Email to GenScript

FLCN folliculin [Homo sapiens (human)]

Gene Symbol FLCN
Entrez Gene ID 201163
Full Name folliculin
Synonyms BHD, FLCL
General protein information
Preferred Names
folliculin
Names
folliculin
birt-Hogg-Dube syndrome protein
BHD skin lesion fibrofolliculoma protein
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

17

17p11.2

Summary This gene is located within the Smith-Magenis syndrome region on chromosome 17. Mutations in this gene are associated with Birt-Hogg-Dube syndrome, which is characterized by fibrofolliculomas, renal tumors, lung cysts, and pneumothorax. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:

607273

Disorder Html: Birt-Hogg-Dube syndrome, 135150 (3); Pneumothorax, primary





The following FLCN gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the FLCN gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu77698 XM_011523714 PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu77698 XM_011523715 PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu77698 XM_011523716 PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu77698 XM_011523717 PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu77698 XM_011523718 PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu77699 XM_011523719 PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu77700 XM_011523720 PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu77698 XM_011523721 PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X8, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu18989 NM_144997 Homo sapiens folliculin (FLCN), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
$307.3
$439
OHu19027 NM_144606 Homo sapiens folliculin (FLCN), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
$223.3
$319

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.


CloneID OHu77698
Accession Version XM_011523714.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1794bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product folliculin isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010718.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
ATGAATGCCA TCGTGGCTCT CTGCCACTTC TGCGAGCTCC ACGGCCCCCG CACTCTCTTC 
TGCACGGAGG TGCTGCACGC CCCACTTCCT CAAGGGGATG GGAATGAGGA CAGTCCTGGC
CAGGGTGAGC AGGCGGAAGA AGAGGAAGGT GGCATTCAGA TGAACAGTCG GATGCGTGCG
CACAGCCCCG CAGAGGGGGC CAGCGTCGAG TCCAGCAGCC CGGGGCCCAA AAAGTCGGAC
ATGTGCGAGG GCTGCCGGTC ACTTGCTGCA GGGCACCCGG GATATATCAG CCATGATAAA
GAGACCTCCA TTAAATACGT CAGCCACCAG CACCCCAGCC ACCCCCAGCT CTTCAGCATT
GTCCGCCAGG CCTGTGTCCG GAGCCTGAGC TGTGAGTGCA GGGAGAGTGC AGTGGCTGCT
CTGACCTGCT GGTTCTTCTG CATGCTCCAG GTCTGCCCTG GCCGTGAAGG CCCCATCTTC
TTCGGAGATG AGCAGCACGG CTTTGTGTTC AGCCACACCT TCTTCATCAA GGACAGCCTG
GCCAGGGGCT TCCAGCGCTG GTACAGCATC ATCACCATCA TGATGGACCG GATCTACCTC
ATCAACTCCT GGCCCTTCCT GCTGGGGAAG GTCCGGGGAA TCATCGATGA GCTCCAGGGC
AAGGCGCTCA AGGTGTTTGA GGCAGAGCAG TTTGGATGCC CACAGCGTGC TCAGAGGATG
AACACAGCCT TCACGCCATT CCTACACCAG AGGAACGGCA ACGCCGCCCG CTCGCTGACA
TCGCTGACAA GTGATGACAA CCTGTGGGCG TGCCTGCACA CCTCCTTTGC CTGGCTCCTG
AAGGCGTGTG GCAGCCGGCT GACCGAGAAG CTCCTGGAAG GTGCTCCGAC CGAGGATACC
TTGGTCCAGA TGGAGAAGCT CGCTGATTTA GAAGAGGAAT CAGAAAGCTG GGACAACTCT
GAGGCTGAAG AGGAGGAGAA AGCCCCTGTG TTGCCAGAGA GTACAGAAGG GCGGGAGCTG
ACCCAGGGCC CGGCAGAGTC CTCCTCTCTC TCAGGCTGTG GGAGCTGGCA GCCCCGGAAG
CTGCCAGTCT TCAAGTCCCT CCGGCACATG AGGCAGGTCC TGGGTGCCCC TTCTTTCCGC
ATGCTGGCCT GGCACGTTCT CATGGGGAAC CAGGTGATCT GGAAAAGCAG AGACGTGGAC
CTCGTCCAGT CAGCTTTTGA AGTACTTCGG ACCATGCTTC CCGTGGGCTG CGTCCGCATC
ATCCCATACA GCAGCCAGTA CGAGGAGGCC TATCGGTGCA ACTTCCTGGG GCTCAGCCCG
CACGTGCAGA TCCCCCCCCA CGTGCTCTCC TCAGAGTTTG CTGTCATCGT GGAGGTCCAC
GCAGCCGCAC GTTCCACCCT CCACCCTGTG GGGTGTGAGG ATGACCAGTC TCTCAGCAAG
TACGAGTTTG TGGTGACCAG TGGGAGCCCT GTAGCTGCAG ACCGAGTGGG CCCCACCATC
CTGAATAAGA TTGAAGCGGC TCTGACCAAC CAGAACCTGT CTGTGGATGT GGTGGACCAG
TGCCTCGTCT GCCTCAAGGA GGAGTGGATG AACAAAGTGA AGGTGCTTTT TAAGTTCACC
AAGGTGGACA GTCGACCCAA AGAGGACACA CAGAAGCTGC TGAGCATCCT GGGTGCGTCC
GAGGAGGACA ATGTCAAGCT GCTGAAGTTC TGGATGACTG GCCTGAGCAA GACCTACAAG
TCACACCTCA TGTCCACGGT CCGCAGCCCC ACAGCCTCGG AGTCTCGGAA CTGA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_011522016.1
CDS505..2298
Misc Feature(1)814..1359(+)
Translation
Position Chain Variation Link
18 18 c, g dbSNP:1736209
24 24 a, g dbSNP:207476321
25 25 c, g dbSNP:564584154
37 37 a, c dbSNP:207476320
39 39 c, t dbSNP:575905361
53 53 a, c dbSNP:562310783
60 60 a, g dbSNP:542327641
74 74 c, t dbSNP:138847774
75 75 c, t dbSNP:553452028
78 78 a, g dbSNP:539415254
130 130 c, t dbSNP:577176265
164 164 g, t dbSNP:528481171
167 167 c, g dbSNP:557719136
168 168 a, g dbSNP:537792180
187 187 c, t dbSNP:180900492
203 203 a, g dbSNP:41345949
205 205 c, g dbSNP:548796445
206 206 c, t dbSNP:1708629
221 221 c, g dbSNP:78262456
223 223 c, g dbSNP:78918950
225 225 g, t dbSNP:75014442
248 248 a, g dbSNP:370286675
276 276 -, ggtaggcgggggtctgagg dbSNP:370486376
329 329 a, g dbSNP:117215381
362 362 a, c, t dbSNP:560968516
364 364 g, t dbSNP:541105214
371 371 c, t dbSNP:116581458
408 408 c, t dbSNP:114481741
412 412 c, t dbSNP:115413827
413 413 a, g dbSNP:756416340
415 415 a, g dbSNP:8069957
426 426 a, g dbSNP:535864585
427 427 c, g dbSNP:147598893
440 440 a, g dbSNP:145125741
447 447 c, t dbSNP:140144170
460 460 a, g dbSNP:571154058
476 476 a, g dbSNP:151144873
493 493 c, t dbSNP:779391001
497 497 a, g dbSNP:369632481
516 516 c, t dbSNP:752123350
517 517 a, g dbSNP:767235709
537 537 c, t dbSNP:754616167
538 538 a, g dbSNP:751171641
546 546 c, t dbSNP:766288960
547 547 a, g dbSNP:539468848
549 549 c, t dbSNP:773349151
553 553 -, c dbSNP:758385503
553 553 c, t dbSNP:765251703
554 554 c, g dbSNP:398124537
556 556 a, g dbSNP:761993256
564 564 c, t dbSNP:776605909
569 569 c, t dbSNP:768734584
570 570 a, g dbSNP:747210367
574 574 g, t dbSNP:775626774
579 579 a, g dbSNP:200350612
582 582 c, t dbSNP:746222481
583 583 a, g dbSNP:779449668
584 584 c, t dbSNP:757670898
586 586 c, t dbSNP:749758787
587 587 -, c dbSNP:398124540
587 587 c, g dbSNP:780588085
588 588 a, g dbSNP:754450145
590 590 c, t dbSNP:150051278
594 594 c, t dbSNP:766122649
597 597 a, g dbSNP:758326533
598 598 c, g dbSNP:750221380
599 599 a, g dbSNP:587778366
601 601 c, g dbSNP:386833401
603 603 a, t dbSNP:375348725
617 617 g, t dbSNP:139418842
633 633 c, g dbSNP:760808366
638 638 c, g, t dbSNP:556510460
639 639 a, g dbSNP:759930161
643 643 c, g dbSNP:369115472
662 662 a, g dbSNP:771056209
672 672 c, t dbSNP:774725046
673 673 c, t dbSNP:746507528
674 674 a, g dbSNP:749770193
679 679 c, t dbSNP:778275358
680 680 a, g, t dbSNP:374969279
683 683 c, t dbSNP:779900587
685 685 c, g dbSNP:758156813
693 693 c, t dbSNP:750047828
694 694 a, g dbSNP:778587763
698 698 a, c dbSNP:757012294
701 701 a, g dbSNP:753787458
705 705 c, g dbSNP:764082089
706 706 a, g dbSNP:587778365
708 708 c, t dbSNP:371947198
709 709 a, g dbSNP:567617762
711 711 c, t dbSNP:759772780
712 712 a, g dbSNP:554247745
714 714 a, g dbSNP:771202158
715 715 c, t dbSNP:763369657
725 725 c, t dbSNP:773648142
726 726 a, g dbSNP:770311645
734 734 a, c dbSNP:746556970
739 739 -, tcgg dbSNP:750146811
739 739 g, t dbSNP:779733014
740 740 c, g dbSNP:137852930
741 741 a, g dbSNP:771650940
745 745 a, g dbSNP:745521431
750 750 c, t dbSNP:150712346
751 751 a, g dbSNP:757060348
761 761 a, g dbSNP:765550303
772 772 g, t dbSNP:141140415
775 775 a, g dbSNP:781100382
778 778 c, t dbSNP:755107067
779 779 a, g dbSNP:751634275
782 782 c, t dbSNP:766548696
783 783 a, g dbSNP:138688941
786 786 a, g dbSNP:750553308
800 800 -, a dbSNP:398124534
809 809 a, c dbSNP:765702734
810 810 c, t dbSNP:762265819
812 812 a, c dbSNP:777336970
815 815 c, t dbSNP:764679174
819 819 a, g dbSNP:759011359
822 822 c, t dbSNP:773946854
823 823 cac, gt dbSNP:398124535
850 850 a, c, t dbSNP:398124536
851 851 -, a dbSNP:776896550
869 869 c, g dbSNP:748979393
939 939 c, t dbSNP:140220661
946 946 a, t dbSNP:752261491
953 953 a, g dbSNP:539457096
960 960 c, t dbSNP:756563416
979 979 a, g dbSNP:375921200
985 985 -, ttc dbSNP:764153620
987 987 c, t dbSNP:773792624
988 988 a, g dbSNP:372918705
1002 1002 c, t dbSNP:376825814
1003 1003 a, g dbSNP:752014050
1004 1004 -, g dbSNP:727504645
1008 1008 c, t dbSNP:200672897
1009 1009 a, g dbSNP:147164515
1010 1010 c, t dbSNP:373794943
1014 1014 c, t dbSNP:763630763
1027 1027 -, ttc dbSNP:786203218
1040 1040 a, g dbSNP:760556162
1047 1047 a, c dbSNP:775176038
1053 1053 c, t dbSNP:767290984
1057 1057 c, t dbSNP:587782069
1059 1059 c, g dbSNP:772775816
1060 1060 c, t dbSNP:587778367
1061 1061 a, g dbSNP:759556434
1093 1093 c, t dbSNP:774358971
1094 1094 g, t dbSNP:369906553
1096 1096 a, c dbSNP:771205573
1102 1102 c, t dbSNP:749368513
1104 1104 c, t dbSNP:773535830
1110 1110 a, c dbSNP:143525924
1113 1113 c, t dbSNP:748363919
1123 1123 c, t dbSNP:781433539
1125 1125 a, g dbSNP:755278796
1127 1127 -, g dbSNP:34867548
1129 1129 a, g dbSNP:747581757
1138 1138 c, t dbSNP:138070947
1139 1139 a, g dbSNP:756807584
1144 1144 a, g dbSNP:201078144
1149 1149 c, t dbSNP:763617124
1150 1150 a, c, g dbSNP:200168437
1161 1161 c, g, t dbSNP:759405317
1162 1162 a, g dbSNP:774491699
1168 1168 gc, ta dbSNP:398124538
1169 1169 c, t dbSNP:766401197
1170 1170 a, g dbSNP:763168749
1192 1192 a, c dbSNP:558699420
1202 1202 a, g dbSNP:370074267
1203 1203 c, t dbSNP:772360950
1205 1205 -, c dbSNP:772407910
1211 1211 a, g dbSNP:367843558
1226 1226 a, g dbSNP:779467022
1231 1231 a, g dbSNP:769250170
1238 1238 c, t dbSNP:747675386
1239 1239 a, g dbSNP:781035304
1245 1245 c, t dbSNP:754710935
1248 1248 a, c dbSNP:373977390
1254 1254 g, t dbSNP:780010668
1261 1261 a, g dbSNP:200693409
1266 1266 c, t dbSNP:750394475
1269 1269 c, t dbSNP:111258744
1273 1273 c, t dbSNP:78683075
1274 1274 a, g dbSNP:753948488
