851
2932 2932 a, c dbSNP:199572622
2936 2936 c, t dbSNP:780240981
2978 2978 a, g dbSNP:539709518
2993 2993 c, t dbSNP:775700421
3012 3012 a, c dbSNP:189888135
3015 3015 a, t dbSNP:550746288
3037 3037 c, t dbSNP:558952732
3039 3039 c, g dbSNP:530771625
3084 3084 a, g dbSNP:143768653
3092 3092 a, g dbSNP:139529824
3119 3119 a, g dbSNP:770643935
3126 3126 g, t dbSNP:750900491
3148 3148 c, g dbSNP:185759963
3149 3149 -, c dbSNP:748168795
3209 3209 a, g dbSNP:571893996
3212 3212 c, t dbSNP:7223831
3254 3254 a, g dbSNP:141650706
3299 3299 a, g dbSNP:532627636
3333 3333 c, t dbSNP:566019526
3343 3343 a, g dbSNP:563644388
3360 3360 a, g dbSNP:771952210
3399 3399 c, t dbSNP:543608114
3413 3413 a, g dbSNP:574733214
3449 3449 c, t dbSNP:62064407
3451 3451 -, tttt dbSNP:397932764
3477 3477 a, t dbSNP:540609895
3480 3480 -, a dbSNP:199535675
3532 3532 a, g dbSNP:747663295
3542 3542 c, t dbSNP:554751440
3544 3544 c, g dbSNP:541543491
3587 3587 a, g dbSNP:572462992
3596 3596 c, t dbSNP:558869941
3634 3634 g, t dbSNP:7218992
3650 3650 g, t dbSNP:11654407
3664 3664 a, g dbSNP:754539748
3688 3688 c, g dbSNP:570755484
3691 3691 a, g dbSNP:557330837
3701 3701 c, t dbSNP:7218795
3710 3710 a, g dbSNP:568272777

Target ORF information:

RefSeq Version XM_011523714
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu77698D
Sequence Information ORF Nucleotide Sequence (Length: 1794bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product folliculin isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010718.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1558..2103(+)
Position Chain Variation Link
18 18 c, g dbSNP:1736209
24 24 a, g dbSNP:207476321
25 25 c, g dbSNP:564584154
37 37 a, c dbSNP:207476320
39 39 c, t dbSNP:575905361
53 53 a, c dbSNP:562310783
60 60 a, g dbSNP:542327641
74 74 c, t dbSNP:138847774
75 75 c, t dbSNP:553452028
78 78 a, g dbSNP:539415254
130 130 c, t dbSNP:577176265
164 164 g, t dbSNP:528481171
167 167 c, g dbSNP:557719136
168 168 a, g dbSNP:537792180
187 187 c, t dbSNP:180900492
203 203 a, g dbSNP:41345949
205 205 c, g dbSNP:548796445
206 206 c, t dbSNP:1708629
221 221 c, g dbSNP:78262456
223 223 c, g dbSNP:78918950
225 225 g, t dbSNP:75014442
248 248 a, g dbSNP:370286675
276 276 -, ggtaggcgggggtctgagg dbSNP:370486376
329 329 a, g dbSNP:117215381
362 362 a, c, t dbSNP:560968516
364 364 g, t dbSNP:541105214
371 371 c, t dbSNP:116581458
408 408 c, t dbSNP:114481741
412 412 c, t dbSNP:115413827
413 413 a, g dbSNP:756416340
415 415 a, g dbSNP:8069957
426 426 a, g dbSNP:535864585
427 427 c, g dbSNP:147598893
440 440 a, g dbSNP:145125741
447 447 c, t dbSNP:140144170
460 460 a, g dbSNP:571154058
476 476 a, g dbSNP:151144873
498 498 c, t dbSNP:1736215
528 528 a, g dbSNP:117827241
534 534 c, t dbSNP:79717038
544 544 c, t dbSNP:758047209
573 573 c, g dbSNP:528401271
611 611 c, t dbSNP:753086978
616 616 c, t dbSNP:533687652
666 666 c, g dbSNP:545983207
686 686 c, g dbSNP:116438960
691 691 -, ctc dbSNP:528431686
699 699 -, a dbSNP:572591896
708 708 a, g dbSNP:555731464
745 745 -, c dbSNP:559377745
749 749 a, g dbSNP:543198678
752 752 c, g dbSNP:574363104
769 769 a, c dbSNP:146246174
784 784 a, g dbSNP:541043827
790 790 c, t dbSNP:572369766
791 791 a, t dbSNP:558834443
793 793 -, cc dbSNP:540656367
797 797 g, t dbSNP:538804082
799 799 -, gtat dbSNP:375495673
800 800 -, cc dbSNP:200365194
801 801 c, t dbSNP:112002657
830 830 a, g dbSNP:569964752
831 831 a, g dbSNP:1708618
841 841 a, g dbSNP:185401594
843 843 g, t dbSNP:766570505
844 844 a, g dbSNP:763224453
860 860 a, g dbSNP:181549149
874 874 a, g dbSNP:760682564
881 881 c, t dbSNP:532847715
924 924 a, g dbSNP:142149319
940 940 c, t dbSNP:750557906
943 943 c, t dbSNP:565937473
959 959 a, g dbSNP:761981111
982 982 a, g dbSNP:75336342
986 986 c, t dbSNP:532342547
1011 1011 c, t dbSNP:563376820
1055 1055 c, t dbSNP:543487724
1059 1059 a, g dbSNP:529727139
1085 1085 a, g dbSNP:561055780
1121 1121 a, g dbSNP:761617653
1143 1143 c, t dbSNP:540630142
1145 1145 a, c dbSNP:571710524
1185 1185 a, g dbSNP:764888176
1186 1186 c, t dbSNP:759415328
1187 1187 a, t dbSNP:565505709
1194 1194 a, g dbSNP:545337155
1198 1198 a, c dbSNP:780421535
1219 1219 a, g dbSNP:776640058
1220 1220 c, t dbSNP:758705818
1221 1221 g, t dbSNP:746381939
1223 1223 -, g dbSNP:35936022
1237 1237 c, t dbSNP:779391001
1241 1241 a, g dbSNP:369632481
1260 1260 c, t dbSNP:752123350
1261 1261 a, g dbSNP:767235709
1281 1281 c, t dbSNP:754616167
1282 1282 a, g dbSNP:751171641
1290 1290 c, t dbSNP:766288960
1291 1291 a, g dbSNP:539468848
1293 1293 c, t dbSNP:773349151
1297 1297 -, c dbSNP:758385503
1297 1297 c, t dbSNP:765251703
1298 1298 c, g dbSNP:398124537
1300 1300 a, g dbSNP:761993256
1308 1308 c, t dbSNP:776605909
1313 1313 c, t dbSNP:768734584
1314 1314 a, g dbSNP:747210367
1318 1318 g, t dbSNP:775626774
1323 1323 a, g dbSNP:200350612
1326 1326 c, t dbSNP:746222481
1327 1327 a, g dbSNP:779449668
1328 1328 c, t dbSNP:757670898
1330 1330 c, t dbSNP:749758787
1331 1331 -, c dbSNP:398124540
1331 1331 c, g dbSNP:780588085
1332 1332 a, g dbSNP:754450145
1334 1334 c, t dbSNP:150051278
1338 1338 c, t dbSNP:766122649
1341 1341 a, g dbSNP:758326533
1342 1342 c, g dbSNP:750221380
1343 1343 a, g dbSNP:587778366
1345 1345 c, g dbSNP:386833401
1347 1347 a, t dbSNP:375348725
1361 1361 g, t dbSNP:139418842
1377 1377 c, g dbSNP:760808366
1382 1382 c, g, t dbSNP:556510460
1383 1383 a, g dbSNP:759930161
1387 1387 c, g dbSNP:369115472
1406 1406 a, g dbSNP:771056209
1416 1416 c, t dbSNP:774725046
1417 1417 c, t dbSNP:746507528
1418 1418 a, g dbSNP:749770193
1423 1423 c, t dbSNP:778275358
1424 1424 a, g, t dbSNP:374969279
1427 1427 c, t dbSNP:779900587
1429 1429 c, g dbSNP:758156813
1437 1437 c, t dbSNP:750047828
1438 1438 a, g dbSNP:778587763
1442 1442 a, c dbSNP:757012294
1445 1445 a, g dbSNP:753787458
1449 1449 c, g dbSNP:764082089
1450 1450 a, g dbSNP:587778365
1452 1452 c, t dbSNP:371947198
1453 1453 a, g dbSNP:567617762
1455 1455 c, t dbSNP:759772780
1456 1456 a, g dbSNP:554247745
1458 1458 a, g dbSNP:771202158
1459 1459 c, t dbSNP:763369657
1469 1469 c, t dbSNP:773648142
1470 1470 a, g dbSNP:770311645
1478 1478 a, c dbSNP:746556970
1483 1483 -, tcgg dbSNP:750146811
1483 1483 g, t dbSNP:779733014
1484 1484 c, g dbSNP:137852930
1485 1485 a, g dbSNP:771650940
1489 1489 a, g dbSNP:745521431
1494 1494 c, t dbSNP:150712346
1495 1495 a, g dbSNP:757060348
1505 1505 a, g dbSNP:765550303
1516 1516 g, t dbSNP:141140415
1519 1519 a, g dbSNP:781100382
1522 1522 c, t dbSNP:755107067
1523 1523 a, g dbSNP:751634275
1526 1526 c, t dbSNP:766548696
1527 1527 a, g dbSNP:138688941
1530 1530 a, g dbSNP:750553308
