Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

ERCC4 excision repair cross-complementation group 4 [Homo sapiens (human)]

Gene Symbol ERCC4
Entrez Gene ID 2072
Full Name excision repair cross-complementation group 4
Synonyms ERCC11, FANCQ, RAD1, XPF
General protein information
Preferred Names
DNA repair endonuclease XPF
DNA repair endonuclease XPF
DNA excision repair protein ERCC-4
DNA repair protein complementing XP-F cells
xeroderma pigmentosum, complementation group F
xeroderma pigmentosum group F-complementing protein
excision-repair, complementing defective, in Chinese hamster
Gene Type protein-coding
Organism Homo sapiens (human)



Summary The protein encoded by this gene forms a complex with ERCC1 and is involved in the 5' incision made during nucleotide excision repair. This complex is a structure specific DNA repair endonuclease that interacts with EME1. Defects in this gene are a cause of xeroderma pigmentosum complementation group F (XP-F), or xeroderma pigmentosum VI (XP6).[provided by RefSeq, Mar 2009]. lac of sum
Disorder MIM:


Disorder Html: Xeroderma pigmentosum, group F, 278760 (3); XFE progeroid syndrome,
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu57569 XM_011522424 PREDICTED: Homo sapiens excision repair cross-complementation group 4 (ERCC4), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 12-14 Starting from $99.00
OHu57570 XM_011522425 PREDICTED: Homo sapiens excision repair cross-complementation group 4 (ERCC4), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu57571 XM_011522426 PREDICTED: Homo sapiens excision repair cross-complementation group 4 (ERCC4), transcript variant X4, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu57572 XM_011522427 PREDICTED: Homo sapiens excision repair cross-complementation group 4 (ERCC4), transcript variant X5, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu18825 NM_005236 Homo sapiens excision repair cross-complementation group 4 (ERCC4), mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu57569D
Sequence Information ORF Nucleotide Sequence (Length: 2889bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA repair endonuclease XPF isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)310..2880(+)
Misc Feature(2)2215..2607(+)
Position Chain Variation Link
5 5 a, g dbSNP:200113697
7 7 c, g dbSNP:766745594
10 10 a, c, g dbSNP:751823206
14 14 g, t dbSNP:763809454
20 20 a, c dbSNP:753601029
22 22 a, c dbSNP:543978998
23 23 g, t dbSNP:778859873
25 25 a, g dbSNP:373789508
27 27 a, g dbSNP:749985757
29 29 c, g, t dbSNP:148904556
30 30 a, c dbSNP:375831794
31 31 a, g dbSNP:768243270
33 33 a, g dbSNP:781417413
36 36 a, g dbSNP:748509102
37 37 c, g, t dbSNP:61760160
39 39 a, g dbSNP:763189317
40 40 a, g dbSNP:771117594
42 42 c, t dbSNP:759774291
43 43 c, g dbSNP:774510191
44 44 a, g dbSNP:759843019
52 52 g, t dbSNP:767738598
53 53 c, t dbSNP:753596005
54 54 a, c, t dbSNP:3136042
55 55 a, g dbSNP:750358005
58 58 a, g, t dbSNP:374243778
59 59 a, c dbSNP:751008601
60 60 a, g dbSNP:112419956
62 62 c, t dbSNP:754622238
64 64 c, t dbSNP:140734311
70 70 g, t dbSNP:368281878
82 82 c, g dbSNP:748499820
83 83 a, c dbSNP:756494000
84 84 c, g dbSNP:375896908
87 87 a, g dbSNP:749822829
90 90 a, g dbSNP:201606798
94 94 g, t dbSNP:560047653
95 95 a, t dbSNP:745893266
99 99 a, g dbSNP:772230343
100 100 c, t dbSNP:587778282
104 104 a, g dbSNP:367608263
106 106 a, g dbSNP:765069053
117 117 a, g dbSNP:772933233
118 118 c, g dbSNP:34205098
121 121 c, g dbSNP:61731714
126 126 c, t dbSNP:762885804
130 130 c, t dbSNP:144602005
142 142 -, g dbSNP:749349821
143 143 c, g dbSNP:751095195
144 144 c, g dbSNP:754491247
145 145 a, g dbSNP:767138486
146 146 a, g dbSNP:752379459
147 147 c, t dbSNP:755659888
150 150 a, g dbSNP:778283997
156 156 c, t dbSNP:749628982
158 158 a, g dbSNP:757860762
164 164 a, t dbSNP:779538282
166 166 c, t dbSNP:552142099
182 182 a, c dbSNP:772189900
186 186 a, g dbSNP:571953222
187 187 c, g, t dbSNP:537670308
195 195 c, g dbSNP:768694415
197 197 a, t dbSNP:587778283
202 202 a, g dbSNP:773025207
217 217 c, t dbSNP:762691172
229 229 g, t dbSNP:759518166
