Email to GenScript

ERCC4 excision repair cross-complementation group 4 [Homo sapiens (human)]

Gene Symbol ERCC4
Entrez Gene ID 2072
Full Name excision repair cross-complementation group 4
Synonyms ERCC11, FANCQ, RAD1, XPF
General protein information
Preferred Names
DNA repair endonuclease XPF
DNA repair endonuclease XPF
DNA excision repair protein ERCC-4
DNA repair protein complementing XP-F cells
xeroderma pigmentosum, complementation group F
xeroderma pigmentosum group F-complementing protein
excision-repair, complementing defective, in Chinese hamster
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene forms a complex with ERCC1 and is involved in the 5' incision made during nucleotide excision repair. This complex is a structure specific DNA repair endonuclease that interacts with EME1. Defects in this gene are a cause of xeroderma pigmentosum complementation group F (XP-F), or xeroderma pigmentosum VI (XP6).[provided by RefSeq, Mar 2009]. lac of sum
Disorder MIM:


Disorder Html: Xeroderma pigmentosum, group F, 278760 (3); XFE progeroid syndrome,

The following ERCC4 gene sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the ERCC4 gene which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu57569 XM_011522424 PREDICTED: Homo sapiens excision repair cross-complementation group 4 (ERCC4), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu57570 XM_011522425 PREDICTED: Homo sapiens excision repair cross-complementation group 4 (ERCC4), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 Quote Price
OHu57571 XM_011522426 PREDICTED: Homo sapiens excision repair cross-complementation group 4 (ERCC4), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439
OHu57572 XM_011522427 PREDICTED: Homo sapiens excision repair cross-complementation group 4 (ERCC4), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 5-7 $319
OHu18825 NM_005236 Homo sapiens excision repair cross-complementation group 4 (ERCC4), mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu57569
Accession Version XM_011522424.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2889bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA repair endonuclease XPF isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)310..2880(+)
Misc Feature(2)2215..2607(+)
Position Chain Variation Link
5 5 a, g dbSNP:200113697
7 7 c, g dbSNP:766745594
10 10 a, c, g dbSNP:751823206
14 14 g, t dbSNP:763809454
20 20 a, c dbSNP:753601029
22 22 a, c dbSNP:543978998
23 23 g, t dbSNP:778859873
25 25 a, g dbSNP:373789508
27 27 a, g dbSNP:749985757
29 29 c, g, t dbSNP:148904556
30 30 a, c dbSNP:375831794
31 31 a, g dbSNP:768243270
33 33 a, g dbSNP:781417413
36 36 a, g dbSNP:748509102
37 37 c, g, t dbSNP:61760160
39 39 a, g dbSNP:763189317
40 40 a, g dbSNP:771117594
42 42 c, t dbSNP:759774291
43 43 c, g dbSNP:774510191
44 44 a, g dbSNP:759843019
52 52 g, t dbSNP:767738598
53 53 c, t dbSNP:753596005
54 54 a, c, t dbSNP:3136042
55 55 a, g dbSNP:750358005
58 58 a, g, t dbSNP:374243778
59 59 a, c dbSNP:751008601
60 60 a, g dbSNP:112419956
62 62 c, t dbSNP:754622238
64 64 c, t dbSNP:140734311
70 70 g, t dbSNP:368281878
82 82 c, g dbSNP:748499820
83 83 a, c dbSNP:756494000
84 84 c, g dbSNP:375896908
87 87 a, g dbSNP:749822829
90 90 a, g dbSNP:201606798
94 94 g, t dbSNP:560047653
95 95 a, t dbSNP:745893266
99 99 a, g dbSNP:772230343
100 100 c, t dbSNP:587778282
104 104 a, g dbSNP:367608263
106 106 a, g dbSNP:765069053
117 117 a, g dbSNP:772933233
118 118 c, g dbSNP:34205098
121 121 c, g dbSNP:61731714
126 126 c, t dbSNP:762885804
130 130 c, t dbSNP:144602005
142 142 -, g dbSNP:749349821
143 143 c, g dbSNP:751095195
144 144 c, g dbSNP:754491247
145 145 a, g dbSNP:767138486
146 146 a, g dbSNP:752379459
147 147 c, t dbSNP:755659888
150 150 a, g dbSNP:778283997
156 156 c, t dbSNP:749628982
158 158 a, g dbSNP:757860762
164 164 a, t dbSNP:779538282
166 166 c, t dbSNP:552142099
182 182 a, c dbSNP:772189900
186 186 a, g dbSNP:571953222
187 187 c, g, t dbSNP:537670308
195 195 c, g dbSNP:768694415
197 197 a, t dbSNP:587778283
202 202 a, g dbSNP:773025207
217 217 c, t dbSNP:762691172
229 229 g, t dbSNP:759518166
231 231 a, g dbSNP:771860466
232 232 c, t dbSNP:145315496
238 238 a, g dbSNP:141591400
246 246 a, g dbSNP:192488568
247 247 c, t dbSNP:753534967
249 249 a, g dbSNP:61760162
253 253 a, t dbSNP:765712858
255 255 -, aga dbSNP:771203473
260 260 a, g dbSNP:750687183
262 262 a, g, t dbSNP:55761944
266 266 a, g dbSNP:751713894
268 268 c, t dbSNP:755021656
273 273 c, t dbSNP:3136056
274 274 c, t dbSNP:748380872
277 277 c, t dbSNP:769932063
278 278 a, g dbSNP:187435008
280 280 c, t dbSNP:191886782
281 281 a, g dbSNP:371487368
296 296 g, t dbSNP:556330628
307 307 a, c dbSNP:775257742
310 310 c, t dbSNP:760327512
311 311 a, g dbSNP:768270013
326 326 a, c, t dbSNP:144408815
327 327 a, t dbSNP:764943215
329 329 a, c dbSNP:773652331
335 335 c, g dbSNP:763208431
338 338 g, t dbSNP:766951888
340 340 a, t dbSNP:752008977
342 342 a, g dbSNP:549297996
346 346 a, g dbSNP:148791570
347 347 c, t dbSNP:767586458
348 348 a, g dbSNP:377085353
367 367 a, g dbSNP:763811136
372 372 c, t dbSNP:189742296
376 376 c, t dbSNP:565715127
381 381 g, t dbSNP:777834718
384 384 c, t dbSNP:555020322
388 388 a, g dbSNP:144666685
393 393 c, t dbSNP:780096152
413 413 c, t dbSNP:540204753
444 444 c, t dbSNP:188067471
447 447 a, g dbSNP:573860878
470 470 c, g dbSNP:528753371
473 473 a, g dbSNP:554873911
479 479 a, g dbSNP:752813352
487 487 a, g dbSNP:571857798
550 550 a, g dbSNP:769186966
554 554 c, t dbSNP:772979483
556 556 a, c, g dbSNP:748894431
558 558 a, g dbSNP:774717152
560 560 a, g, t dbSNP:745648039
563 563 c, g dbSNP:772606808
567 567 c, g dbSNP:775970324
579 579 c, t dbSNP:138724289
580 580 a, g dbSNP:760865964
584 584 a, c dbSNP:764093404
585 585 a, c, t dbSNP:147455220
587 587 a, g dbSNP:765509563
589 589 c, g dbSNP:751450497
606 606 g, t dbSNP:139989614
607 607 a, c, t dbSNP:145402255
608 608 a, g dbSNP:377014538
613 613 c, t dbSNP:752672749
617 617 a, c, g dbSNP:121913050
620 620 a, g dbSNP:772205098
624 624 a, g dbSNP:748779012
629 629 a, t dbSNP:770535929
630 630 a, g dbSNP:3136092
631 631 c, t dbSNP:746296279
634 634 c, g dbSNP:181993439
646 646 a, g dbSNP:778574449
662 662 c, g, t dbSNP:2020961
679 679 c, g dbSNP:775540682
680 680 a, g dbSNP:761092120
691 691 a, g, t dbSNP:149927607
696 696 a, g dbSNP:373408411
699 699 a, g dbSNP:765599689
700 700 a, g, t dbSNP:750673145
712 712 a, c dbSNP:767437700
714 714 c, t dbSNP:113129434
728 728 c, t dbSNP:756024042
733 733 c, t dbSNP:377547617
737 737 -, ggccaa dbSNP:776329282
738 738 a, g dbSNP:753325454
780 780 c, g dbSNP:766656010
790 790 a, g dbSNP:775194104
811 811 a, g dbSNP:145138851
814 814 a, g dbSNP:764003312
820 820 -, c dbSNP:758362908
826 826 c, t dbSNP:753799081
832 832 a, c dbSNP:757128317
834 834 a, g dbSNP:764731249
842 842 c, g, t dbSNP:749895744
845 845 c, t dbSNP:779737289
848 848 c, t dbSNP:397509402
859 859 a, c dbSNP:368218302
861 861 c, t dbSNP:755368456
862 862 a, g dbSNP:141101671
865 865 c, t dbSNP:397509403
873 873 a, g dbSNP:780166871
877 877 c, g dbSNP:746904084
884 884 a, g dbSNP:768217559
887 887 a, g dbSNP:144608823
889 889 a, c dbSNP:201176880
892 892 a, c dbSNP:773444862
895 895 a, t dbSNP:749352103
896 896 c, t dbSNP:370864937
897 897 a, g dbSNP:146650135
913 913 a, t dbSNP:760444530
914 914 c, t dbSNP:763961422
915 915 a, g dbSNP:776221530
935 935 a, g dbSNP:140299888
941 941 c, t dbSNP:765111229
942 942 -, t dbSNP:751290625
957 957 c, g dbSNP:746106147
958 958 c, t dbSNP:373570729
959 959 a, g, t dbSNP:143479220
981 981 a, g dbSNP:769764837
984 984 c, t dbSNP:773131349
1005 1005 a, g dbSNP:200536315
1013 1013 c, t dbSNP:765930617
1015 1015 c, t dbSNP:750971687
1033 1033 c, t dbSNP:759268826
1034 1034 a, g dbSNP:202243691
1045 1045 c, t dbSNP:753149023
1046 1046 a, g dbSNP:756540416
1048 1048 a, t dbSNP:778480216
1061 1061 a, g dbSNP:754408222
1063 1063 g, t dbSNP:757636398
1065 1065 c, t dbSNP:148003381
1071 1071 c, t dbSNP:564247394
1072 1072 a, g dbSNP:772385411
1074 1074 -, a dbSNP:772432152
1079 1079 a, t dbSNP:780219730
1082 1082 a, t dbSNP:141961015