1544 1544 -, a dbSNP:398124534
1553 1553 a, c dbSNP:765702734
1554 1554 c, t dbSNP:762265819
1556 1556 a, c dbSNP:777336970
1559 1559 c, t dbSNP:764679174
1563 1563 a, g dbSNP:759011359
1566 1566 c, t dbSNP:773946854
1567 1567 cac, gt dbSNP:398124535
1594 1594 a, c, t dbSNP:398124536
1595 1595 -, a dbSNP:776896550
1613 1613 c, g dbSNP:748979393
1683 1683 c, t dbSNP:140220661
1690 1690 a, t dbSNP:752261491
1697 1697 a, g dbSNP:539457096
1704 1704 c, t dbSNP:756563416
1723 1723 a, g dbSNP:375921200
1729 1729 -, ttc dbSNP:764153620
1731 1731 c, t dbSNP:773792624
1732 1732 a, g dbSNP:372918705
1746 1746 c, t dbSNP:376825814
1747 1747 a, g dbSNP:752014050
1748 1748 -, g dbSNP:727504645
1752 1752 c, t dbSNP:200672897
1753 1753 a, g dbSNP:147164515
1754 1754 c, t dbSNP:373794943
1758 1758 c, t dbSNP:763630763
1771 1771 -, ttc dbSNP:786203218
1784 1784 a, g dbSNP:760556162
1791 1791 a, c dbSNP:775176038
1797 1797 c, t dbSNP:767290984
1801 1801 c, t dbSNP:587782069
1803 1803 c, g dbSNP:772775816
1804 1804 c, t dbSNP:587778367
1805 1805 a, g dbSNP:759556434
1837 1837 c, t dbSNP:774358971
1838 1838 g, t dbSNP:369906553
1840 1840 a, c dbSNP:771205573
1846 1846 c, t dbSNP:749368513
1848 1848 c, t dbSNP:773535830
1854 1854 a, c dbSNP:143525924
1857 1857 c, t dbSNP:748363919
1867 1867 c, t dbSNP:781433539
1869 1869 a, g dbSNP:755278796
1871 1871 -, g dbSNP:34867548
1873 1873 a, g dbSNP:747581757
1882 1882 c, t dbSNP:138070947
1883 1883 a, g dbSNP:756807584
1888 1888 a, g dbSNP:201078144
1893 1893 c, t dbSNP:763617124
1894 1894 a, c, g dbSNP:200168437
1905 1905 c, g, t dbSNP:759405317
1906 1906 a, g dbSNP:774491699
1912 1912 gc, ta dbSNP:398124538
1913 1913 c, t dbSNP:766401197
1914 1914 a, g dbSNP:763168749
1936 1936 a, c dbSNP:558699420
1946 1946 a, g dbSNP:370074267
1947 1947 c, t dbSNP:772360950
1949 1949 -, c dbSNP:772407910
1955 1955 a, g dbSNP:367843558
1970 1970 a, g dbSNP:779467022
1975 1975 a, g dbSNP:769250170
1982 1982 c, t dbSNP:747675386
1983 1983 a, g dbSNP:781035304
1989 1989 c, t dbSNP:754710935
1992 1992 a, c dbSNP:373977390
1998 1998 g, t dbSNP:780010668
2005 2005 a, g dbSNP:200693409
2010 2010 c, t dbSNP:750394475
2013 2013 c, t dbSNP:111258744
2017 2017 c, t dbSNP:78683075
2018 2018 a, g dbSNP:753948488
2022 2022 a, g dbSNP:186366202
2027 2027 c, t dbSNP:536249722
2028 2028 a, t dbSNP:113938514
2031 2031 a, g dbSNP:377261933
2033 2033 c, t dbSNP:759928360
2036 2036 a, c dbSNP:371401039
2037 2037 a, c, g, t dbSNP:150175875
2038 2038 a, g dbSNP:768225327
2047 2047 a, c dbSNP:747429545
2058 2058 a, g dbSNP:746664975
2060 2060 a, g dbSNP:779849453
2081 2081 a, g dbSNP:368778627
2083 2083 c, t dbSNP:751677461
2093 2093 c, t dbSNP:372304384
2094 2094 a, g dbSNP:140500421
2103 2103 c, g, t dbSNP:765807221
2104 2104 c, t dbSNP:762370059
2105 2105 a, g dbSNP:775085512
2106 2106 g, t dbSNP:771424902
2112 2112 a, c, g, t dbSNP:372342796
2121 2121 c, t dbSNP:749057444
2124 2124 a, g dbSNP:777731843
2127 2127 a, g dbSNP:769758699
2131 2131 -, tg dbSNP:398124539
2135 2135 c, t dbSNP:748031634
2136 2136 a, g, t dbSNP:146801028
2139 2139 c, t dbSNP:751877389
2144 2144 a, g dbSNP:780125534
2147 2147 c, t dbSNP:758884167
2148 2148 c, t dbSNP:750848964
2154 2154 c, t dbSNP:765647841
2156 2156 -, tcca dbSNP:771374314
2169 2169 a, c, t dbSNP:367562964
2170 2170 a, g dbSNP:767119281
2175 2175 c, t dbSNP:767527483
2176 2176 c, t dbSNP:759503601
2190 2190 a, g dbSNP:774591810
2192 2192 -, aaag dbSNP:398124541
2192 2192 a, g dbSNP:770988236
2197 2197 g, t dbSNP:763092545
2208 2208 -, t dbSNP:757111995
2210 2210 a, g dbSNP:773482946
2217 2217 a, g dbSNP:551034228
2230 2230 a, g dbSNP:748491270
2233 2233 c, t dbSNP:140246224
2235 2235 c, t dbSNP:769183979
2241 2241 a, g dbSNP:558365108
2243 2243 a, c dbSNP:747467294
2245 2245 g, t dbSNP:587781952
2251 2251 a, g dbSNP:147142086
2254 2254 a, g dbSNP:756787389
2256 2256 -, agcccctgtgttgccagagagtacagaa dbSNP:398124542
2257 2257 c, g dbSNP:753491072
2260 2260 c, t dbSNP:777456756
2261 2261 a, g dbSNP:143483053
2273 2273 a, c, g dbSNP:767368450
2277 2277 c, t dbSNP:530884373
2278 2278 c, t dbSNP:751478971
2279 2279 c, t dbSNP:138031155
2283 2283 a, g dbSNP:763078516
2286 2286 a, g dbSNP:773355729
2288 2288 c, t dbSNP:770027312
2292 2292 c, t dbSNP:761984486
2294 2294 c, t dbSNP:202215080
2295 2295 c, t dbSNP:768940625
2304 2304 c, t dbSNP:747579747
2306 2306 a, g dbSNP:780597146
2323 2323 c, t dbSNP:770396757
2324 2324 a, g dbSNP:375352888
2328 2328 c, g dbSNP:777103374
2337 2337 c, g dbSNP:755850825
2342 2342 a, g dbSNP:752337482
2346 2346 c, t dbSNP:200224064
2351 2351 a, g dbSNP:190786280
2361 2361 a, g dbSNP:751513488
2362 2362 c, t dbSNP:398124523
2368 2368 c, g dbSNP:757313788
2370 2370 g, t dbSNP:534904034
2377 2377 c, t dbSNP:184718358
2386 2386 c, t dbSNP:557336321
2387 2387 g, t dbSNP:559055296
2404 2404 a, g dbSNP:767714543
2409 2409 c, t dbSNP:786202175
2411 2411 c, t dbSNP:200877872
2419 2419 a, c, t dbSNP:398124524
2435 2435 a, g dbSNP:769489773
2437 2437 a, g dbSNP:747644007
2440 2440 c, g dbSNP:776467886
2442 2442 c, t dbSNP:768454196
2451 2451 c, t dbSNP:150752548
2452 2452 a, g dbSNP:779913370
2456 2456 a, t dbSNP:758063582
2457 2457 g, t dbSNP:141250189
2477 2477 a, g dbSNP:570066243
2481 2481 a, c dbSNP:755413587
2481 2481 -, c dbSNP:398124525
2491 2491 a, g dbSNP:752006809
2495 2495 c, g dbSNP:766801011
2496 2496 c, t dbSNP:763569367
2499 2499 c, t dbSNP:750894316
2500 2500 a, g, t dbSNP:148257120
2501 2501 c, t dbSNP:760079073
2503 2503 c, t dbSNP:143183215
2504 2504 a, g dbSNP:771653740
2505 2505 -, c dbSNP:398124526
2517 2517 c, g dbSNP:786202541
2518 2518 a, g dbSNP:528541881
2526 2526 g, t dbSNP:774142829
2529 2529 c, t dbSNP:561236067
2530 2530 a, g dbSNP:763591386
2532 2532 a, g dbSNP:749287631
2535 2535 a, g dbSNP:61750032
2538 2538 c, t dbSNP:769968368
2544 2544 g, t dbSNP:376836624
2547 2547 c, t dbSNP:748148728
2549 2549 a, g dbSNP:781295687
2557 2557 a, g dbSNP:527859185
2558 2558 g, t dbSNP:755177473
2559 2559 a, g dbSNP:747171802
2562 2562 c, t dbSNP:780571501
2564 2564 a, g dbSNP:368175757
2567 2567 c, t dbSNP:565447853
2568 2568 a, g dbSNP:751013842
2569 2569 c, t dbSNP:765628527
2571 2571 c, t dbSNP:41464156
2573 2573 c, t dbSNP:752170592
2576 2576 a, g dbSNP:786203348
2579 2579 c, t dbSNP:766990565
2580 2580 c, t dbSNP:41459448
2581 2581 a, c dbSNP:773986076
2582 2582 a, c dbSNP:766218250
2583 2583 c, g dbSNP:372207262
2584 2584 c, g dbSNP:368880414
2585 2585 a, c, g, t dbSNP:199889477
2587 2587 -, c dbSNP:80338682
2587 2587 a, c, t dbSNP:375082054
2587 2587 -, c dbSNP:80338683
2589 2589 c, t dbSNP:374707789
2594 2594 c, t dbSNP:758871984