231 231 a, g dbSNP:771860466
232 232 c, t dbSNP:145315496
238 238 a, g dbSNP:141591400
246 246 a, g dbSNP:192488568
247 247 c, t dbSNP:753534967
249 249 a, g dbSNP:61760162
253 253 a, t dbSNP:765712858
255 255 -, aga dbSNP:771203473
260 260 a, g dbSNP:750687183
262 262 a, g, t dbSNP:55761944
266 266 a, g dbSNP:751713894
268 268 c, t dbSNP:755021656
273 273 c, t dbSNP:3136056
274 274 c, t dbSNP:748380872
277 277 c, t dbSNP:769932063
278 278 a, g dbSNP:187435008
280 280 c, t dbSNP:191886782
281 281 a, g dbSNP:371487368
296 296 g, t dbSNP:556330628
307 307 a, c dbSNP:775257742
310 310 c, t dbSNP:760327512
311 311 a, g dbSNP:768270013
326 326 a, c, t dbSNP:144408815
327 327 a, t dbSNP:764943215
329 329 a, c dbSNP:773652331
335 335 c, g dbSNP:763208431
338 338 g, t dbSNP:766951888
340 340 a, t dbSNP:752008977
342 342 a, g dbSNP:549297996
346 346 a, g dbSNP:148791570
347 347 c, t dbSNP:767586458
348 348 a, g dbSNP:377085353
367 367 a, g dbSNP:763811136
372 372 c, t dbSNP:189742296
376 376 c, t dbSNP:565715127
381 381 g, t dbSNP:777834718
384 384 c, t dbSNP:555020322
388 388 a, g dbSNP:144666685
393 393 c, t dbSNP:780096152
413 413 c, t dbSNP:540204753
444 444 c, t dbSNP:188067471
447 447 a, g dbSNP:573860878
470 470 c, g dbSNP:528753371
473 473 a, g dbSNP:554873911
479 479 a, g dbSNP:752813352
487 487 a, g dbSNP:571857798
550 550 a, g dbSNP:769186966
554 554 c, t dbSNP:772979483
556 556 a, c, g dbSNP:748894431
558 558 a, g dbSNP:774717152
560 560 a, g, t dbSNP:745648039
563 563 c, g dbSNP:772606808
567 567 c, g dbSNP:775970324
579 579 c, t dbSNP:138724289
580 580 a, g dbSNP:760865964
584 584 a, c dbSNP:764093404
585 585 a, c, t dbSNP:147455220
587 587 a, g dbSNP:765509563
589 589 c, g dbSNP:751450497
606 606 g, t dbSNP:139989614
607 607 a, c, t dbSNP:145402255
608 608 a, g dbSNP:377014538
613 613 c, t dbSNP:752672749
617 617 a, c, g dbSNP:121913050
620 620 a, g dbSNP:772205098
624 624 a, g dbSNP:748779012
629 629 a, t dbSNP:770535929
630 630 a, g dbSNP:3136092
631 631 c, t dbSNP:746296279
634 634 c, g dbSNP:181993439
646 646 a, g dbSNP:778574449
662 662 c, g, t dbSNP:2020961
679 679 c, g dbSNP:775540682
680 680 a, g dbSNP:761092120
691 691 a, g, t dbSNP:149927607
696 696 a, g dbSNP:373408411
699 699 a, g dbSNP:765599689
700 700 a, g, t dbSNP:750673145
712 712 a, c dbSNP:767437700
714 714 c, t dbSNP:113129434
728 728 c, t dbSNP:756024042
733 733 c, t dbSNP:377547617
737 737 -, ggccaa dbSNP:776329282
738 738 a, g dbSNP:753325454
780 780 c, g dbSNP:766656010
790 790 a, g dbSNP:775194104
811 811 a, g dbSNP:145138851
814 814 a, g dbSNP:764003312
820 820 -, c dbSNP:758362908
826 826 c, t dbSNP:753799081
832 832 a, c dbSNP:757128317
834 834 a, g dbSNP:764731249
842 842 c, g, t dbSNP:749895744
845 845 c, t dbSNP:779737289
848 848 c, t dbSNP:397509402
859 859 a, c dbSNP:368218302
861 861 c, t dbSNP:755368456
862 862 a, g dbSNP:141101671
865 865 c, t dbSNP:397509403
873 873 a, g dbSNP:780166871
877 877 c, g dbSNP:746904084
884 884 a, g dbSNP:768217559
887 887 a, g dbSNP:144608823
889 889 a, c dbSNP:201176880
892 892 a, c dbSNP:773444862
895 895 a, t dbSNP:749352103
896 896 c, t dbSNP:370864937
897 897 a, g dbSNP:146650135
913 913 a, t dbSNP:760444530
914 914 c, t dbSNP:763961422
915 915 a, g dbSNP:776221530
935 935 a, g dbSNP:140299888
941 941 c, t dbSNP:765111229
942 942 -, t dbSNP:751290625
957 957 c, g dbSNP:746106147
958 958 c, t dbSNP:373570729
959 959 a, g, t dbSNP:143479220
981 981 a, g dbSNP:769764837
984 984 c, t dbSNP:773131349
1005 1005 a, g dbSNP:200536315
1013 1013 c, t dbSNP:765930617
1015 1015 c, t dbSNP:750971687
1033 1033 c, t dbSNP:759268826
1034 1034 a, g dbSNP:202243691
1045 1045 c, t dbSNP:753149023
1046 1046 a, g dbSNP:756540416
1048 1048 a, t dbSNP:778480216
1061 1061 a, g dbSNP:754408222
1063 1063 g, t dbSNP:757636398
1065 1065 c, t dbSNP:148003381
1071 1071 c, t dbSNP:564247394
1072 1072 a, g dbSNP:772385411
1074 1074 -, a dbSNP:772432152
1079 1079 a, t dbSNP:780219730
1082 1082 a, t dbSNP:141961015
1093 1093 g, t dbSNP:200596978
1096 1096 -, t dbSNP:780647908
1097 1097 c, t dbSNP:150244523