1278 1278 a, g dbSNP:186366202
1283 1283 c, t dbSNP:536249722
1284 1284 a, t dbSNP:113938514
1287 1287 a, g dbSNP:377261933
1289 1289 c, t dbSNP:759928360
1292 1292 a, c dbSNP:371401039
1293 1293 a, c, g, t dbSNP:150175875
1294 1294 a, g dbSNP:768225327
1303 1303 a, c dbSNP:747429545
1314 1314 a, g dbSNP:746664975
1316 1316 a, g dbSNP:779849453
1337 1337 a, g dbSNP:368778627
1339 1339 c, t dbSNP:751677461
1349 1349 c, t dbSNP:372304384
1350 1350 a, g dbSNP:140500421
1359 1359 c, g, t dbSNP:765807221
1360 1360 c, t dbSNP:762370059
1361 1361 a, g dbSNP:775085512
1362 1362 g, t dbSNP:771424902
1368 1368 a, c, g, t dbSNP:372342796
1377 1377 c, t dbSNP:749057444
1380 1380 a, g dbSNP:777731843
1383 1383 a, g dbSNP:769758699
1387 1387 -, tg dbSNP:398124539
1391 1391 c, t dbSNP:748031634
1392 1392 a, g, t dbSNP:146801028
1395 1395 c, t dbSNP:751877389
1400 1400 a, g dbSNP:780125534
1403 1403 c, t dbSNP:758884167
1404 1404 c, t dbSNP:750848964
1410 1410 c, t dbSNP:765647841
1412 1412 -, tcca dbSNP:771374314
1425 1425 a, c, t dbSNP:367562964
1426 1426 a, g dbSNP:767119281
1431 1431 c, t dbSNP:767527483
1432 1432 c, t dbSNP:759503601
1446 1446 a, g dbSNP:774591810
1448 1448 -, aaag dbSNP:398124541
1448 1448 a, g dbSNP:770988236
1453 1453 g, t dbSNP:763092545
1464 1464 -, t dbSNP:757111995
1466 1466 a, g dbSNP:773482946
1473 1473 a, g dbSNP:551034228
1486 1486 a, g dbSNP:748491270
1489 1489 c, t dbSNP:140246224
1491 1491 c, t dbSNP:769183979
1497 1497 a, g dbSNP:558365108
1499 1499 a, c dbSNP:747467294
1501 1501 g, t dbSNP:587781952
1507 1507 a, g dbSNP:147142086
1510 1510 a, g dbSNP:756787389
1512 1512 -, agcccctgtgttgccagagagtacagaa dbSNP:398124542
1513 1513 c, g dbSNP:753491072
1516 1516 c, t dbSNP:777456756
1517 1517 a, g dbSNP:143483053
1529 1529 a, c, g dbSNP:767368450
1533 1533 c, t dbSNP:530884373
1534 1534 c, t dbSNP:751478971
1535 1535 c, t dbSNP:138031155
1539 1539 a, g dbSNP:763078516
1542 1542 a, g dbSNP:773355729
1544 1544 c, t dbSNP:770027312
1548 1548 c, t dbSNP:761984486
1550 1550 c, t dbSNP:202215080
1551 1551 c, t dbSNP:768940625
1560 1560 c, t dbSNP:747579747
1562 1562 a, g dbSNP:780597146
1579 1579 c, t dbSNP:770396757
1580 1580 a, g dbSNP:375352888
1584 1584 c, g dbSNP:777103374
1593 1593 c, g dbSNP:755850825
1598 1598 a, g dbSNP:752337482
1602 1602 c, t dbSNP:200224064
1607 1607 a, g dbSNP:190786280
1617 1617 a, g dbSNP:751513488
1618 1618 c, t dbSNP:398124523
1624 1624 c, g dbSNP:757313788
1626 1626 g, t dbSNP:534904034
1633 1633 c, t dbSNP:184718358
1642 1642 c, t dbSNP:557336321
1643 1643 g, t dbSNP:559055296
1660 1660 a, g dbSNP:767714543
1665 1665 c, t dbSNP:786202175
1667 1667 c, t dbSNP:200877872
1675 1675 a, c, t dbSNP:398124524
1691 1691 a, g dbSNP:769489773
1693 1693 a, g dbSNP:747644007
1696 1696 c, g dbSNP:776467886
1698 1698 c, t dbSNP:768454196
1707 1707 c, t dbSNP:150752548
1708 1708 a, g dbSNP:779913370
1712 1712 a, t dbSNP:758063582
1713 1713 g, t dbSNP:141250189
1733 1733 a, g dbSNP:570066243
1737 1737 a, c dbSNP:755413587
1737 1737 -, c dbSNP:398124525
1747 1747 a, g dbSNP:752006809
1751 1751 c, g dbSNP:766801011
1752 1752 c, t dbSNP:763569367
1755 1755 c, t dbSNP:750894316
1756 1756 a, g, t dbSNP:148257120
1757 1757 c, t dbSNP:760079073
1759 1759 c, t dbSNP:143183215
1760 1760 a, g dbSNP:771653740
1761 1761 -, c dbSNP:398124526
1773 1773 c, g dbSNP:786202541
1774 1774 a, g dbSNP:528541881
1782 1782 g, t dbSNP:774142829
1785 1785 c, t dbSNP:561236067
1786 1786 a, g dbSNP:763591386
1788 1788 a, g dbSNP:749287631
1791 1791 a, g dbSNP:61750032
1794 1794 c, t dbSNP:769968368
1800 1800 g, t dbSNP:376836624
1803 1803 c, t dbSNP:748148728
1805 1805 a, g dbSNP:781295687
1813 1813 a, g dbSNP:527859185
1814 1814 g, t dbSNP:755177473
1815 1815 a, g dbSNP:747171802
1818 1818 c, t dbSNP:780571501
1820 1820 a, g dbSNP:368175757
1823 1823 c, t dbSNP:565447853
1824 1824 a, g dbSNP:751013842
1825 1825 c, t dbSNP:765628527
1827 1827 c, t dbSNP:41464156
1829 1829 c, t dbSNP:752170592
1832 1832 a, g dbSNP:786203348
1835 1835 c, t dbSNP:766990565
1836 1836 c, t dbSNP:41459448
1837 1837 a, c dbSNP:773986076
1838 1838 a, c dbSNP:766218250
1839 1839 c, g dbSNP:372207262
1840 1840 c, g dbSNP:368880414
1841 1841 a, c, g, t dbSNP:199889477
1843 1843 -, c dbSNP:80338682
1843 1843 a, c, t dbSNP:375082054
1843 1843 -, c dbSNP:80338683
1845 1845 c, t dbSNP:374707789
1850 1850 c, t dbSNP:758871984
1854 1854 -, ctc dbSNP:763354508
1863 1863 -, t dbSNP:398124527
1866 1866 g, t dbSNP:775722367
1867 1867 a, c, g dbSNP:772207015
1870 1870 a, t dbSNP:759743111
1872 1872 a, c, t dbSNP:771247255
1873 1873 a, g dbSNP:112980409
1884 1884 c, t dbSNP:145004158
1885 1885 a, g dbSNP:535236784
1890 1890 a, c, t dbSNP:141283741
1891 1891 a, g dbSNP:41419545
1894 1894 c, t dbSNP:200724468
1895 1895 a, g dbSNP:750104212
1896 1896 c, t dbSNP:569587785
1908 1908 a, c, t dbSNP:753685944
1912 1912 a, g dbSNP:763920904
1914 1914 a, g dbSNP:760690745
1917 1917 a, g dbSNP:752677061
1918 1918 c, t dbSNP:767762804
1921 1921 a, g dbSNP:759637055
1922 1922 a, g dbSNP:199786696
1931 1931 a, g dbSNP:150439088
1934 1934 c, t dbSNP:377468280
1937 1937 c, t dbSNP:112196863
1938 1938 c, t dbSNP:773581294
1941 1941 c, t dbSNP:772310968
1945 1945 c, t dbSNP:770077517
1947 1947 c, g, t dbSNP:137852929
1962 1962 c, t dbSNP:777113065
1972 1972 c, g dbSNP:151312899
1976 1976 c, t dbSNP:144883828
1977 1977 a, c dbSNP:141036419
1986 1986 c, g dbSNP:756944795
1988 1988 a, g dbSNP:748878853
1990 1990 c, g dbSNP:777774091
1997 1997 c, t dbSNP:745720578
2000 2000 c, g dbSNP:781081891
2016 2016 -, ataagatt dbSNP:757197845
2017 2017 g, t dbSNP:786202475
2021 2021 c, t dbSNP:200660337
2022 2022 a, g dbSNP:747029882
2023 2023 a, g dbSNP:757222242
2034 2034 c, t dbSNP:779837933
2037 2037 a, g dbSNP:758516602
2045 2045 c, g dbSNP:750535468
2066 2066 c, g dbSNP:778904029
2070 2070 c, t dbSNP:757471403
2071 2071 a, g dbSNP:376715412
2080 2080 -, aag dbSNP:398124529
2081 2081 a, g dbSNP:199643834
2088 2088 a, g dbSNP:531459106
2091 2091 a, g dbSNP:398124530
2117 2117 a, g dbSNP:142288285
2137 2137 -, a dbSNP:753009073
2138 2138 a, g dbSNP:777826268
2148 2148 c, g dbSNP:756318617
2152 2152 a, c dbSNP:753023144
2155 2155 c, t dbSNP:398124532
2157 2157 c, g dbSNP:190965235
2178 2178 c, t dbSNP:755548579
2179 2179 a, g dbSNP:752108683
2180 2180 c, t dbSNP:764899882
2181 2181 a, g dbSNP:185419942
2185 2185 a, g dbSNP:776389684
2190 2190 a, g dbSNP:763688092
2193 2193 c, g dbSNP:760329266
2195 2195 a, g dbSNP:775149348
2202 2202 c, g dbSNP:771847652
2211 2211 a, g dbSNP:745859406
2225 2225 -, a dbSNP:767479616
2225 2225 c, g dbSNP:774247151
2235 2235 a, g dbSNP:771038343
2243 2243 a, g dbSNP:749359334
2250 2250 c, t dbSNP:201810397
2255 2255 c, t dbSNP:756302545
2260 2260 a, g dbSNP:748337450
2261 2261 c, t dbSNP:781733528
2262 2262 a, g dbSNP:147554296
2266 2266 c, t dbSNP:752161850
2267 2267 a, g dbSNP:201056799
2275 2275 a, t dbSNP:758901704
2276 2276 c, t dbSNP:753313171
2282 2282 c, t dbSNP:763604691
2283 2283 a, g dbSNP:760307957
2290 2290 c, t dbSNP:775107483
2295 2295 c, t dbSNP:767345167
2299 2299 c, t dbSNP:759292330
2301 2301 c, t dbSNP:774091922
2302 2302 a, g dbSNP:770795599
2306 2306 a, c, t dbSNP:773168989
2312 2312 a, c, t dbSNP:748379299
2315 2315 g, t dbSNP:115885284
2316 2316 c, t dbSNP:370269600
2328 2328 a, g dbSNP:747413239
2330 2330 c, t dbSNP:780520253
2333 2333 c, t dbSNP:149134801
2340 2340 c, t dbSNP:750934121
2349 2349 c, t dbSNP:777203555
2351 2351 a, t dbSNP:111861140
2356 2356 c, t dbSNP:535022712
2385 2385 a, c dbSNP:778606717
2386 2386 a, g dbSNP:754626617
2389 2389 g, t dbSNP:564383830
2476 2476 a, g dbSNP:145430714
2491 2491 a, g dbSNP:144507152
2496 2496 a, c dbSNP:771890381
2518 2518 a, t dbSNP:541599658
2521 2521 c, t dbSNP:76272341
2522 2522 a, g dbSNP:541003301
2551 2551 a, g dbSNP:774288275
2553 2553 c, g dbSNP:564245440
2566 2566 c, t dbSNP:180873537
2619 2619 c, t dbSNP:139734855
2621 2621 a, g dbSNP:571999061
2631 2631 c, t dbSNP:750896108
2642 2642 c, g dbSNP:554190238
2654 2654 g, t dbSNP:7224474
2677 2677 a, g dbSNP:117436649
2691 2691 a, g dbSNP:12602675
2701 2701 c, t dbSNP:188840802
2723 2723 a, g dbSNP:7224335
2740 2740 c, t dbSNP:7224213
2778 2778 a, c dbSNP:146851795
2780 2780 a, c dbSNP:574471240
2794 2794 -, gtga dbSNP:778371655
2808 2808 g, t dbSNP:537259057
2824 2824 c, t dbSNP:574547835
2826 2826 a, g dbSNP:184006653
2838 2838 g, t dbSNP:181935335
2855 2855 c, t dbSNP:3803761
2878 2878 c, t dbSNP:566100851
2932 2932 a, c dbSNP:199572622
2936 2936 c, t dbSNP:780240981
2978 2978 a, g dbSNP:539709518
2993 2993 c, t dbSNP:775700421
3012 3012 a, c dbSNP:189888135
3015 3015 a, t dbSNP:550746288
3037 3037 c, t dbSNP:558952732
3039 3039 c, g dbSNP:530771625
3084 3084 a, g dbSNP:143768653
3092 3092 a, g dbSNP:139529824
3119 3119 a, g dbSNP:770643935
3126 3126 g, t dbSNP:750900491
3148 3148 c, g dbSNP:185759963
3149 3149 -, c dbSNP:748168795
3209 3209 a, g dbSNP:571893996
3212 3212 c, t dbSNP:7223831
3254 3254 a, g dbSNP:141650706
3299 3299 a, g dbSNP:532627636
3333 3333 c, t dbSNP:566019526
3343 3343 a, g dbSNP:563644388
3360 3360 a, g dbSNP:771952210
3399 3399 c, t dbSNP:543608114
3413 3413 a, g dbSNP:574733214
3449 3449 c, t dbSNP:62064407
3451 3451 -, tttt dbSNP:397932764
3477 3477 a, t dbSNP:540609895
3480 3480 -, a dbSNP:199535675
3532 3532 a, g dbSNP:747663295
3542 3542 c, t dbSNP:554751440
3544 3544 c, g dbSNP:541543491
3587 3587 a, g dbSNP:572462992
3596 3596 c, t dbSNP:558869941
3634 3634 g, t dbSNP:7218992
3650 3650 g, t dbSNP:11654407
3664 3664 a, g dbSNP:754539748
3688 3688 c, g dbSNP:570755484
3691 3691 a, g dbSNP:557330837
3701 3701 c, t dbSNP:7218795
3710 3710 a, g dbSNP:568272777