2598 2598 -, ctc dbSNP:763354508
2607 2607 -, t dbSNP:398124527
2610 2610 g, t dbSNP:775722367
2611 2611 a, c, g dbSNP:772207015
2614 2614 a, t dbSNP:759743111
2616 2616 a, c, t dbSNP:771247255
2617 2617 a, g dbSNP:112980409
2628 2628 c, t dbSNP:145004158
2629 2629 a, g dbSNP:535236784
2634 2634 a, c, t dbSNP:141283741
2635 2635 a, g dbSNP:41419545
2638 2638 c, t dbSNP:200724468
2639 2639 a, g dbSNP:750104212
2640 2640 c, t dbSNP:569587785
2652 2652 a, c, t dbSNP:753685944
2656 2656 a, g dbSNP:763920904
2658 2658 a, g dbSNP:760690745
2661 2661 a, g dbSNP:752677061
2662 2662 c, t dbSNP:767762804
2665 2665 a, g dbSNP:759637055
2666 2666 a, g dbSNP:199786696
2675 2675 a, g dbSNP:150439088
2678 2678 c, t dbSNP:377468280
2681 2681 c, t dbSNP:112196863
2682 2682 c, t dbSNP:773581294
2685 2685 c, t dbSNP:772310968
2689 2689 c, t dbSNP:770077517
2691 2691 c, g, t dbSNP:137852929
2706 2706 c, t dbSNP:777113065
2716 2716 c, g dbSNP:151312899
2720 2720 c, t dbSNP:144883828
2721 2721 a, c dbSNP:141036419
2730 2730 c, g dbSNP:756944795
2732 2732 a, g dbSNP:748878853
2734 2734 c, g dbSNP:777774091
2741 2741 c, t dbSNP:745720578
2744 2744 c, g dbSNP:781081891
2760 2760 -, ataagatt dbSNP:757197845
2761 2761 g, t dbSNP:786202475
2765 2765 c, t dbSNP:200660337
2766 2766 a, g dbSNP:747029882
2767 2767 a, g dbSNP:757222242
2778 2778 c, t dbSNP:779837933
2781 2781 a, g dbSNP:758516602
2789 2789 c, g dbSNP:750535468
2810 2810 c, g dbSNP:778904029
2814 2814 c, t dbSNP:757471403
2815 2815 a, g dbSNP:376715412
2824 2824 -, aag dbSNP:398124529
2825 2825 a, g dbSNP:199643834
2832 2832 a, g dbSNP:531459106
2835 2835 a, g dbSNP:398124530
2861 2861 a, g dbSNP:142288285
2881 2881 -, a dbSNP:753009073
2882 2882 a, g dbSNP:777826268
2892 2892 c, g dbSNP:756318617
2896 2896 a, c dbSNP:753023144
2899 2899 c, t dbSNP:398124532
2901 2901 c, g dbSNP:190965235
2922 2922 c, t dbSNP:755548579
2923 2923 a, g dbSNP:752108683
2924 2924 c, t dbSNP:764899882
2925 2925 a, g dbSNP:185419942
2929 2929 a, g dbSNP:776389684
2934 2934 a, g dbSNP:763688092
2937 2937 c, g dbSNP:760329266
2939 2939 a, g dbSNP:775149348
2946 2946 c, g dbSNP:771847652
2955 2955 a, g dbSNP:745859406
2969 2969 -, a dbSNP:767479616
2969 2969 c, g dbSNP:774247151
2979 2979 a, g dbSNP:771038343
2987 2987 a, g dbSNP:749359334
2994 2994 c, t dbSNP:201810397
2999 2999 c, t dbSNP:756302545
3004 3004 a, g dbSNP:748337450
3005 3005 c, t dbSNP:781733528
3006 3006 a, g dbSNP:147554296
3010 3010 c, t dbSNP:752161850
3011 3011 a, g dbSNP:201056799
3019 3019 a, t dbSNP:758901704
3020 3020 c, t dbSNP:753313171
3026 3026 c, t dbSNP:763604691
3027 3027 a, g dbSNP:760307957
3034 3034 c, t dbSNP:775107483
3039 3039 c, t dbSNP:767345167
3043 3043 c, t dbSNP:759292330
3045 3045 c, t dbSNP:774091922
3046 3046 a, g dbSNP:770795599
3050 3050 a, c, t dbSNP:773168989
3056 3056 a, c, t dbSNP:748379299
3059 3059 g, t dbSNP:115885284
3060 3060 c, t dbSNP:370269600
3072 3072 a, g dbSNP:747413239
3074 3074 c, t dbSNP:780520253
3077 3077 c, t dbSNP:149134801
3084 3084 c, t dbSNP:750934121
3093 3093 c, t dbSNP:777203555
3095 3095 a, t dbSNP:111861140
3100 3100 c, t dbSNP:535022712
3129 3129 a, c dbSNP:778606717
3130 3130 a, g dbSNP:754626617
3133 3133 g, t dbSNP:564383830
3220 3220 a, g dbSNP:145430714
3235 3235 a, g dbSNP:144507152
3240 3240 a, c dbSNP:771890381
3262 3262 a, t dbSNP:541599658
3265 3265 c, t dbSNP:76272341
3266 3266 a, g dbSNP:541003301
3295 3295 a, g dbSNP:774288275
3297 3297 c, g dbSNP:564245440
3310 3310 c, t dbSNP:180873537
3363 3363 c, t dbSNP:139734855
3365 3365 a, g dbSNP:571999061
3375 3375 c, t dbSNP:750896108
3386 3386 c, g dbSNP:554190238
3398 3398 g, t dbSNP:7224474
3421 3421 a, g dbSNP:117436649
3435 3435 a, g dbSNP:12602675
3445 3445 c, t dbSNP:188840802
3467 3467 a, g dbSNP:7224335
3484 3484 c, t dbSNP:7224213
3522 3522 a, c dbSNP:146851795
3524 3524 a, c dbSNP:574471240
3538 3538 -, gtga dbSNP:778371655
3552 3552 g, t dbSNP:537259057
3568 3568 c, t dbSNP:574547835
3570 3570 a, g dbSNP:184006653
3582 3582 g, t dbSNP:181935335
3599 3599 c, t dbSNP:3803761
3622 3622 c, t dbSNP:566100851
3676 3676 a, c dbSNP:199572622
3680 3680 c, t dbSNP:780240981
3722 3722 a, g dbSNP:539709518
3737 3737 c, t dbSNP:775700421
3756 3756 a, c dbSNP:189888135
3759 3759 a, t dbSNP:550746288
3781 3781 c, t dbSNP:558952732
3783 3783 c, g dbSNP:530771625
3828 3828 a, g dbSNP:143768653
3836 3836 a, g dbSNP:139529824
3863 3863 a, g dbSNP:770643935
3870 3870 g, t dbSNP:750900491
3892 3892 c, g dbSNP:185759963
3893 3893 -, c dbSNP:748168795
3953 3953 a, g dbSNP:571893996
3956 3956 c, t dbSNP:7223831
3998 3998 a, g dbSNP:141650706
4043 4043 a, g dbSNP:532627636
4077 4077 c, t dbSNP:566019526
4087 4087 a, g dbSNP:563644388
4104 4104 a, g dbSNP:771952210
4143 4143 c, t dbSNP:543608114
4157 4157 a, g dbSNP:574733214
4193 4193 c, t dbSNP:62064407
4195 4195 -, tttt dbSNP:397932764
4221 4221 a, t dbSNP:540609895
4224 4224 -, a dbSNP:199535675
4276 4276 a, g dbSNP:747663295
4286 4286 c, t dbSNP:554751440
4288 4288 c, g dbSNP:541543491
4331 4331 a, g dbSNP:572462992
4340 4340 c, t dbSNP:558869941
4378 4378 g, t dbSNP:7218992
4394 4394 g, t dbSNP:11654407
4408 4408 a, g dbSNP:754539748
4432 4432 c, g dbSNP:570755484
4435 4435 a, g dbSNP:557330837
4445 4445 c, t dbSNP:7218795
4454 4454 a, g dbSNP:568272777

Target ORF information:

RefSeq Version XM_011523715
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu77698D
Sequence Information ORF Nucleotide Sequence (Length: 1794bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product folliculin isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010718.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1189..1734(+)
Position Chain Variation Link
13 13 c, t dbSNP:751203462
23 23 c, t dbSNP:777579858
33 33 a, g dbSNP:368564214
53 53 c, t dbSNP:191206646
54 54 a, g dbSNP:186399255
65 65 c, t dbSNP:563465500
77 77 c, t dbSNP:80273086
78 78 a, g dbSNP:530049762
82 82 c, t dbSNP:180910271
83 83 g, t dbSNP:189661839
99 99 g, t dbSNP:375397832
113 113 a, g dbSNP:73284571
134 134 c, t dbSNP:765764511
155 155 a, g dbSNP:559620125
174 174 c, t dbSNP:1708617
183 183 c, t dbSNP:186456499
186 186 c, t dbSNP:557108066
191 191 a, g dbSNP:766406776
193 193 c, g dbSNP:537007843
195 195 c, t dbSNP:181143663
238 238 a, c dbSNP:34282314
266 266 c, t dbSNP:555238346
282 282 c, t dbSNP:746597526
295 295 c, t dbSNP:576303605
301 301 a, g dbSNP:773367021
329 329 c, t dbSNP:772287296
336 336 c, g dbSNP:762793663
379 379 c, t dbSNP:565915341
380 380 a, g dbSNP:552325187
385 385 a, c, t dbSNP:569439458
397 397 c, t dbSNP:769739197
424 424 a, c dbSNP:189514467
459 459 c, g dbSNP:1736214