1093 1093 g, t dbSNP:200596978
1096 1096 -, t dbSNP:780647908
1097 1097 c, t dbSNP:150244523
1102 1102 g, t dbSNP:762885572
1107 1107 a, g dbSNP:770736492
1109 1109 a, g dbSNP:773938568
1116 1116 -, t dbSNP:747327001
1122 1122 g, t dbSNP:758933707
1123 1123 c, g dbSNP:767264265
1125 1125 -, t dbSNP:35090754
1135 1135 g, t dbSNP:760433983
1140 1140 a, g dbSNP:763789717
1147 1147 c, g dbSNP:587778285
1148 1148 a, c dbSNP:777183693
1150 1150 a, t dbSNP:762052950
1157 1157 c, t dbSNP:765840370
1160 1160 c, t dbSNP:750883282
1162 1162 a, g dbSNP:758884625
1178 1178 a, g dbSNP:753728949
1181 1181 c, g dbSNP:373229910
1184 1184 a, g dbSNP:267604416
1186 1186 g, t dbSNP:755219554
1190 1190 a, g, t dbSNP:145851520
1194 1194 c, t dbSNP:756986546
1204 1204 a, g dbSNP:201410515
1217 1217 a, t dbSNP:569926448
1221 1221 a, g dbSNP:745796159
1225 1225 a, g dbSNP:772092631
1227 1227 a, c dbSNP:775161827
1228 1228 -, a dbSNP:34607888
1228 1228 a, t dbSNP:746495409
1230 1230 a, g, t dbSNP:768464180
1234 1234 -, a dbSNP:769120755
1245 1245 a, g dbSNP:762297186
1247 1247 -, t dbSNP:776206553
1249 1249 a, g dbSNP:765535723
1261 1261 a, g, t dbSNP:148933357
1266 1266 a, t dbSNP:749724323
1268 1268 a, g dbSNP:561066051
1269 1269 a, t dbSNP:774643449
1275 1275 a, g dbSNP:760060914
1279 1279 a, g dbSNP:765738455
1280 1280 a, t dbSNP:772594065
1282 1282 c, t dbSNP:376695854
1290 1290 c, t dbSNP:760787953
1294 1294 c, t dbSNP:1799802
1306 1306 a, g dbSNP:201051665
1321 1321 c, t dbSNP:199505105
1355 1355 -, ac dbSNP:779091652
1360 1360 c, t dbSNP:147458778
1363 1363 a, c, g dbSNP:200759609
1366 1366 c, g dbSNP:751348446
1367 1367 a, g dbSNP:754994055
1369 1369 c, t dbSNP:767454772
1371 1371 a, g dbSNP:752193295
1376 1376 a, g dbSNP:762147159
1378 1378 g, t dbSNP:765513788
1402 1402 c, t dbSNP:374470560
1403 1403 a, g dbSNP:1800067
1410 1410 a, t dbSNP:762738968
1424 1424 a, g dbSNP:767408205
1425 1425 a, c dbSNP:181278137
1427 1427 a, g dbSNP:143924094
1428 1428 c, t dbSNP:144305111
1442 1442 a, c, t dbSNP:763619616
1443 1443 a, g dbSNP:3136151
1452 1452 -, c dbSNP:750512090
1453 1453 g, t dbSNP:778515954
1456 1456 c, t dbSNP:116615540
1475 1475 a, c dbSNP:758786333
1477 1477 g, t dbSNP:370344307
1480 1480 a, g dbSNP:747564755
1493 1493 a, c dbSNP:368559924
1496 1496 c, t dbSNP:776880848
1498 1498 a, g dbSNP:748206066
1501 1501 c, g dbSNP:547209644
1518 1518 c, t dbSNP:773551391
1523 1523 a, g dbSNP:759312308
1525 1525 a, g dbSNP:142332295
1529 1529 a, g dbSNP:775102285
1530 1530 c, g dbSNP:760701586
1532 1532 a, g dbSNP:763991308
1535 1535 a, c dbSNP:201179693
1538 1538 a, t dbSNP:761301503
1540 1540 a, c dbSNP:764936603
1543 1543 a, g dbSNP:750095432
1545 1545 c, t dbSNP:757930503
1550 1550 a, t dbSNP:780488548
1552 1552 c, t dbSNP:751828681
1557 1557 c, g dbSNP:372950439
1559 1559 a, g dbSNP:781758234
1561 1561 a, g dbSNP:748292174
1562 1562 c, g dbSNP:769985983
1564 1564 c, t dbSNP:777945955
1571 1571 -, c dbSNP:758567128
1574 1574 c, t dbSNP:572439259
1581 1581 c, t dbSNP:771022303
1588 1588 c, t dbSNP:41557814
1589 1589 a, g dbSNP:775398434
1590 1590 g, t dbSNP:760367072
1596 1596 c, t dbSNP:768640061
1598 1598 c, t dbSNP:776546311
1605 1605 a, g dbSNP:114077770
1606 1606 a, g dbSNP:587778286
1609 1609 a, g, t dbSNP:764739776
1616 1616 a, g dbSNP:762697491
1620 1620 -, a dbSNP:747558645
1629 1629 -, g dbSNP:34930410
1641 1641 -, aactc dbSNP:768847411
1643 1643 -, ctcaa dbSNP:397509400
1647 1647 a, c, g, t dbSNP:146601373
1651 1651 a, g, t dbSNP:140252818
1652 1652 c, t dbSNP:373587423
1653 1653 a, t dbSNP:538185672
1659 1659 a, c dbSNP:777944273
1660 1660 c, g, t dbSNP:371114175
1666 1666 a, g dbSNP:778992329
1671 1671 -, g dbSNP:781559890
1680 1680 a, c dbSNP:746890369
1682 1682 a, g dbSNP:587778288
1690 1690 a, g dbSNP:200617058
1691 1691 a, g dbSNP:761759726
1696 1696 a, g dbSNP:769679311
1698 1698 a, g dbSNP:374391979
1700 1700 a, g dbSNP:201514032
1703 1703 a, g dbSNP:766111215
1707 1707 a, g dbSNP:773866713
1708 1708 a, g dbSNP:150291286
1713 1713 a, c dbSNP:768020598
1722 1722 a, c, g dbSNP:41552412
1734 1734 c, t dbSNP:779170299
1736 1736 a, c, t dbSNP:149056863
1737 1737 a, g dbSNP:757281318
1740 1740 a, t dbSNP:200649435
1755 1755 a, g dbSNP:746104783
1765 1765 c, g dbSNP:143347563
1767 1767 a, g dbSNP:780996067
1778 1778 c, t dbSNP:368830992
1779 1779 a, g dbSNP:769817145
1790 1790 -, t dbSNP:369082850
1792 1792 a, g dbSNP:773007457
1807 1807 c, t dbSNP:139197943
1808 1808 c, t dbSNP:770347803
1813 1813 a, g dbSNP:773850619
1814 1814 c, t dbSNP:549865610
1816 1816 a, g dbSNP:376216413
1827 1827 a, g dbSNP:759296999
1835 1835 a, g dbSNP:370896187
1836 1836 c, t dbSNP:776049363
1843 1843 a, g dbSNP:55736359
1847 1847 c, g, t dbSNP:764730051
1848 1848 c, g dbSNP:553999029
1850 1850 a, g, t dbSNP:765254949
1861 1861 a, t dbSNP:758658934
1863 1863 a, g, t dbSNP:780225844
1864 1864 a, g dbSNP:755854109
1865 1865 c, t dbSNP:777553142
1870 1870 c, t dbSNP:587778287
1886 1886 c, g dbSNP:1800068
1887 1887 a, g, t dbSNP:765454246
1888 1888 -, a dbSNP:747759202
1889 1889 -, a dbSNP:397509404
1891 1891 a, g dbSNP:202186213
1893 1893 a, g dbSNP:771912352
1899 1899 g, t dbSNP:374556359
1905 1905 c, g dbSNP:775278986
1908 1908 a, g dbSNP:760310698
1917 1917 c, g dbSNP:367595904
1921 1921 a, g dbSNP:777006157
1922 1922 c, t dbSNP:371392134
1924 1924 c, t dbSNP:147105770
1925 1925 a, g dbSNP:750549531
1927 1927 c, t dbSNP:763006163
1930 1930 c, g dbSNP:766652186
1946 1946 a, c, t dbSNP:751782722
1947 1947 g, t dbSNP:374303503
1952 1952 a, g dbSNP:777448181
1955 1955 c, t dbSNP:753641687
1957 1957 a, g dbSNP:755150407
1961 1961 a, c dbSNP:138532294
1966 1966 c, t dbSNP:745442045
1976 1976 a, g, t dbSNP:189463122
1979 1979 g, t dbSNP:748526617
1980 1980 g, t dbSNP:61760161
1989 1989 c, t dbSNP:763332387
1990 1990 a, g dbSNP:749814308
1999 1999 a, g dbSNP:771383745
2004 2004 a, c, g dbSNP:774347057
2009 2009 -, a dbSNP:769406369
2009 2009 a, g dbSNP:767702213
2011 2011 c, t dbSNP:373565480
2012 2012 a, g dbSNP:760922582
2013 2013 c, g dbSNP:765147177
2015 2015 a, g dbSNP:750205235
2019 2019 c, g dbSNP:758451676
2029 2029 a, c, t dbSNP:766395322
2030 2030 a, g dbSNP:180919656
2038 2038 -, aagg dbSNP:772899497
2040 2040 g, t dbSNP:780500474
2043 2043 a, g dbSNP:2020958
2055 2055 a, g, t dbSNP:546230479
2059 2059 -, ataag dbSNP:762355362
2059 2059 a, g dbSNP:533626393
2061 2061 a, g dbSNP:749634352
2062 2062 a, c dbSNP:771488066
2076 2076 a, c dbSNP:377213481
2077 2077 a, c dbSNP:762059602
2080 2080 a, g dbSNP:770771750
2084 2084 c, t dbSNP:773964691
2097 2097 a, g dbSNP:759544889
2099 2099 a, g dbSNP:112490976
2101 2101 a, g dbSNP:369471816
2102 2102 a, g dbSNP:752265539
2107 2107 g, t dbSNP:760177195
2129 2129 c, t dbSNP:763532154
2134 2134 a, g dbSNP:753506602
2135 2135 a, g dbSNP:756811179
2138 2138 a, c, t dbSNP:779366136
2142 2142 a, g dbSNP:373237850
2143 2143 c, t dbSNP:2020955
2148 2148 a, c dbSNP:747151321
2159 2159 a, c, t dbSNP:200317919
2160 2160 g, t dbSNP:781362388
2162 2162 a, t dbSNP:748400348
2164 2164 a, g dbSNP:769863971
2166 2166 g, t dbSNP:376422457
2167 2167 c, t dbSNP:139782718
2168 2168 a, g dbSNP:56129764
2171 2171 a, g dbSNP:201675333
2175 2175 c, t dbSNP:775414253
2176 2176 a, c, g dbSNP:760553358
2179 2179 a, g dbSNP:765005836
2189 2189 a, g dbSNP:370466614
2198 2198 c, t dbSNP:762607920
2205 2205 a, g dbSNP:565249189
2216 2216 c, t dbSNP:751928876
2221 2221 a, t dbSNP:755577606
2224 2224 a, c, t dbSNP:149364215
2233 2233 c, t dbSNP:756155469
2234 2234 a, g, t dbSNP:777853585
2235 2235 a, g dbSNP:757434523
2236 2236 a, g dbSNP:779865123
2237 2237 g, t dbSNP:746784825
2242 2242 a, c dbSNP:768640022
2246 2246 c, t dbSNP:752894496
2256 2256 a, c, g dbSNP:556423345
2260 2260 c, g dbSNP:772728961
2261 2261 a, g dbSNP:762543560
2264 2264 a, g dbSNP:144058769
2267 2267 g, t dbSNP:774900622
2276 2276 c, t dbSNP:1800069
2277 2277 c, t dbSNP:777766206
2281 2281 c, t dbSNP:753161715
2283 2283 a, c, t dbSNP:376391395
2284 2284 a, g dbSNP:373906926
2297 2297 c, t dbSNP:757525012
2315 2315 a, c, t dbSNP:779096061
2323 2323 a, g dbSNP:754771000