Target ORF information:

RefSeq Version XM_011523714
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X1, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_011523714

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
ATGAATGCCA TCGTGGCTCT CTGCCACTTC TGCGAGCTCC ACGGCCCCCG CACTCTCTTC 
TGCACGGAGG TGCTGCACGC CCCACTTCCT CAAGGGGATG GGAATGAGGA CAGTCCTGGC
CAGGGTGAGC AGGCGGAAGA AGAGGAAGGT GGCATTCAGA TGAACAGTCG GATGCGTGCG
CACAGCCCCG CAGAGGGGGC CAGCGTCGAG TCCAGCAGCC CGGGGCCCAA AAAGTCGGAC
ATGTGCGAGG GCTGCCGGTC ACTTGCTGCA GGGCACCCGG GATATATCAG CCATGATAAA
GAGACCTCCA TTAAATACGT CAGCCACCAG CACCCCAGCC ACCCCCAGCT CTTCAGCATT
GTCCGCCAGG CCTGTGTCCG GAGCCTGAGC TGTGAGTGCA GGGAGAGTGC AGTGGCTGCT
CTGACCTGCT GGTTCTTCTG CATGCTCCAG GTCTGCCCTG GCCGTGAAGG CCCCATCTTC
TTCGGAGATG AGCAGCACGG CTTTGTGTTC AGCCACACCT TCTTCATCAA GGACAGCCTG
GCCAGGGGCT TCCAGCGCTG GTACAGCATC ATCACCATCA TGATGGACCG GATCTACCTC
ATCAACTCCT GGCCCTTCCT GCTGGGGAAG GTCCGGGGAA TCATCGATGA GCTCCAGGGC
AAGGCGCTCA AGGTGTTTGA GGCAGAGCAG TTTGGATGCC CACAGCGTGC TCAGAGGATG
AACACAGCCT TCACGCCATT CCTACACCAG AGGAACGGCA ACGCCGCCCG CTCGCTGACA
TCGCTGACAA GTGATGACAA CCTGTGGGCG TGCCTGCACA CCTCCTTTGC CTGGCTCCTG
AAGGCGTGTG GCAGCCGGCT GACCGAGAAG CTCCTGGAAG GTGCTCCGAC CGAGGATACC
TTGGTCCAGA TGGAGAAGCT CGCTGATTTA GAAGAGGAAT CAGAAAGCTG GGACAACTCT
GAGGCTGAAG AGGAGGAGAA AGCCCCTGTG TTGCCAGAGA GTACAGAAGG GCGGGAGCTG
ACCCAGGGCC CGGCAGAGTC CTCCTCTCTC TCAGGCTGTG GGAGCTGGCA GCCCCGGAAG
CTGCCAGTCT TCAAGTCCCT CCGGCACATG AGGCAGGTCC TGGGTGCCCC TTCTTTCCGC
ATGCTGGCCT GGCACGTTCT CATGGGGAAC CAGGTGATCT GGAAAAGCAG AGACGTGGAC
CTCGTCCAGT CAGCTTTTGA AGTACTTCGG ACCATGCTTC CCGTGGGCTG CGTCCGCATC
ATCCCATACA GCAGCCAGTA CGAGGAGGCC TATCGGTGCA ACTTCCTGGG GCTCAGCCCG
CACGTGCAGA TCCCCCCCCA CGTGCTCTCC TCAGAGTTTG CTGTCATCGT GGAGGTCCAC
GCAGCCGCAC GTTCCACCCT CCACCCTGTG GGGTGTGAGG ATGACCAGTC TCTCAGCAAG
TACGAGTTTG TGGTGACCAG TGGGAGCCCT GTAGCTGCAG ACCGAGTGGG CCCCACCATC
CTGAATAAGA TTGAAGCGGC TCTGACCAAC CAGAACCTGT CTGTGGATGT GGTGGACCAG
TGCCTCGTCT GCCTCAAGGA GGAGTGGATG AACAAAGTGA AGGTGCTTTT TAAGTTCACC
AAGGTGGACA GTCGACCCAA AGAGGACACA CAGAAGCTGC TGAGCATCCT GGGTGCGTCC
GAGGAGGACA ATGTCAAGCT GCTGAAGTTC TGGATGACTG GCCTGAGCAA GACCTACAAG
TCACACCTCA TGTCCACGGT CCGCAGCCCC ACAGCCTCGG AGTCTCGGAA CTGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu77698
Accession Version XM_011523715.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1794bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product folliculin isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010718.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
ATGAATGCCA TCGTGGCTCT CTGCCACTTC TGCGAGCTCC ACGGCCCCCG CACTCTCTTC 
TGCACGGAGG TGCTGCACGC CCCACTTCCT CAAGGGGATG GGAATGAGGA CAGTCCTGGC
CAGGGTGAGC AGGCGGAAGA AGAGGAAGGT GGCATTCAGA TGAACAGTCG GATGCGTGCG
CACAGCCCCG CAGAGGGGGC CAGCGTCGAG TCCAGCAGCC CGGGGCCCAA AAAGTCGGAC
ATGTGCGAGG GCTGCCGGTC ACTTGCTGCA GGGCACCCGG GATATATCAG CCATGATAAA
GAGACCTCCA TTAAATACGT CAGCCACCAG CACCCCAGCC ACCCCCAGCT CTTCAGCATT
GTCCGCCAGG CCTGTGTCCG GAGCCTGAGC TGTGAGTGCA GGGAGAGTGC AGTGGCTGCT
CTGACCTGCT GGTTCTTCTG CATGCTCCAG GTCTGCCCTG GCCGTGAAGG CCCCATCTTC
TTCGGAGATG AGCAGCACGG CTTTGTGTTC AGCCACACCT TCTTCATCAA GGACAGCCTG
GCCAGGGGCT TCCAGCGCTG GTACAGCATC ATCACCATCA TGATGGACCG GATCTACCTC
ATCAACTCCT GGCCCTTCCT GCTGGGGAAG GTCCGGGGAA TCATCGATGA GCTCCAGGGC
AAGGCGCTCA AGGTGTTTGA GGCAGAGCAG TTTGGATGCC CACAGCGTGC TCAGAGGATG
AACACAGCCT TCACGCCATT CCTACACCAG AGGAACGGCA ACGCCGCCCG CTCGCTGACA
TCGCTGACAA GTGATGACAA CCTGTGGGCG TGCCTGCACA CCTCCTTTGC CTGGCTCCTG
AAGGCGTGTG GCAGCCGGCT GACCGAGAAG CTCCTGGAAG GTGCTCCGAC CGAGGATACC
TTGGTCCAGA TGGAGAAGCT CGCTGATTTA GAAGAGGAAT CAGAAAGCTG GGACAACTCT
GAGGCTGAAG AGGAGGAGAA AGCCCCTGTG TTGCCAGAGA GTACAGAAGG GCGGGAGCTG
ACCCAGGGCC CGGCAGAGTC CTCCTCTCTC TCAGGCTGTG GGAGCTGGCA GCCCCGGAAG
CTGCCAGTCT TCAAGTCCCT CCGGCACATG AGGCAGGTCC TGGGTGCCCC TTCTTTCCGC
ATGCTGGCCT GGCACGTTCT CATGGGGAAC CAGGTGATCT GGAAAAGCAG AGACGTGGAC
CTCGTCCAGT CAGCTTTTGA AGTACTTCGG ACCATGCTTC CCGTGGGCTG CGTCCGCATC
ATCCCATACA GCAGCCAGTA CGAGGAGGCC TATCGGTGCA ACTTCCTGGG GCTCAGCCCG
CACGTGCAGA TCCCCCCCCA CGTGCTCTCC TCAGAGTTTG CTGTCATCGT GGAGGTCCAC
GCAGCCGCAC GTTCCACCCT CCACCCTGTG GGGTGTGAGG ATGACCAGTC TCTCAGCAAG
TACGAGTTTG TGGTGACCAG TGGGAGCCCT GTAGCTGCAG ACCGAGTGGG CCCCACCATC
CTGAATAAGA TTGAAGCGGC TCTGACCAAC CAGAACCTGT CTGTGGATGT GGTGGACCAG
TGCCTCGTCT GCCTCAAGGA GGAGTGGATG AACAAAGTGA AGGTGCTTTT TAAGTTCACC
AAGGTGGACA GTCGACCCAA AGAGGACACA CAGAAGCTGC TGAGCATCCT GGGTGCGTCC
GAGGAGGACA ATGTCAAGCT GCTGAAGTTC TGGATGACTG GCCTGAGCAA GACCTACAAG
TCACACCTCA TGTCCACGGT CCGCAGCCCC ACAGCCTCGG AGTCTCGGAA CTGA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_011522017.1
CDS1249..3042
Misc Feature(1)1558..2103(+)
Translation
Position Chain Variation Link
18 18 c, g dbSNP:1736209
24 24 a, g dbSNP:207476321
25 25 c, g dbSNP:564584154
37 37 a, c dbSNP:207476320
39 39 c, t dbSNP:575905361
53 53 a, c dbSNP:562310783
60 60 a, g dbSNP:542327641
74 74 c, t dbSNP:138847774
75 75 c, t dbSNP:553452028
78 78 a, g dbSNP:539415254
130 130 c, t dbSNP:577176265
164 164 g, t dbSNP:528481171
167 167 c, g dbSNP:557719136
168 168 a, g dbSNP:537792180
187 187 c, t dbSNP:180900492
203 203 a, g dbSNP:41345949
205 205 c, g dbSNP:548796445
206 206 c, t dbSNP:1708629
221 221 c, g dbSNP:78262456
223 223 c, g dbSNP:78918950
225 225 g, t dbSNP:75014442
248 248 a, g dbSNP:370286675
276 276 -, ggtaggcgggggtctgagg dbSNP:370486376
329 329 a, g dbSNP:117215381
362 362 a, c, t dbSNP:560968516
364 364 g, t dbSNP:541105214
371 371 c, t dbSNP:116581458
408 408 c, t dbSNP:114481741
412 412 c, t dbSNP:115413827
413 413 a, g dbSNP:756416340
415 415 a, g dbSNP:8069957
426 426 a, g dbSNP:535864585
427 427 c, g dbSNP:147598893
440 440 a, g dbSNP:145125741
447 447 c, t dbSNP:140144170
460 460 a, g dbSNP:571154058
476 476 a, g dbSNP:151144873
498 498 c, t dbSNP:1736215
528 528 a, g dbSNP:117827241
534 534 c, t dbSNP:79717038
544 544 c, t dbSNP:758047209
573 573 c, g dbSNP:528401271
611 611 c, t dbSNP:753086978
616 616 c, t dbSNP:533687652
666 666 c, g dbSNP:545983207
686 686 c, g dbSNP:116438960
691 691 -, ctc dbSNP:528431686
699 699 -, a dbSNP:572591896
708 708 a, g dbSNP:555731464
745 745 -, c dbSNP:559377745
749 749 a, g dbSNP:543198678
752 752 c, g dbSNP:574363104
769 769 a, c dbSNP:146246174
784 784 a, g dbSNP:541043827
790 790 c, t dbSNP:572369766
791 791 a, t dbSNP:558834443
793 793 -, cc dbSNP:540656367
797 797 g, t dbSNP:538804082
799 799 -, gtat dbSNP:375495673
800 800 -, cc dbSNP:200365194
801 801 c, t dbSNP:112002657
830 830 a, g dbSNP:569964752
831 831 a, g dbSNP:1708618
841 841 a, g dbSNP:185401594
843 843 g, t dbSNP:766570505
844 844 a, g dbSNP:763224453
860 860 a, g dbSNP:181549149
874 874 a, g dbSNP:760682564
881 881 c, t dbSNP:532847715
924 924 a, g dbSNP:142149319
940 940 c, t dbSNP:750557906
943 943 c, t dbSNP:565937473
959 959 a, g dbSNP:761981111
982 982 a, g dbSNP:75336342
986 986 c, t dbSNP:532342547
1011 1011 c, t dbSNP:563376820
1055 1055 c, t dbSNP:543487724
1059 1059 a, g dbSNP:529727139
1085 1085 a, g dbSNP:561055780
1121 1121 a, g dbSNP:761617653
1143 1143 c, t dbSNP:540630142
1145 1145 a, c dbSNP:571710524
1185 1185 a, g dbSNP:764888176
1186 1186 c, t dbSNP:759415328
1187 1187 a, t dbSNP:565505709
1194 1194 a, g dbSNP:545337155
1198 1198 a, c dbSNP:780421535
1219 1219 a, g dbSNP:776640058
1220 1220 c, t dbSNP:758705818
1221 1221 g, t dbSNP:746381939
1223 1223 -, g dbSNP:35936022
1237 1237 c, t dbSNP:779391001
1241 1241 a, g dbSNP:369632481
1260 1260 c, t dbSNP:752123350
1261 1261 a, g dbSNP:767235709
1281 1281 c, t dbSNP:754616167
1282 1282 a, g dbSNP:751171641
1290 1290 c, t dbSNP:766288960
1291 1291 a, g dbSNP:539468848
1293 1293 c, t dbSNP:773349151
1297 1297 -, c dbSNP:758385503
1297 1297 c, t dbSNP:765251703
1298 1298 c, g dbSNP:398124537
1300 1300 a, g dbSNP:761993256
1308 1308 c, t dbSNP:776605909
1313 1313 c, t dbSNP:768734584
1314 1314 a, g dbSNP:747210367
1318 1318 g, t dbSNP:775626774
1323 1323 a, g dbSNP:200350612
1326 1326 c, t dbSNP:746222481
1327 1327 a, g dbSNP:779449668
1328 1328 c, t dbSNP:757670898
1330 1330 c, t dbSNP:749758787
1331 1331 -, c dbSNP:398124540
1331 1331 c, g dbSNP:780588085
1332 1332 a, g dbSNP:754450145
1334 1334 c, t dbSNP:150051278
1338 1338 c, t dbSNP:766122649
1341 1341 a, g dbSNP:758326533
1342 1342 c, g dbSNP:750221380
1343 1343 a, g dbSNP:587778366
1345 1345 c, g dbSNP:386833401
1347 1347 a, t dbSNP:375348725
1361 1361 g, t dbSNP:139418842
1377 1377 c, g dbSNP:760808366
1382 1382 c, g, t dbSNP:556510460
1383 1383 a, g dbSNP:759930161
1387 1387 c, g dbSNP:369115472
1406 1406 a, g dbSNP:771056209
1416 1416 c, t dbSNP:774725046
1417 1417 c, t dbSNP:746507528
1418 1418 a, g dbSNP:749770193
1423 1423 c, t dbSNP:778275358
1424 1424 a, g, t dbSNP:374969279
1427 1427 c, t dbSNP:779900587
1429 1429 c, g dbSNP:758156813
1437 1437 c, t dbSNP:750047828
1438 1438 a, g dbSNP:778587763
1442 1442 a, c dbSNP:757012294
1445 1445 a, g dbSNP:753787458
1449 1449 c, g dbSNP:764082089
1450 1450 a, g dbSNP:587778365
1452 1452 c, t dbSNP:371947198
1453 1453 a, g dbSNP:567617762
1455 1455 c, t dbSNP:759772780
1456 1456 a, g dbSNP:554247745
1458 1458 a, g dbSNP:771202158
1459 1459 c, t dbSNP:763369657
1469 1469 c, t dbSNP:773648142
1470 1470 a, g dbSNP:770311645
1478 1478 a, c dbSNP:746556970
1483 1483 -, tcgg dbSNP:750146811
1483 1483 g, t dbSNP:779733014
1484 1484 c, g dbSNP:137852930
1485 1485 a, g dbSNP:771650940
1489 1489 a, g dbSNP:745521431
1494 1494 c, t dbSNP:150712346
1495 1495 a, g dbSNP:757060348
1505 1505 a, g dbSNP:765550303
1516 1516 g, t dbSNP:141140415
1519 1519 a, g dbSNP:781100382
1522 1522 c, t dbSNP:755107067
1523 1523 a, g dbSNP:751634275
1526 1526 c, t dbSNP:766548696
1527 1527 a, g dbSNP:138688941
1530 1530 a, g dbSNP:750553308
1544 1544 -, a dbSNP:398124534
1553 1553 a, c dbSNP:765702734
1554 1554 c, t dbSNP:762265819
1556 1556 a, c dbSNP:777336970
1559 1559 c, t dbSNP:764679174
1563 1563 a, g dbSNP:759011359
1566 1566 c, t dbSNP:773946854
1567 1567 cac, gt dbSNP:398124535
1594 1594 a, c, t dbSNP:398124536
1595 1595 -, a dbSNP:776896550
1613 1613 c, g dbSNP:748979393
1683 1683 c, t dbSNP:140220661
1690 1690 a, t dbSNP:752261491
1697 1697 a, g dbSNP:539457096
1704 1704 c, t dbSNP:756563416
1723 1723 a, g dbSNP:375921200
1729 1729 -, ttc dbSNP:764153620
1731 1731 c, t dbSNP:773792624
1732 1732 a, g dbSNP:372918705
1746 1746 c, t dbSNP:376825814
1747 1747 a, g dbSNP:752014050
1748 1748 -, g dbSNP:727504645
1752 1752 c, t dbSNP:200672897
1753 1753 a, g dbSNP:147164515
1754 1754 c, t dbSNP:373794943
1758 1758 c, t dbSNP:763630763
1771 1771 -, ttc dbSNP:786203218
1784 1784 a, g dbSNP:760556162
1791 1791 a, c dbSNP:775176038
1797 1797 c, t dbSNP:767290984
1801 1801 c, t dbSNP:587782069
1803 1803 c, g dbSNP:772775816
1804 1804 c, t dbSNP:587778367
1805 1805 a, g dbSNP:759556434
1837 1837 c, t dbSNP:774358971
1838 1838 g, t dbSNP:369906553