484 484 c, t dbSNP:781297160
539 539 -, c dbSNP:559823870
590 590 c, t dbSNP:1736215
620 620 a, g dbSNP:117827241
626 626 c, t dbSNP:79717038
636 636 c, t dbSNP:758047209
665 665 c, g dbSNP:528401271
703 703 c, t dbSNP:753086978
708 708 c, t dbSNP:533687652
758 758 c, g dbSNP:545983207
778 778 c, g dbSNP:116438960
783 783 -, ctc dbSNP:528431686
791 791 -, a dbSNP:572591896
800 800 a, g dbSNP:555731464
837 837 -, c dbSNP:559377745
841 841 a, g dbSNP:543198678
844 844 c, g dbSNP:574363104
868 868 c, t dbSNP:779391001
872 872 a, g dbSNP:369632481
891 891 c, t dbSNP:752123350
892 892 a, g dbSNP:767235709
912 912 c, t dbSNP:754616167
913 913 a, g dbSNP:751171641
921 921 c, t dbSNP:766288960
922 922 a, g dbSNP:539468848
924 924 c, t dbSNP:773349151
928 928 -, c dbSNP:758385503
928 928 c, t dbSNP:765251703
929 929 c, g dbSNP:398124537
931 931 a, g dbSNP:761993256
939 939 c, t dbSNP:776605909
944 944 c, t dbSNP:768734584
945 945 a, g dbSNP:747210367
949 949 g, t dbSNP:775626774
954 954 a, g dbSNP:200350612
957 957 c, t dbSNP:746222481
958 958 a, g dbSNP:779449668
959 959 c, t dbSNP:757670898
961 961 c, t dbSNP:749758787
962 962 -, c dbSNP:398124540
962 962 c, g dbSNP:780588085
963 963 a, g dbSNP:754450145
965 965 c, t dbSNP:150051278
969 969 c, t dbSNP:766122649
972 972 a, g dbSNP:758326533
973 973 c, g dbSNP:750221380
974 974 a, g dbSNP:587778366
976 976 c, g dbSNP:386833401
978 978 a, t dbSNP:375348725
992 992 g, t dbSNP:139418842
1008 1008 c, g dbSNP:760808366
1013 1013 c, g, t dbSNP:556510460
1014 1014 a, g dbSNP:759930161
1018 1018 c, g dbSNP:369115472
1037 1037 a, g dbSNP:771056209
1047 1047 c, t dbSNP:774725046
1048 1048 c, t dbSNP:746507528
1049 1049 a, g dbSNP:749770193
1054 1054 c, t dbSNP:778275358
1055 1055 a, g, t dbSNP:374969279
1058 1058 c, t dbSNP:779900587
1060 1060 c, g dbSNP:758156813
1068 1068 c, t dbSNP:750047828
1069 1069 a, g dbSNP:778587763
1073 1073 a, c dbSNP:757012294
1076 1076 a, g dbSNP:753787458
1080 1080 c, g dbSNP:764082089
1081 1081 a, g dbSNP:587778365
1083 1083 c, t dbSNP:371947198
1084 1084 a, g dbSNP:567617762
1086 1086 c, t dbSNP:759772780
1087 1087 a, g dbSNP:554247745
1089 1089 a, g dbSNP:771202158
1090 1090 c, t dbSNP:763369657
1100 1100 c, t dbSNP:773648142
1101 1101 a, g dbSNP:770311645
1109 1109 a, c dbSNP:746556970
1114 1114 -, tcgg dbSNP:750146811
1114 1114 g, t dbSNP:779733014
1115 1115 c, g dbSNP:137852930
1116 1116 a, g dbSNP:771650940
1120 1120 a, g dbSNP:745521431
1125 1125 c, t dbSNP:150712346
1126 1126 a, g dbSNP:757060348
1136 1136 a, g dbSNP:765550303
1147 1147 g, t dbSNP:141140415
1150 1150 a, g dbSNP:781100382
1153 1153 c, t dbSNP:755107067
1154 1154 a, g dbSNP:751634275
1157 1157 c, t dbSNP:766548696
1158 1158 a, g dbSNP:138688941
1161 1161 a, g dbSNP:750553308
1175 1175 -, a dbSNP:398124534
1184 1184 a, c dbSNP:765702734
1185 1185 c, t dbSNP:762265819
1187 1187 a, c dbSNP:777336970
1190 1190 c, t dbSNP:764679174
1194 1194 a, g dbSNP:759011359
1197 1197 c, t dbSNP:773946854
1198 1198 cac, gt dbSNP:398124535
1225 1225 a, c, t dbSNP:398124536
1226 1226 -, a dbSNP:776896550
1244 1244 c, g dbSNP:748979393
1314 1314 c, t dbSNP:140220661
1321 1321 a, t dbSNP:752261491
1328 1328 a, g dbSNP:539457096
1335 1335 c, t dbSNP:756563416
1354 1354 a, g dbSNP:375921200
1360 1360 -, ttc dbSNP:764153620
1362 1362 c, t dbSNP:773792624
1363 1363 a, g dbSNP:372918705
1377 1377 c, t dbSNP:376825814
1378 1378 a, g dbSNP:752014050
1379 1379 -, g dbSNP:727504645
1383 1383 c, t dbSNP:200672897
1384 1384 a, g dbSNP:147164515
1385 1385 c, t dbSNP:373794943
1389 1389 c, t dbSNP:763630763
1402 1402 -, ttc dbSNP:786203218
1415 1415 a, g dbSNP:760556162
1422 1422 a, c dbSNP:775176038
1428 1428 c, t dbSNP:767290984
1432 1432 c, t dbSNP:587782069
1434 1434 c, g dbSNP:772775816
1435 1435 c, t dbSNP:587778367
1436 1436 a, g dbSNP:759556434
1468 1468 c, t dbSNP:774358971
1469 1469 g, t dbSNP:369906553
1471 1471 a, c dbSNP:771205573
1477 1477 c, t dbSNP:749368513
1479 1479 c, t dbSNP:773535830
1485 1485 a, c dbSNP:143525924
1488 1488 c, t dbSNP:748363919
1498 1498 c, t dbSNP:781433539
1500 1500 a, g dbSNP:755278796
1502 1502 -, g dbSNP:34867548
1504 1504 a, g dbSNP:747581757
1513 1513 c, t dbSNP:138070947
1514 1514 a, g dbSNP:756807584
1519 1519 a, g dbSNP:201078144
1524 1524 c, t dbSNP:763617124
1525 1525 a, c, g dbSNP:200168437
1536 1536 c, g, t dbSNP:759405317
1537 1537 a, g dbSNP:774491699
1543 1543 gc, ta dbSNP:398124538
1544 1544 c, t dbSNP:766401197
1545 1545 a, g dbSNP:763168749
1567 1567 a, c dbSNP:558699420
1577 1577 a, g dbSNP:370074267
1578 1578 c, t dbSNP:772360950
1580 1580 -, c dbSNP:772407910
1586 1586 a, g dbSNP:367843558
1601 1601 a, g dbSNP:779467022
1606 1606 a, g dbSNP:769250170
1613 1613 c, t dbSNP:747675386
1614 1614 a, g dbSNP:781035304
1620 1620 c, t dbSNP:754710935
1623 1623 a, c dbSNP:373977390
1629 1629 g, t dbSNP:780010668
1636 1636 a, g dbSNP:200693409
1641 1641 c, t dbSNP:750394475
1644 1644 c, t dbSNP:111258744
1648 1648 c, t dbSNP:78683075
1649 1649 a, g dbSNP:753948488
1653 1653 a, g dbSNP:186366202
1658 1658 c, t dbSNP:536249722
1659 1659 a, t dbSNP:113938514
1662 1662 a, g dbSNP:377261933
1664 1664 c, t dbSNP:759928360
1667 1667 a, c dbSNP:371401039
1668 1668 a, c, g, t dbSNP:150175875
1669 1669 a, g dbSNP:768225327
1678 1678 a, c dbSNP:747429545
1689 1689 a, g dbSNP:746664975
1691 1691 a, g dbSNP:779849453
1712 1712 a, g dbSNP:368778627
1714 1714 c, t dbSNP:751677461
1724 1724 c, t dbSNP:372304384
1725 1725 a, g dbSNP:140500421
1734 1734 c, g, t dbSNP:765807221
1735 1735 c, t dbSNP:762370059
1736 1736 a, g dbSNP:775085512
1737 1737 g, t dbSNP:771424902
1743 1743 a, c, g, t dbSNP:372342796
1752 1752 c, t dbSNP:749057444
1755 1755 a, g dbSNP:777731843
1758 1758 a, g dbSNP:769758699
1762 1762 -, tg dbSNP:398124539
1766 1766 c, t dbSNP:748031634
1767 1767 a, g, t dbSNP:146801028
1770 1770 c, t dbSNP:751877389
1775 1775 a, g dbSNP:780125534
1778 1778 c, t dbSNP:758884167
1779 1779 c, t dbSNP:750848964
1785 1785 c, t dbSNP:765647841
1787 1787 -, tcca dbSNP:771374314
1800 1800 a, c, t dbSNP:367562964
1801 1801 a, g dbSNP:767119281
1806 1806 c, t dbSNP:767527483
1807 1807 c, t dbSNP:759503601
1821 1821 a, g dbSNP:774591810
1823 1823 -, aaag dbSNP:398124541
1823 1823 a, g dbSNP:770988236
1828 1828 g, t dbSNP:763092545
1839 1839 -, t dbSNP:757111995
1841 1841 a, g dbSNP:773482946
1848 1848 a, g dbSNP:551034228
1861 1861 a, g dbSNP:748491270
1864 1864 c, t dbSNP:140246224
1866 1866 c, t dbSNP:769183979
1872 1872 a, g dbSNP:558365108
1874 1874 a, c dbSNP:747467294
1876 1876 g, t dbSNP:587781952
1882 1882 a, g dbSNP:147142086
1885 1885 a, g dbSNP:756787389