2328 2328 a, c, t dbSNP:2020959
2334 2334 a, g dbSNP:769731155
2335 2335 a, c, t dbSNP:777184889
2336 2336 a, c, g dbSNP:368096448
2345 2345 c, t dbSNP:375860375
2346 2346 c, t dbSNP:746273815
2348 2348 a, g dbSNP:772589823
2349 2349 c, t dbSNP:368274574
2355 2355 a, g dbSNP:761130884
2358 2358 c, t dbSNP:372425414
2359 2359 a, g dbSNP:753924297
2367 2367 a, g dbSNP:761878121
2374 2374 a, g dbSNP:765235917
2377 2377 c, t dbSNP:376688194
2378 2378 a, g dbSNP:758565772
2384 2384 a, g dbSNP:780880381
2392 2392 c, g, t dbSNP:12932917
2395 2395 a, c dbSNP:756050702
2399 2399 c, t dbSNP:12928616
2400 2400 c, t dbSNP:367813650
2407 2407 c, t dbSNP:374978891
2408 2408 a, g dbSNP:748870665
2419 2419 c, t dbSNP:535728795
2420 2420 a, g dbSNP:143357336
2424 2424 c, t dbSNP:555317161
2425 2425 a, g dbSNP:201501958
2436 2436 g, t dbSNP:778971103
2447 2447 c, t dbSNP:761087753
2449 2449 a, g dbSNP:146764714
2451 2451 c, t dbSNP:139406689
2455 2455 a, c dbSNP:142532415
2462 2462 c, t dbSNP:12928650
2464 2464 c, t dbSNP:373135011
2466 2466 c, t dbSNP:765321722
2473 2473 c, t dbSNP:150920741
2495 2495 c, t dbSNP:763202833
2498 2498 c, g dbSNP:766596368
2507 2507 a, g dbSNP:375263578
2517 2517 c, t dbSNP:143081574
2519 2519 a, g dbSNP:755929592
2520 2520 a, g dbSNP:763726880
2528 2528 c, t dbSNP:753851289
2534 2534 -, cacttcacttc dbSNP:775452814
2539 2539 a, c, t dbSNP:757223070
2545 2545 a, c dbSNP:772423662
2551 2551 c, g dbSNP:369736388
2553 2553 a, g dbSNP:111613748
2554 2554 c, t dbSNP:121913049
2557 2557 -, cttacacttcacttccccagactacgga dbSNP:397509401
2568 2568 c, t dbSNP:779753781
2582 2582 c, g dbSNP:746576915
2585 2585 c, t dbSNP:769080259
2586 2586 a, g dbSNP:2020960
2588 2588 a, c dbSNP:748683649
2589 2589 a, g dbSNP:770255135
2592 2592 a, g dbSNP:773329866
2595 2595 a, g dbSNP:373510515
2602 2602 c, g dbSNP:766573225
2611 2611 c, g dbSNP:774635437
2616 2616 a, c dbSNP:759616913
2621 2621 c, t dbSNP:763983833
2622 2622 a, g dbSNP:2020953
2625 2625 a, g dbSNP:757316495
2633 2633 c, g dbSNP:765253522
2634 2634 a, g dbSNP:200818432
2636 2636 c, t dbSNP:141790888
2639 2639 c, t dbSNP:757931216
2644 2644 c, t dbSNP:779375310
2650 2650 a, g dbSNP:746694351
2653 2653 a, g dbSNP:754544912
2655 2655 a, g dbSNP:147083262
2659 2659 a, g, t dbSNP:138583819
2663 2663 a, c dbSNP:370258803
2664 2664 c, t dbSNP:1799801
2665 2665 a, g dbSNP:749688539
2671 2671 c, g dbSNP:771053699
2673 2673 c, t dbSNP:200069811
2676 2676 c, g, t dbSNP:200715555
2677 2677 a, g dbSNP:776625719
2678 2678 a, c dbSNP:761699907
2693 2693 a, g dbSNP:377562755
2694 2694 c, t dbSNP:750391635
2696 2696 c, t dbSNP:762753294
2704 2704 c, g dbSNP:374186605
2705 2705 a, t dbSNP:750999717
2708 2708 a, g dbSNP:754705146
2710 2710 g, t dbSNP:780805780
2715 2715 c, g dbSNP:529976681
2729 2729 a, g dbSNP:776036851
2730 2730 a, g dbSNP:111787810
2733 2733 a, g dbSNP:753126294
2738 2738 a, c dbSNP:4986933
2739 2739 a, c dbSNP:76446924
2744 2744 a, c dbSNP:202159590
2745 2745 c, t dbSNP:778051880
2746 2746 g, t dbSNP:773636525
2747 2747 c, g dbSNP:749822053
2749 2749 c, t dbSNP:587778284
2753 2753 c, t dbSNP:779099430
2754 2754 -, t dbSNP:760599709
2754 2754 c, t dbSNP:745923107
2761 2761 c, t dbSNP:548842693
2762 2762 a, c dbSNP:368064765
2763 2763 c, t dbSNP:370809250
2766 2766 c, t dbSNP:769736716
2767 2767 a, g dbSNP:562305007
2769 2769 a, t dbSNP:762984557
2774 2774 a, g dbSNP:766200743
2775 2775 c, t dbSNP:763275769
2776 2776 a, g dbSNP:2020957
2778 2778 c, t dbSNP:759042927
2780 2780 c, t dbSNP:766946690
2783 2783 a, g dbSNP:1800124
2789 2789 c, g dbSNP:755713614
2791 2791 g, t dbSNP:778153718
2800 2800 c, g dbSNP:754131812
2802 2802 a, g dbSNP:757841266
2805 2805 a, c, t dbSNP:538267970
2806 2806 a, g dbSNP:201652412
2813 2813 c, t dbSNP:772294893
2814 2814 a, g dbSNP:16963255
2818 2818 a, g dbSNP:752703922
2834 2834 a, c dbSNP:747268097
2836 2836 a, g dbSNP:201926295
2853 2853 c, t dbSNP:138296474
2854 2854 g, t dbSNP:537592259
2859 2859 c, t dbSNP:191674905
2867 2867 c, t dbSNP:770963694
2873 2873 g, t dbSNP:774160726
2876 2876 c, t dbSNP:759410779
2880 2880 a, g dbSNP:767034692
2881 2881 -, a dbSNP:765546590
2882 2882 a, t dbSNP:774939544
2883 2883 a, c, t dbSNP:3136225
2884 2884 a, c, g dbSNP:140726146
2888 2888 c, t dbSNP:765582513
2891 2891 a, g dbSNP:753734253
2893 2893 a, g dbSNP:150077735
2894 2894 a, g dbSNP:2020956
2895 2895 -, a dbSNP:750727529
2905 2905 a, c dbSNP:758936308
2908 2908 c, t dbSNP:780318166
2913 2913 a, g dbSNP:747059736
2915 2915 c, t dbSNP:755306366
2918 2918 c, t dbSNP:781261543
2921 2921 c, t dbSNP:9929524
2922 2922 a, t dbSNP:770644250
2929 2929 g, t dbSNP:574181440
2935 2935 c, t dbSNP:369845118
2936 2936 a, g dbSNP:745834636
2942 2942 a, g dbSNP:771976579
2946 2946 a, t dbSNP:775040023
2948 2948 g, t dbSNP:760175182
2953 2953 c, t dbSNP:200296085
2954 2954 a, g dbSNP:3136226
2958 2958 c, t dbSNP:761481929
3005 3005 a, g dbSNP:117384292
3068 3068 c, t dbSNP:543502035
3098 3098 a, t dbSNP:556712304
3102 3102 c, t dbSNP:536552167
3108 3108 c, t dbSNP:542176025
3118 3118 c, t dbSNP:562343456
3132 3132 c, t dbSNP:527893953
3133 3133 a, g dbSNP:543279126
3158 3158 a, g dbSNP:541600279
3170 3170 g, t dbSNP:564658450
3173 3173 c, t dbSNP:533310107
3175 3175 c, g dbSNP:550225655
3210 3210 a, g dbSNP:765296684
3228 3228 a, t dbSNP:147799208
3232 3232 a, c dbSNP:750308239
3268 3268 c, t dbSNP:762905902
3269 3269 a, g dbSNP:183465897
3321 3321 c, t dbSNP:141279442
3361 3361 c, t dbSNP:565592403
3376 3376 g, t dbSNP:534595915
3394 3394 g, t dbSNP:3743538
3419 3419 a, g dbSNP:760978837
3423 3423 c, g, t dbSNP:371345833
3427 3427 a, t dbSNP:545416742
3429 3429 a, g dbSNP:746499083
3449 3449 a, g dbSNP:565318315
3468 3468 a, c dbSNP:376791839
3526 3526 c, t dbSNP:536781995
3584 3584 c, g dbSNP:1651204
3585 3585 g, t dbSNP:1651203
3589 3589 c, g dbSNP:116246143
3610 3610 -, at dbSNP:750161593
3611 3611 a, t dbSNP:146955145
3636 3636 c, g dbSNP:2276464
3655 3655 a, c dbSNP:541739848
3718 3718 c, t dbSNP:561265785
3720 3720 a, g dbSNP:2276465
3792 3792 c, g dbSNP:187039399
3796 3796 c, t dbSNP:757335570
3801 3801 a, g dbSNP:191634336
3840 3840 c, t dbSNP:1055443
3842 3842 a, g dbSNP:112574290
3851 3851 a, c dbSNP:376982978
3857 3857 c, t dbSNP:117293226
3881 3881 c, g dbSNP:2276466
3913 3913 c, t dbSNP:764425829
3920 3920 a, g dbSNP:182347151
3923 3923 c, g dbSNP:776927829
3936 3936 c, g dbSNP:368797729
3944 3944 a, g dbSNP:528398095
3947 3947 a, t dbSNP:551248118
3961 3961 c, t dbSNP:545772856
3966 3966 a, g dbSNP:72781468
3971 3971 -, aaaag dbSNP:549984925
4000 4000 a, g dbSNP:537224795
4051 4051 a, g dbSNP:186586436
4056 4056 c, t dbSNP:567315876
4112 4112 g, t dbSNP:536346195
4117 4117 g, t dbSNP:193289721
4128 4128 a, g dbSNP:572852406
4161 4161 c, t dbSNP:532485638
4166 4166 c, g dbSNP:373479879
4196 4196 a, g dbSNP:185626419
4197 4197 c, t dbSNP:535372156
4198 4198 a, g dbSNP:143188036
4203 4203 a, g dbSNP:375218385
4254 4254 -, t dbSNP:34388983
4256 4256 c, t dbSNP:750161345
4263 4263 a, g dbSNP:77401662
4265 4265 a, g dbSNP:543949045
4320 4320 a, g dbSNP:766219203
4325 4325 c, t dbSNP:548735957
4331 4331 g, t dbSNP:76447723
4382 4382 c, t dbSNP:112742002
4388 4388 c, t dbSNP:754423213
4429 4429 g, t dbSNP:542690728
4465 4465 c, t dbSNP:190536009
4511 4511 c, t dbSNP:747753243
4547 4547 c, t dbSNP:568549113
4556 4556 c, g dbSNP:372528374
4585 4585 c, t dbSNP:570169244
4589 4589 a, g dbSNP:537527346
4594 4594 a, g dbSNP:148155845
4609 4609 c, t dbSNP:747649934
4614 4614 a, g dbSNP:755744665
4618 4618 a, g dbSNP:528435639
4620 4620 c, t dbSNP:746216891
4644 4644 c, t dbSNP:551285375
4684 4684 c, t dbSNP:772694607
4685 4685 a, g dbSNP:773340693
4706 4706 c, t dbSNP:565142105
4712 4712 c, t dbSNP:537535365
4713 4713 a, g dbSNP:530629612
4768 4768 c, t dbSNP:775803860
4772 4772 c, t dbSNP:550794794
4790 4790 c, t dbSNP:112776898
4804 4804 a, g dbSNP:192910261
4814 4814 a, g dbSNP:770921381
4826 4826 -, c dbSNP:34866586
4846 4846 a, g dbSNP:115472788
4901 4901 a, t dbSNP:567966619
4937 4937 g, t dbSNP:538608476
4985 4985 a, g dbSNP:558169438
5033 5033 g, t dbSNP:774315575