1840 1840 a, c dbSNP:771205573
1846 1846 c, t dbSNP:749368513
1848 1848 c, t dbSNP:773535830
1854 1854 a, c dbSNP:143525924
1857 1857 c, t dbSNP:748363919
1867 1867 c, t dbSNP:781433539
1869 1869 a, g dbSNP:755278796
1871 1871 -, g dbSNP:34867548
1873 1873 a, g dbSNP:747581757
1882 1882 c, t dbSNP:138070947
1883 1883 a, g dbSNP:756807584
1888 1888 a, g dbSNP:201078144
1893 1893 c, t dbSNP:763617124
1894 1894 a, c, g dbSNP:200168437
1905 1905 c, g, t dbSNP:759405317
1906 1906 a, g dbSNP:774491699
1912 1912 gc, ta dbSNP:398124538
1913 1913 c, t dbSNP:766401197
1914 1914 a, g dbSNP:763168749
1936 1936 a, c dbSNP:558699420
1946 1946 a, g dbSNP:370074267
1947 1947 c, t dbSNP:772360950
1949 1949 -, c dbSNP:772407910
1955 1955 a, g dbSNP:367843558
1970 1970 a, g dbSNP:779467022
1975 1975 a, g dbSNP:769250170
1982 1982 c, t dbSNP:747675386
1983 1983 a, g dbSNP:781035304
1989 1989 c, t dbSNP:754710935
1992 1992 a, c dbSNP:373977390
1998 1998 g, t dbSNP:780010668
2005 2005 a, g dbSNP:200693409
2010 2010 c, t dbSNP:750394475
2013 2013 c, t dbSNP:111258744
2017 2017 c, t dbSNP:78683075
2018 2018 a, g dbSNP:753948488
2022 2022 a, g dbSNP:186366202
2027 2027 c, t dbSNP:536249722
2028 2028 a, t dbSNP:113938514
2031 2031 a, g dbSNP:377261933
2033 2033 c, t dbSNP:759928360
2036 2036 a, c dbSNP:371401039
2037 2037 a, c, g, t dbSNP:150175875
2038 2038 a, g dbSNP:768225327
2047 2047 a, c dbSNP:747429545
2058 2058 a, g dbSNP:746664975
2060 2060 a, g dbSNP:779849453
2081 2081 a, g dbSNP:368778627
2083 2083 c, t dbSNP:751677461
2093 2093 c, t dbSNP:372304384
2094 2094 a, g dbSNP:140500421
2103 2103 c, g, t dbSNP:765807221
2104 2104 c, t dbSNP:762370059
2105 2105 a, g dbSNP:775085512
2106 2106 g, t dbSNP:771424902
2112 2112 a, c, g, t dbSNP:372342796
2121 2121 c, t dbSNP:749057444
2124 2124 a, g dbSNP:777731843
2127 2127 a, g dbSNP:769758699
2131 2131 -, tg dbSNP:398124539
2135 2135 c, t dbSNP:748031634
2136 2136 a, g, t dbSNP:146801028
2139 2139 c, t dbSNP:751877389
2144 2144 a, g dbSNP:780125534
2147 2147 c, t dbSNP:758884167
2148 2148 c, t dbSNP:750848964
2154 2154 c, t dbSNP:765647841
2156 2156 -, tcca dbSNP:771374314
2169 2169 a, c, t dbSNP:367562964
2170 2170 a, g dbSNP:767119281
2175 2175 c, t dbSNP:767527483
2176 2176 c, t dbSNP:759503601
2190 2190 a, g dbSNP:774591810
2192 2192 -, aaag dbSNP:398124541
2192 2192 a, g dbSNP:770988236
2197 2197 g, t dbSNP:763092545
2208 2208 -, t dbSNP:757111995
2210 2210 a, g dbSNP:773482946
2217 2217 a, g dbSNP:551034228
2230 2230 a, g dbSNP:748491270
2233 2233 c, t dbSNP:140246224
2235 2235 c, t dbSNP:769183979
2241 2241 a, g dbSNP:558365108
2243 2243 a, c dbSNP:747467294
2245 2245 g, t dbSNP:587781952
2251 2251 a, g dbSNP:147142086
2254 2254 a, g dbSNP:756787389
2256 2256 -, agcccctgtgttgccagagagtacagaa dbSNP:398124542
2257 2257 c, g dbSNP:753491072
2260 2260 c, t dbSNP:777456756
2261 2261 a, g dbSNP:143483053
2273 2273 a, c, g dbSNP:767368450
2277 2277 c, t dbSNP:530884373
2278 2278 c, t dbSNP:751478971
2279 2279 c, t dbSNP:138031155
2283 2283 a, g dbSNP:763078516
2286 2286 a, g dbSNP:773355729
2288 2288 c, t dbSNP:770027312
2292 2292 c, t dbSNP:761984486
2294 2294 c, t dbSNP:202215080
2295 2295 c, t dbSNP:768940625
2304 2304 c, t dbSNP:747579747
2306 2306 a, g dbSNP:780597146
2323 2323 c, t dbSNP:770396757
2324 2324 a, g dbSNP:375352888
2328 2328 c, g dbSNP:777103374
2337 2337 c, g dbSNP:755850825
2342 2342 a, g dbSNP:752337482
2346 2346 c, t dbSNP:200224064
2351 2351 a, g dbSNP:190786280
2361 2361 a, g dbSNP:751513488
2362 2362 c, t dbSNP:398124523
2368 2368 c, g dbSNP:757313788
2370 2370 g, t dbSNP:534904034
2377 2377 c, t dbSNP:184718358
2386 2386 c, t dbSNP:557336321
2387 2387 g, t dbSNP:559055296
2404 2404 a, g dbSNP:767714543
2409 2409 c, t dbSNP:786202175
2411 2411 c, t dbSNP:200877872
2419 2419 a, c, t dbSNP:398124524
2435 2435 a, g dbSNP:769489773
2437 2437 a, g dbSNP:747644007
2440 2440 c, g dbSNP:776467886
2442 2442 c, t dbSNP:768454196
2451 2451 c, t dbSNP:150752548
2452 2452 a, g dbSNP:779913370
2456 2456 a, t dbSNP:758063582
2457 2457 g, t dbSNP:141250189
2477 2477 a, g dbSNP:570066243
2481 2481 a, c dbSNP:755413587
2481 2481 -, c dbSNP:398124525
2491 2491 a, g dbSNP:752006809
2495 2495 c, g dbSNP:766801011
2496 2496 c, t dbSNP:763569367
2499 2499 c, t dbSNP:750894316
2500 2500 a, g, t dbSNP:148257120
2501 2501 c, t dbSNP:760079073
2503 2503 c, t dbSNP:143183215
2504 2504 a, g dbSNP:771653740
2505 2505 -, c dbSNP:398124526
2517 2517 c, g dbSNP:786202541
2518 2518 a, g dbSNP:528541881
2526 2526 g, t dbSNP:774142829
2529 2529 c, t dbSNP:561236067
2530 2530 a, g dbSNP:763591386
2532 2532 a, g dbSNP:749287631
2535 2535 a, g dbSNP:61750032
2538 2538 c, t dbSNP:769968368
2544 2544 g, t dbSNP:376836624
2547 2547 c, t dbSNP:748148728
2549 2549 a, g dbSNP:781295687
2557 2557 a, g dbSNP:527859185
2558 2558 g, t dbSNP:755177473
2559 2559 a, g dbSNP:747171802
2562 2562 c, t dbSNP:780571501
2564 2564 a, g dbSNP:368175757
2567 2567 c, t dbSNP:565447853
2568 2568 a, g dbSNP:751013842
2569 2569 c, t dbSNP:765628527
2571 2571 c, t dbSNP:41464156
2573 2573 c, t dbSNP:752170592
2576 2576 a, g dbSNP:786203348
2579 2579 c, t dbSNP:766990565
2580 2580 c, t dbSNP:41459448
2581 2581 a, c dbSNP:773986076
2582 2582 a, c dbSNP:766218250
2583 2583 c, g dbSNP:372207262
2584 2584 c, g dbSNP:368880414
2585 2585 a, c, g, t dbSNP:199889477
2587 2587 -, c dbSNP:80338682
2587 2587 a, c, t dbSNP:375082054
2587 2587 -, c dbSNP:80338683
2589 2589 c, t dbSNP:374707789
2594 2594 c, t dbSNP:758871984
2598 2598 -, ctc dbSNP:763354508
2607 2607 -, t dbSNP:398124527
2610 2610 g, t dbSNP:775722367
2611 2611 a, c, g dbSNP:772207015
2614 2614 a, t dbSNP:759743111
2616 2616 a, c, t dbSNP:771247255
2617 2617 a, g dbSNP:112980409
2628 2628 c, t dbSNP:145004158
2629 2629 a, g dbSNP:535236784
2634 2634 a, c, t dbSNP:141283741
2635 2635 a, g dbSNP:41419545
2638 2638 c, t dbSNP:200724468
2639 2639 a, g dbSNP:750104212
2640 2640 c, t dbSNP:569587785
2652 2652 a, c, t dbSNP:753685944
2656 2656 a, g dbSNP:763920904
2658 2658 a, g dbSNP:760690745
2661 2661 a, g dbSNP:752677061
2662 2662 c, t dbSNP:767762804
2665 2665 a, g dbSNP:759637055
2666 2666 a, g dbSNP:199786696
2675 2675 a, g dbSNP:150439088
2678 2678 c, t dbSNP:377468280
2681 2681 c, t dbSNP:112196863
2682 2682 c, t dbSNP:773581294
2685 2685 c, t dbSNP:772310968
2689 2689 c, t dbSNP:770077517
2691 2691 c, g, t dbSNP:137852929
2706 2706 c, t dbSNP:777113065
2716 2716 c, g dbSNP:151312899
2720 2720 c, t dbSNP:144883828
2721 2721 a, c dbSNP:141036419
2730 2730 c, g dbSNP:756944795
2732 2732 a, g dbSNP:748878853
2734 2734 c, g dbSNP:777774091
2741 2741 c, t dbSNP:745720578
2744 2744 c, g dbSNP:781081891
2760 2760 -, ataagatt dbSNP:757197845
2761 2761 g, t dbSNP:786202475
2765 2765 c, t dbSNP:200660337
2766 2766 a, g dbSNP:747029882
2767 2767 a, g dbSNP:757222242
2778 2778 c, t dbSNP:779837933
2781 2781 a, g dbSNP:758516602
2789 2789 c, g dbSNP:750535468
2810 2810 c, g dbSNP:778904029
2814 2814 c, t dbSNP:757471403
2815 2815 a, g dbSNP:376715412
2824 2824 -, aag dbSNP:398124529
2825 2825 a, g dbSNP:199643834
2832 2832 a, g dbSNP:531459106
2835 2835 a, g dbSNP:398124530
2861 2861 a, g dbSNP:142288285
2881 2881 -, a dbSNP:753009073
2882 2882 a, g dbSNP:777826268
2892 2892 c, g dbSNP:756318617
2896 2896 a, c dbSNP:753023144
2899 2899 c, t dbSNP:398124532
2901 2901 c, g dbSNP:190965235
2922 2922 c, t dbSNP:755548579
2923 2923 a, g dbSNP:752108683
2924 2924 c, t dbSNP:764899882
2925 2925 a, g dbSNP:185419942
2929 2929 a, g dbSNP:776389684
2934 2934 a, g dbSNP:763688092
2937 2937 c, g dbSNP:760329266
2939 2939 a, g dbSNP:775149348
2946 2946 c, g dbSNP:771847652
2955 2955 a, g dbSNP:745859406
2969 2969 -, a dbSNP:767479616
2969 2969 c, g dbSNP:774247151
2979 2979 a, g dbSNP:771038343
2987 2987 a, g dbSNP:749359334
2994 2994 c, t dbSNP:201810397
2999 2999 c, t dbSNP:756302545
3004 3004 a, g dbSNP:748337450
3005 3005 c, t dbSNP:781733528
3006 3006 a, g dbSNP:147554296
3010 3010 c, t dbSNP:752161850
3011 3011 a, g dbSNP:201056799
3019 3019 a, t dbSNP:758901704
3020 3020 c, t dbSNP:753313171
3026 3026 c, t dbSNP:763604691
3027 3027 a, g dbSNP:760307957
3034 3034 c, t dbSNP:775107483
3039 3039 c, t dbSNP:767345167
3043 3043 c, t dbSNP:759292330
3045 3045 c, t dbSNP:774091922
3046 3046 a, g dbSNP:770795599
3050 3050 a, c, t dbSNP:773168989
3056 3056 a, c, t dbSNP:748379299
3059 3059 g, t dbSNP:115885284
3060 3060 c, t dbSNP:370269600
3072 3072 a, g dbSNP:747413239
3074 3074 c, t dbSNP:780520253
3077 3077 c, t dbSNP:149134801
3084 3084 c, t dbSNP:750934121
3093 3093 c, t dbSNP:777203555
3095 3095 a, t dbSNP:111861140
3100 3100 c, t dbSNP:535022712
3129 3129 a, c dbSNP:778606717
3130 3130 a, g dbSNP:754626617
3133 3133 g, t dbSNP:564383830
3220 3220 a, g dbSNP:145430714
3235 3235 a, g dbSNP:144507152
3240 3240 a, c dbSNP:771890381
3262 3262 a, t dbSNP:541599658
3265 3265 c, t dbSNP:76272341
3266 3266 a, g dbSNP:541003301
3295 3295 a, g dbSNP:774288275
3297 3297 c, g dbSNP:564245440
3310 3310 c, t dbSNP:180873537
3363 3363 c, t dbSNP:139734855
3365 3365 a, g dbSNP:571999061
3375 3375 c, t dbSNP:750896108
3386 3386 c, g dbSNP:554190238
3398 3398 g, t dbSNP:7224474
3421 3421 a, g dbSNP:117436649
3435 3435 a, g dbSNP:12602675
3445 3445 c, t dbSNP:188840802
3467 3467 a, g dbSNP:7224335
3484 3484 c, t dbSNP:7224213
3522 3522 a, c dbSNP:146851795
3524 3524 a, c dbSNP:574471240
3538 3538 -, gtga dbSNP:778371655
3552 3552 g, t dbSNP:537259057
3568 3568 c, t dbSNP:574547835
3570 3570 a, g dbSNP:184006653
3582 3582 g, t dbSNP:181935335
3599 3599 c, t dbSNP:3803761
3622 3622 c, t dbSNP:566100851
3676 3676 a, c dbSNP:199572622
3680 3680 c, t dbSNP:780240981
3722 3722 a, g dbSNP:539709518
3737 3737 c, t dbSNP:775700421
3756 3756 a, c dbSNP:189888135
3759 3759 a, t dbSNP:550746288
3781 3781 c, t dbSNP:558952732
3783 3783 c, g dbSNP:530771625
3828 3828 a, g dbSNP:143768653
3836 3836 a, g dbSNP:139529824
3863 3863 a, g dbSNP:770643935
3870 3870 g, t dbSNP:750900491
3892 3892 c, g dbSNP:185759963
3893 3893 -, c dbSNP:748168795
3953 3953 a, g dbSNP:571893996
3956 3956 c, t dbSNP:7223831
3998 3998 a, g dbSNP:141650706
4043 4043 a, g dbSNP:532627636
4077 4077 c, t dbSNP:566019526
4087 4087 a, g dbSNP:563644388
4104 4104 a, g dbSNP:771952210
4143 4143 c, t dbSNP:543608114
4157 4157 a, g dbSNP:574733214
4193 4193 c, t dbSNP:62064407
4195 4195 -, tttt dbSNP:397932764
4221 4221 a, t dbSNP:540609895
4224 4224 -, a dbSNP:199535675
4276 4276 a, g dbSNP:747663295
4286 4286 c, t dbSNP:554751440
4288 4288 c, g dbSNP:541543491
4331 4331 a, g dbSNP:572462992
4340 4340 c, t dbSNP:558869941
4378 4378 g, t dbSNP:7218992
4394 4394 g, t dbSNP:11654407
4408 4408 a, g dbSNP:754539748
4432 4432 c, g dbSNP:570755484
4435 4435 a, g dbSNP:557330837
4445 4445 c, t dbSNP:7218795
4454 4454 a, g dbSNP:568272777