1887 1887 -, agcccctgtgttgccagagagtacagaa dbSNP:398124542
1888 1888 c, g dbSNP:753491072
1891 1891 c, t dbSNP:777456756
1892 1892 a, g dbSNP:143483053
1904 1904 a, c, g dbSNP:767368450
1908 1908 c, t dbSNP:530884373
1909 1909 c, t dbSNP:751478971
1910 1910 c, t dbSNP:138031155
1914 1914 a, g dbSNP:763078516
1917 1917 a, g dbSNP:773355729
1919 1919 c, t dbSNP:770027312
1923 1923 c, t dbSNP:761984486
1925 1925 c, t dbSNP:202215080
1926 1926 c, t dbSNP:768940625
1935 1935 c, t dbSNP:747579747
1937 1937 a, g dbSNP:780597146
1954 1954 c, t dbSNP:770396757
1955 1955 a, g dbSNP:375352888
1959 1959 c, g dbSNP:777103374
1968 1968 c, g dbSNP:755850825
1973 1973 a, g dbSNP:752337482
1977 1977 c, t dbSNP:200224064
1982 1982 a, g dbSNP:190786280
1992 1992 a, g dbSNP:751513488
1993 1993 c, t dbSNP:398124523
1999 1999 c, g dbSNP:757313788
2001 2001 g, t dbSNP:534904034
2008 2008 c, t dbSNP:184718358
2017 2017 c, t dbSNP:557336321
2018 2018 g, t dbSNP:559055296
2035 2035 a, g dbSNP:767714543
2040 2040 c, t dbSNP:786202175
2042 2042 c, t dbSNP:200877872
2050 2050 a, c, t dbSNP:398124524
2066 2066 a, g dbSNP:769489773
2068 2068 a, g dbSNP:747644007
2071 2071 c, g dbSNP:776467886
2073 2073 c, t dbSNP:768454196
2082 2082 c, t dbSNP:150752548
2083 2083 a, g dbSNP:779913370
2087 2087 a, t dbSNP:758063582
2088 2088 g, t dbSNP:141250189
2108 2108 a, g dbSNP:570066243
2112 2112 a, c dbSNP:755413587
2112 2112 -, c dbSNP:398124525
2122 2122 a, g dbSNP:752006809
2126 2126 c, g dbSNP:766801011
2127 2127 c, t dbSNP:763569367
2130 2130 c, t dbSNP:750894316
2131 2131 a, g, t dbSNP:148257120
2132 2132 c, t dbSNP:760079073
2134 2134 c, t dbSNP:143183215
2135 2135 a, g dbSNP:771653740
2136 2136 -, c dbSNP:398124526
2148 2148 c, g dbSNP:786202541
2149 2149 a, g dbSNP:528541881
2157 2157 g, t dbSNP:774142829
2160 2160 c, t dbSNP:561236067
2161 2161 a, g dbSNP:763591386
2163 2163 a, g dbSNP:749287631
2166 2166 a, g dbSNP:61750032
2169 2169 c, t dbSNP:769968368
2175 2175 g, t dbSNP:376836624
2178 2178 c, t dbSNP:748148728
2180 2180 a, g dbSNP:781295687
2188 2188 a, g dbSNP:527859185
2189 2189 g, t dbSNP:755177473
2190 2190 a, g dbSNP:747171802
2193 2193 c, t dbSNP:780571501
2195 2195 a, g dbSNP:368175757
2198 2198 c, t dbSNP:565447853
2199 2199 a, g dbSNP:751013842
2200 2200 c, t dbSNP:765628527
2202 2202 c, t dbSNP:41464156
2204 2204 c, t dbSNP:752170592
2207 2207 a, g dbSNP:786203348
2210 2210 c, t dbSNP:766990565
2211 2211 c, t dbSNP:41459448
2212 2212 a, c dbSNP:773986076
2213 2213 a, c dbSNP:766218250
2214 2214 c, g dbSNP:372207262
2215 2215 c, g dbSNP:368880414
2216 2216 a, c, g, t dbSNP:199889477
2218 2218 -, c dbSNP:80338682
2218 2218 a, c, t dbSNP:375082054
2218 2218 -, c dbSNP:80338683
2220 2220 c, t dbSNP:374707789
2225 2225 c, t dbSNP:758871984
2229 2229 -, ctc dbSNP:763354508
2238 2238 -, t dbSNP:398124527
2241 2241 g, t dbSNP:775722367
2242 2242 a, c, g dbSNP:772207015
2245 2245 a, t dbSNP:759743111
2247 2247 a, c, t dbSNP:771247255
2248 2248 a, g dbSNP:112980409
2259 2259 c, t dbSNP:145004158
2260 2260 a, g dbSNP:535236784
2265 2265 a, c, t dbSNP:141283741
2266 2266 a, g dbSNP:41419545
2269 2269 c, t dbSNP:200724468
2270 2270 a, g dbSNP:750104212
2271 2271 c, t dbSNP:569587785
2283 2283 a, c, t dbSNP:753685944
2287 2287 a, g dbSNP:763920904
2289 2289 a, g dbSNP:760690745
2292 2292 a, g dbSNP:752677061
2293 2293 c, t dbSNP:767762804
2296 2296 a, g dbSNP:759637055
2297 2297 a, g dbSNP:199786696
2306 2306 a, g dbSNP:150439088
2309 2309 c, t dbSNP:377468280
2312 2312 c, t dbSNP:112196863
2313 2313 c, t dbSNP:773581294
2316 2316 c, t dbSNP:772310968
2320 2320 c, t dbSNP:770077517
2322 2322 c, g, t dbSNP:137852929
2337 2337 c, t dbSNP:777113065
2347 2347 c, g dbSNP:151312899
2351 2351 c, t dbSNP:144883828
2352 2352 a, c dbSNP:141036419
2361 2361 c, g dbSNP:756944795
2363 2363 a, g dbSNP:748878853
2365 2365 c, g dbSNP:777774091
2372 2372 c, t dbSNP:745720578
2375 2375 c, g dbSNP:781081891
2391 2391 -, ataagatt dbSNP:757197845
2392 2392 g, t dbSNP:786202475
2396 2396 c, t dbSNP:200660337
2397 2397 a, g dbSNP:747029882
2398 2398 a, g dbSNP:757222242
2409 2409 c, t dbSNP:779837933
2412 2412 a, g dbSNP:758516602
2420 2420 c, g dbSNP:750535468
2441 2441 c, g dbSNP:778904029
2445 2445 c, t dbSNP:757471403
2446 2446 a, g dbSNP:376715412
2455 2455 -, aag dbSNP:398124529
2456 2456 a, g dbSNP:199643834
2463 2463 a, g dbSNP:531459106
2466 2466 a, g dbSNP:398124530
2492 2492 a, g dbSNP:142288285
2512 2512 -, a dbSNP:753009073
2513 2513 a, g dbSNP:777826268
2523 2523 c, g dbSNP:756318617
2527 2527 a, c dbSNP:753023144
2530 2530 c, t dbSNP:398124532
2532 2532 c, g dbSNP:190965235
2553 2553 c, t dbSNP:755548579
2554 2554 a, g dbSNP:752108683
2555 2555 c, t dbSNP:764899882
2556 2556 a, g dbSNP:185419942
2560 2560 a, g dbSNP:776389684
2565 2565 a, g dbSNP:763688092
2568 2568 c, g dbSNP:760329266
2570 2570 a, g dbSNP:775149348
2577 2577 c, g dbSNP:771847652
2586 2586 a, g dbSNP:745859406
2600 2600 -, a dbSNP:767479616
2600 2600 c, g dbSNP:774247151
2610 2610 a, g dbSNP:771038343
2618 2618 a, g dbSNP:749359334
2625 2625 c, t dbSNP:201810397
2630 2630 c, t dbSNP:756302545
2635 2635 a, g dbSNP:748337450
2636 2636 c, t dbSNP:781733528
2637 2637 a, g dbSNP:147554296
2641 2641 c, t dbSNP:752161850
2642 2642 a, g dbSNP:201056799
2650 2650 a, t dbSNP:758901704
2651 2651 c, t dbSNP:753313171
2657 2657 c, t dbSNP:763604691
2658 2658 a, g dbSNP:760307957
2665 2665 c, t dbSNP:775107483
2670 2670 c, t dbSNP:767345167
2674 2674 c, t dbSNP:759292330
2676 2676 c, t dbSNP:774091922
2677 2677 a, g dbSNP:770795599
2681 2681 a, c, t dbSNP:773168989
2687 2687 a, c, t dbSNP:748379299
2690 2690 g, t dbSNP:115885284
2691 2691 c, t dbSNP:370269600
2703 2703 a, g dbSNP:747413239
2705 2705 c, t dbSNP:780520253
2708 2708 c, t dbSNP:149134801
2715 2715 c, t dbSNP:750934121
2724 2724 c, t dbSNP:777203555
2726 2726 a, t dbSNP:111861140
2731 2731 c, t dbSNP:535022712
2760 2760 a, c dbSNP:778606717
2761 2761 a, g dbSNP:754626617
2764 2764 g, t dbSNP:564383830
2851 2851 a, g dbSNP:145430714
2866 2866 a, g dbSNP:144507152
2871 2871 a, c dbSNP:771890381
2893 2893 a, t dbSNP:541599658
2896 2896 c, t dbSNP:76272341
2897 2897 a, g dbSNP:541003301
2926 2926 a, g dbSNP:774288275
2928 2928 c, g dbSNP:564245440
2941 2941 c, t dbSNP:180873537
2994 2994 c, t dbSNP:139734855
2996 2996 a, g dbSNP:571999061
3006 3006 c, t dbSNP:750896108
3017 3017 c, g dbSNP:554190238
3029 3029 g, t dbSNP:7224474
3052 3052 a, g dbSNP:117436649
3066 3066 a, g dbSNP:12602675
3076 3076 c, t dbSNP:188840802
3098 3098 a, g dbSNP:7224335
3115 3115 c, t dbSNP:7224213
3153 3153 a, c dbSNP:146851795
3155 3155 a, c dbSNP:574471240