5045 5045 a, g dbSNP:578166086
5049 5049 a, c dbSNP:140019040
5084 5084 a, g dbSNP:9925509
5089 5089 c, t dbSNP:111651288
5181 5181 a, g dbSNP:573881501
5274 5274 a, g dbSNP:542729521
5312 5312 a, g dbSNP:559394290
5324 5324 a, t dbSNP:572906300
5325 5325 a, g dbSNP:549968233
5336 5336 a, t dbSNP:768817193
5352 5352 g, t dbSNP:565128975
5355 5355 a, t dbSNP:777015670
5356 5356 a, g dbSNP:530884886
5363 5363 a, g dbSNP:567813836
5387 5387 -, a dbSNP:563490201
5421 5421 a, g dbSNP:184381372
5423 5423 a, c dbSNP:11075223
5424 5424 a, g dbSNP:553578280
5449 5449 a, g dbSNP:115526695
5482 5482 -, c dbSNP:61422086
5486 5486 a, cc dbSNP:386789300
5487 5487 a, c dbSNP:56012340
5497 5497 a, t dbSNP:76963262
5498 5498 a, g dbSNP:188840787
5553 5553 -, g dbSNP:373646296
5557 5557 a, g dbSNP:532153427
5559 5559 a, t dbSNP:376328949
5573 5573 c, t dbSNP:558811254
5622 5622 c, t dbSNP:552190642
5631 5631 a, t dbSNP:762639164
5647 5647 a, g dbSNP:142073142
5654 5654 a, t dbSNP:12325236
5661 5661 a, g dbSNP:751428407
5669 5669 c, t dbSNP:776910274
5693 5693 a, g dbSNP:545748696
5726 5726 a, t dbSNP:146325817
5759 5759 a, g dbSNP:567543133
5789 5789 a, c dbSNP:181178937
5802 5802 c, g dbSNP:376334296
5840 5840 a, g dbSNP:573044100
5851 5851 g, t dbSNP:545171920
5896 5896 a, t dbSNP:558935375
5915 5915 c, g dbSNP:115605700
5931 5931 g, t dbSNP:767067212
5935 5935 a, g dbSNP:544513268
5942 5942 g, t dbSNP:4781562
6003 6003 c, t dbSNP:183916977
6035 6035 a, g dbSNP:115183774
6040 6040 c, t dbSNP:189232031
6081 6081 a, c, t dbSNP:180762894
6094 6094 a, g dbSNP:577306350
6105 6105 a, g dbSNP:4781563
6110 6110 a, g dbSNP:8056393
6113 6113 a, g dbSNP:114059834
6177 6177 a, g dbSNP:187182207
6209 6209 a, g dbSNP:551258089
6229 6229 a, g dbSNP:567578149
6232 6232 c, t dbSNP:536535885
6237 6237 a, g dbSNP:535056033
6329 6329 c, g dbSNP:543593100
6349 6349 a, g dbSNP:192113185
6386 6386 c, t dbSNP:539159846
6403 6403 c, t dbSNP:79560972
6447 6447 c, t dbSNP:113073720
6468 6468 -, t dbSNP:34103244
6505 6505 c, t dbSNP:544234052
6506 6506 a, g dbSNP:554914070
6510 6510 -, a dbSNP:34282104
6530 6530 c, t dbSNP:117678596
6626 6626 a, g dbSNP:370469183
6637 6637 g, t dbSNP:560338292
6700 6700 a, g dbSNP:545911330
6711 6711 c, t dbSNP:113403633
6716 6716 -, ttgtat dbSNP:748796519
6724 6724 a, c, g dbSNP:181872627
6821 6821 c, t dbSNP:552082015
6823 6823 c, g dbSNP:112259692
6831 6831 a, c dbSNP:773246781
6856 6856 -, t dbSNP:3837752
6863 6863 -, t dbSNP:397778750
6870 6870 a, g dbSNP:531344901
6887 6887 a, c dbSNP:762808427
6903 6903 c, t dbSNP:530337169

Target ORF information:

RefSeq Version XM_011522424
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens excision repair cross-complementation group 4 (ERCC4), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu57570
Accession Version XM_011522425.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2208bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA repair endonuclease XPF isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)1236..3413(+)
Misc Feature(2)2748..3140(+)
Position Chain Variation Link
6 6 a, g dbSNP:372797345
40 40 c, t dbSNP:3136061
65 65 c, g dbSNP:779583075
111 111 a, g dbSNP:577093457
116 116 g, t dbSNP:746342641
149 149 c, t dbSNP:546002455
151 151 a, g dbSNP:536531115
177 177 a, g dbSNP:189492432
208 208 a, t dbSNP:373941150
215 215 c, t dbSNP:542006023
235 235 c, t dbSNP:772052472
236 236 a, g dbSNP:145519412
241 241 -, t dbSNP:35308675
247 247 a, g dbSNP:775584585
267 267 c, g dbSNP:559454559
278 278 a, g dbSNP:181865195
281 281 a, g dbSNP:559297175
324 324 -, c dbSNP:74684179
325 325 -, c dbSNP:67254371
325 325 c, t dbSNP:3136062
330 330 a, g dbSNP:3136063
333 333 a, g dbSNP:564397026
348 348 c, t dbSNP:533231946
355 355 c, t dbSNP:758485331
360 360 a, g dbSNP:185975565
403 403 a, g dbSNP:190441377
418 418 c, t dbSNP:529074381
421 421 c, t dbSNP:3136064
462 462 c, t dbSNP:761646891
478 478 a, g dbSNP:764964841
482 482 c, t dbSNP:773166256
488 488 a, g dbSNP:3136065
505 505 c, g dbSNP:3136066
525 525 c, g dbSNP:142559661
593 593 a, g dbSNP:748478470
594 594 c, g dbSNP:570819693
599 599 c, t dbSNP:3136067
620 620 -, c, gtgcctggt dbSNP:3136068
620 620 -, tgcctggt dbSNP:140731678
623 623 -, ctggt dbSNP:201791769
648 648 c, t dbSNP:3136069
700 700 c, g dbSNP:754415677
749 749 a, c dbSNP:747648386
759 759 a, t dbSNP:3136070
765 765 a, t dbSNP:542396169
766 766 a, t dbSNP:181664152
795 795 a, g dbSNP:536490011
807 807 a, g dbSNP:550187970
808 808 g, t dbSNP:3136071
833 833 a, c dbSNP:76510856
836 836 c, t dbSNP:777433770
858 858 a, t dbSNP:140654892
869 869 c, t dbSNP:3136072
873 873 a, g dbSNP:145909251
881 881 a, g dbSNP:3136073
898 898 a, c dbSNP:533358791
924 924 c, g dbSNP:746376610
942 942 c, g dbSNP:2238463
1034 1034 c, t dbSNP:780424700
1062 1062 a, c, g dbSNP:138461931
1063 1063 c, g dbSNP:141232484
1069 1069 a, c, t dbSNP:150182424
1083 1083 a, g dbSNP:769186966
1087 1087 c, t dbSNP:772979483
1089 1089 a, c, g dbSNP:748894431
1091 1091 a, g dbSNP:774717152
1093 1093 a, g, t dbSNP:745648039
1096 1096 c, g dbSNP:772606808
1100 1100 c, g dbSNP:775970324
1112 1112 c, t dbSNP:138724289
1113 1113 a, g dbSNP:760865964
1117 1117 a, c dbSNP:764093404
1118 1118 a, c, t dbSNP:147455220
1120 1120 a, g dbSNP:765509563
1122 1122 c, g dbSNP:751450497
1139 1139 g, t dbSNP:139989614
1140 1140 a, c, t dbSNP:145402255
1141 1141 a, g dbSNP:377014538
1146 1146 c, t dbSNP:752672749
1150 1150 a, c, g dbSNP:121913050
1153 1153 a, g dbSNP:772205098
1157 1157 a, g dbSNP:748779012
1162 1162 a, t dbSNP:770535929
1163 1163 a, g dbSNP:3136092
1164 1164 c, t dbSNP:746296279
1167 1167 c, g dbSNP:181993439
1179 1179 a, g dbSNP:778574449
1195 1195 c, g, t dbSNP:2020961
1212 1212 c, g dbSNP:775540682
1213 1213 a, g dbSNP:761092120
1224 1224 a, g, t dbSNP:149927607
1229 1229 a, g dbSNP:373408411
1232 1232 a, g dbSNP:765599689
1233 1233 a, g, t dbSNP:750673145
1245 1245 a, c dbSNP:767437700
1247 1247 c, t dbSNP:113129434
1261 1261 c, t dbSNP:756024042
1266 1266 c, t dbSNP:377547617
1270 1270 -, ggccaa dbSNP:776329282
1271 1271 a, g dbSNP:753325454
1313 1313 c, g dbSNP:766656010
1323 1323 a, g dbSNP:775194104
1344 1344 a, g dbSNP:145138851
1347 1347 a, g dbSNP:764003312
1353 1353 -, c dbSNP:758362908
1359 1359 c, t dbSNP:753799081
1365 1365 a, c dbSNP:757128317
1367 1367 a, g dbSNP:764731249
1375 1375 c, g, t dbSNP:749895744
1378 1378 c, t dbSNP:779737289
1381 1381 c, t dbSNP:397509402
1392 1392 a, c dbSNP:368218302
1394 1394 c, t dbSNP:755368456
1395 1395 a, g dbSNP:141101671
1398 1398 c, t dbSNP:397509403
1406 1406 a, g dbSNP:780166871
1410 1410 c, g dbSNP:746904084
1417 1417 a, g dbSNP:768217559
1420 1420 a, g dbSNP:144608823
1422 1422 a, c dbSNP:201176880
1425 1425 a, c dbSNP:773444862
1428 1428 a, t dbSNP:749352103
1429 1429 c, t dbSNP:370864937
1430 1430 a, g dbSNP:146650135
1446 1446 a, t dbSNP:760444530
1447 1447 c, t dbSNP:763961422
1448 1448 a, g dbSNP:776221530
1468 1468 a, g dbSNP:140299888
1474 1474 c, t dbSNP:765111229
1475 1475 -, t dbSNP:751290625
1490 1490 c, g dbSNP:746106147
1491 1491 c, t dbSNP:373570729
1492 1492 a, g, t dbSNP:143479220
1514 1514 a, g dbSNP:769764837
1517 1517 c, t dbSNP:773131349
1538 1538 a, g dbSNP:200536315
1546 1546 c, t dbSNP:765930617
1548 1548 c, t dbSNP:750971687
1566 1566 c, t dbSNP:759268826
1567 1567 a, g dbSNP:202243691
1578 1578 c, t dbSNP:753149023
1579 1579 a, g dbSNP:756540416
1581 1581 a, t dbSNP:778480216
1594 1594 a, g dbSNP:754408222
1596 1596 g, t dbSNP:757636398
1598 1598 c, t dbSNP:148003381
1604 1604 c, t dbSNP:564247394
1605 1605 a, g dbSNP:772385411
1607 1607 -, a dbSNP:772432152
1612 1612 a, t dbSNP:780219730
1615 1615 a, t dbSNP:141961015
1626 1626 g, t dbSNP:200596978
1629 1629 -, t dbSNP:780647908
1630 1630 c, t dbSNP:150244523
1635 1635 g, t dbSNP:762885572
1640 1640 a, g dbSNP:770736492
1642 1642 a, g dbSNP:773938568
1649 1649 -, t dbSNP:747327001
1655 1655 g, t dbSNP:758933707
1656 1656 c, g dbSNP:767264265
1658 1658 -, t dbSNP:35090754
1668 1668 g, t dbSNP:760433983
1673 1673 a, g dbSNP:763789717
1680 1680 c, g dbSNP:587778285
1681 1681 a, c dbSNP:777183693