Target ORF information:

RefSeq Version XM_011523715
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X2, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_011523715

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
ATGAATGCCA TCGTGGCTCT CTGCCACTTC TGCGAGCTCC ACGGCCCCCG CACTCTCTTC 
TGCACGGAGG TGCTGCACGC CCCACTTCCT CAAGGGGATG GGAATGAGGA CAGTCCTGGC
CAGGGTGAGC AGGCGGAAGA AGAGGAAGGT GGCATTCAGA TGAACAGTCG GATGCGTGCG
CACAGCCCCG CAGAGGGGGC CAGCGTCGAG TCCAGCAGCC CGGGGCCCAA AAAGTCGGAC
ATGTGCGAGG GCTGCCGGTC ACTTGCTGCA GGGCACCCGG GATATATCAG CCATGATAAA
GAGACCTCCA TTAAATACGT CAGCCACCAG CACCCCAGCC ACCCCCAGCT CTTCAGCATT
GTCCGCCAGG CCTGTGTCCG GAGCCTGAGC TGTGAGTGCA GGGAGAGTGC AGTGGCTGCT
CTGACCTGCT GGTTCTTCTG CATGCTCCAG GTCTGCCCTG GCCGTGAAGG CCCCATCTTC
TTCGGAGATG AGCAGCACGG CTTTGTGTTC AGCCACACCT TCTTCATCAA GGACAGCCTG
GCCAGGGGCT TCCAGCGCTG GTACAGCATC ATCACCATCA TGATGGACCG GATCTACCTC
ATCAACTCCT GGCCCTTCCT GCTGGGGAAG GTCCGGGGAA TCATCGATGA GCTCCAGGGC
AAGGCGCTCA AGGTGTTTGA GGCAGAGCAG TTTGGATGCC CACAGCGTGC TCAGAGGATG
AACACAGCCT TCACGCCATT CCTACACCAG AGGAACGGCA ACGCCGCCCG CTCGCTGACA
TCGCTGACAA GTGATGACAA CCTGTGGGCG TGCCTGCACA CCTCCTTTGC CTGGCTCCTG
AAGGCGTGTG GCAGCCGGCT GACCGAGAAG CTCCTGGAAG GTGCTCCGAC CGAGGATACC
TTGGTCCAGA TGGAGAAGCT CGCTGATTTA GAAGAGGAAT CAGAAAGCTG GGACAACTCT
GAGGCTGAAG AGGAGGAGAA AGCCCCTGTG TTGCCAGAGA GTACAGAAGG GCGGGAGCTG
ACCCAGGGCC CGGCAGAGTC CTCCTCTCTC TCAGGCTGTG GGAGCTGGCA GCCCCGGAAG
CTGCCAGTCT TCAAGTCCCT CCGGCACATG AGGCAGGTCC TGGGTGCCCC TTCTTTCCGC
ATGCTGGCCT GGCACGTTCT CATGGGGAAC CAGGTGATCT GGAAAAGCAG AGACGTGGAC
CTCGTCCAGT CAGCTTTTGA AGTACTTCGG ACCATGCTTC CCGTGGGCTG CGTCCGCATC
ATCCCATACA GCAGCCAGTA CGAGGAGGCC TATCGGTGCA ACTTCCTGGG GCTCAGCCCG
CACGTGCAGA TCCCCCCCCA CGTGCTCTCC TCAGAGTTTG CTGTCATCGT GGAGGTCCAC
GCAGCCGCAC GTTCCACCCT CCACCCTGTG GGGTGTGAGG ATGACCAGTC TCTCAGCAAG
TACGAGTTTG TGGTGACCAG TGGGAGCCCT GTAGCTGCAG ACCGAGTGGG CCCCACCATC
CTGAATAAGA TTGAAGCGGC TCTGACCAAC CAGAACCTGT CTGTGGATGT GGTGGACCAG
TGCCTCGTCT GCCTCAAGGA GGAGTGGATG AACAAAGTGA AGGTGCTTTT TAAGTTCACC
AAGGTGGACA GTCGACCCAA AGAGGACACA CAGAAGCTGC TGAGCATCCT GGGTGCGTCC
GAGGAGGACA ATGTCAAGCT GCTGAAGTTC TGGATGACTG GCCTGAGCAA GACCTACAAG
TCACACCTCA TGTCCACGGT CCGCAGCCCC ACAGCCTCGG AGTCTCGGAA CTGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu77698
Accession Version XM_011523716.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1794bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product folliculin isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010718.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
ATGAATGCCA TCGTGGCTCT CTGCCACTTC TGCGAGCTCC ACGGCCCCCG CACTCTCTTC 
TGCACGGAGG TGCTGCACGC CCCACTTCCT CAAGGGGATG GGAATGAGGA CAGTCCTGGC
CAGGGTGAGC AGGCGGAAGA AGAGGAAGGT GGCATTCAGA TGAACAGTCG GATGCGTGCG
CACAGCCCCG CAGAGGGGGC CAGCGTCGAG TCCAGCAGCC CGGGGCCCAA AAAGTCGGAC
ATGTGCGAGG GCTGCCGGTC ACTTGCTGCA GGGCACCCGG GATATATCAG CCATGATAAA
GAGACCTCCA TTAAATACGT CAGCCACCAG CACCCCAGCC ACCCCCAGCT CTTCAGCATT
GTCCGCCAGG CCTGTGTCCG GAGCCTGAGC TGTGAGTGCA GGGAGAGTGC AGTGGCTGCT
CTGACCTGCT GGTTCTTCTG CATGCTCCAG GTCTGCCCTG GCCGTGAAGG CCCCATCTTC
TTCGGAGATG AGCAGCACGG CTTTGTGTTC AGCCACACCT TCTTCATCAA GGACAGCCTG
GCCAGGGGCT TCCAGCGCTG GTACAGCATC ATCACCATCA TGATGGACCG GATCTACCTC
ATCAACTCCT GGCCCTTCCT GCTGGGGAAG GTCCGGGGAA TCATCGATGA GCTCCAGGGC
AAGGCGCTCA AGGTGTTTGA GGCAGAGCAG TTTGGATGCC CACAGCGTGC TCAGAGGATG
AACACAGCCT TCACGCCATT CCTACACCAG AGGAACGGCA ACGCCGCCCG CTCGCTGACA
TCGCTGACAA GTGATGACAA CCTGTGGGCG TGCCTGCACA CCTCCTTTGC CTGGCTCCTG
AAGGCGTGTG GCAGCCGGCT GACCGAGAAG CTCCTGGAAG GTGCTCCGAC CGAGGATACC
TTGGTCCAGA TGGAGAAGCT CGCTGATTTA GAAGAGGAAT CAGAAAGCTG GGACAACTCT
GAGGCTGAAG AGGAGGAGAA AGCCCCTGTG TTGCCAGAGA GTACAGAAGG GCGGGAGCTG
ACCCAGGGCC CGGCAGAGTC CTCCTCTCTC TCAGGCTGTG GGAGCTGGCA GCCCCGGAAG
CTGCCAGTCT TCAAGTCCCT CCGGCACATG AGGCAGGTCC TGGGTGCCCC TTCTTTCCGC
ATGCTGGCCT GGCACGTTCT CATGGGGAAC CAGGTGATCT GGAAAAGCAG AGACGTGGAC
CTCGTCCAGT CAGCTTTTGA AGTACTTCGG ACCATGCTTC CCGTGGGCTG CGTCCGCATC
ATCCCATACA GCAGCCAGTA CGAGGAGGCC TATCGGTGCA ACTTCCTGGG GCTCAGCCCG
CACGTGCAGA TCCCCCCCCA CGTGCTCTCC TCAGAGTTTG CTGTCATCGT GGAGGTCCAC
GCAGCCGCAC GTTCCACCCT CCACCCTGTG GGGTGTGAGG ATGACCAGTC TCTCAGCAAG
TACGAGTTTG TGGTGACCAG TGGGAGCCCT GTAGCTGCAG ACCGAGTGGG CCCCACCATC
CTGAATAAGA TTGAAGCGGC TCTGACCAAC CAGAACCTGT CTGTGGATGT GGTGGACCAG
TGCCTCGTCT GCCTCAAGGA GGAGTGGATG AACAAAGTGA AGGTGCTTTT TAAGTTCACC
AAGGTGGACA GTCGACCCAA AGAGGACACA CAGAAGCTGC TGAGCATCCT GGGTGCGTCC
GAGGAGGACA ATGTCAAGCT GCTGAAGTTC TGGATGACTG GCCTGAGCAA GACCTACAAG
TCACACCTCA TGTCCACGGT CCGCAGCCCC ACAGCCTCGG AGTCTCGGAA CTGA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_011522018.1
CDS880..2673
Misc Feature(1)1189..1734(+)
Translation
Position Chain Variation Link
13 13 c, t dbSNP:751203462
23 23 c, t dbSNP:777579858
33 33 a, g dbSNP:368564214
53 53 c, t dbSNP:191206646
54 54 a, g dbSNP:186399255
65 65 c, t dbSNP:563465500
77 77 c, t dbSNP:80273086
78 78 a, g dbSNP:530049762
82 82 c, t dbSNP:180910271
83 83 g, t dbSNP:189661839
99 99 g, t dbSNP:375397832
113 113 a, g dbSNP:73284571
134 134 c, t dbSNP:765764511
155 155 a, g dbSNP:559620125
174 174 c, t dbSNP:1708617
183 183 c, t dbSNP:186456499
186 186 c, t dbSNP:557108066
191 191 a, g dbSNP:766406776
193 193 c, g dbSNP:537007843
195 195 c, t dbSNP:181143663
238 238 a, c dbSNP:34282314
266 266 c, t dbSNP:555238346
282 282 c, t dbSNP:746597526
295 295 c, t dbSNP:576303605
301 301 a, g dbSNP:773367021
329 329 c, t dbSNP:772287296
336 336 c, g dbSNP:762793663
379 379 c, t dbSNP:565915341
380 380 a, g dbSNP:552325187
385 385 a, c, t dbSNP:569439458
397 397 c, t dbSNP:769739197
424 424 a, c dbSNP:189514467
459 459 c, g dbSNP:1736214
484 484 c, t dbSNP:781297160
539 539 -, c dbSNP:559823870
590 590 c, t dbSNP:1736215
620 620 a, g dbSNP:117827241
626 626 c, t dbSNP:79717038
636 636 c, t dbSNP:758047209
665 665 c, g dbSNP:528401271
703 703 c, t dbSNP:753086978
708 708 c, t dbSNP:533687652
758 758 c, g dbSNP:545983207
778 778 c, g dbSNP:116438960
783 783 -, ctc dbSNP:528431686
791 791 -, a dbSNP:572591896
800 800 a, g dbSNP:555731464
837 837 -, c dbSNP:559377745
841 841 a, g dbSNP:543198678
844 844 c, g dbSNP:574363104
868 868 c, t dbSNP:779391001
872 872 a, g dbSNP:369632481
891 891 c, t dbSNP:752123350
892 892 a, g dbSNP:767235709
912 912 c, t dbSNP:754616167
913 913 a, g dbSNP:751171641
921 921 c, t dbSNP:766288960
922 922 a, g dbSNP:539468848
924 924 c, t dbSNP:773349151
928 928 -, c dbSNP:758385503
928 928 c, t dbSNP:765251703
929 929 c, g dbSNP:398124537
931 931 a, g dbSNP:761993256
939 939 c, t dbSNP:776605909
944 944 c, t dbSNP:768734584
945 945 a, g dbSNP:747210367
949 949 g, t dbSNP:775626774
954 954 a, g dbSNP:200350612
957 957 c, t dbSNP:746222481
958 958 a, g dbSNP:779449668
959 959 c, t dbSNP:757670898
961 961 c, t dbSNP:749758787
962 962 -, c dbSNP:398124540
962 962 c, g dbSNP:780588085
963 963 a, g dbSNP:754450145
965 965 c, t dbSNP:150051278
969 969 c, t dbSNP:766122649
972 972 a, g dbSNP:758326533
973 973 c, g dbSNP:750221380
974 974 a, g dbSNP:587778366
976 976 c, g dbSNP:386833401
978 978 a, t dbSNP:375348725
992 992 g, t dbSNP:139418842
1008 1008 c, g dbSNP:760808366
1013 1013 c, g, t dbSNP:556510460
1014 1014 a, g dbSNP:759930161
1018 1018 c, g dbSNP:369115472
1037 1037 a, g dbSNP:771056209
1047 1047 c, t dbSNP:774725046
1048 1048 c, t dbSNP:746507528
1049 1049 a, g dbSNP:749770193
1054 1054 c, t dbSNP:778275358
1055 1055 a, g, t dbSNP:374969279
1058 1058 c, t dbSNP:779900587
1060 1060 c, g dbSNP:758156813
1068 1068 c, t dbSNP:750047828
1069 1069 a, g dbSNP:778587763
1073 1073 a, c dbSNP:757012294
1076 1076 a, g dbSNP:753787458
1080 1080 c, g dbSNP:764082089
1081 1081 a, g dbSNP:587778365
1083 1083 c, t dbSNP:371947198
1084 1084 a, g dbSNP:567617762
1086 1086 c, t dbSNP:759772780
1087 1087 a, g dbSNP:554247745
1089 1089 a, g dbSNP:771202158
1090 1090 c, t dbSNP:763369657
1100 1100 c, t dbSNP:773648142
1101 1101 a, g dbSNP:770311645
1109 1109 a, c dbSNP:746556970
1114 1114 -, tcgg dbSNP:750146811
1114 1114 g, t dbSNP:779733014
1115 1115 c, g dbSNP:137852930
1116 1116 a, g dbSNP:771650940
1120 1120 a, g dbSNP:745521431
1125 1125 c, t dbSNP:150712346
1126 1126 a, g dbSNP:757060348
1136 1136 a, g dbSNP:765550303
1147 1147 g, t dbSNP:141140415
1150 1150 a, g dbSNP:781100382
1153 1153 c, t dbSNP:755107067
1154 1154 a, g dbSNP:751634275
1157 1157 c, t dbSNP:766548696
1158 1158 a, g dbSNP:138688941
1161 1161 a, g dbSNP:750553308
1175 1175 -, a dbSNP:398124534
1184 1184 a, c dbSNP:765702734
1185 1185 c, t dbSNP:762265819
1187 1187 a, c dbSNP:777336970
1190 1190 c, t dbSNP:764679174
1194 1194 a, g dbSNP:759011359
1197 1197 c, t dbSNP:773946854
1198 1198 cac, gt dbSNP:398124535
1225 1225 a, c, t dbSNP:398124536
1226 1226 -, a dbSNP:776896550
1244 1244 c, g dbSNP:748979393
1314 1314 c, t dbSNP:140220661
1321 1321 a, t dbSNP:752261491
1328 1328 a, g dbSNP:539457096
1335 1335 c, t dbSNP:756563416
1354 1354 a, g dbSNP:375921200
1360 1360 -, ttc dbSNP:764153620
1362 1362 c, t dbSNP:773792624
1363 1363 a, g dbSNP:372918705
1377 1377 c, t dbSNP:376825814
1378 1378 a, g dbSNP:752014050
1379 1379 -, g dbSNP:727504645
1383 1383 c, t dbSNP:200672897
1384 1384 a, g dbSNP:147164515
1385 1385 c, t dbSNP:373794943
1389 1389 c, t dbSNP:763630763
1402 1402 -, ttc dbSNP:786203218
1415 1415 a, g dbSNP:760556162
1422 1422 a, c dbSNP:775176038
1428 1428 c, t dbSNP:767290984
1432 1432 c, t dbSNP:587782069
1434 1434 c, g dbSNP:772775816
1435 1435 c, t dbSNP:587778367
1436 1436 a, g dbSNP:759556434
1468 1468 c, t dbSNP:774358971
1469 1469 g, t dbSNP:369906553
1471 1471 a, c dbSNP:771205573
1477 1477 c, t dbSNP:749368513
1479 1479 c, t dbSNP:773535830
1485 1485 a, c dbSNP:143525924
1488 1488 c, t dbSNP:748363919
1498 1498 c, t dbSNP:781433539
1500 1500 a, g dbSNP:755278796
1502 1502 -, g dbSNP:34867548
1504 1504 a, g dbSNP:747581757
1513 1513 c, t dbSNP:138070947
1514 1514 a, g dbSNP:756807584
1519 1519 a, g dbSNP:201078144
1524 1524 c, t dbSNP:763617124
1525 1525 a, c, g dbSNP:200168437
1536 1536 c, g, t dbSNP:759405317
1537 1537 a, g dbSNP:774491699
1543 1543 gc, ta dbSNP:398124538
1544 1544 c, t dbSNP:766401197
1545 1545 a, g dbSNP:763168749
1567 1567 a, c dbSNP:558699420
1577 1577 a, g dbSNP:370074267