1102 1102 g, t dbSNP:762885572
1107 1107 a, g dbSNP:770736492
1109 1109 a, g dbSNP:773938568
1116 1116 -, t dbSNP:747327001
1122 1122 g, t dbSNP:758933707
1123 1123 c, g dbSNP:767264265
1125 1125 -, t dbSNP:35090754
1135 1135 g, t dbSNP:760433983
1140 1140 a, g dbSNP:763789717
1147 1147 c, g dbSNP:587778285
1148 1148 a, c dbSNP:777183693
1150 1150 a, t dbSNP:762052950
1157 1157 c, t dbSNP:765840370
1160 1160 c, t dbSNP:750883282
1162 1162 a, g dbSNP:758884625
1178 1178 a, g dbSNP:753728949
1181 1181 c, g dbSNP:373229910
1184 1184 a, g dbSNP:267604416
1186 1186 g, t dbSNP:755219554
1190 1190 a, g, t dbSNP:145851520
1194 1194 c, t dbSNP:756986546
1204 1204 a, g dbSNP:201410515
1217 1217 a, t dbSNP:569926448
1221 1221 a, g dbSNP:745796159
1225 1225 a, g dbSNP:772092631
1227 1227 a, c dbSNP:775161827
1228 1228 -, a dbSNP:34607888
1228 1228 a, t dbSNP:746495409
1230 1230 a, g, t dbSNP:768464180
1234 1234 -, a dbSNP:769120755
1245 1245 a, g dbSNP:762297186
1247 1247 -, t dbSNP:776206553
1249 1249 a, g dbSNP:765535723
1261 1261 a, g, t dbSNP:148933357
1266 1266 a, t dbSNP:749724323
1268 1268 a, g dbSNP:561066051
1269 1269 a, t dbSNP:774643449
1275 1275 a, g dbSNP:760060914
1279 1279 a, g dbSNP:765738455
1280 1280 a, t dbSNP:772594065
1282 1282 c, t dbSNP:376695854
1290 1290 c, t dbSNP:760787953
1294 1294 c, t dbSNP:1799802
1306 1306 a, g dbSNP:201051665
1321 1321 c, t dbSNP:199505105
1355 1355 -, ac dbSNP:779091652
1360 1360 c, t dbSNP:147458778
1363 1363 a, c, g dbSNP:200759609
1366 1366 c, g dbSNP:751348446
1367 1367 a, g dbSNP:754994055
1369 1369 c, t dbSNP:767454772
1371 1371 a, g dbSNP:752193295
1376 1376 a, g dbSNP:762147159
1378 1378 g, t dbSNP:765513788
1402 1402 c, t dbSNP:374470560
1403 1403 a, g dbSNP:1800067
1410 1410 a, t dbSNP:762738968
1424 1424 a, g dbSNP:767408205
1425 1425 a, c dbSNP:181278137
1427 1427 a, g dbSNP:143924094
1428 1428 c, t dbSNP:144305111
1442 1442 a, c, t dbSNP:763619616
1443 1443 a, g dbSNP:3136151
1452 1452 -, c dbSNP:750512090
1453 1453 g, t dbSNP:778515954
1456 1456 c, t dbSNP:116615540
1475 1475 a, c dbSNP:758786333
1477 1477 g, t dbSNP:370344307
1480 1480 a, g dbSNP:747564755
1493 1493 a, c dbSNP:368559924
1496 1496 c, t dbSNP:776880848
1498 1498 a, g dbSNP:748206066
1501 1501 c, g dbSNP:547209644
1518 1518 c, t dbSNP:773551391
1523 1523 a, g dbSNP:759312308
1525 1525 a, g dbSNP:142332295
1529 1529 a, g dbSNP:775102285
1530 1530 c, g dbSNP:760701586
1532 1532 a, g dbSNP:763991308
1535 1535 a, c dbSNP:201179693
1538 1538 a, t dbSNP:761301503
1540 1540 a, c dbSNP:764936603
1543 1543 a, g dbSNP:750095432
1545 1545 c, t dbSNP:757930503
1550 1550 a, t dbSNP:780488548
1552 1552 c, t dbSNP:751828681
1557 1557 c, g dbSNP:372950439
1559 1559 a, g dbSNP:781758234
1561 1561 a, g dbSNP:748292174
1562 1562 c, g dbSNP:769985983
1564 1564 c, t dbSNP:777945955
1571 1571 -, c dbSNP:758567128
1574 1574 c, t dbSNP:572439259
1581 1581 c, t dbSNP:771022303
1588 1588 c, t dbSNP:41557814
1589 1589 a, g dbSNP:775398434
1590 1590 g, t dbSNP:760367072
1596 1596 c, t dbSNP:768640061
1598 1598 c, t dbSNP:776546311
1605 1605 a, g dbSNP:114077770
1606 1606 a, g dbSNP:587778286
1609 1609 a, g, t dbSNP:764739776
1616 1616 a, g dbSNP:762697491
1620 1620 -, a dbSNP:747558645
1629 1629 -, g dbSNP:34930410
1641 1641 -, aactc dbSNP:768847411
1643 1643 -, ctcaa dbSNP:397509400
1647 1647 a, c, g, t dbSNP:146601373
1651 1651 a, g, t dbSNP:140252818
1652 1652 c, t dbSNP:373587423
1653 1653 a, t dbSNP:538185672
1659 1659 a, c dbSNP:777944273
1660 1660 c, g, t dbSNP:371114175
1666 1666 a, g dbSNP:778992329
1671 1671 -, g dbSNP:781559890
1680 1680 a, c dbSNP:746890369
1682 1682 a, g dbSNP:587778288
1690 1690 a, g dbSNP:200617058
1691 1691 a, g dbSNP:761759726
1696 1696 a, g dbSNP:769679311
1698 1698 a, g dbSNP:374391979
1700 1700 a, g dbSNP:201514032
1703 1703 a, g dbSNP:766111215
1707 1707 a, g dbSNP:773866713
1708 1708 a, g dbSNP:150291286
1713 1713 a, c dbSNP:768020598
1722 1722 a, c, g dbSNP:41552412
1734 1734 c, t dbSNP:779170299
1736 1736 a, c, t dbSNP:149056863
1737 1737 a, g dbSNP:757281318
1740 1740 a, t dbSNP:200649435
1755 1755 a, g dbSNP:746104783