1683 1683 a, t dbSNP:762052950
1690 1690 c, t dbSNP:765840370
1693 1693 c, t dbSNP:750883282
1695 1695 a, g dbSNP:758884625
1711 1711 a, g dbSNP:753728949
1714 1714 c, g dbSNP:373229910
1717 1717 a, g dbSNP:267604416
1719 1719 g, t dbSNP:755219554
1723 1723 a, g, t dbSNP:145851520
1727 1727 c, t dbSNP:756986546
1737 1737 a, g dbSNP:201410515
1750 1750 a, t dbSNP:569926448
1754 1754 a, g dbSNP:745796159
1758 1758 a, g dbSNP:772092631
1760 1760 a, c dbSNP:775161827
1761 1761 -, a dbSNP:34607888
1761 1761 a, t dbSNP:746495409
1763 1763 a, g, t dbSNP:768464180
1767 1767 -, a dbSNP:769120755
1778 1778 a, g dbSNP:762297186
1780 1780 -, t dbSNP:776206553
1782 1782 a, g dbSNP:765535723
1794 1794 a, g, t dbSNP:148933357
1799 1799 a, t dbSNP:749724323
1801 1801 a, g dbSNP:561066051
1802 1802 a, t dbSNP:774643449
1808 1808 a, g dbSNP:760060914
1812 1812 a, g dbSNP:765738455
1813 1813 a, t dbSNP:772594065
1815 1815 c, t dbSNP:376695854
1823 1823 c, t dbSNP:760787953
1827 1827 c, t dbSNP:1799802
1839 1839 a, g dbSNP:201051665
1854 1854 c, t dbSNP:199505105
1888 1888 -, ac dbSNP:779091652
1893 1893 c, t dbSNP:147458778
1896 1896 a, c, g dbSNP:200759609
1899 1899 c, g dbSNP:751348446
1900 1900 a, g dbSNP:754994055
1902 1902 c, t dbSNP:767454772
1904 1904 a, g dbSNP:752193295
1909 1909 a, g dbSNP:762147159
1911 1911 g, t dbSNP:765513788
1935 1935 c, t dbSNP:374470560
1936 1936 a, g dbSNP:1800067
1943 1943 a, t dbSNP:762738968
1957 1957 a, g dbSNP:767408205
1958 1958 a, c dbSNP:181278137
1960 1960 a, g dbSNP:143924094
1961 1961 c, t dbSNP:144305111
1975 1975 a, c, t dbSNP:763619616
1976 1976 a, g dbSNP:3136151
1985 1985 -, c dbSNP:750512090
1986 1986 g, t dbSNP:778515954
1989 1989 c, t dbSNP:116615540
2008 2008 a, c dbSNP:758786333
2010 2010 g, t dbSNP:370344307
2013 2013 a, g dbSNP:747564755
2026 2026 a, c dbSNP:368559924
2029 2029 c, t dbSNP:776880848
2031 2031 a, g dbSNP:748206066
2034 2034 c, g dbSNP:547209644
2051 2051 c, t dbSNP:773551391
2056 2056 a, g dbSNP:759312308
2058 2058 a, g dbSNP:142332295
2062 2062 a, g dbSNP:775102285
2063 2063 c, g dbSNP:760701586
2065 2065 a, g dbSNP:763991308
2068 2068 a, c dbSNP:201179693
2071 2071 a, t dbSNP:761301503
2073 2073 a, c dbSNP:764936603
2076 2076 a, g dbSNP:750095432
2078 2078 c, t dbSNP:757930503
2083 2083 a, t dbSNP:780488548
2085 2085 c, t dbSNP:751828681
2090 2090 c, g dbSNP:372950439
2092 2092 a, g dbSNP:781758234
2094 2094 a, g dbSNP:748292174
2095 2095 c, g dbSNP:769985983
2097 2097 c, t dbSNP:777945955
2104 2104 -, c dbSNP:758567128
2107 2107 c, t dbSNP:572439259
2114 2114 c, t dbSNP:771022303
2121 2121 c, t dbSNP:41557814
2122 2122 a, g dbSNP:775398434
2123 2123 g, t dbSNP:760367072
2129 2129 c, t dbSNP:768640061
2131 2131 c, t dbSNP:776546311
2138 2138 a, g dbSNP:114077770
2139 2139 a, g dbSNP:587778286
2142 2142 a, g, t dbSNP:764739776
2149 2149 a, g dbSNP:762697491
2153 2153 -, a dbSNP:747558645
2162 2162 -, g dbSNP:34930410
2174 2174 -, aactc dbSNP:768847411
2176 2176 -, ctcaa dbSNP:397509400
2180 2180 a, c, g, t dbSNP:146601373
2184 2184 a, g, t dbSNP:140252818
2185 2185 c, t dbSNP:373587423
2186 2186 a, t dbSNP:538185672
2192 2192 a, c dbSNP:777944273
2193 2193 c, g, t dbSNP:371114175
2199 2199 a, g dbSNP:778992329
2204 2204 -, g dbSNP:781559890
2213 2213 a, c dbSNP:746890369
2215 2215 a, g dbSNP:587778288
2223 2223 a, g dbSNP:200617058
2224 2224 a, g dbSNP:761759726
2229 2229 a, g dbSNP:769679311
2231 2231 a, g dbSNP:374391979
2233 2233 a, g dbSNP:201514032
2236 2236 a, g dbSNP:766111215
2240 2240 a, g dbSNP:773866713
2241 2241 a, g dbSNP:150291286
2246 2246 a, c dbSNP:768020598
2255 2255 a, c, g dbSNP:41552412
2267 2267 c, t dbSNP:779170299
2269 2269 a, c, t dbSNP:149056863
2270 2270 a, g dbSNP:757281318
2273 2273 a, t dbSNP:200649435
2288 2288 a, g dbSNP:746104783
2298 2298 c, g dbSNP:143347563
2300 2300 a, g dbSNP:780996067
2311 2311 c, t dbSNP:368830992
2312 2312 a, g dbSNP:769817145
2323 2323 -, t dbSNP:369082850
2325 2325 a, g dbSNP:773007457
2340 2340 c, t dbSNP:139197943
2341 2341 c, t dbSNP:770347803
2346 2346 a, g dbSNP:773850619
2347 2347 c, t dbSNP:549865610
2349 2349 a, g dbSNP:376216413
2360 2360 a, g dbSNP:759296999
2368 2368 a, g dbSNP:370896187
2369 2369 c, t dbSNP:776049363
2376 2376 a, g dbSNP:55736359
2380 2380 c, g, t dbSNP:764730051
2381 2381 c, g dbSNP:553999029
2383 2383 a, g, t dbSNP:765254949
2394 2394 a, t dbSNP:758658934
2396 2396 a, g, t dbSNP:780225844
2397 2397 a, g dbSNP:755854109
2398 2398 c, t dbSNP:777553142
2403 2403 c, t dbSNP:587778287
2419 2419 c, g dbSNP:1800068
2420 2420 a, g, t dbSNP:765454246
2421 2421 -, a dbSNP:747759202
2422 2422 -, a dbSNP:397509404
2424 2424 a, g dbSNP:202186213
2426 2426 a, g dbSNP:771912352
2432 2432 g, t dbSNP:374556359
2438 2438 c, g dbSNP:775278986
2441 2441 a, g dbSNP:760310698
2450 2450 c, g dbSNP:367595904
2454 2454 a, g dbSNP:777006157
2455 2455 c, t dbSNP:371392134
2457 2457 c, t dbSNP:147105770
2458 2458 a, g dbSNP:750549531
2460 2460 c, t dbSNP:763006163
2463 2463 c, g dbSNP:766652186
2479 2479 a, c, t dbSNP:751782722
2480 2480 g, t dbSNP:374303503
2485 2485 a, g dbSNP:777448181
2488 2488 c, t dbSNP:753641687
2490 2490 a, g dbSNP:755150407
2494 2494 a, c dbSNP:138532294
2499 2499 c, t dbSNP:745442045
2509 2509 a, g, t dbSNP:189463122
2512 2512 g, t dbSNP:748526617
2513 2513 g, t dbSNP:61760161
2522 2522 c, t dbSNP:763332387
2523 2523 a, g dbSNP:749814308
2532 2532 a, g dbSNP:771383745
2537 2537 a, c, g dbSNP:774347057
2542 2542 -, a dbSNP:769406369
2542 2542 a, g dbSNP:767702213
2544 2544 c, t dbSNP:373565480
2545 2545 a, g dbSNP:760922582
2546 2546 c, g dbSNP:765147177
2548 2548 a, g dbSNP:750205235
2552 2552 c, g dbSNP:758451676
2562 2562 a, c, t dbSNP:766395322
2563 2563 a, g dbSNP:180919656
2571 2571 -, aagg dbSNP:772899497
2573 2573 g, t dbSNP:780500474
2576 2576 a, g dbSNP:2020958
2588 2588 a, g, t dbSNP:546230479
2592 2592 -, ataag dbSNP:762355362
2592 2592 a, g dbSNP:533626393
2594 2594 a, g dbSNP:749634352
2595 2595 a, c dbSNP:771488066
2609 2609 a, c dbSNP:377213481
2610 2610 a, c dbSNP:762059602
2613 2613 a, g dbSNP:770771750
2617 2617 c, t dbSNP:773964691
2630 2630 a, g dbSNP:759544889
2632 2632 a, g dbSNP:112490976
2634 2634 a, g dbSNP:369471816
2635 2635 a, g dbSNP:752265539
2640 2640 g, t dbSNP:760177195
2662 2662 c, t dbSNP:763532154
2667 2667 a, g dbSNP:753506602
2668 2668 a, g dbSNP:756811179
2671 2671 a, c, t dbSNP:779366136
2675 2675 a, g dbSNP:373237850
2676 2676 c, t dbSNP:2020955
2681 2681 a, c dbSNP:747151321
2692 2692 a, c, t dbSNP:200317919
2693 2693 g, t dbSNP:781362388
2695 2695 a, t dbSNP:748400348
2697 2697 a, g dbSNP:769863971
2699 2699 g, t dbSNP:376422457
2700 2700 c, t dbSNP:139782718
2701 2701 a, g dbSNP:56129764
2704 2704 a, g dbSNP:201675333
2708 2708 c, t dbSNP:775414253
2709 2709 a, c, g dbSNP:760553358
2712 2712 a, g dbSNP:765005836
2722 2722 a, g dbSNP:370466614
2731 2731 c, t dbSNP:762607920
2738 2738 a, g dbSNP:565249189
2749 2749 c, t dbSNP:751928876
2754 2754 a, t dbSNP:755577606
2757 2757 a, c, t dbSNP:149364215
2766 2766 c, t dbSNP:756155469
2767 2767 a, g, t dbSNP:777853585
2768 2768 a, g dbSNP:757434523
2769 2769 a, g dbSNP:779865123
2770 2770 g, t dbSNP:746784825
2775 2775 a, c dbSNP:768640022
2779 2779 c, t dbSNP:752894496
2789 2789 a, c, g dbSNP:556423345
2793 2793 c, g dbSNP:772728961
2794 2794 a, g dbSNP:762543560
2797 2797 a, g dbSNP:144058769
2800 2800 g, t dbSNP:774900622
2809 2809 c, t dbSNP:1800069
2810 2810 c, t dbSNP:777766206
2814 2814 c, t dbSNP:753161715
2816 2816 a, c, t dbSNP:376391395
2817 2817 a, g dbSNP:373906926
2830 2830 c, t dbSNP:757525012
2848 2848 a, c, t dbSNP:779096061
2856 2856 a, g dbSNP:754771000
2861 2861 a, c, t dbSNP:2020959
2867 2867 a, g dbSNP:769731155
2868 2868 a, c, t dbSNP:777184889
2869 2869 a, c, g dbSNP:368096448
2878 2878 c, t dbSNP:375860375
2879 2879 c, t dbSNP:746273815
2881 2881 a, g dbSNP:772589823
2882 2882 c, t dbSNP:368274574
2888 2888 a, g dbSNP:761130884
2891 2891 c, t dbSNP:372425414
2892 2892 a, g dbSNP:753924297
2900 2900 a, g dbSNP:761878121
2907 2907 a, g dbSNP:765235917
2910 2910 c, t dbSNP:376688194