1578 1578 c, t dbSNP:772360950
1580 1580 -, c dbSNP:772407910
1586 1586 a, g dbSNP:367843558
1601 1601 a, g dbSNP:779467022
1606 1606 a, g dbSNP:769250170
1613 1613 c, t dbSNP:747675386
1614 1614 a, g dbSNP:781035304
1620 1620 c, t dbSNP:754710935
1623 1623 a, c dbSNP:373977390
1629 1629 g, t dbSNP:780010668
1636 1636 a, g dbSNP:200693409
1641 1641 c, t dbSNP:750394475
1644 1644 c, t dbSNP:111258744
1648 1648 c, t dbSNP:78683075
1649 1649 a, g dbSNP:753948488
1653 1653 a, g dbSNP:186366202
1658 1658 c, t dbSNP:536249722
1659 1659 a, t dbSNP:113938514
1662 1662 a, g dbSNP:377261933
1664 1664 c, t dbSNP:759928360
1667 1667 a, c dbSNP:371401039
1668 1668 a, c, g, t dbSNP:150175875
1669 1669 a, g dbSNP:768225327
1678 1678 a, c dbSNP:747429545
1689 1689 a, g dbSNP:746664975
1691 1691 a, g dbSNP:779849453
1712 1712 a, g dbSNP:368778627
1714 1714 c, t dbSNP:751677461
1724 1724 c, t dbSNP:372304384
1725 1725 a, g dbSNP:140500421
1734 1734 c, g, t dbSNP:765807221
1735 1735 c, t dbSNP:762370059
1736 1736 a, g dbSNP:775085512
1737 1737 g, t dbSNP:771424902
1743 1743 a, c, g, t dbSNP:372342796
1752 1752 c, t dbSNP:749057444
1755 1755 a, g dbSNP:777731843
1758 1758 a, g dbSNP:769758699
1762 1762 -, tg dbSNP:398124539
1766 1766 c, t dbSNP:748031634
1767 1767 a, g, t dbSNP:146801028
1770 1770 c, t dbSNP:751877389
1775 1775 a, g dbSNP:780125534
1778 1778 c, t dbSNP:758884167
1779 1779 c, t dbSNP:750848964
1785 1785 c, t dbSNP:765647841
1787 1787 -, tcca dbSNP:771374314
1800 1800 a, c, t dbSNP:367562964
1801 1801 a, g dbSNP:767119281
1806 1806 c, t dbSNP:767527483
1807 1807 c, t dbSNP:759503601
1821 1821 a, g dbSNP:774591810
1823 1823 -, aaag dbSNP:398124541
1823 1823 a, g dbSNP:770988236
1828 1828 g, t dbSNP:763092545
1839 1839 -, t dbSNP:757111995
1841 1841 a, g dbSNP:773482946
1848 1848 a, g dbSNP:551034228
1861 1861 a, g dbSNP:748491270
1864 1864 c, t dbSNP:140246224
1866 1866 c, t dbSNP:769183979
1872 1872 a, g dbSNP:558365108
1874 1874 a, c dbSNP:747467294
1876 1876 g, t dbSNP:587781952
1882 1882 a, g dbSNP:147142086
1885 1885 a, g dbSNP:756787389
1887 1887 -, agcccctgtgttgccagagagtacagaa dbSNP:398124542
1888 1888 c, g dbSNP:753491072
1891 1891 c, t dbSNP:777456756
1892 1892 a, g dbSNP:143483053
1904 1904 a, c, g dbSNP:767368450
1908 1908 c, t dbSNP:530884373
1909 1909 c, t dbSNP:751478971
1910 1910 c, t dbSNP:138031155
1914 1914 a, g dbSNP:763078516
1917 1917 a, g dbSNP:773355729
1919 1919 c, t dbSNP:770027312
1923 1923 c, t dbSNP:761984486
1925 1925 c, t dbSNP:202215080
1926 1926 c, t dbSNP:768940625
1935 1935 c, t dbSNP:747579747
1937 1937 a, g dbSNP:780597146
1954 1954 c, t dbSNP:770396757
1955 1955 a, g dbSNP:375352888
1959 1959 c, g dbSNP:777103374
1968 1968 c, g dbSNP:755850825
1973 1973 a, g dbSNP:752337482
1977 1977 c, t dbSNP:200224064
1982 1982 a, g dbSNP:190786280
1992 1992 a, g dbSNP:751513488
1993 1993 c, t dbSNP:398124523
1999 1999 c, g dbSNP:757313788
2001 2001 g, t dbSNP:534904034
2008 2008 c, t dbSNP:184718358
2017 2017 c, t dbSNP:557336321
2018 2018 g, t dbSNP:559055296
2035 2035 a, g dbSNP:767714543
2040 2040 c, t dbSNP:786202175
2042 2042 c, t dbSNP:200877872
2050 2050 a, c, t dbSNP:398124524
2066 2066 a, g dbSNP:769489773
2068 2068 a, g dbSNP:747644007
2071 2071 c, g dbSNP:776467886
2073 2073 c, t dbSNP:768454196
2082 2082 c, t dbSNP:150752548
2083 2083 a, g dbSNP:779913370
2087 2087 a, t dbSNP:758063582
2088 2088 g, t dbSNP:141250189
2108 2108 a, g dbSNP:570066243
2112 2112 a, c dbSNP:755413587
2112 2112 -, c dbSNP:398124525
2122 2122 a, g dbSNP:752006809
2126 2126 c, g dbSNP:766801011
2127 2127 c, t dbSNP:763569367
2130 2130 c, t dbSNP:750894316
2131 2131 a, g, t dbSNP:148257120
2132 2132 c, t dbSNP:760079073
2134 2134 c, t dbSNP:143183215
2135 2135 a, g dbSNP:771653740
2136 2136 -, c dbSNP:398124526
2148 2148 c, g dbSNP:786202541
2149 2149 a, g dbSNP:528541881
2157 2157 g, t dbSNP:774142829
2160 2160 c, t dbSNP:561236067
2161 2161 a, g dbSNP:763591386
2163 2163 a, g dbSNP:749287631
2166 2166 a, g dbSNP:61750032
2169 2169 c, t dbSNP:769968368
2175 2175 g, t dbSNP:376836624
2178 2178 c, t dbSNP:748148728
2180 2180 a, g dbSNP:781295687
2188 2188 a, g dbSNP:527859185
2189 2189 g, t dbSNP:755177473
2190 2190 a, g dbSNP:747171802
2193 2193 c, t dbSNP:780571501
2195 2195 a, g dbSNP:368175757
2198 2198 c, t dbSNP:565447853
2199 2199 a, g dbSNP:751013842
2200 2200 c, t dbSNP:765628527
2202 2202 c, t dbSNP:41464156
2204 2204 c, t dbSNP:752170592
2207 2207 a, g dbSNP:786203348
2210 2210 c, t dbSNP:766990565
2211 2211 c, t dbSNP:41459448
2212 2212 a, c dbSNP:773986076
2213 2213 a, c dbSNP:766218250
2214 2214 c, g dbSNP:372207262
2215 2215 c, g dbSNP:368880414
2216 2216 a, c, g, t dbSNP:199889477
2218 2218 -, c dbSNP:80338682
2218 2218 a, c, t dbSNP:375082054
2218 2218 -, c dbSNP:80338683
2220 2220 c, t dbSNP:374707789
2225 2225 c, t dbSNP:758871984
2229 2229 -, ctc dbSNP:763354508
2238 2238 -, t dbSNP:398124527
2241 2241 g, t dbSNP:775722367
2242 2242 a, c, g dbSNP:772207015
2245 2245 a, t dbSNP:759743111
2247 2247 a, c, t dbSNP:771247255
2248 2248 a, g dbSNP:112980409
2259 2259 c, t dbSNP:145004158
2260 2260 a, g dbSNP:535236784
2265 2265 a, c, t dbSNP:141283741
2266 2266 a, g dbSNP:41419545
2269 2269 c, t dbSNP:200724468
2270 2270 a, g dbSNP:750104212
2271 2271 c, t dbSNP:569587785
2283 2283 a, c, t dbSNP:753685944
2287 2287 a, g dbSNP:763920904
2289 2289 a, g dbSNP:760690745
2292 2292 a, g dbSNP:752677061
2293 2293 c, t dbSNP:767762804
2296 2296 a, g dbSNP:759637055
2297 2297 a, g dbSNP:199786696
2306 2306 a, g dbSNP:150439088
2309 2309 c, t dbSNP:377468280
2312 2312 c, t dbSNP:112196863
2313 2313 c, t dbSNP:773581294
2316 2316 c, t dbSNP:772310968
2320 2320 c, t dbSNP:770077517
2322 2322 c, g, t dbSNP:137852929
2337 2337 c, t dbSNP:777113065
2347 2347 c, g dbSNP:151312899
2351 2351 c, t dbSNP:144883828
2352 2352 a, c dbSNP:141036419
2361 2361 c, g dbSNP:756944795
2363 2363 a, g dbSNP:748878853
2365 2365 c, g dbSNP:777774091
2372 2372 c, t dbSNP:745720578
2375 2375 c, g dbSNP:781081891
2391 2391 -, ataagatt dbSNP:757197845
2392 2392 g, t dbSNP:786202475
2396 2396 c, t dbSNP:200660337
2397 2397 a, g dbSNP:747029882
2398 2398 a, g dbSNP:757222242
2409 2409 c, t dbSNP:779837933
2412 2412 a, g dbSNP:758516602
2420 2420 c, g dbSNP:750535468
2441 2441 c, g dbSNP:778904029
2445 2445 c, t dbSNP:757471403
2446 2446 a, g dbSNP:376715412
2455 2455 -, aag dbSNP:398124529
2456 2456 a, g dbSNP:199643834
2463 2463 a, g dbSNP:531459106
2466 2466 a, g dbSNP:398124530
2492 2492 a, g dbSNP:142288285
2512 2512 -, a dbSNP:753009073
2513 2513 a, g dbSNP:777826268
2523 2523 c, g dbSNP:756318617
2527 2527 a, c dbSNP:753023144
2530 2530 c, t dbSNP:398124532
2532 2532 c, g dbSNP:190965235
2553 2553 c, t dbSNP:755548579
2554 2554 a, g dbSNP:752108683
2555 2555 c, t dbSNP:764899882
2556 2556 a, g dbSNP:185419942
2560 2560 a, g dbSNP:776389684
2565 2565 a, g dbSNP:763688092
2568 2568 c, g dbSNP:760329266
2570 2570 a, g dbSNP:775149348
2577 2577 c, g dbSNP:771847652
2586 2586 a, g dbSNP:745859406
2600 2600 -, a dbSNP:767479616
2600 2600 c, g dbSNP:774247151
2610 2610 a, g dbSNP:771038343
2618 2618 a, g dbSNP:749359334
2625 2625 c, t dbSNP:201810397
2630 2630 c, t dbSNP:756302545
2635 2635 a, g dbSNP:748337450
2636 2636 c, t dbSNP:781733528
2637 2637 a, g dbSNP:147554296
2641 2641 c, t dbSNP:752161850
2642 2642 a, g dbSNP:201056799
2650 2650 a, t dbSNP:758901704
2651 2651 c, t dbSNP:753313171
2657 2657 c, t dbSNP:763604691
2658 2658 a, g dbSNP:760307957
2665 2665 c, t dbSNP:775107483
2670 2670 c, t dbSNP:767345167
2674 2674 c, t dbSNP:759292330
2676 2676 c, t dbSNP:774091922
2677 2677 a, g dbSNP:770795599
2681 2681 a, c, t dbSNP:773168989
2687 2687 a, c, t dbSNP:748379299
2690 2690 g, t dbSNP:115885284
2691 2691 c, t dbSNP:370269600
2703 2703 a, g dbSNP:747413239
2705 2705 c, t dbSNP:780520253
2708 2708 c, t dbSNP:149134801
2715 2715 c, t dbSNP:750934121
2724 2724 c, t dbSNP:777203555
2726 2726 a, t dbSNP:111861140
2731 2731 c, t dbSNP:535022712
2760 2760 a, c dbSNP:778606717
2761 2761 a, g dbSNP:754626617
2764 2764 g, t dbSNP:564383830
2851 2851 a, g dbSNP:145430714
2866 2866 a, g dbSNP:144507152
2871 2871 a, c dbSNP:771890381
2893 2893 a, t dbSNP:541599658
2896 2896 c, t dbSNP:76272341
2897 2897 a, g dbSNP:541003301
2926 2926 a, g dbSNP:774288275
2928 2928 c, g dbSNP:564245440
2941 2941 c, t dbSNP:180873537
2994 2994 c, t dbSNP:139734855
2996 2996 a, g dbSNP:571999061
3006 3006 c, t dbSNP:750896108
3017 3017 c, g dbSNP:554190238
3029 3029 g, t dbSNP:7224474
3052 3052 a, g dbSNP:117436649
3066 3066 a, g dbSNP:12602675
3076 3076 c, t dbSNP:188840802
3098 3098 a, g dbSNP:7224335
3115 3115 c, t dbSNP:7224213
3153 3153 a, c dbSNP:146851795
3155 3155 a, c dbSNP:574471240
3169 3169 -, gtga dbSNP:778371655
3183 3183 g, t dbSNP:537259057
3199 3199 c, t dbSNP:574547835
3201 3201 a, g dbSNP:184006653
3213 3213 g, t dbSNP:181935335
3230 3230 c, t dbSNP:3803761
3253 3253 c, t dbSNP:566100851
3307 3307 a, c dbSNP:199572622
3311 3311 c, t dbSNP:780240981
3353 3353 a, g dbSNP:539709518
3368 3368 c, t dbSNP:775700421
3387 3387 a, c dbSNP:189888135
3390 3390 a, t dbSNP:550746288
3412 3412 c, t dbSNP:558952732
3414 3414 c, g dbSNP:530771625
3459 3459 a, g dbSNP:143768653
3467 3467 a, g dbSNP:139529824
3494 3494 a, g dbSNP:770643935
3501 3501 g, t dbSNP:750900491
3523 3523 c, g dbSNP:185759963
3524 3524 -, c dbSNP:748168795
3584 3584 a, g dbSNP:571893996
3587 3587 c, t dbSNP:7223831
3629 3629 a, g dbSNP:141650706
3674 3674 a, g dbSNP:532627636
3708 3708 c, t dbSNP:566019526
3718 3718 a, g dbSNP:563644388
3735 3735 a, g dbSNP:771952210
3774 3774 c, t dbSNP:543608114
3788 3788 a, g dbSNP:574733214
3824 3824 c, t dbSNP:62064407
3826 3826 -, tttt dbSNP:397932764
3852 3852 a, t dbSNP:540609895
3855 3855 -, a dbSNP:199535675
3907 3907 a, g dbSNP:747663295
3917 3917 c, t dbSNP:554751440
3919 3919 c, g dbSNP:541543491
3962 3962 a, g dbSNP:572462992
3971 3971 c, t dbSNP:558869941
4009 4009 g, t dbSNP:7218992
4025 4025 g, t dbSNP:11654407
4039 4039 a, g dbSNP:754539748
4063 4063 c, g dbSNP:570755484
4066 4066 a, g dbSNP:557330837
4076 4076 c, t dbSNP:7218795
4085 4085 a, g dbSNP:568272777