1765 1765 c, g dbSNP:143347563
1767 1767 a, g dbSNP:780996067
1778 1778 c, t dbSNP:368830992
1779 1779 a, g dbSNP:769817145
1790 1790 -, t dbSNP:369082850
1792 1792 a, g dbSNP:773007457
1807 1807 c, t dbSNP:139197943
1808 1808 c, t dbSNP:770347803
1813 1813 a, g dbSNP:773850619
1814 1814 c, t dbSNP:549865610
1816 1816 a, g dbSNP:376216413
1827 1827 a, g dbSNP:759296999
1835 1835 a, g dbSNP:370896187
1836 1836 c, t dbSNP:776049363
1843 1843 a, g dbSNP:55736359
1847 1847 c, g, t dbSNP:764730051
1848 1848 c, g dbSNP:553999029
1850 1850 a, g, t dbSNP:765254949
1861 1861 a, t dbSNP:758658934
1863 1863 a, g, t dbSNP:780225844
1864 1864 a, g dbSNP:755854109
1865 1865 c, t dbSNP:777553142
1870 1870 c, t dbSNP:587778287
1886 1886 c, g dbSNP:1800068
1887 1887 a, g, t dbSNP:765454246
1888 1888 -, a dbSNP:747759202
1889 1889 -, a dbSNP:397509404
1891 1891 a, g dbSNP:202186213
1893 1893 a, g dbSNP:771912352
1899 1899 g, t dbSNP:374556359
1905 1905 c, g dbSNP:775278986
1908 1908 a, g dbSNP:760310698
1917 1917 c, g dbSNP:367595904
1921 1921 a, g dbSNP:777006157
1922 1922 c, t dbSNP:371392134
1924 1924 c, t dbSNP:147105770
1925 1925 a, g dbSNP:750549531
1927 1927 c, t dbSNP:763006163
1930 1930 c, g dbSNP:766652186
1946 1946 a, c, t dbSNP:751782722
1947 1947 g, t dbSNP:374303503
1952 1952 a, g dbSNP:777448181
1955 1955 c, t dbSNP:753641687
1957 1957 a, g dbSNP:755150407
1961 1961 a, c dbSNP:138532294
1966 1966 c, t dbSNP:745442045
1976 1976 a, g, t dbSNP:189463122
1979 1979 g, t dbSNP:748526617
1980 1980 g, t dbSNP:61760161
1989 1989 c, t dbSNP:763332387
1990 1990 a, g dbSNP:749814308
1999 1999 a, g dbSNP:771383745
2004 2004 a, c, g dbSNP:774347057
2009 2009 -, a dbSNP:769406369
2009 2009 a, g dbSNP:767702213
2011 2011 c, t dbSNP:373565480
2012 2012 a, g dbSNP:760922582
2013 2013 c, g dbSNP:765147177
2015 2015 a, g dbSNP:750205235
2019 2019 c, g dbSNP:758451676
2029 2029 a, c, t dbSNP:766395322
2030 2030 a, g dbSNP:180919656
2038 2038 -, aagg dbSNP:772899497
2040 2040 g, t dbSNP:780500474
2043 2043 a, g dbSNP:2020958
2055 2055 a, g, t dbSNP:546230479
2059 2059 -, ataag dbSNP:762355362
2059 2059 a, g dbSNP:533626393
2061 2061 a, g dbSNP:749634352
2062 2062 a, c dbSNP:771488066
2076 2076 a, c dbSNP:377213481
2077 2077 a, c dbSNP:762059602
2080 2080 a, g dbSNP:770771750
2084 2084 c, t dbSNP:773964691
2097 2097 a, g dbSNP:759544889
2099 2099 a, g dbSNP:112490976
2101 2101 a, g dbSNP:369471816
2102 2102 a, g dbSNP:752265539
2107 2107 g, t dbSNP:760177195
2129 2129 c, t dbSNP:763532154
2134 2134 a, g dbSNP:753506602
2135 2135 a, g dbSNP:756811179
2138 2138 a, c, t dbSNP:779366136
2142 2142 a, g dbSNP:373237850
2143 2143 c, t dbSNP:2020955
2148 2148 a, c dbSNP:747151321
2159 2159 a, c, t dbSNP:200317919
2160 2160 g, t dbSNP:781362388
2162 2162 a, t dbSNP:748400348
2164 2164 a, g dbSNP:769863971
2166 2166 g, t dbSNP:376422457
2167 2167 c, t dbSNP:139782718
2168 2168 a, g dbSNP:56129764
2171 2171 a, g dbSNP:201675333
2175 2175 c, t dbSNP:775414253
2176 2176 a, c, g dbSNP:760553358
2179 2179 a, g dbSNP:765005836
2189 2189 a, g dbSNP:370466614
2198 2198 c, t dbSNP:762607920
2205 2205 a, g dbSNP:565249189
2216 2216 c, t dbSNP:751928876
2221 2221 a, t dbSNP:755577606
2224 2224 a, c, t dbSNP:149364215
2233 2233 c, t dbSNP:756155469
2234 2234 a, g, t dbSNP:777853585
2235 2235 a, g dbSNP:757434523
2236 2236 a, g dbSNP:779865123
2237 2237 g, t dbSNP:746784825
2242 2242 a, c dbSNP:768640022
2246 2246 c, t dbSNP:752894496
2256 2256 a, c, g dbSNP:556423345
2260 2260 c, g dbSNP:772728961
2261 2261 a, g dbSNP:762543560
2264 2264 a, g dbSNP:144058769
2267 2267 g, t dbSNP:774900622
2276 2276 c, t dbSNP:1800069
2277 2277 c, t dbSNP:777766206
2281 2281 c, t dbSNP:753161715
2283 2283 a, c, t dbSNP:376391395
2284 2284 a, g dbSNP:373906926
2297 2297 c, t dbSNP:757525012
2315 2315 a, c, t dbSNP:779096061
2323 2323 a, g dbSNP:754771000
2328 2328 a, c, t dbSNP:2020959
2334 2334 a, g dbSNP:769731155
2335 2335 a, c, t dbSNP:777184889
2336 2336 a, c, g dbSNP:368096448
2345 2345 c, t dbSNP:375860375
2346 2346 c, t dbSNP:746273815
2348 2348 a, g dbSNP:772589823