2911 2911 a, g dbSNP:758565772
2917 2917 a, g dbSNP:780880381
2925 2925 c, g, t dbSNP:12932917
2928 2928 a, c dbSNP:756050702
2932 2932 c, t dbSNP:12928616
2933 2933 c, t dbSNP:367813650
2940 2940 c, t dbSNP:374978891
2941 2941 a, g dbSNP:748870665
2952 2952 c, t dbSNP:535728795
2953 2953 a, g dbSNP:143357336
2957 2957 c, t dbSNP:555317161
2958 2958 a, g dbSNP:201501958
2969 2969 g, t dbSNP:778971103
2980 2980 c, t dbSNP:761087753
2982 2982 a, g dbSNP:146764714
2984 2984 c, t dbSNP:139406689
2988 2988 a, c dbSNP:142532415
2995 2995 c, t dbSNP:12928650
2997 2997 c, t dbSNP:373135011
2999 2999 c, t dbSNP:765321722
3006 3006 c, t dbSNP:150920741
3028 3028 c, t dbSNP:763202833
3031 3031 c, g dbSNP:766596368
3040 3040 a, g dbSNP:375263578
3050 3050 c, t dbSNP:143081574
3052 3052 a, g dbSNP:755929592
3053 3053 a, g dbSNP:763726880
3061 3061 c, t dbSNP:753851289
3067 3067 -, cacttcacttc dbSNP:775452814
3072 3072 a, c, t dbSNP:757223070
3078 3078 a, c dbSNP:772423662
3084 3084 c, g dbSNP:369736388
3086 3086 a, g dbSNP:111613748
3087 3087 c, t dbSNP:121913049
3090 3090 -, cttacacttcacttccccagactacgga dbSNP:397509401
3101 3101 c, t dbSNP:779753781
3115 3115 c, g dbSNP:746576915
3118 3118 c, t dbSNP:769080259
3119 3119 a, g dbSNP:2020960
3121 3121 a, c dbSNP:748683649
3122 3122 a, g dbSNP:770255135
3125 3125 a, g dbSNP:773329866
3128 3128 a, g dbSNP:373510515
3135 3135 c, g dbSNP:766573225
3144 3144 c, g dbSNP:774635437
3149 3149 a, c dbSNP:759616913
3154 3154 c, t dbSNP:763983833
3155 3155 a, g dbSNP:2020953
3158 3158 a, g dbSNP:757316495
3166 3166 c, g dbSNP:765253522
3167 3167 a, g dbSNP:200818432
3169 3169 c, t dbSNP:141790888
3172 3172 c, t dbSNP:757931216
3177 3177 c, t dbSNP:779375310
3183 3183 a, g dbSNP:746694351
3186 3186 a, g dbSNP:754544912
3188 3188 a, g dbSNP:147083262
3192 3192 a, g, t dbSNP:138583819
3196 3196 a, c dbSNP:370258803
3197 3197 c, t dbSNP:1799801
3198 3198 a, g dbSNP:749688539
3204 3204 c, g dbSNP:771053699
3206 3206 c, t dbSNP:200069811
3209 3209 c, g, t dbSNP:200715555
3210 3210 a, g dbSNP:776625719
3211 3211 a, c dbSNP:761699907
3226 3226 a, g dbSNP:377562755
3227 3227 c, t dbSNP:750391635
3229 3229 c, t dbSNP:762753294
3237 3237 c, g dbSNP:374186605
3238 3238 a, t dbSNP:750999717
3241 3241 a, g dbSNP:754705146
3243 3243 g, t dbSNP:780805780
3248 3248 c, g dbSNP:529976681
3262 3262 a, g dbSNP:776036851
3263 3263 a, g dbSNP:111787810
3266 3266 a, g dbSNP:753126294
3271 3271 a, c dbSNP:4986933
3272 3272 a, c dbSNP:76446924
3277 3277 a, c dbSNP:202159590
3278 3278 c, t dbSNP:778051880
3279 3279 g, t dbSNP:773636525
3280 3280 c, g dbSNP:749822053
3282 3282 c, t dbSNP:587778284
3286 3286 c, t dbSNP:779099430
3287 3287 -, t dbSNP:760599709
3287 3287 c, t dbSNP:745923107
3294 3294 c, t dbSNP:548842693
3295 3295 a, c dbSNP:368064765
3296 3296 c, t dbSNP:370809250
3299 3299 c, t dbSNP:769736716
3300 3300 a, g dbSNP:562305007
3302 3302 a, t dbSNP:762984557
3307 3307 a, g dbSNP:766200743
3308 3308 c, t dbSNP:763275769
3309 3309 a, g dbSNP:2020957
3311 3311 c, t dbSNP:759042927
3313 3313 c, t dbSNP:766946690
3316 3316 a, g dbSNP:1800124
3322 3322 c, g dbSNP:755713614
3324 3324 g, t dbSNP:778153718
3333 3333 c, g dbSNP:754131812
3335 3335 a, g dbSNP:757841266
3338 3338 a, c, t dbSNP:538267970
3339 3339 a, g dbSNP:201652412
3346 3346 c, t dbSNP:772294893
3347 3347 a, g dbSNP:16963255
3351 3351 a, g dbSNP:752703922
3367 3367 a, c dbSNP:747268097
3369 3369 a, g dbSNP:201926295
3386 3386 c, t dbSNP:138296474
3387 3387 g, t dbSNP:537592259
3392 3392 c, t dbSNP:191674905
3400 3400 c, t dbSNP:770963694
3406 3406 g, t dbSNP:774160726
3409 3409 c, t dbSNP:759410779
3413 3413 a, g dbSNP:767034692
3414 3414 -, a dbSNP:765546590
3415 3415 a, t dbSNP:774939544
3416 3416 a, c, t dbSNP:3136225
3417 3417 a, c, g dbSNP:140726146
3421 3421 c, t dbSNP:765582513
3424 3424 a, g dbSNP:753734253
3426 3426 a, g dbSNP:150077735
3427 3427 a, g dbSNP:2020956
3428 3428 -, a dbSNP:750727529
3438 3438 a, c dbSNP:758936308
3441 3441 c, t dbSNP:780318166
3446 3446 a, g dbSNP:747059736
3448 3448 c, t dbSNP:755306366
3451 3451 c, t dbSNP:781261543
3454 3454 c, t dbSNP:9929524
3455 3455 a, t dbSNP:770644250
3462 3462 g, t dbSNP:574181440
3468 3468 c, t dbSNP:369845118
3469 3469 a, g dbSNP:745834636
3475 3475 a, g dbSNP:771976579
3479 3479 a, t dbSNP:775040023
3481 3481 g, t dbSNP:760175182
3486 3486 c, t dbSNP:200296085
3487 3487 a, g dbSNP:3136226
3491 3491 c, t dbSNP:761481929
3538 3538 a, g dbSNP:117384292
3601 3601 c, t dbSNP:543502035
3631 3631 a, t dbSNP:556712304
3635 3635 c, t dbSNP:536552167
3641 3641 c, t dbSNP:542176025
3651 3651 c, t dbSNP:562343456
3665 3665 c, t dbSNP:527893953
3666 3666 a, g dbSNP:543279126
3691 3691 a, g dbSNP:541600279
3703 3703 g, t dbSNP:564658450
3706 3706 c, t dbSNP:533310107
3708 3708 c, g dbSNP:550225655
3743 3743 a, g dbSNP:765296684
3761 3761 a, t dbSNP:147799208
3765 3765 a, c dbSNP:750308239
3801 3801 c, t dbSNP:762905902
3802 3802 a, g dbSNP:183465897
3854 3854 c, t dbSNP:141279442
3894 3894 c, t dbSNP:565592403
3909 3909 g, t dbSNP:534595915
3927 3927 g, t dbSNP:3743538
3952 3952 a, g dbSNP:760978837
3956 3956 c, g, t dbSNP:371345833
3960 3960 a, t dbSNP:545416742
3962 3962 a, g dbSNP:746499083
3982 3982 a, g dbSNP:565318315
4001 4001 a, c dbSNP:376791839
4059 4059 c, t dbSNP:536781995
4117 4117 c, g dbSNP:1651204
4118 4118 g, t dbSNP:1651203
4122 4122 c, g dbSNP:116246143
4143 4143 -, at dbSNP:750161593
4144 4144 a, t dbSNP:146955145
4169 4169 c, g dbSNP:2276464
4188 4188 a, c dbSNP:541739848
4251 4251 c, t dbSNP:561265785
4253 4253 a, g dbSNP:2276465
4325 4325 c, g dbSNP:187039399
4329 4329 c, t dbSNP:757335570
4334 4334 a, g dbSNP:191634336
4373 4373 c, t dbSNP:1055443
4375 4375 a, g dbSNP:112574290
4384 4384 a, c dbSNP:376982978
4390 4390 c, t dbSNP:117293226
4414 4414 c, g dbSNP:2276466
4446 4446 c, t dbSNP:764425829
4453 4453 a, g dbSNP:182347151
4456 4456 c, g dbSNP:776927829
4469 4469 c, g dbSNP:368797729
4477 4477 a, g dbSNP:528398095
4480 4480 a, t dbSNP:551248118
4494 4494 c, t dbSNP:545772856
4499 4499 a, g dbSNP:72781468
4504 4504 -, aaaag dbSNP:549984925
4533 4533 a, g dbSNP:537224795
4584 4584 a, g dbSNP:186586436
4589 4589 c, t dbSNP:567315876
4645 4645 g, t dbSNP:536346195
4650 4650 g, t dbSNP:193289721
4661 4661 a, g dbSNP:572852406
4694 4694 c, t dbSNP:532485638
4699 4699 c, g dbSNP:373479879
4729 4729 a, g dbSNP:185626419
4730 4730 c, t dbSNP:535372156
4731 4731 a, g dbSNP:143188036
4736 4736 a, g dbSNP:375218385
4787 4787 -, t dbSNP:34388983
4789 4789 c, t dbSNP:750161345
4796 4796 a, g dbSNP:77401662
4798 4798 a, g dbSNP:543949045
4853 4853 a, g dbSNP:766219203
4858 4858 c, t dbSNP:548735957
4864 4864 g, t dbSNP:76447723
4915 4915 c, t dbSNP:112742002
4921 4921 c, t dbSNP:754423213
4962 4962 g, t dbSNP:542690728
4998 4998 c, t dbSNP:190536009
5044 5044 c, t dbSNP:747753243
5080 5080 c, t dbSNP:568549113
5089 5089 c, g dbSNP:372528374
5118 5118 c, t dbSNP:570169244
5122 5122 a, g dbSNP:537527346
5127 5127 a, g dbSNP:148155845
5142 5142 c, t dbSNP:747649934
5147 5147 a, g dbSNP:755744665
5151 5151 a, g dbSNP:528435639
5153 5153 c, t dbSNP:746216891
5177 5177 c, t dbSNP:551285375
5217 5217 c, t dbSNP:772694607
5218 5218 a, g dbSNP:773340693
5239 5239 c, t dbSNP:565142105
5245 5245 c, t dbSNP:537535365
5246 5246 a, g dbSNP:530629612
5301 5301 c, t dbSNP:775803860
5305 5305 c, t dbSNP:550794794
5323 5323 c, t dbSNP:112776898
5337 5337 a, g dbSNP:192910261
5347 5347 a, g dbSNP:770921381
5359 5359 -, c dbSNP:34866586
5379 5379 a, g dbSNP:115472788
5434 5434 a, t dbSNP:567966619
5470 5470 g, t dbSNP:538608476
5518 5518 a, g dbSNP:558169438
5566 5566 g, t dbSNP:774315575
5578 5578 a, g dbSNP:578166086
5582 5582 a, c dbSNP:140019040
5617 5617 a, g dbSNP:9925509
5622 5622 c, t dbSNP:111651288
5714 5714 a, g dbSNP:573881501
5807 5807 a, g dbSNP:542729521
5845 5845 a, g dbSNP:559394290
5857 5857 a, t dbSNP:572906300
5858 5858 a, g dbSNP:549968233
5869 5869 a, t dbSNP:768817193
5885 5885 g, t dbSNP:565128975
5888 5888 a, t dbSNP:777015670
5889 5889 a, g dbSNP:530884886
5896 5896 a, g dbSNP:567813836
5920 5920 -, a dbSNP:563490201