Target ORF information:

RefSeq Version XM_011523716
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X3, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
XM_011523716

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
ATGAATGCCA TCGTGGCTCT CTGCCACTTC TGCGAGCTCC ACGGCCCCCG CACTCTCTTC 
TGCACGGAGG TGCTGCACGC CCCACTTCCT CAAGGGGATG GGAATGAGGA CAGTCCTGGC
CAGGGTGAGC AGGCGGAAGA AGAGGAAGGT GGCATTCAGA TGAACAGTCG GATGCGTGCG
CACAGCCCCG CAGAGGGGGC CAGCGTCGAG TCCAGCAGCC CGGGGCCCAA AAAGTCGGAC
ATGTGCGAGG GCTGCCGGTC ACTTGCTGCA GGGCACCCGG GATATATCAG CCATGATAAA
GAGACCTCCA TTAAATACGT CAGCCACCAG CACCCCAGCC ACCCCCAGCT CTTCAGCATT
GTCCGCCAGG CCTGTGTCCG GAGCCTGAGC TGTGAGTGCA GGGAGAGTGC AGTGGCTGCT
CTGACCTGCT GGTTCTTCTG CATGCTCCAG GTCTGCCCTG GCCGTGAAGG CCCCATCTTC
TTCGGAGATG AGCAGCACGG CTTTGTGTTC AGCCACACCT TCTTCATCAA GGACAGCCTG
GCCAGGGGCT TCCAGCGCTG GTACAGCATC ATCACCATCA TGATGGACCG GATCTACCTC
ATCAACTCCT GGCCCTTCCT GCTGGGGAAG GTCCGGGGAA TCATCGATGA GCTCCAGGGC
AAGGCGCTCA AGGTGTTTGA GGCAGAGCAG TTTGGATGCC CACAGCGTGC TCAGAGGATG
AACACAGCCT TCACGCCATT CCTACACCAG AGGAACGGCA ACGCCGCCCG CTCGCTGACA
TCGCTGACAA GTGATGACAA CCTGTGGGCG TGCCTGCACA CCTCCTTTGC CTGGCTCCTG
AAGGCGTGTG GCAGCCGGCT GACCGAGAAG CTCCTGGAAG GTGCTCCGAC CGAGGATACC
TTGGTCCAGA TGGAGAAGCT CGCTGATTTA GAAGAGGAAT CAGAAAGCTG GGACAACTCT
GAGGCTGAAG AGGAGGAGAA AGCCCCTGTG TTGCCAGAGA GTACAGAAGG GCGGGAGCTG
ACCCAGGGCC CGGCAGAGTC CTCCTCTCTC TCAGGCTGTG GGAGCTGGCA GCCCCGGAAG
CTGCCAGTCT TCAAGTCCCT CCGGCACATG AGGCAGGTCC TGGGTGCCCC TTCTTTCCGC
ATGCTGGCCT GGCACGTTCT CATGGGGAAC CAGGTGATCT GGAAAAGCAG AGACGTGGAC
CTCGTCCAGT CAGCTTTTGA AGTACTTCGG ACCATGCTTC CCGTGGGCTG CGTCCGCATC
ATCCCATACA GCAGCCAGTA CGAGGAGGCC TATCGGTGCA ACTTCCTGGG GCTCAGCCCG
CACGTGCAGA TCCCCCCCCA CGTGCTCTCC TCAGAGTTTG CTGTCATCGT GGAGGTCCAC
GCAGCCGCAC GTTCCACCCT CCACCCTGTG GGGTGTGAGG ATGACCAGTC TCTCAGCAAG
TACGAGTTTG TGGTGACCAG TGGGAGCCCT GTAGCTGCAG ACCGAGTGGG CCCCACCATC
CTGAATAAGA TTGAAGCGGC TCTGACCAAC CAGAACCTGT CTGTGGATGT GGTGGACCAG
TGCCTCGTCT GCCTCAAGGA GGAGTGGATG AACAAAGTGA AGGTGCTTTT TAAGTTCACC
AAGGTGGACA GTCGACCCAA AGAGGACACA CAGAAGCTGC TGAGCATCCT GGGTGCGTCC
GAGGAGGACA ATGTCAAGCT GCTGAAGTTC TGGATGACTG GCCTGAGCAA GACCTACAAG
TCACACCTCA TGTCCACGGT CCGCAGCCCC ACAGCCTCGG AGTCTCGGAA CTGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu77698
Accession Version XM_011523717.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1794bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product folliculin isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010718.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381
1441
1501
1561
1621
1681
1741
ATGAATGCCA TCGTGGCTCT CTGCCACTTC TGCGAGCTCC ACGGCCCCCG CACTCTCTTC 
TGCACGGAGG TGCTGCACGC CCCACTTCCT CAAGGGGATG GGAATGAGGA CAGTCCTGGC
CAGGGTGAGC AGGCGGAAGA AGAGGAAGGT GGCATTCAGA TGAACAGTCG GATGCGTGCG
CACAGCCCCG CAGAGGGGGC CAGCGTCGAG TCCAGCAGCC CGGGGCCCAA AAAGTCGGAC
ATGTGCGAGG GCTGCCGGTC ACTTGCTGCA GGGCACCCGG GATATATCAG CCATGATAAA
GAGACCTCCA TTAAATACGT CAGCCACCAG CACCCCAGCC ACCCCCAGCT CTTCAGCATT
GTCCGCCAGG CCTGTGTCCG GAGCCTGAGC TGTGAGTGCA GGGAGAGTGC AGTGGCTGCT
CTGACCTGCT GGTTCTTCTG CATGCTCCAG GTCTGCCCTG GCCGTGAAGG CCCCATCTTC
TTCGGAGATG AGCAGCACGG CTTTGTGTTC AGCCACACCT TCTTCATCAA GGACAGCCTG
GCCAGGGGCT TCCAGCGCTG GTACAGCATC ATCACCATCA TGATGGACCG GATCTACCTC
ATCAACTCCT GGCCCTTCCT GCTGGGGAAG GTCCGGGGAA TCATCGATGA GCTCCAGGGC
AAGGCGCTCA AGGTGTTTGA GGCAGAGCAG TTTGGATGCC CACAGCGTGC TCAGAGGATG
AACACAGCCT TCACGCCATT CCTACACCAG AGGAACGGCA ACGCCGCCCG CTCGCTGACA
TCGCTGACAA GTGATGACAA CCTGTGGGCG TGCCTGCACA CCTCCTTTGC CTGGCTCCTG
AAGGCGTGTG GCAGCCGGCT GACCGAGAAG CTCCTGGAAG GTGCTCCGAC CGAGGATACC
TTGGTCCAGA TGGAGAAGCT CGCTGATTTA GAAGAGGAAT CAGAAAGCTG GGACAACTCT
GAGGCTGAAG AGGAGGAGAA AGCCCCTGTG TTGCCAGAGA GTACAGAAGG GCGGGAGCTG
ACCCAGGGCC CGGCAGAGTC CTCCTCTCTC TCAGGCTGTG GGAGCTGGCA GCCCCGGAAG
CTGCCAGTCT TCAAGTCCCT CCGGCACATG AGGCAGGTCC TGGGTGCCCC TTCTTTCCGC
ATGCTGGCCT GGCACGTTCT CATGGGGAAC CAGGTGATCT GGAAAAGCAG AGACGTGGAC
CTCGTCCAGT CAGCTTTTGA AGTACTTCGG ACCATGCTTC CCGTGGGCTG CGTCCGCATC
ATCCCATACA GCAGCCAGTA CGAGGAGGCC TATCGGTGCA ACTTCCTGGG GCTCAGCCCG
CACGTGCAGA TCCCCCCCCA CGTGCTCTCC TCAGAGTTTG CTGTCATCGT GGAGGTCCAC
GCAGCCGCAC GTTCCACCCT CCACCCTGTG GGGTGTGAGG ATGACCAGTC TCTCAGCAAG
TACGAGTTTG TGGTGACCAG TGGGAGCCCT GTAGCTGCAG ACCGAGTGGG CCCCACCATC
CTGAATAAGA TTGAAGCGGC TCTGACCAAC CAGAACCTGT CTGTGGATGT GGTGGACCAG
TGCCTCGTCT GCCTCAAGGA GGAGTGGATG AACAAAGTGA AGGTGCTTTT TAAGTTCACC
AAGGTGGACA GTCGACCCAA AGAGGACACA CAGAAGCTGC TGAGCATCCT GGGTGCGTCC
GAGGAGGACA ATGTCAAGCT GCTGAAGTTC TGGATGACTG GCCTGAGCAA GACCTACAAG
TCACACCTCA TGTCCACGGT CCGCAGCCCC ACAGCCTCGG AGTCTCGGAA CTGA
The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
RefSeqXP_011522019.1
CDS1165..2958
Misc Feature(1)1474..2019(+)
Translation
Position Chain Variation Link
18 18 c, g dbSNP:1736209
24 24 a, g dbSNP:207476321
25 25 c, g dbSNP:564584154
37 37 a, c dbSNP:207476320
39 39 c, t dbSNP:575905361
53 53 a, c dbSNP:562310783
60 60 a, g dbSNP:542327641
74 74 c, t dbSNP:138847774
75 75 c, t dbSNP:553452028
78 78 a, g dbSNP:539415254
130 130 c, t dbSNP:577176265
164 164 g, t dbSNP:528481171
167 167 c, g dbSNP:557719136
168 168 a, g dbSNP:537792180
187 187 c, t dbSNP:180900492
203 203 a, g dbSNP:41345949
205 205 c, g dbSNP:548796445
206 206 c, t dbSNP:1708629
221 221 c, g dbSNP:78262456
223 223 c, g dbSNP:78918950
225 225 g, t dbSNP:75014442
248 248 a, g dbSNP:370286675
276 276 -, ggtaggcgggggtctgagg dbSNP:370486376
329 329 a, g dbSNP:117215381
362 362 a, c, t dbSNP:560968516
364 364 g, t dbSNP:541105214
371 371 c, t dbSNP:116581458
408 408 c, t dbSNP:114481741
412 412 c, t dbSNP:115413827
413 413 a, g dbSNP:756416340
415 415 a, g dbSNP:8069957
426 426 a, g dbSNP:535864585
427 427 c, g dbSNP:147598893
440 440 a, g dbSNP:145125741
447 447 c, t dbSNP:140144170
460 460 a, g dbSNP:571154058
476 476 a, g dbSNP:151144873
489 489 c, g dbSNP:528401271
527 527 c, t dbSNP:753086978
532 532 c, t dbSNP:533687652
582 582 c, g dbSNP:545983207
602 602 c, g dbSNP:116438960
607 607 -, ctc dbSNP:528431686
615 615 -, a dbSNP:572591896
624 624 a, g dbSNP:555731464
661 661 -, c dbSNP:559377745
665 665 a, g dbSNP:543198678
668 668 c, g dbSNP:574363104
685 685 a, c dbSNP:146246174
700 700 a, g dbSNP:541043827
706 706 c, t dbSNP:572369766
707 707 a, t dbSNP:558834443
709 709 -, cc dbSNP:540656367
713 713 g, t dbSNP:538804082
715 715 -, gtat dbSNP:375495673
716 716 -, cc dbSNP:200365194
717 717 c, t dbSNP:112002657
746 746 a, g dbSNP:569964752
747 747 a, g dbSNP:1708618
757 757 a, g dbSNP:185401594
759 759 g, t dbSNP:766570505
760 760 a, g dbSNP:763224453
776 776 a, g dbSNP:181549149
790 790 a, g dbSNP:760682564
797 797 c, t dbSNP:532847715
840 840 a, g dbSNP:142149319
856 856 c, t dbSNP:750557906
859 859 c, t dbSNP:565937473
875 875 a, g dbSNP:761981111
898 898 a, g dbSNP:75336342
902 902 c, t dbSNP:532342547
927 927 c, t dbSNP:563376820
971 971 c, t dbSNP:543487724
975 975 a, g dbSNP:529727139
1001 1001 a, g dbSNP:561055780
1037 1037 a, g dbSNP:761617653
1059 1059 c, t dbSNP:540630142
1061 1061 a, c dbSNP:571710524
1101 1101 a, g dbSNP:764888176
1102 1102 c, t dbSNP:759415328
1103 1103 a, t dbSNP:565505709
1110 1110 a, g dbSNP:545337155
1114 1114 a, c dbSNP:780421535
1135 1135 a, g dbSNP:776640058
1136 1136 c, t dbSNP:758705818
1137 1137 g, t dbSNP:746381939
1139 1139 -, g dbSNP:35936022
1153 1153 c, t dbSNP:779391001
1157 1157 a, g dbSNP:369632481
1176 1176 c, t dbSNP:752123350
1177 1177 a, g dbSNP:767235709
1197 1197 c, t dbSNP:754616167
1198 1198 a, g dbSNP:751171641
1206 1206 c, t dbSNP:766288960
1207 1207 a, g dbSNP:539468848
1209 1209 c, t dbSNP:773349151
1213 1213 -, c dbSNP:758385503
1213 1213 c, t dbSNP:765251703
1214 1214 c, g dbSNP:398124537
1216 1216 a, g dbSNP:761993256
1224 1224 c, t dbSNP:776605909
1229 1229 c, t dbSNP:768734584
1230 1230 a, g dbSNP:747210367
1234 1234 g, t dbSNP:775626774
1239 1239 a, g dbSNP:200350612
1242 1242 c, t dbSNP:746222481
1243 1243 a, g dbSNP:779449668
1244 1244 c, t dbSNP:757670898
1246 1246 c, t dbSNP:749758787
1247 1247 -, c dbSNP:398124540
1247 1247 c, g dbSNP:780588085
1248 1248 a, g dbSNP:754450145
1250 1250 c, t dbSNP:150051278
1254 1254 c, t dbSNP:766122649
1257 1257 a, g dbSNP:758326533
1258 1258 c, g dbSNP:750221380
1259 1259 a, g dbSNP:587778366
1261 1261 c, g dbSNP:386833401
1263 1263 a, t dbSNP:375348725
1277 1277 g, t dbSNP:139418842
1293 1293 c, g dbSNP:760808366
1298 1298 c, g, t dbSNP:556510460
1299 1299 a, g dbSNP:759930161
1303 1303 c, g dbSNP:369115472
1322 1322 a, g dbSNP:771056209
1332 1332 c, t dbSNP:774725046
1333 1333 c, t dbSNP:746507528
1334 1334 a, g dbSNP:749770193
1339 1339 c, t dbSNP:778275358
1340 1340 a, g, t dbSNP:374969279
1343 1343 c, t dbSNP:779900587
1345 1345 c, g dbSNP:758156813
1353 1353 c, t dbSNP:750047828
1354 1354 a, g dbSNP:778587763
1358 1358 a, c dbSNP:757012294
1361 1361 a, g dbSNP:753787458
1365 1365 c, g dbSNP:764082089
1366 1366 a, g dbSNP:587778365
1368 1368 c, t dbSNP:371947198
1369 1369 a, g dbSNP:567617762
1371 1371 c, t dbSNP:759772780
1372 1372 a, g dbSNP:554247745
1374 1374 a, g dbSNP:771202158
1375 1375 c, t dbSNP:763369657
1385 1385 c, t dbSNP:773648142
1386 1386 a, g dbSNP:770311645
1394 1394 a, c dbSNP:746556970
1399 1399 -, tcgg dbSNP:750146811
1399 1399 g, t dbSNP:779733014
1400 1400 c, g dbSNP:137852930
1401 1401 a, g dbSNP:771650940
1405 1405 a, g dbSNP:745521431
1410 1410 c, t dbSNP:150712346
1411 1411 a, g dbSNP:757060348
1421 1421 a, g dbSNP:765550303
1432 1432 g, t dbSNP:141140415
1435 1435 a, g dbSNP:781100382
1438 1438 c, t dbSNP:755107067