2349 2349 c, t dbSNP:368274574
2355 2355 a, g dbSNP:761130884
2358 2358 c, t dbSNP:372425414
2359 2359 a, g dbSNP:753924297
2367 2367 a, g dbSNP:761878121
2374 2374 a, g dbSNP:765235917
2377 2377 c, t dbSNP:376688194
2378 2378 a, g dbSNP:758565772
2384 2384 a, g dbSNP:780880381
2392 2392 c, g, t dbSNP:12932917
2395 2395 a, c dbSNP:756050702
2399 2399 c, t dbSNP:12928616
2400 2400 c, t dbSNP:367813650
2407 2407 c, t dbSNP:374978891
2408 2408 a, g dbSNP:748870665
2419 2419 c, t dbSNP:535728795
2420 2420 a, g dbSNP:143357336
2424 2424 c, t dbSNP:555317161
2425 2425 a, g dbSNP:201501958
2436 2436 g, t dbSNP:778971103
2447 2447 c, t dbSNP:761087753
2449 2449 a, g dbSNP:146764714
2451 2451 c, t dbSNP:139406689
2455 2455 a, c dbSNP:142532415
2462 2462 c, t dbSNP:12928650
2464 2464 c, t dbSNP:373135011
2466 2466 c, t dbSNP:765321722
2473 2473 c, t dbSNP:150920741
2495 2495 c, t dbSNP:763202833
2498 2498 c, g dbSNP:766596368
2507 2507 a, g dbSNP:375263578
2517 2517 c, t dbSNP:143081574
2519 2519 a, g dbSNP:755929592
2520 2520 a, g dbSNP:763726880
2528 2528 c, t dbSNP:753851289
2534 2534 -, cacttcacttc dbSNP:775452814
2539 2539 a, c, t dbSNP:757223070
2545 2545 a, c dbSNP:772423662
2551 2551 c, g dbSNP:369736388
2553 2553 a, g dbSNP:111613748
2554 2554 c, t dbSNP:121913049
2557 2557 -, cttacacttcacttccccagactacgga dbSNP:397509401
2568 2568 c, t dbSNP:779753781
2582 2582 c, g dbSNP:746576915
2585 2585 c, t dbSNP:769080259
2586 2586 a, g dbSNP:2020960
2588 2588 a, c dbSNP:748683649
2589 2589 a, g dbSNP:770255135
2592 2592 a, g dbSNP:773329866
2595 2595 a, g dbSNP:373510515
2602 2602 c, g dbSNP:766573225
2611 2611 c, g dbSNP:774635437
2616 2616 a, c dbSNP:759616913
2621 2621 c, t dbSNP:763983833
2622 2622 a, g dbSNP:2020953
2625 2625 a, g dbSNP:757316495
2633 2633 c, g dbSNP:765253522
2634 2634 a, g dbSNP:200818432
2636 2636 c, t dbSNP:141790888
2639 2639 c, t dbSNP:757931216
2644 2644 c, t dbSNP:779375310
2650 2650 a, g dbSNP:746694351
2653 2653 a, g dbSNP:754544912
2655 2655 a, g dbSNP:147083262
2659 2659 a, g, t dbSNP:138583819
2663 2663 a, c dbSNP:370258803
2664 2664 c, t dbSNP:1799801
2665 2665 a, g dbSNP:749688539
2671 2671 c, g dbSNP:771053699
2673 2673 c, t dbSNP:200069811
2676 2676 c, g, t dbSNP:200715555
2677 2677 a, g dbSNP:776625719
2678 2678 a, c dbSNP:761699907
2693 2693 a, g dbSNP:377562755
2694 2694 c, t dbSNP:750391635
2696 2696 c, t dbSNP:762753294
2704 2704 c, g dbSNP:374186605
2705 2705 a, t dbSNP:750999717
2708 2708 a, g dbSNP:754705146
2710 2710 g, t dbSNP:780805780
2715 2715 c, g dbSNP:529976681
2729 2729 a, g dbSNP:776036851
2730 2730 a, g dbSNP:111787810
2733 2733 a, g dbSNP:753126294
2738 2738 a, c dbSNP:4986933
2739 2739 a, c dbSNP:76446924
2744 2744 a, c dbSNP:202159590
2745 2745 c, t dbSNP:778051880
2746 2746 g, t dbSNP:773636525
2747 2747 c, g dbSNP:749822053
2749 2749 c, t dbSNP:587778284
2753 2753 c, t dbSNP:779099430
2754 2754 -, t dbSNP:760599709
2754 2754 c, t dbSNP:745923107
2761 2761 c, t dbSNP:548842693
2762 2762 a, c dbSNP:368064765
2763 2763 c, t dbSNP:370809250
2766 2766 c, t dbSNP:769736716
2767 2767 a, g dbSNP:562305007
2769 2769 a, t dbSNP:762984557
2774 2774 a, g dbSNP:766200743
2775 2775 c, t dbSNP:763275769
2776 2776 a, g dbSNP:2020957
2778 2778 c, t dbSNP:759042927
2780 2780 c, t dbSNP:766946690
2783 2783 a, g dbSNP:1800124
2789 2789 c, g dbSNP:755713614
2791 2791 g, t dbSNP:778153718
2800 2800 c, g dbSNP:754131812
2802 2802 a, g dbSNP:757841266
2805 2805 a, c, t dbSNP:538267970
2806 2806 a, g dbSNP:201652412
2813 2813 c, t dbSNP:772294893
2814 2814 a, g dbSNP:16963255
2818 2818 a, g dbSNP:752703922
2834 2834 a, c dbSNP:747268097
2836 2836 a, g dbSNP:201926295
2853 2853 c, t dbSNP:138296474
2854 2854 g, t dbSNP:537592259
2859 2859 c, t dbSNP:191674905
2867 2867 c, t dbSNP:770963694
2873 2873 g, t dbSNP:774160726
2876 2876 c, t dbSNP:759410779
2880 2880 a, g dbSNP:767034692
2881 2881 -, a dbSNP:765546590
2882 2882 a, t dbSNP:774939544
2883 2883 a, c, t dbSNP:3136225
2884 2884 a, c, g dbSNP:140726146
2888 2888 c, t dbSNP:765582513
2891 2891 a, g dbSNP:753734253
2893 2893 a, g dbSNP:150077735
2894 2894 a, g dbSNP:2020956