5954 5954 a, g dbSNP:184381372
5956 5956 a, c dbSNP:11075223
5957 5957 a, g dbSNP:553578280
5982 5982 a, g dbSNP:115526695
6015 6015 -, c dbSNP:61422086
6019 6019 a, cc dbSNP:386789300
6020 6020 a, c dbSNP:56012340
6030 6030 a, t dbSNP:76963262
6031 6031 a, g dbSNP:188840787
6086 6086 -, g dbSNP:373646296
6090 6090 a, g dbSNP:532153427
6092 6092 a, t dbSNP:376328949
6106 6106 c, t dbSNP:558811254
6155 6155 c, t dbSNP:552190642
6164 6164 a, t dbSNP:762639164
6180 6180 a, g dbSNP:142073142
6187 6187 a, t dbSNP:12325236
6194 6194 a, g dbSNP:751428407
6202 6202 c, t dbSNP:776910274
6226 6226 a, g dbSNP:545748696
6259 6259 a, t dbSNP:146325817
6292 6292 a, g dbSNP:567543133
6322 6322 a, c dbSNP:181178937
6335 6335 c, g dbSNP:376334296
6373 6373 a, g dbSNP:573044100
6384 6384 g, t dbSNP:545171920
6429 6429 a, t dbSNP:558935375
6448 6448 c, g dbSNP:115605700
6464 6464 g, t dbSNP:767067212
6468 6468 a, g dbSNP:544513268
6475 6475 g, t dbSNP:4781562
6536 6536 c, t dbSNP:183916977
6568 6568 a, g dbSNP:115183774
6573 6573 c, t dbSNP:189232031
6614 6614 a, c, t dbSNP:180762894
6627 6627 a, g dbSNP:577306350
6638 6638 a, g dbSNP:4781563
6643 6643 a, g dbSNP:8056393
6646 6646 a, g dbSNP:114059834
6710 6710 a, g dbSNP:187182207
6742 6742 a, g dbSNP:551258089
6762 6762 a, g dbSNP:567578149
6765 6765 c, t dbSNP:536535885
6770 6770 a, g dbSNP:535056033
6862 6862 c, g dbSNP:543593100
6882 6882 a, g dbSNP:192113185
6919 6919 c, t dbSNP:539159846
6936 6936 c, t dbSNP:79560972
6980 6980 c, t dbSNP:113073720
7001 7001 -, t dbSNP:34103244
7038 7038 c, t dbSNP:544234052
7039 7039 a, g dbSNP:554914070
7043 7043 -, a dbSNP:34282104
7063 7063 c, t dbSNP:117678596
7159 7159 a, g dbSNP:370469183
7170 7170 g, t dbSNP:560338292
7233 7233 a, g dbSNP:545911330
7244 7244 c, t dbSNP:113403633
7249 7249 -, ttgtat dbSNP:748796519
7257 7257 a, c, g dbSNP:181872627
7354 7354 c, t dbSNP:552082015
7356 7356 c, g dbSNP:112259692
7364 7364 a, c dbSNP:773246781
7389 7389 -, t dbSNP:3837752
7396 7396 -, t dbSNP:397778750
7403 7403 a, g dbSNP:531344901
7420 7420 a, c dbSNP:762808427
7436 7436 c, t dbSNP:530337169

Target ORF information:

RefSeq Version XM_011522425
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens excision repair cross-complementation group 4 (ERCC4), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu57571
Accession Version XM_011522426.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1962bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA repair endonuclease XPF isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
Misc Feature(1)101..2029(+)
Misc Feature(2)1364..1756(+)
Position Chain Variation Link
13 13 a, g dbSNP:537462553
80 80 a, c dbSNP:544617095
106 106 c, g dbSNP:746106147
107 107 c, t dbSNP:373570729
108 108 a, g, t dbSNP:143479220
130 130 a, g dbSNP:769764837
133 133 c, t dbSNP:773131349
154 154 a, g dbSNP:200536315
162 162 c, t dbSNP:765930617
164 164 c, t dbSNP:750971687
182 182 c, t dbSNP:759268826
183 183 a, g dbSNP:202243691
194 194 c, t dbSNP:753149023
195 195 a, g dbSNP:756540416
197 197 a, t dbSNP:778480216
210 210 a, g dbSNP:754408222
212 212 g, t dbSNP:757636398
214 214 c, t dbSNP:148003381
220 220 c, t dbSNP:564247394
221 221 a, g dbSNP:772385411
223 223 -, a dbSNP:772432152
228 228 a, t dbSNP:780219730
231 231 a, t dbSNP:141961015
242 242 g, t dbSNP:200596978
245 245 -, t dbSNP:780647908
246 246 c, t dbSNP:150244523
251 251 g, t dbSNP:762885572
256 256 a, g dbSNP:770736492
258 258 a, g dbSNP:773938568
265 265 -, t dbSNP:747327001
271 271 g, t dbSNP:758933707
272 272 c, g dbSNP:767264265
274 274 -, t dbSNP:35090754
284 284 g, t dbSNP:760433983
289 289 a, g dbSNP:763789717
296 296 c, g dbSNP:587778285
297 297 a, c dbSNP:777183693
299 299 a, t dbSNP:762052950
306 306 c, t dbSNP:765840370
309 309 c, t dbSNP:750883282
311 311 a, g dbSNP:758884625
327 327 a, g dbSNP:753728949
330 330 c, g dbSNP:373229910
333 333 a, g dbSNP:267604416
335 335 g, t dbSNP:755219554
339 339 a, g, t dbSNP:145851520
343 343 c, t dbSNP:756986546
353 353 a, g dbSNP:201410515
366 366 a, t dbSNP:569926448
370 370 a, g dbSNP:745796159
374 374 a, g dbSNP:772092631
376 376 a, c dbSNP:775161827
377 377 -, a dbSNP:34607888
377 377 a, t dbSNP:746495409
379 379 a, g, t dbSNP:768464180
383 383 -, a dbSNP:769120755
394 394 a, g dbSNP:762297186
396 396 -, t dbSNP:776206553
398 398 a, g dbSNP:765535723
410 410 a, g, t dbSNP:148933357
415 415 a, t dbSNP:749724323
417 417 a, g dbSNP:561066051
418 418 a, t dbSNP:774643449
424 424 a, g dbSNP:760060914
428 428 a, g dbSNP:765738455
429 429 a, t dbSNP:772594065
431 431 c, t dbSNP:376695854
439 439 c, t dbSNP:760787953
443 443 c, t dbSNP:1799802
455 455 a, g dbSNP:201051665
470 470 c, t dbSNP:199505105
504 504 -, ac dbSNP:779091652
509 509 c, t dbSNP:147458778
512 512 a, c, g dbSNP:200759609
515 515 c, g dbSNP:751348446
516 516 a, g dbSNP:754994055
518 518 c, t dbSNP:767454772
520 520 a, g dbSNP:752193295
525 525 a, g dbSNP:762147159
527 527 g, t dbSNP:765513788
551 551 c, t dbSNP:374470560
552 552 a, g dbSNP:1800067
559 559 a, t dbSNP:762738968
573 573 a, g dbSNP:767408205
574 574 a, c dbSNP:181278137
576 576 a, g dbSNP:143924094
577 577 c, t dbSNP:144305111
591 591 a, c, t dbSNP:763619616
592 592 a, g dbSNP:3136151
601 601 -, c dbSNP:750512090
602 602 g, t dbSNP:778515954
605 605 c, t dbSNP:116615540
624 624 a, c dbSNP:758786333
626 626 g, t dbSNP:370344307
629 629 a, g dbSNP:747564755
642 642 a, c dbSNP:368559924
645 645 c, t dbSNP:776880848
647 647 a, g dbSNP:748206066
650 650 c, g dbSNP:547209644
667 667 c, t dbSNP:773551391
672 672 a, g dbSNP:759312308
674 674 a, g dbSNP:142332295
678 678 a, g dbSNP:775102285
679 679 c, g dbSNP:760701586
681 681 a, g dbSNP:763991308
684 684 a, c dbSNP:201179693
687 687 a, t dbSNP:761301503
689 689 a, c dbSNP:764936603
692 692 a, g dbSNP:750095432
694 694 c, t dbSNP:757930503
699 699 a, t dbSNP:780488548
701 701 c, t dbSNP:751828681
706 706 c, g dbSNP:372950439
708 708 a, g dbSNP:781758234
710 710 a, g dbSNP:748292174
711 711 c, g dbSNP:769985983
713 713 c, t dbSNP:777945955
720 720 -, c dbSNP:758567128
723 723 c, t dbSNP:572439259
730 730 c, t dbSNP:771022303
737 737 c, t dbSNP:41557814
738 738 a, g dbSNP:775398434
739 739 g, t dbSNP:760367072
745 745 c, t dbSNP:768640061
747 747 c, t dbSNP:776546311
754 754 a, g dbSNP:114077770
755 755 a, g dbSNP:587778286
758 758 a, g, t dbSNP:764739776
765 765 a, g dbSNP:762697491
769 769 -, a dbSNP:747558645
778 778 -, g dbSNP:34930410
790 790 -, aactc dbSNP:768847411
792 792 -, ctcaa dbSNP:397509400
796 796 a, c, g, t dbSNP:146601373
800 800 a, g, t dbSNP:140252818
801 801 c, t dbSNP:373587423
802 802 a, t dbSNP:538185672
808 808 a, c dbSNP:777944273
809 809 c, g, t dbSNP:371114175
815 815 a, g dbSNP:778992329
820 820 -, g dbSNP:781559890
829 829 a, c dbSNP:746890369
831 831 a, g dbSNP:587778288
839 839 a, g dbSNP:200617058
840 840 a, g dbSNP:761759726
845 845 a, g dbSNP:769679311
847 847 a, g dbSNP:374391979
849 849 a, g dbSNP:201514032
852 852 a, g dbSNP:766111215
856 856 a, g dbSNP:773866713
857 857 a, g dbSNP:150291286
862 862 a, c dbSNP:768020598
871 871 a, c, g dbSNP:41552412
883 883 c, t dbSNP:779170299
885 885 a, c, t dbSNP:149056863
886 886 a, g dbSNP:757281318
889 889 a, t dbSNP:200649435
904 904 a, g dbSNP:746104783
914 914 c, g dbSNP:143347563
916 916 a, g dbSNP:780996067
927 927 c, t dbSNP:368830992
928 928 a, g dbSNP:769817145
939 939 -, t dbSNP:369082850
941 941 a, g dbSNP:773007457
956 956 c, t dbSNP:139197943
957 957 c, t dbSNP:770347803
962 962 a, g dbSNP:773850619
963 963 c, t dbSNP:549865610
965 965 a, g dbSNP:376216413
976 976 a, g dbSNP:759296999
984 984 a, g dbSNP:370896187
985 985 c, t dbSNP:776049363
992 992 a, g dbSNP:55736359
996 996 c, g, t dbSNP:764730051
997 997 c, g dbSNP:553999029
999 999 a, g, t dbSNP:765254949
1010 1010 a, t dbSNP:758658934
1012 1012 a, g, t dbSNP:780225844
1013 1013 a, g dbSNP:755854109
1014 1014 c, t dbSNP:777553142
1019 1019 c, t dbSNP:587778287
1035 1035 c, g dbSNP:1800068
1036 1036 a, g, t dbSNP:765454246
1037 1037 -, a dbSNP:747759202
1038 1038 -, a dbSNP:397509404
1040 1040 a, g dbSNP:202186213