3169 3169 -, gtga dbSNP:778371655
3183 3183 g, t dbSNP:537259057
3199 3199 c, t dbSNP:574547835
3201 3201 a, g dbSNP:184006653
3213 3213 g, t dbSNP:181935335
3230 3230 c, t dbSNP:3803761
3253 3253 c, t dbSNP:566100851
3307 3307 a, c dbSNP:199572622
3311 3311 c, t dbSNP:780240981
3353 3353 a, g dbSNP:539709518
3368 3368 c, t dbSNP:775700421
3387 3387 a, c dbSNP:189888135
3390 3390 a, t dbSNP:550746288
3412 3412 c, t dbSNP:558952732
3414 3414 c, g dbSNP:530771625
3459 3459 a, g dbSNP:143768653
3467 3467 a, g dbSNP:139529824
3494 3494 a, g dbSNP:770643935
3501 3501 g, t dbSNP:750900491
3523 3523 c, g dbSNP:185759963
3524 3524 -, c dbSNP:748168795
3584 3584 a, g dbSNP:571893996
3587 3587 c, t dbSNP:7223831
3629 3629 a, g dbSNP:141650706
3674 3674 a, g dbSNP:532627636
3708 3708 c, t dbSNP:566019526
3718 3718 a, g dbSNP:563644388
3735 3735 a, g dbSNP:771952210
3774 3774 c, t dbSNP:543608114
3788 3788 a, g dbSNP:574733214
3824 3824 c, t dbSNP:62064407
3826 3826 -, tttt dbSNP:397932764
3852 3852 a, t dbSNP:540609895
3855 3855 -, a dbSNP:199535675
3907 3907 a, g dbSNP:747663295
3917 3917 c, t dbSNP:554751440
3919 3919 c, g dbSNP:541543491
3962 3962 a, g dbSNP:572462992
3971 3971 c, t dbSNP:558869941
4009 4009 g, t dbSNP:7218992
4025 4025 g, t dbSNP:11654407
4039 4039 a, g dbSNP:754539748
4063 4063 c, g dbSNP:570755484
4066 4066 a, g dbSNP:557330837
4076 4076 c, t dbSNP:7218795
4085 4085 a, g dbSNP:568272777

Target ORF information:

RefSeq Version XM_011523716
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu77698D
Sequence Information ORF Nucleotide Sequence (Length: 1794bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product folliculin isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010718.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1474..2019(+)
Position Chain Variation Link
18 18 c, g dbSNP:1736209
24 24 a, g dbSNP:207476321
25 25 c, g dbSNP:564584154
37 37 a, c dbSNP:207476320
39 39 c, t dbSNP:575905361
53 53 a, c dbSNP:562310783
60 60 a, g dbSNP:542327641
74 74 c, t dbSNP:138847774
75 75 c, t dbSNP:553452028
78 78 a, g dbSNP:539415254
130 130 c, t dbSNP:577176265
164 164 g, t dbSNP:528481171
167 167 c, g dbSNP:557719136
168 168 a, g dbSNP:537792180
187 187 c, t dbSNP:180900492
203 203 a, g dbSNP:41345949
205 205 c, g dbSNP:548796445
206 206 c, t dbSNP:1708629
221 221 c, g dbSNP:78262456
223 223 c, g dbSNP:78918950
225 225 g, t dbSNP:75014442
248 248 a, g dbSNP:370286675
276 276 -, ggtaggcgggggtctgagg dbSNP:370486376
329 329 a, g dbSNP:117215381
362 362 a, c, t dbSNP:560968516
364 364 g, t dbSNP:541105214
371 371 c, t dbSNP:116581458
408 408 c, t dbSNP:114481741
412 412 c, t dbSNP:115413827
413 413 a, g dbSNP:756416340
415 415 a, g dbSNP:8069957
426 426 a, g dbSNP:535864585
427 427 c, g dbSNP:147598893
440 440 a, g dbSNP:145125741
447 447 c, t dbSNP:140144170
460 460 a, g dbSNP:571154058
476 476 a, g dbSNP:151144873
489 489 c, g dbSNP:528401271
527 527 c, t dbSNP:753086978
532 532 c, t dbSNP:533687652
582 582 c, g dbSNP:545983207
602 602 c, g dbSNP:116438960
607 607 -, ctc dbSNP:528431686
615 615 -, a dbSNP:572591896
624 624 a, g dbSNP:555731464
661 661 -, c dbSNP:559377745
665 665 a, g dbSNP:543198678
668 668 c, g dbSNP:574363104
685 685 a, c dbSNP:146246174
700 700 a, g dbSNP:541043827
706 706 c, t dbSNP:572369766
707 707 a, t dbSNP:558834443
709 709 -, cc dbSNP:540656367
713 713 g, t dbSNP:538804082
715 715 -, gtat dbSNP:375495673
716 716 -, cc dbSNP:200365194
717 717 c, t dbSNP:112002657
746 746 a, g dbSNP:569964752
747 747 a, g dbSNP:1708618
757 757 a, g dbSNP:185401594
759 759 g, t dbSNP:766570505
760 760 a, g dbSNP:763224453
776 776 a, g dbSNP:181549149
790 790 a, g dbSNP:760682564
797 797 c, t dbSNP:532847715
840 840 a, g dbSNP:142149319
856 856 c, t dbSNP:750557906
859 859 c, t dbSNP:565937473
875 875 a, g dbSNP:761981111
898 898 a, g dbSNP:75336342
902 902 c, t dbSNP:532342547
927 927 c, t dbSNP:563376820
971 971 c, t dbSNP:543487724
975 975 a, g dbSNP:529727139
1001 1001 a, g dbSNP:561055780
1037 1037 a, g dbSNP:761617653
1059 1059 c, t dbSNP:540630142
1061 1061 a, c dbSNP:571710524
1101 1101 a, g dbSNP:764888176
1102 1102 c, t dbSNP:759415328
1103 1103 a, t dbSNP:565505709
1110 1110 a, g dbSNP:545337155
1114 1114 a, c dbSNP:780421535
1135 1135 a, g dbSNP:776640058
1136 1136 c, t dbSNP:758705818
1137 1137 g, t dbSNP:746381939
1139 1139 -, g dbSNP:35936022
1153 1153 c, t dbSNP:779391001
1157 1157 a, g dbSNP:369632481
1176 1176 c, t dbSNP:752123350
1177 1177 a, g dbSNP:767235709
1197 1197 c, t dbSNP:754616167
1198 1198 a, g dbSNP:751171641
1206 1206 c, t dbSNP:766288960
1207 1207 a, g dbSNP:539468848
1209 1209 c, t dbSNP:773349151
1213 1213 -, c dbSNP:758385503
1213 1213 c, t dbSNP:765251703
1214 1214 c, g dbSNP:398124537
1216 1216 a, g dbSNP:761993256
1224 1224 c, t dbSNP:776605909
1229 1229 c, t dbSNP:768734584
1230 1230 a, g dbSNP:747210367
1234 1234 g, t dbSNP:775626774
1239 1239 a, g dbSNP:200350612
1242 1242 c, t dbSNP:746222481
1243 1243 a, g dbSNP:779449668
1244 1244 c, t dbSNP:757670898
1246 1246 c, t dbSNP:749758787
1247 1247 -, c dbSNP:398124540
1247 1247 c, g dbSNP:780588085
1248 1248 a, g dbSNP:754450145
1250 1250 c, t dbSNP:150051278
1254 1254 c, t dbSNP:766122649
1257 1257 a, g dbSNP:758326533
1258 1258 c, g dbSNP:750221380
1259 1259 a, g dbSNP:587778366
1261 1261 c, g dbSNP:386833401
1263 1263 a, t dbSNP:375348725
1277 1277 g, t dbSNP:139418842
1293 1293 c, g dbSNP:760808366
1298 1298 c, g, t dbSNP:556510460
1299 1299 a, g dbSNP:759930161
1303 1303 c, g dbSNP:369115472
1322 1322 a, g dbSNP:771056209
1332 1332 c, t dbSNP:774725046
1333 1333 c, t dbSNP:746507528
1334 1334 a, g dbSNP:749770193
1339 1339 c, t dbSNP:778275358
1340 1340 a, g, t dbSNP:374969279
1343 1343 c, t dbSNP:779900587
1345 1345 c, g dbSNP:758156813
1353 1353 c, t dbSNP:750047828
1354 1354 a, g dbSNP:778587763
1358 1358 a, c dbSNP:757012294
1361 1361 a, g dbSNP:753787458
1365 1365 c, g dbSNP:764082089
1366 1366 a, g dbSNP:587778365
1368 1368 c, t dbSNP:371947198
1369 1369 a, g dbSNP:567617762
1371 1371 c, t dbSNP:759772780
1372 1372 a, g dbSNP:554247745
1374 1374 a, g dbSNP:771202158
1375 1375 c, t dbSNP:763369657
1385 1385 c, t dbSNP:773648142
1386 1386 a, g dbSNP:770311645
1394 1394 a, c dbSNP:746556970
1399 1399 -, tcgg dbSNP:750146811
1399 1399 g, t dbSNP:779733014
1400 1400 c, g dbSNP:137852930
1401 1401 a, g dbSNP:771650940
1405 1405 a, g dbSNP:745521431
1410 1410 c, t dbSNP:150712346
1411 1411 a, g dbSNP:757060348
1421 1421 a, g dbSNP:765550303
1432 1432 g, t dbSNP:141140415
1435 1435 a, g dbSNP:781100382
1438 1438 c, t dbSNP:755107067
1439 1439 a, g dbSNP:751634275