2895 2895 -, a dbSNP:750727529
2905 2905 a, c dbSNP:758936308
2908 2908 c, t dbSNP:780318166
2913 2913 a, g dbSNP:747059736
2915 2915 c, t dbSNP:755306366
2918 2918 c, t dbSNP:781261543
2921 2921 c, t dbSNP:9929524
2922 2922 a, t dbSNP:770644250
2929 2929 g, t dbSNP:574181440
2935 2935 c, t dbSNP:369845118
2936 2936 a, g dbSNP:745834636
2942 2942 a, g dbSNP:771976579
2946 2946 a, t dbSNP:775040023
2948 2948 g, t dbSNP:760175182
2953 2953 c, t dbSNP:200296085
2954 2954 a, g dbSNP:3136226
2958 2958 c, t dbSNP:761481929
3005 3005 a, g dbSNP:117384292
3068 3068 c, t dbSNP:543502035
3098 3098 a, t dbSNP:556712304
3102 3102 c, t dbSNP:536552167
3108 3108 c, t dbSNP:542176025
3118 3118 c, t dbSNP:562343456
3132 3132 c, t dbSNP:527893953
3133 3133 a, g dbSNP:543279126
3158 3158 a, g dbSNP:541600279
3170 3170 g, t dbSNP:564658450
3173 3173 c, t dbSNP:533310107
3175 3175 c, g dbSNP:550225655
3210 3210 a, g dbSNP:765296684
3228 3228 a, t dbSNP:147799208
3232 3232 a, c dbSNP:750308239
3268 3268 c, t dbSNP:762905902
3269 3269 a, g dbSNP:183465897
3321 3321 c, t dbSNP:141279442
3361 3361 c, t dbSNP:565592403
3376 3376 g, t dbSNP:534595915
3394 3394 g, t dbSNP:3743538
3419 3419 a, g dbSNP:760978837
3423 3423 c, g, t dbSNP:371345833
3427 3427 a, t dbSNP:545416742
3429 3429 a, g dbSNP:746499083
3449 3449 a, g dbSNP:565318315
3468 3468 a, c dbSNP:376791839
3526 3526 c, t dbSNP:536781995
3584 3584 c, g dbSNP:1651204
3585 3585 g, t dbSNP:1651203
3589 3589 c, g dbSNP:116246143
3610 3610 -, at dbSNP:750161593
3611 3611 a, t dbSNP:146955145
3636 3636 c, g dbSNP:2276464
3655 3655 a, c dbSNP:541739848
3718 3718 c, t dbSNP:561265785
3720 3720 a, g dbSNP:2276465
3792 3792 c, g dbSNP:187039399
3796 3796 c, t dbSNP:757335570
3801 3801 a, g dbSNP:191634336
3840 3840 c, t dbSNP:1055443
3842 3842 a, g dbSNP:112574290
3851 3851 a, c dbSNP:376982978
3857 3857 c, t dbSNP:117293226
3881 3881 c, g dbSNP:2276466
3913 3913 c, t dbSNP:764425829
3920 3920 a, g dbSNP:182347151
3923 3923 c, g dbSNP:776927829
3936 3936 c, g dbSNP:368797729
3944 3944 a, g dbSNP:528398095
3947 3947 a, t dbSNP:551248118
3961 3961 c, t dbSNP:545772856
3966 3966 a, g dbSNP:72781468
3971 3971 -, aaaag dbSNP:549984925
4000 4000 a, g dbSNP:537224795
4051 4051 a, g dbSNP:186586436
4056 4056 c, t dbSNP:567315876
4112 4112 g, t dbSNP:536346195
4117 4117 g, t dbSNP:193289721
4128 4128 a, g dbSNP:572852406
4161 4161 c, t dbSNP:532485638
4166 4166 c, g dbSNP:373479879
4196 4196 a, g dbSNP:185626419
4197 4197 c, t dbSNP:535372156
4198 4198 a, g dbSNP:143188036
4203 4203 a, g dbSNP:375218385
4254 4254 -, t dbSNP:34388983
4256 4256 c, t dbSNP:750161345
4263 4263 a, g dbSNP:77401662
4265 4265 a, g dbSNP:543949045
4320 4320 a, g dbSNP:766219203
4325 4325 c, t dbSNP:548735957
4331 4331 g, t dbSNP:76447723
4382 4382 c, t dbSNP:112742002
4388 4388 c, t dbSNP:754423213
4429 4429 g, t dbSNP:542690728
4465 4465 c, t dbSNP:190536009
4511 4511 c, t dbSNP:747753243
4547 4547 c, t dbSNP:568549113
4556 4556 c, g dbSNP:372528374
4585 4585 c, t dbSNP:570169244
4589 4589 a, g dbSNP:537527346
4594 4594 a, g dbSNP:148155845
4609 4609 c, t dbSNP:747649934
4614 4614 a, g dbSNP:755744665
4618 4618 a, g dbSNP:528435639
4620 4620 c, t dbSNP:746216891
4644 4644 c, t dbSNP:551285375
4684 4684 c, t dbSNP:772694607
4685 4685 a, g dbSNP:773340693
4706 4706 c, t dbSNP:565142105
4712 4712 c, t dbSNP:537535365
4713 4713 a, g dbSNP:530629612
4768 4768 c, t dbSNP:775803860
4772 4772 c, t dbSNP:550794794
4790 4790 c, t dbSNP:112776898
4804 4804 a, g dbSNP:192910261
4814 4814 a, g dbSNP:770921381
4826 4826 -, c dbSNP:34866586
4846 4846 a, g dbSNP:115472788
4901 4901 a, t dbSNP:567966619
4937 4937 g, t dbSNP:538608476
4985 4985 a, g dbSNP:558169438
5033 5033 g, t dbSNP:774315575
5045 5045 a, g dbSNP:578166086
5049 5049 a, c dbSNP:140019040
5084 5084 a, g dbSNP:9925509
5089 5089 c, t dbSNP:111651288
5181 5181 a, g dbSNP:573881501
5274 5274 a, g dbSNP:542729521
5312 5312 a, g dbSNP:559394290
5324 5324 a, t dbSNP:572906300
5325 5325 a, g dbSNP:549968233
5336 5336 a, t dbSNP:768817193
5352 5352 g, t dbSNP:565128975