1042 1042 a, g dbSNP:771912352
1048 1048 g, t dbSNP:374556359
1054 1054 c, g dbSNP:775278986
1057 1057 a, g dbSNP:760310698
1066 1066 c, g dbSNP:367595904
1070 1070 a, g dbSNP:777006157
1071 1071 c, t dbSNP:371392134
1073 1073 c, t dbSNP:147105770
1074 1074 a, g dbSNP:750549531
1076 1076 c, t dbSNP:763006163
1079 1079 c, g dbSNP:766652186
1095 1095 a, c, t dbSNP:751782722
1096 1096 g, t dbSNP:374303503
1101 1101 a, g dbSNP:777448181
1104 1104 c, t dbSNP:753641687
1106 1106 a, g dbSNP:755150407
1110 1110 a, c dbSNP:138532294
1115 1115 c, t dbSNP:745442045
1125 1125 a, g, t dbSNP:189463122
1128 1128 g, t dbSNP:748526617
1129 1129 g, t dbSNP:61760161
1138 1138 c, t dbSNP:763332387
1139 1139 a, g dbSNP:749814308
1148 1148 a, g dbSNP:771383745
1153 1153 a, c, g dbSNP:774347057
1158 1158 -, a dbSNP:769406369
1158 1158 a, g dbSNP:767702213
1160 1160 c, t dbSNP:373565480
1161 1161 a, g dbSNP:760922582
1162 1162 c, g dbSNP:765147177
1164 1164 a, g dbSNP:750205235
1168 1168 c, g dbSNP:758451676
1178 1178 a, c, t dbSNP:766395322
1179 1179 a, g dbSNP:180919656
1187 1187 -, aagg dbSNP:772899497
1189 1189 g, t dbSNP:780500474
1192 1192 a, g dbSNP:2020958
1204 1204 a, g, t dbSNP:546230479
1208 1208 -, ataag dbSNP:762355362
1208 1208 a, g dbSNP:533626393
1210 1210 a, g dbSNP:749634352
1211 1211 a, c dbSNP:771488066
1225 1225 a, c dbSNP:377213481
1226 1226 a, c dbSNP:762059602
1229 1229 a, g dbSNP:770771750
1233 1233 c, t dbSNP:773964691
1246 1246 a, g dbSNP:759544889
1248 1248 a, g dbSNP:112490976
1250 1250 a, g dbSNP:369471816
1251 1251 a, g dbSNP:752265539
1256 1256 g, t dbSNP:760177195
1278 1278 c, t dbSNP:763532154
1283 1283 a, g dbSNP:753506602
1284 1284 a, g dbSNP:756811179
1287 1287 a, c, t dbSNP:779366136
1291 1291 a, g dbSNP:373237850
1292 1292 c, t dbSNP:2020955
1297 1297 a, c dbSNP:747151321
1308 1308 a, c, t dbSNP:200317919
1309 1309 g, t dbSNP:781362388
1311 1311 a, t dbSNP:748400348
1313 1313 a, g dbSNP:769863971
1315 1315 g, t dbSNP:376422457
1316 1316 c, t dbSNP:139782718
1317 1317 a, g dbSNP:56129764
1320 1320 a, g dbSNP:201675333
1324 1324 c, t dbSNP:775414253
1325 1325 a, c, g dbSNP:760553358
1328 1328 a, g dbSNP:765005836
1338 1338 a, g dbSNP:370466614
1347 1347 c, t dbSNP:762607920
1354 1354 a, g dbSNP:565249189
1365 1365 c, t dbSNP:751928876
1370 1370 a, t dbSNP:755577606
1373 1373 a, c, t dbSNP:149364215
1382 1382 c, t dbSNP:756155469
1383 1383 a, g, t dbSNP:777853585
1384 1384 a, g dbSNP:757434523
1385 1385 a, g dbSNP:779865123
1386 1386 g, t dbSNP:746784825
1391 1391 a, c dbSNP:768640022
1395 1395 c, t dbSNP:752894496
1405 1405 a, c, g dbSNP:556423345
1409 1409 c, g dbSNP:772728961
1410 1410 a, g dbSNP:762543560
1413 1413 a, g dbSNP:144058769
1416 1416 g, t dbSNP:774900622
1425 1425 c, t dbSNP:1800069
1426 1426 c, t dbSNP:777766206
1430 1430 c, t dbSNP:753161715
1432 1432 a, c, t dbSNP:376391395
1433 1433 a, g dbSNP:373906926
1446 1446 c, t dbSNP:757525012
1464 1464 a, c, t dbSNP:779096061
1472 1472 a, g dbSNP:754771000
1477 1477 a, c, t dbSNP:2020959
1483 1483 a, g dbSNP:769731155
1484 1484 a, c, t dbSNP:777184889
1485 1485 a, c, g dbSNP:368096448
1494 1494 c, t dbSNP:375860375
1495 1495 c, t dbSNP:746273815
1497 1497 a, g dbSNP:772589823
1498 1498 c, t dbSNP:368274574
1504 1504 a, g dbSNP:761130884
1507 1507 c, t dbSNP:372425414
1508 1508 a, g dbSNP:753924297
1516 1516 a, g dbSNP:761878121
1523 1523 a, g dbSNP:765235917
1526 1526 c, t dbSNP:376688194
1527 1527 a, g dbSNP:758565772
1533 1533 a, g dbSNP:780880381
1541 1541 c, g, t dbSNP:12932917
1544 1544 a, c dbSNP:756050702
1548 1548 c, t dbSNP:12928616
1549 1549 c, t dbSNP:367813650
1556 1556 c, t dbSNP:374978891
1557 1557 a, g dbSNP:748870665
1568 1568 c, t dbSNP:535728795
1569 1569 a, g dbSNP:143357336
1573 1573 c, t dbSNP:555317161
1574 1574 a, g dbSNP:201501958
1585 1585 g, t dbSNP:778971103
1596 1596 c, t dbSNP:761087753
1598 1598 a, g dbSNP:146764714
1600 1600 c, t dbSNP:139406689
1604 1604 a, c dbSNP:142532415
1611 1611 c, t dbSNP:12928650
1613 1613 c, t dbSNP:373135011
1615 1615 c, t dbSNP:765321722
1622 1622 c, t dbSNP:150920741
1644 1644 c, t dbSNP:763202833
1647 1647 c, g dbSNP:766596368
1656 1656 a, g dbSNP:375263578
1666 1666 c, t dbSNP:143081574
1668 1668 a, g dbSNP:755929592
1669 1669 a, g dbSNP:763726880
1677 1677 c, t dbSNP:753851289
1683 1683 -, cacttcacttc dbSNP:775452814
1688 1688 a, c, t dbSNP:757223070
1694 1694 a, c dbSNP:772423662
1700 1700 c, g dbSNP:369736388
1702 1702 a, g dbSNP:111613748
1703 1703 c, t dbSNP:121913049
1706 1706 -, cttacacttcacttccccagactacgga dbSNP:397509401
1717 1717 c, t dbSNP:779753781
1731 1731 c, g dbSNP:746576915
1734 1734 c, t dbSNP:769080259
1735 1735 a, g dbSNP:2020960
1737 1737 a, c dbSNP:748683649
1738 1738 a, g dbSNP:770255135
1741 1741 a, g dbSNP:773329866
1744 1744 a, g dbSNP:373510515
1751 1751 c, g dbSNP:766573225
1760 1760 c, g dbSNP:774635437
1765 1765 a, c dbSNP:759616913
1770 1770 c, t dbSNP:763983833
1771 1771 a, g dbSNP:2020953
1774 1774 a, g dbSNP:757316495
1782 1782 c, g dbSNP:765253522
1783 1783 a, g dbSNP:200818432
1785 1785 c, t dbSNP:141790888
1788 1788 c, t dbSNP:757931216
1793 1793 c, t dbSNP:779375310
1799 1799 a, g dbSNP:746694351
1802 1802 a, g dbSNP:754544912
1804 1804 a, g dbSNP:147083262
1808 1808 a, g, t dbSNP:138583819
1812 1812 a, c dbSNP:370258803
1813 1813 c, t dbSNP:1799801
1814 1814 a, g dbSNP:749688539
1820 1820 c, g dbSNP:771053699
1822 1822 c, t dbSNP:200069811
1825 1825 c, g, t dbSNP:200715555
1826 1826 a, g dbSNP:776625719
1827 1827 a, c dbSNP:761699907
1842 1842 a, g dbSNP:377562755
1843 1843 c, t dbSNP:750391635
1845 1845 c, t dbSNP:762753294
1853 1853 c, g dbSNP:374186605
1854 1854 a, t dbSNP:750999717
1857 1857 a, g dbSNP:754705146
1859 1859 g, t dbSNP:780805780
1864 1864 c, g dbSNP:529976681
1878 1878 a, g dbSNP:776036851
1879 1879 a, g dbSNP:111787810
1882 1882 a, g dbSNP:753126294
1887 1887 a, c dbSNP:4986933
1888 1888 a, c dbSNP:76446924
1893 1893 a, c dbSNP:202159590
1894 1894 c, t dbSNP:778051880
1895 1895 g, t dbSNP:773636525
1896 1896 c, g dbSNP:749822053
1898 1898 c, t dbSNP:587778284
1902 1902 c, t dbSNP:779099430
1903 1903 -, t dbSNP:760599709
1903 1903 c, t dbSNP:745923107
1910 1910 c, t dbSNP:548842693
1911 1911 a, c dbSNP:368064765
1912 1912 c, t dbSNP:370809250
1915 1915 c, t dbSNP:769736716
1916 1916 a, g dbSNP:562305007
1918 1918 a, t dbSNP:762984557
1923 1923 a, g dbSNP:766200743
1924 1924 c, t dbSNP:763275769
1925 1925 a, g dbSNP:2020957
1927 1927 c, t dbSNP:759042927
1929 1929 c, t dbSNP:766946690
1932 1932 a, g dbSNP:1800124
1938 1938 c, g dbSNP:755713614
1940 1940 g, t dbSNP:778153718
1949 1949 c, g dbSNP:754131812
1951 1951 a, g dbSNP:757841266
1954 1954 a, c, t dbSNP:538267970
1955 1955 a, g dbSNP:201652412
1962 1962 c, t dbSNP:772294893
1963 1963 a, g dbSNP:16963255
1967 1967 a, g dbSNP:752703922
1983 1983 a, c dbSNP:747268097
1985 1985 a, g dbSNP:201926295
2002 2002 c, t dbSNP:138296474
2003 2003 g, t dbSNP:537592259
2008 2008 c, t dbSNP:191674905
2016 2016 c, t dbSNP:770963694
2022 2022 g, t dbSNP:774160726
2025 2025 c, t dbSNP:759410779
2029 2029 a, g dbSNP:767034692
2030 2030 -, a dbSNP:765546590
2031 2031 a, t dbSNP:774939544
2032 2032 a, c, t dbSNP:3136225
2033 2033 a, c, g dbSNP:140726146
2037 2037 c, t dbSNP:765582513
2040 2040 a, g dbSNP:753734253
2042 2042 a, g dbSNP:150077735
2043 2043 a, g dbSNP:2020956
2044 2044 -, a dbSNP:750727529
2054 2054 a, c dbSNP:758936308
2057 2057 c, t dbSNP:780318166
2062 2062 a, g dbSNP:747059736
2064 2064 c, t dbSNP:755306366
2067 2067 c, t dbSNP:781261543
2070 2070 c, t dbSNP:9929524
2071 2071 a, t dbSNP:770644250
2078 2078 g, t dbSNP:574181440
2084 2084 c, t dbSNP:369845118
2085 2085 a, g dbSNP:745834636
2091 2091 a, g dbSNP:771976579
2095 2095 a, t dbSNP:775040023
2097 2097 g, t dbSNP:760175182
2102 2102 c, t dbSNP:200296085
2103 2103 a, g dbSNP:3136226
2107 2107 c, t dbSNP:761481929
2154 2154 a, g dbSNP:117384292
2217 2217 c, t dbSNP:543502035
2247 2247 a, t dbSNP:556712304
2251 2251 c, t dbSNP:536552167
2257 2257 c, t dbSNP:542176025
2267 2267 c, t dbSNP:562343456
2281 2281 c, t dbSNP:527893953
2282 2282 a, g