1439 1439 a, g dbSNP:751634275
1442 1442 c, t dbSNP:766548696
1443 1443 a, g dbSNP:138688941
1446 1446 a, g dbSNP:750553308
1460 1460 -, a dbSNP:398124534
1469 1469 a, c dbSNP:765702734
1470 1470 c, t dbSNP:762265819
1472 1472 a, c dbSNP:777336970
1475 1475 c, t dbSNP:764679174
1479 1479 a, g dbSNP:759011359
1482 1482 c, t dbSNP:773946854
1483 1483 cac, gt dbSNP:398124535
1510 1510 a, c, t dbSNP:398124536
1511 1511 -, a dbSNP:776896550
1529 1529 c, g dbSNP:748979393
1599 1599 c, t dbSNP:140220661
1606 1606 a, t dbSNP:752261491
1613 1613 a, g dbSNP:539457096
1620 1620 c, t dbSNP:756563416
1639 1639 a, g dbSNP:375921200
1645 1645 -, ttc dbSNP:764153620
1647 1647 c, t dbSNP:773792624
1648 1648 a, g dbSNP:372918705
1662 1662 c, t dbSNP:376825814
1663 1663 a, g dbSNP:752014050
1664 1664 -, g dbSNP:727504645
1668 1668 c, t dbSNP:200672897
1669 1669 a, g dbSNP:147164515
1670 1670 c, t dbSNP:373794943
1674 1674 c, t dbSNP:763630763
1687 1687 -, ttc dbSNP:786203218
1700 1700 a, g dbSNP:760556162
1707 1707 a, c dbSNP:775176038
1713 1713 c, t dbSNP:767290984
1717 1717 c, t dbSNP:587782069
1719 1719 c, g dbSNP:772775816
1720 1720 c, t dbSNP:587778367
1721 1721 a, g dbSNP:759556434
1753 1753 c, t dbSNP:774358971
1754 1754 g, t dbSNP:369906553
1756 1756 a, c dbSNP:771205573
1762 1762 c, t dbSNP:749368513
1764 1764 c, t dbSNP:773535830
1770 1770 a, c dbSNP:143525924
1773 1773 c, t dbSNP:748363919
1783 1783 c, t dbSNP:781433539
1785 1785 a, g dbSNP:755278796
1787 1787 -, g dbSNP:34867548
1789 1789 a, g dbSNP:747581757
1798 1798 c, t dbSNP:138070947
1799 1799 a, g dbSNP:756807584
1804 1804 a, g dbSNP:201078144
1809 1809 c, t dbSNP:763617124
1810 1810 a, c, g dbSNP:200168437
1821 1821 c, g, t dbSNP:759405317
1822 1822 a, g dbSNP:774491699
1828 1828 gc, ta dbSNP:398124538
1829 1829 c, t dbSNP:766401197
1830 1830 a, g dbSNP:763168749
1852 1852 a, c dbSNP:558699420
1862 1862 a, g dbSNP:370074267
1863 1863 c, t dbSNP:772360950
1865 1865 -, c dbSNP:772407910
1871 1871 a, g dbSNP:367843558
1886 1886 a, g dbSNP:779467022
1891 1891 a, g dbSNP:769250170
1898 1898 c, t dbSNP:747675386
1899 1899 a, g dbSNP:781035304
1905 1905 c, t dbSNP:754710935
1908 1908 a, c dbSNP:373977390
1914 1914 g, t dbSNP:780010668
1921 1921 a, g dbSNP:200693409
1926 1926 c, t dbSNP:750394475
1929 1929 c, t dbSNP:111258744
1933 1933 c, t dbSNP:78683075
1934 1934 a, g dbSNP:753948488
1938 1938 a, g dbSNP:186366202
1943 1943 c, t dbSNP:536249722
1944 1944 a, t dbSNP:113938514
1947 1947 a, g dbSNP:377261933
1949 1949 c, t dbSNP:759928360
1952 1952 a, c dbSNP:371401039
1953 1953 a, c, g, t dbSNP:150175875
1954 1954 a, g dbSNP:768225327
1963 1963 a, c dbSNP:747429545
1974 1974 a, g dbSNP:746664975
1976 1976 a, g dbSNP:779849453
1997 1997 a, g dbSNP:368778627
1999 1999 c, t dbSNP:751677461
2009 2009 c, t dbSNP:372304384
2010 2010 a, g dbSNP:140500421
2019 2019 c, g, t dbSNP:765807221
2020 2020 c, t dbSNP:762370059
2021 2021 a, g dbSNP:775085512
2022 2022 g, t dbSNP:771424902
2028 2028 a, c, g, t dbSNP:372342796
2037 2037 c, t dbSNP:749057444
2040 2040 a, g dbSNP:777731843
2043 2043 a, g dbSNP:769758699
2047 2047 -, tg dbSNP:398124539
2051 2051 c, t dbSNP:748031634
2052 2052 a, g, t dbSNP:146801028
2055 2055 c, t dbSNP:751877389
2060 2060 a, g dbSNP:780125534
2063 2063 c, t dbSNP:758884167
2064 2064 c, t dbSNP:750848964
2070 2070 c, t dbSNP:765647841
2072 2072 -, tcca dbSNP:771374314
2085 2085 a, c, t dbSNP:367562964
2086 2086 a, g dbSNP:767119281
2091 2091 c, t dbSNP:767527483
2092 2092 c, t dbSNP:759503601
2106 2106 a, g dbSNP:774591810
2108 2108 -, aaag dbSNP:398124541
2108 2108 a, g dbSNP:770988236
2113 2113 g, t dbSNP:763092545
2124 2124 -, t dbSNP:757111995
2126 2126 a, g dbSNP:773482946
2133 2133 a, g dbSNP:551034228
2146 2146 a, g dbSNP:748491270
2149 2149 c, t dbSNP:140246224
2151 2151 c, t dbSNP:769183979
2157 2157 a, g dbSNP:558365108
2159 2159 a, c dbSNP:747467294
2161 2161 g, t dbSNP:587781952
2167 2167 a, g dbSNP:147142086
2170 2170 a, g dbSNP:756787389
2172 2172 -, agcccctgtgttgccagagagtacagaa dbSNP:398124542
2173 2173 c, g dbSNP:753491072
2176 2176 c, t dbSNP:777456756
2177 2177 a, g dbSNP:143483053
2189 2189 a, c, g dbSNP:767368450
2193 2193 c, t dbSNP:530884373
2194 2194 c, t dbSNP:751478971
2195 2195 c, t dbSNP:138031155
2199 2199 a, g dbSNP:763078516
2202 2202 a, g dbSNP:773355729
2204 2204 c, t dbSNP:770027312
2208 2208 c, t dbSNP:761984486
2210 2210 c, t dbSNP:202215080
2211 2211 c, t dbSNP:768940625
2220 2220 c, t dbSNP:747579747
2222 2222 a, g dbSNP:780597146
2239 2239 c, t dbSNP:770396757
2240 2240 a, g dbSNP:375352888
2244 2244 c, g dbSNP:777103374
2253 2253 c, g dbSNP:755850825
2258 2258 a, g dbSNP:752337482
2262 2262 c, t dbSNP:200224064
2267 2267 a, g dbSNP:190786280
2277 2277 a, g dbSNP:751513488
2278 2278 c, t dbSNP:398124523
2284 2284 c, g dbSNP:757313788
2286 2286 g, t dbSNP:534904034
2293 2293 c, t dbSNP:184718358
2302 2302 c, t dbSNP:557336321
2303 2303 g, t dbSNP:559055296
2320 2320 a, g dbSNP:767714543
2325 2325 c, t dbSNP:786202175
2327 2327 c, t dbSNP:200877872
2335 2335 a, c, t dbSNP:398124524
2351 2351 a, g dbSNP:769489773
2353 2353 a, g dbSNP:747644007
2356 2356 c, g dbSNP:776467886
2358 2358 c, t dbSNP:768454196
2367 2367 c, t dbSNP:150752548
2368 2368 a, g dbSNP:779913370
2372 2372 a, t dbSNP:758063582
2373 2373 g, t dbSNP:141250189
2393 2393 a, g dbSNP:570066243
2397 2397 a, c dbSNP:755413587
2397 2397 -, c dbSNP:398124525
2407 2407 a, g dbSNP:752006809
2411 2411 c, g dbSNP:766801011
2412 2412 c, t dbSNP:763569367
2415 2415 c, t dbSNP:750894316
2416 2416 a, g, t dbSNP:148257120
2417 2417 c, t dbSNP:760079073
2419 2419 c, t dbSNP:143183215
2420 2420 a, g dbSNP:771653740
2421 2421 -, c dbSNP:398124526
2433 2433 c, g dbSNP:786202541
2434 2434 a, g dbSNP:528541881
2442 2442 g, t dbSNP:774142829
2445 2445 c, t dbSNP:561236067
2446 2446 a, g dbSNP:763591386
2448 2448 a, g dbSNP:749287631
2451 2451 a, g dbSNP:61750032
2454 2454 c, t dbSNP:769968368
2460 2460 g, t dbSNP:376836624
2463 2463 c, t dbSNP:748148728
2465 2465 a, g dbSNP:781295687
2473 2473 a, g dbSNP:527859185
2474 2474 g, t dbSNP:755177473
2475 2475 a, g dbSNP:747171802
2478 2478 c, t dbSNP:780571501
2480 2480 a, g dbSNP:368175757
2483 2483 c, t dbSNP:565447853
2484 2484 a, g dbSNP:751013842
2485 2485 c, t dbSNP:765628527
2487 2487 c, t dbSNP:41464156
2489 2489 c, t dbSNP:752170592
2492 2492 a, g dbSNP:786203348
2495 2495 c, t dbSNP:766990565
2496 2496 c, t dbSNP:41459448
2497 2497 a, c dbSNP:773986076
2498 2498 a, c dbSNP:766218250
2499 2499 c, g dbSNP:372207262
2500 2500 c, g dbSNP:368880414
2501 2501 a, c, g, t dbSNP:199889477
2503 2503 -, c dbSNP:80338682
2503 2503 a, c, t dbSNP:375082054
2503 2503 -, c dbSNP:80338683
2505 2505 c, t dbSNP:374707789
2510 2510 c, t dbSNP:758871984
2514 2514 -, ctc dbSNP:763354508
2523 2523 -, t dbSNP:398124527
2526 2526 g, t dbSNP:775722367
2527 2527 a, c, g dbSNP:772207015
2530 2530 a, t dbSNP:759743111
2532 2532 a, c, t dbSNP:771247255
2533 2533 a, g dbSNP:112980409
2544 2544 c, t dbSNP:145004158
2545 2545 a, g dbSNP:535236784
2550 2550 a, c, t dbSNP:141283741
2551 2551 a, g dbSNP:41419545
2554 2554 c, t dbSNP:200724468
2555 2555 a, g dbSNP:750104212
2556 2556 c, t dbSNP:569587785
2568 2568 a, c, t dbSNP:753685944
2572 2572 a, g dbSNP:763920904
2574 2574 a, g dbSNP:760690745
2577 2577 a, g dbSNP:752677061
2578 2578 c, t dbSNP:767762804
2581 2581 a, g dbSNP:759637055
2582 2582 a, g dbSNP:199786696
2591 2591 a, g dbSNP:150439088
2594 2594 c, t dbSNP:377468280
2597 2597 c, t dbSNP:112196863
2598 2598 c, t dbSNP:773581294
2601 2601 c, t dbSNP:772310968
2605 2605 c, t dbSNP:770077517
2607 2607 c, g, t dbSNP:137852929
2622 2622 c, t dbSNP:777113065
2632 2632 c, g dbSNP:151312899
2636 2636 c, t dbSNP:144883828
2637 2637 a, c dbSNP:141036419
2646 2646 c, g dbSNP:756944795
2648 2648 a, g dbSNP:748878853
2650 2650 c, g dbSNP:777774091
2657 2657 c, t dbSNP:745720578
2660 2660 c, g dbSNP:781081891
2676 2676 -, ataagatt dbSNP:757197845
2677 2677 g, t dbSNP:786202475
2681 2681 c, t dbSNP:200660337
2682 2682 a, g dbSNP:747029882
2683 2683 a, g dbSNP:757222242
2694 2694 c, t dbSNP:779837933
2697 2697 a, g dbSNP:758516602
2705 2705 c, g dbSNP:750535468
2726 2726 c, g dbSNP:778904029
2730 2730 c, t dbSNP:757471403
2731 2731 a, g dbSNP:376715412
2740 2740 -, aag dbSNP:398124529
2741 2741 a, g dbSNP:199643834
2748 2748 a, g dbSNP:531459106
2751 2751 a, g dbSNP:398124530
2777 2777 a, g dbSNP:142288285
2797 2797 -, a dbSNP:753009073
2798 2798 a, g dbSNP:777826268
2808 2808 c, g dbSNP:756318617
2812 2812 a, c dbSNP:753023144
2815 2815 c, t dbSNP:398124532
2817 2817 c, g dbSNP:190965235
2838 2838 c, t dbSNP:755548579
2839 2839 a, g dbSNP:752108683
2840 2840 c, t dbSNP:764899882
2841 2841 a, g dbSNP:185419942
2845 2845 a, g dbSNP:776389684
2850 2850 a, g dbSNP:763688092
2853 2853 c, g dbSNP:760329266
2855 2855 a, g dbSNP:775149348
2862 2862 c, g dbSNP:771847652
2871 2871 a, g dbSNP:745859406
2885 2885 -, a dbSNP:767479616
2885 2885 c, g dbSNP:774247151
2895 2895 a, g dbSNP:771038343
2903 2903 a, g dbSNP:749359334
2910 2910 c, t dbSNP:201810397
2915 2915 c, t dbSNP:756302545
2920 2920 a, g dbSNP:748337450
2921 2921 c, t dbSNP:781733528
2922 2922 a, g dbSNP:147554296
2926 2926 c, t dbSNP:752161850
2927 2927 a, g dbSNP:201056799
2935 2935 a, t dbSNP:758901704
2936 2936 c, t dbSNP:753313171
2942 2942 c, t dbSNP:763604691
2943 2943 a, g dbSNP:760307957
2950 2950 c, t dbSNP:775107483
2955 2955 c, t dbSNP:767345167
2959 2959 c, t dbSNP:759292330