5355 5355 a, t dbSNP:777015670
5356 5356 a, g dbSNP:530884886
5363 5363 a, g dbSNP:567813836
5387 5387 -, a dbSNP:563490201
5421 5421 a, g dbSNP:184381372
5423 5423 a, c dbSNP:11075223
5424 5424 a, g dbSNP:553578280
5449 5449 a, g dbSNP:115526695
5482 5482 -, c dbSNP:61422086
5486 5486 a, cc dbSNP:386789300
5487 5487 a, c dbSNP:56012340
5497 5497 a, t dbSNP:76963262
5498 5498 a, g dbSNP:188840787
5553 5553 -, g dbSNP:373646296
5557 5557 a, g dbSNP:532153427
5559 5559 a, t dbSNP:376328949
5573 5573 c, t dbSNP:558811254
5622 5622 c, t dbSNP:552190642
5631 5631 a, t dbSNP:762639164
5647 5647 a, g dbSNP:142073142
5654 5654 a, t dbSNP:12325236
5661 5661 a, g dbSNP:751428407
5669 5669 c, t dbSNP:776910274
5693 5693 a, g dbSNP:545748696
5726 5726 a, t dbSNP:146325817
5759 5759 a, g dbSNP:567543133
5789 5789 a, c dbSNP:181178937
5802 5802 c, g dbSNP:376334296
5840 5840 a, g dbSNP:573044100
5851 5851 g, t dbSNP:545171920
5896 5896 a, t dbSNP:558935375
5915 5915 c, g dbSNP:115605700
5931 5931 g, t dbSNP:767067212
5935 5935 a, g dbSNP:544513268
5942 5942 g, t dbSNP:4781562
6003 6003 c, t dbSNP:183916977
6035 6035 a, g dbSNP:115183774
6040 6040 c, t dbSNP:189232031
6081 6081 a, c, t dbSNP:180762894
6094 6094 a, g dbSNP:577306350
6105 6105 a, g dbSNP:4781563
6110 6110 a, g dbSNP:8056393
6113 6113 a, g dbSNP:114059834
6177 6177 a, g dbSNP:187182207
6209 6209 a, g dbSNP:551258089
6229 6229 a, g dbSNP:567578149
6232 6232 c, t dbSNP:536535885
6237 6237 a, g dbSNP:535056033
6329 6329 c, g dbSNP:543593100
6349 6349 a, g dbSNP:192113185
6386 6386 c, t dbSNP:539159846
6403 6403 c, t dbSNP:79560972
6447 6447 c, t dbSNP:113073720
6468 6468 -, t dbSNP:34103244
6505 6505 c, t dbSNP:544234052
6506 6506 a, g dbSNP:554914070
6510 6510 -, a dbSNP:34282104
6530 6530 c, t dbSNP:117678596
6626 6626 a, g dbSNP:370469183
6637 6637 g, t dbSNP:560338292
6700 6700 a, g dbSNP:545911330
6711 6711 c, t dbSNP:113403633
6716 6716 -, ttgtat dbSNP:748796519
6724 6724 a, c, g dbSNP:181872627
6821 6821 c, t dbSNP:552082015
6823 6823 c, g dbSNP:112259692
6831 6831 a, c dbSNP:773246781
6856 6856 -, t dbSNP:3837752
6863 6863 -, t dbSNP:397778750
6870 6870 a, g dbSNP:531344901
6887 6887 a, c dbSNP:762808427
6903 6903 c, t dbSNP:530337169

Target ORF information:

RefSeq Version XM_011522424
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens excision repair cross-complementation group 4 (ERCC4), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu57570D
Sequence Information ORF Nucleotide Sequence (Length: 2208bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA repair endonuclease XPF isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)1236..3413(+)
Misc Feature(2)2748..3140(+)
Position Chain Variation Link
6 6 a, g dbSNP:372797345
40 40 c, t dbSNP:3136061
65 65 c, g dbSNP:779583075
111 111 a, g dbSNP:577093457
116 116 g, t dbSNP:746342641
149 149 c, t dbSNP:546002455
151 151 a, g dbSNP:536531115
177 177 a, g dbSNP:189492432
208 208 a, t dbSNP:373941150
215 215 c, t dbSNP:542006023
235 235 c, t dbSNP:772052472
236 236 a, g dbSNP:145519412
241 241 -, t dbSNP:35308675
247 247 a, g dbSNP:775584585
267 267 c, g dbSNP:559454559
278 278 a, g dbSNP:181865195
281 281 a, g dbSNP:559297175
324 324 -, c dbSNP:74684179
325 325 -, c dbSNP:67254371
325 325 c, t dbSNP:3136062
330 330 a, g dbSNP:3136063
333 333 a, g dbSNP:564397026
348 348 c, t dbSNP:533231946
355 355 c, t dbSNP:758485331
360 360 a, g dbSNP:185975565
403 403 a, g dbSNP:190441377
418 418 c, t dbSNP:529074381
421 421 c, t dbSNP:3136064
462 462 c, t dbSNP:761646891
478 478 a, g dbSNP:764964841
482 482 c, t dbSNP:773166256
488 488 a, g dbSNP:3136065
505 505 c, g dbSNP:3136066
525 525 c, g dbSNP:142559661
593 593 a, g dbSNP:748478470
594 594 c, g dbSNP:570819693
599 599 c, t dbSNP:3136067
620 620 -, c, gtgcctggt dbSNP:3136068
620 620 -, tgcctggt dbSNP:140731678
623 623 -, ctggt dbSNP:201791769
648 648 c, t dbSNP:3136069
700 700 c, g dbSNP:754415677
749 749 a, c dbSNP:747648386
759 759 a, t dbSNP:3136070
765 765 a, t dbSNP:542396169
766 766 a, t dbSNP:181664152
795 795 a, g dbSNP:536490011
807 807 a, g dbSNP:550187970