1442 1442 c, t dbSNP:766548696
1443 1443 a, g dbSNP:138688941
1446 1446 a, g dbSNP:750553308
1460 1460 -, a dbSNP:398124534
1469 1469 a, c dbSNP:765702734
1470 1470 c, t dbSNP:762265819
1472 1472 a, c dbSNP:777336970
1475 1475 c, t dbSNP:764679174
1479 1479 a, g dbSNP:759011359
1482 1482 c, t dbSNP:773946854
1483 1483 cac, gt dbSNP:398124535
1510 1510 a, c, t dbSNP:398124536
1511 1511 -, a dbSNP:776896550
1529 1529 c, g dbSNP:748979393
1599 1599 c, t dbSNP:140220661
1606 1606 a, t dbSNP:752261491
1613 1613 a, g dbSNP:539457096
1620 1620 c, t dbSNP:756563416
1639 1639 a, g dbSNP:375921200
1645 1645 -, ttc dbSNP:764153620
1647 1647 c, t dbSNP:773792624
1648 1648 a, g dbSNP:372918705
1662 1662 c, t dbSNP:376825814
1663 1663 a, g dbSNP:752014050
1664 1664 -, g dbSNP:727504645
1668 1668 c, t dbSNP:200672897
1669 1669 a, g dbSNP:147164515
1670 1670 c, t dbSNP:373794943
1674 1674 c, t dbSNP:763630763
1687 1687 -, ttc dbSNP:786203218
1700 1700 a, g dbSNP:760556162
1707 1707 a, c dbSNP:775176038
1713 1713 c, t dbSNP:767290984
1717 1717 c, t dbSNP:587782069
1719 1719 c, g dbSNP:772775816
1720 1720 c, t dbSNP:587778367
1721 1721 a, g dbSNP:759556434
1753 1753 c, t dbSNP:774358971
1754 1754 g, t dbSNP:369906553
1756 1756 a, c dbSNP:771205573
1762 1762 c, t dbSNP:749368513
1764 1764 c, t dbSNP:773535830
1770 1770 a, c dbSNP:143525924
1773 1773 c, t dbSNP:748363919
1783 1783 c, t dbSNP:781433539
1785 1785 a, g dbSNP:755278796
1787 1787 -, g dbSNP:34867548
1789 1789 a, g dbSNP:747581757
1798 1798 c, t dbSNP:138070947
1799 1799 a, g dbSNP:756807584
1804 1804 a, g dbSNP:201078144
1809 1809 c, t dbSNP:763617124
1810 1810 a, c, g dbSNP:200168437
1821 1821 c, g, t dbSNP:759405317
1822 1822 a, g dbSNP:774491699
1828 1828 gc, ta dbSNP:398124538
1829 1829 c, t dbSNP:766401197
1830 1830 a, g dbSNP:763168749
1852 1852 a, c dbSNP:558699420
1862 1862 a, g dbSNP:370074267
1863 1863 c, t dbSNP:772360950
1865 1865 -, c dbSNP:772407910
1871 1871 a, g dbSNP:367843558
1886 1886 a, g dbSNP:779467022
1891 1891 a, g dbSNP:769250170
1898 1898 c, t dbSNP:747675386
1899 1899 a, g dbSNP:781035304
1905 1905 c, t dbSNP:754710935
1908 1908 a, c dbSNP:373977390
1914 1914 g, t dbSNP:780010668
1921 1921 a, g dbSNP:200693409
1926 1926 c, t dbSNP:750394475
1929 1929 c, t dbSNP:111258744
1933 1933 c, t dbSNP:78683075
1934 1934 a, g dbSNP:753948488
1938 1938 a, g dbSNP:186366202
1943 1943 c, t dbSNP:536249722
1944 1944 a, t dbSNP:113938514
1947 1947 a, g dbSNP:377261933
1949 1949 c, t dbSNP:759928360
1952 1952 a, c dbSNP:371401039
1953 1953 a, c, g, t dbSNP:150175875
1954 1954 a, g dbSNP:768225327
1963 1963 a, c dbSNP:747429545
1974 1974 a, g dbSNP:746664975
1976 1976 a, g dbSNP:779849453
1997 1997 a, g dbSNP:368778627
1999 1999 c, t dbSNP:751677461
2009 2009 c, t dbSNP:372304384
2010 2010 a, g dbSNP:140500421
2019 2019 c, g, t dbSNP:765807221
2020 2020 c, t dbSNP:762370059
2021 2021 a, g dbSNP:775085512
2022 2022 g, t dbSNP:771424902
2028 2028 a, c, g, t dbSNP:372342796
2037 2037 c, t dbSNP:749057444
2040 2040 a, g dbSNP:777731843
2043 2043 a, g dbSNP:769758699
2047 2047 -, tg dbSNP:398124539
2051 2051 c, t dbSNP:748031634
2052 2052 a, g, t dbSNP:146801028
2055 2055 c, t dbSNP:751877389
2060 2060 a, g dbSNP:780125534
2063 2063 c, t dbSNP:758884167
2064 2064 c, t dbSNP:750848964
2070 2070 c, t dbSNP:765647841
2072 2072 -, tcca dbSNP:771374314
2085 2085 a, c, t dbSNP:367562964
2086 2086 a, g dbSNP:767119281
2091 2091 c, t dbSNP:767527483
2092 2092 c, t dbSNP:759503601
2106 2106 a, g dbSNP:774591810
2108 2108 -, aaag dbSNP:398124541
2108 2108 a, g dbSNP:770988236
2113 2113 g, t dbSNP:763092545
2124 2124 -, t dbSNP:757111995
2126 2126 a, g dbSNP:773482946
2133 2133 a, g dbSNP:551034228
2146 2146 a, g dbSNP:748491270
2149 2149 c, t dbSNP:140246224
2151 2151 c, t dbSNP:769183979
2157 2157 a, g dbSNP:558365108
2159 2159 a, c dbSNP:747467294
2161 2161 g, t dbSNP:587781952
2167 2167 a, g dbSNP:147142086
2170 2170 a, g dbSNP:756787389
2172 2172 -, agcccctgtgttgccagagagtacagaa dbSNP:398124542
2173 2173 c, g dbSNP:753491072
2176 2176 c, t dbSNP:777456756
2177 2177 a, g dbSNP:143483053
2189 2189 a, c, g dbSNP:767368450
2193 2193 c, t dbSNP:530884373
2194 2194 c, t dbSNP:751478971
2195 2195 c, t dbSNP:138031155
2199 2199 a, g dbSNP:763078516
2202 2202 a, g dbSNP:773355729
2204 2204 c, t dbSNP:770027312
2208 2208 c, t dbSNP:761984486
2210 2210 c, t dbSNP:202215080
2211 2211 c, t dbSNP:768940625
2220 2220 c, t dbSNP:747579747
2222 2222 a, g dbSNP:780597146
2239 2239 c, t dbSNP:770396757
2240 2240 a, g dbSNP:375352888
2244 2244 c, g dbSNP:777103374
2253 2253 c, g dbSNP:755850825
2258 2258 a, g dbSNP:752337482
2262 2262 c, t dbSNP:200224064
2267 2267 a, g dbSNP:190786280
2277 2277 a, g dbSNP:751513488
2278 2278 c, t dbSNP:398124523
2284 2284 c, g dbSNP:757313788
2286 2286 g, t dbSNP:534904034
2293 2293 c, t dbSNP:184718358
2302 2302 c, t dbSNP:557336321
2303 2303 g, t dbSNP:559055296
2320 2320 a, g dbSNP:767714543
2325 2325 c, t dbSNP:786202175
2327 2327 c, t dbSNP:200877872
2335 2335 a, c, t dbSNP:398124524
2351 2351 a, g dbSNP:769489773
2353 2353 a, g dbSNP:747644007
2356 2356 c, g dbSNP:776467886
2358 2358 c, t dbSNP:768454196
2367 2367 c, t dbSNP:150752548
2368 2368 a, g dbSNP:779913370
2372 2372 a, t dbSNP:758063582
2373 2373 g, t dbSNP:141250189
2393 2393 a, g dbSNP:570066243
2397 2397 a, c dbSNP:755413587
2397 2397 -, c dbSNP:398124525
2407 2407 a, g dbSNP:752006809
2411 2411 c, g dbSNP:766801011
2412 2412 c, t dbSNP:763569367
2415 2415 c, t dbSNP:750894316
2416 2416 a, g, t dbSNP:148257120
2417 2417 c, t dbSNP:760079073
2419 2419 c, t dbSNP:143183215
2420 2420 a, g dbSNP:771653740
2421 2421 -, c dbSNP:398124526
2433 2433 c, g dbSNP:786202541
2434 2434 a, g dbSNP:528541881
2442 2442 g, t dbSNP:774142829
2445 2445 c, t dbSNP:561236067
2446 2446 a, g dbSNP:763591386
2448 2448 a, g dbSNP:749287631
2451 2451 a, g dbSNP:61750032
2454 2454 c, t dbSNP:769968368
2460 2460 g, t dbSNP:376836624
2463 2463 c, t dbSNP:748148728
2465 2465 a, g dbSNP:781295687
2473 2473 a, g dbSNP:527859185
2474 2474 g, t dbSNP:755177473
2475 2475 a, g dbSNP:747171802
2478 2478 c, t dbSNP:780571501
2480 2480 a, g dbSNP:368175757
2483 2483 c, t dbSNP:565447853
2484 2484 a, g dbSNP:751013842
2485 2485 c, t dbSNP:765628527
2487 2487 c, t dbSNP:41464156
2489 2489 c, t dbSNP:752170592
2492 2492 a, g dbSNP:786203348
2495 2495 c, t dbSNP:766990565
2496 2496 c, t dbSNP:41459448
2497 2497 a, c dbSNP:773986076
2498 2498 a, c dbSNP:766218250
2499 2499 c, g dbSNP:372207262
2500 2500 c, g dbSNP:368880414
2501 2501 a, c, g, t dbSNP:199889477
2503 2503 -, c dbSNP:80338682
2503 2503 a, c, t dbSNP:375082054
2503 2503 -, c dbSNP:80338683
2505 2505 c, t dbSNP:374707789
2510 2510 c, t dbSNP:758871984
2514 2514 -, ctc dbSNP:763354508
2523 2523 -, t dbSNP:398124527
2526 2526 g, t dbSNP:775722367
2527 2527 a, c, g dbSNP:772207015
2530 2530 a, t dbSNP:759743111
2532 2532 a, c, t dbSNP:771247255
2533 2533 a, g dbSNP:112980409
2544 2544 c, t dbSNP:145004158
2545 2545 a, g dbSNP:535236784
2550 2550 a, c, t dbSNP:141283741
2551 2551 a, g dbSNP:41419545
2554 2554 c, t dbSNP:200724468
2555 2555 a, g dbSNP:750104212
2556 2556 c, t dbSNP:569587785
2568 2568 a, c, t dbSNP:753685944
2572 2572 a, g dbSNP:763920904
2574 2574 a, g dbSNP:760690745
2577 2577 a, g dbSNP:752677061
2578 2578 c, t dbSNP:767762804
2581 2581 a, g dbSNP:759637055
2582 2582 a, g dbSNP:199786696
2591 2591 a, g dbSNP:150439088
2594 2594 c, t dbSNP:377468280
2597 2597 c, t dbSNP:112196863
2598 2598 c, t dbSNP:773581294
2601 2601 c, t dbSNP:772310968
2605 2605 c, t dbSNP:770077517
2607 2607 c, g, t dbSNP:137852929
2622 2622 c, t dbSNP:777113065
2632 2632 c, g dbSNP:151312899
2636 2636 c, t dbSNP:144883828
2637 2637 a, c dbSNP:141036419
2646 2646 c, g dbSNP:756944795
2648 2648 a, g dbSNP:748878853
2650 2650 c, g dbSNP:777774091
2657 2657 c, t dbSNP:745720578
2660 2660 c, g dbSNP:781081891
2676 2676 -, ataagatt dbSNP:757197845
2677 2677 g, t dbSNP:786202475
2681 2681 c, t dbSNP:200660337
2682 2682 a, g dbSNP:747029882
2683 2683 a, g dbSNP:757222242
2694 2694 c, t dbSNP:779837933
2697 2697 a, g dbSNP:758516602
2705 2705 c, g dbSNP:750535468
2726 2726 c, g dbSNP:778904029
2730 2730 c, t dbSNP:757471403
2731 2731 a, g dbSNP:376715412
2740 2740 -, aag dbSNP:398124529
2741 2741 a, g dbSNP:199643834
2748 2748 a, g dbSNP:531459106
2751 2751 a, g dbSNP:398124530
2777 2777 a, g dbSNP:142288285
2797 2797 -, a dbSNP:753009073
2798 2798 a, g dbSNP:777826268
2808 2808 c, g dbSNP:756318617
2812 2812 a, c dbSNP:753023144
2815 2815 c, t dbSNP:398124532
2817 2817 c, g dbSNP:190965235
2838 2838 c, t dbSNP:755548579
2839 2839 a, g dbSNP:752108683
2840 2840 c, t dbSNP:764899882
2841 2841 a, g dbSNP:185419942
2845 2845 a, g dbSNP:776389684
2850 2850 a, g dbSNP:763688092
2853 2853 c, g dbSNP:760329266
2855 2855 a, g dbSNP:775149348
2862 2862 c, g dbSNP:771847652
2871 2871 a, g dbSNP:745859406
2885 2885 -, a dbSNP:767479616
2885 2885 c, g dbSNP:774247151
2895 2895 a, g dbSNP:771038343
2903 2903 a, g dbSNP:749359334
2910 2910 c, t dbSNP:201810397
2915 2915 c, t dbSNP:756302545
2920 2920 a, g dbSNP:748337450
2921 2921 c, t dbSNP:781733528
2922 2922 a, g dbSNP:147554296
2926 2926 c, t dbSNP:752161850
2927 2927 a, g dbSNP:201056799
2935 2935 a, t dbSNP:758901704
2936 2936 c, t dbSNP:753313171
2942 2942 c, t dbSNP:763604691
2943 2943 a, g dbSNP:760307957
2950 2950 c, t dbSNP:775107483
2955 2955 c, t dbSNP:767345167
2959 2959 c, t dbSNP:759292330
2961 2961 c, t dbSNP:774091922
2962 2962 a, g dbSNP:770795599
2966 2966 a, c, t dbSNP:773168989
2972 2972 a, c, t dbSNP:748379299
2975 2975 g, t dbSNP:115885284
2976 2976 c, t dbSNP:370269600
2988 2988 a, g dbSNP:747413239
2990 2990 c, t dbSNP:780520253
2993 2993 c, t dbSNP:149134801
3000 3000 c, t dbSNP:750934121
3009 3009 c, t dbSNP:777203555
3011 3011 a, t dbSNP:111861140
3016 3016 c, t dbSNP:535022712
3045 3045 a, c dbSNP:778606717
3046 3046 a, g dbSNP:754626617
3049 3049 g, t dbSNP:564383830
3136 3136 a, g dbSNP:145430714
3151 3151 a, g dbSNP:144507152
3156 3156 a, c dbSNP:771890381
3178 3178 a, t dbSNP:541599658
3181 3181 c, t dbSNP:76272341
3182 3182 a, g dbSNP:541003301
3211 3211 a, g dbSNP:774288275
3213 3213 c, g dbSNP:564245440
3226 3226 c, t dbSNP:180873537
3279 3279 c, t dbSNP:139734855
3281 3281 a, g dbSNP:571999061
3291 3291 c, t dbSNP:750896108
3302 3302 c, g dbSNP:554190238
3314 3314 g, t dbSNP:7224474
3337 3337 a, g dbSNP:117436649
3351 3351 a, g dbSNP:12602675
3361 3361 c, t dbSNP:188840802
3383 3383 a, g dbSNP:7224335
3400 3400 c, t dbSNP:7224213
3438 3438 a, c dbSNP:146851795
3440 3440 a, c dbSNP:574471240
3454 3454 -, gtga dbSNP:778371655
3468 3468 g, t dbSNP:537259057
3484 3484 c, t dbSNP:574547835
3486 3486 a, g dbSNP:184006653
3498 3498 g, t dbSNP:181935335
3515 3515 c, t dbSNP:3803761
3538 3538 c, t dbSNP:566100851
3592 3592 a, c dbSNP:199572622
3596 3596 c, t dbSNP:780240981
3638 3638 a, g dbSNP:539709518
3653 3653 c, t dbSNP:775700421
3672 3672 a, c dbSNP:189888135
3675 3675 a, t dbSNP:550746288
3697 3697 c, t dbSNP:558952732
3699 3699 c, g dbSNP:530771625
3744 3744 a, g dbSNP:143768653
3752 3752 a, g dbSNP:139529824
3779 3779 a, g dbSNP:770643935
3786 3786 g, t dbSNP:750900491
3808 3808 c, g dbSNP:185759963
3809 3809 -, c dbSNP:748168795
3869 3869 a, g dbSNP:571893996
3872 3872 c, t dbSNP:7223831
3914 3914 a, g dbSNP:141650706
3959 3959 a, g dbSNP:532627636
3993 3993 c, t dbSNP:566019526
4003 4003 a, g dbSNP:563644388
4020 4020 a, g dbSNP:771952210
4059 4059 c, t dbSNP:543608114
4073 4073 a, g dbSNP:574733214
4109 4109 c, t dbSNP:62064407
4111 4111 -, tttt dbSNP:397932764
4137 4137 a, t dbSNP:540609895
4140 4140 -, a dbSNP:199535675
4192 4192 a, g dbSNP:747663295
4202 4202 c, t dbSNP:554751440
4204 4204 c, g dbSNP:541543491
4247 4247 a, g dbSNP:572462992
4256 4256 c, t dbSNP:558869941
4294 4294 g, t dbSNP:7218992
4310 4310 g, t dbSNP:11654407
4324 4324 a, g dbSNP:754539748
4348 4348 c, g dbSNP:570755484
4351 4351 a, g dbSNP:557330837
4361 4361 c, t dbSNP:7218795
4370 4370 a, g dbSNP:568272777

Target ORF information:

RefSeq Version XM_011523717
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu77698D
Sequence Information ORF Nucleotide Sequence (Length: 1794bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product folliculin isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010718.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)725..1270(+)
Position Chain Variation Link
18 18 c, g dbSNP:1736209
24 24 a, g dbSNP:207476321
25 25 c, g dbSNP:564584154
37 37 a, c dbSNP:207476320
39 39 c, t dbSNP:575905361
53 53 a, c dbSNP:562310783
60 60 a, g dbSNP:542327641
74 74 c, t dbSNP:138847774
75 75 c, t dbSNP:553452028
78 78 a, g dbSNP:539415254
130 130 c, t dbSNP:577176265
164 164 g, t dbSNP:528481171
167 167 c, g dbSNP:557719136
168 168 a, g dbSNP:537792180
187 187 c, t dbSNP:180900492
203 203 a, g dbSNP:41345949
205 205 c, g dbSNP:548796445
206 206 c, t dbSNP:1708629
221 221 c, g dbSNP:78262456
223 223 c, g dbSNP:78918950
225 225 g, t dbSNP:75014442
248 248 a, g dbSNP:370286675
276 276 -, ggtaggcgggggtctgagg dbSNP:370486376
329 329 a, g dbSNP:117215381
362 362 a, c, t dbSNP:560968516
364 364 g, t dbSNP:541105214
371 371 c, t dbSNP:116581458
404 404 c, t dbSNP:779391001
408 408 a, g dbSNP:369632481