808 808 g, t dbSNP:3136071
833 833 a, c dbSNP:76510856
836 836 c, t dbSNP:777433770
858 858 a, t dbSNP:140654892
869 869 c, t dbSNP:3136072
873 873 a, g dbSNP:145909251
881 881 a, g dbSNP:3136073
898 898 a, c dbSNP:533358791
924 924 c, g dbSNP:746376610
942 942 c, g dbSNP:2238463
1034 1034 c, t dbSNP:780424700
1062 1062 a, c, g dbSNP:138461931
1063 1063 c, g dbSNP:141232484
1069 1069 a, c, t dbSNP:150182424
1083 1083 a, g dbSNP:769186966
1087 1087 c, t dbSNP:772979483
1089 1089 a, c, g dbSNP:748894431
1091 1091 a, g dbSNP:774717152
1093 1093 a, g, t dbSNP:745648039
1096 1096 c, g dbSNP:772606808
1100 1100 c, g dbSNP:775970324
1112 1112 c, t dbSNP:138724289
1113 1113 a, g dbSNP:760865964
1117 1117 a, c dbSNP:764093404
1118 1118 a, c, t dbSNP:147455220
1120 1120 a, g dbSNP:765509563
1122 1122 c, g dbSNP:751450497
1139 1139 g, t dbSNP:139989614
1140 1140 a, c, t dbSNP:145402255
1141 1141 a, g dbSNP:377014538
1146 1146 c, t dbSNP:752672749
1150 1150 a, c, g dbSNP:121913050
1153 1153 a, g dbSNP:772205098
1157 1157 a, g dbSNP:748779012
1162 1162 a, t dbSNP:770535929
1163 1163 a, g dbSNP:3136092
1164 1164 c, t dbSNP:746296279
1167 1167 c, g dbSNP:181993439
1179 1179 a, g dbSNP:778574449
1195 1195 c, g, t dbSNP:2020961
1212 1212 c, g dbSNP:775540682
1213 1213 a, g dbSNP:761092120
1224 1224 a, g, t dbSNP:149927607
1229 1229 a, g dbSNP:373408411
1232 1232 a, g dbSNP:765599689
1233 1233 a, g, t dbSNP:750673145
1245 1245 a, c dbSNP:767437700
1247 1247 c, t dbSNP:113129434
1261 1261 c, t dbSNP:756024042
1266 1266 c, t dbSNP:377547617
1270 1270 -, ggccaa dbSNP:776329282
1271 1271 a, g dbSNP:753325454
1313 1313 c, g dbSNP:766656010
1323 1323 a, g dbSNP:775194104
1344 1344 a, g dbSNP:145138851
1347 1347 a, g dbSNP:764003312
1353 1353 -, c dbSNP:758362908
1359 1359 c, t dbSNP:753799081
1365 1365 a, c dbSNP:757128317
1367 1367 a, g dbSNP:764731249
1375 1375 c, g, t dbSNP:749895744
1378 1378 c, t dbSNP:779737289
1381 1381 c, t dbSNP:397509402
1392 1392 a, c dbSNP:368218302
1394 1394 c, t dbSNP:755368456
1395 1395 a, g dbSNP:141101671
1398 1398 c, t dbSNP:397509403
1406 1406 a, g dbSNP:780166871
1410 1410 c, g dbSNP:746904084
1417 1417 a, g dbSNP:768217559
1420 1420 a, g dbSNP:144608823
1422 1422 a, c dbSNP:201176880
1425 1425 a, c dbSNP:773444862
1428 1428 a, t dbSNP:749352103
1429 1429 c, t dbSNP:370864937
1430 1430 a, g dbSNP:146650135
1446 1446 a, t dbSNP:760444530
1447 1447 c, t dbSNP:763961422
1448 1448 a, g dbSNP:776221530
1468 1468 a, g dbSNP:140299888
1474 1474 c, t dbSNP:765111229
1475 1475 -, t dbSNP:751290625
1490 1490 c, g dbSNP:746106147
1491 1491 c, t dbSNP:373570729
1492 1492 a, g, t dbSNP:143479220
1514 1514 a, g dbSNP:769764837
1517 1517 c, t dbSNP:773131349
1538 1538 a, g dbSNP:200536315
1546 1546 c, t dbSNP:765930617
1548 1548 c, t dbSNP:750971687
1566 1566 c, t dbSNP:759268826
1567 1567 a, g dbSNP:202243691
1578 1578 c, t dbSNP:753149023
1579 1579 a, g dbSNP:756540416
1581 1581 a, t dbSNP:778480216
1594 1594 a, g dbSNP:754408222
1596 1596 g, t dbSNP:757636398
1598 1598 c, t dbSNP:148003381
1604 1604 c, t dbSNP:564247394
1605 1605 a, g dbSNP:772385411
1607 1607 -, a dbSNP:772432152
1612 1612 a, t dbSNP:780219730
1615 1615 a, t dbSNP:141961015
1626 1626 g, t dbSNP:200596978
1629 1629 -, t dbSNP:780647908
1630 1630 c, t dbSNP:150244523
1635 1635 g, t dbSNP:762885572
1640 1640 a, g dbSNP:770736492
1642 1642 a, g dbSNP:773938568
1649 1649 -, t dbSNP:747327001
1655 1655 g, t dbSNP:758933707
1656 1656 c, g dbSNP:767264265
1658 1658 -, t dbSNP:35090754
1668 1668 g, t dbSNP:760433983
1673 1673 a, g dbSNP:763789717
1680 1680 c, g dbSNP:587778285
1681 1681 a, c dbSNP:777183693
1683 1683 a, t dbSNP:762052950
1690 1690 c, t dbSNP:765840370
1693 1693 c, t dbSNP:750883282
1695 1695 a, g dbSNP:758884625
1711 1711 a, g dbSNP:753728949
1714 1714 c, g dbSNP:373229910
1717 1717 a, g dbSNP:267604416
1719 1719 g, t dbSNP:755219554
1723 1723 a, g, t dbSNP:145851520
1727 1727 c, t dbSNP:756986546
1737 1737 a, g dbSNP:201410515
1750 1750 a, t dbSNP:569926448
1754 1754 a, g dbSNP:745796159
1758 1758 a, g dbSNP:772092631
1760 1760 a, c dbSNP:775161827
1761 1761 -, a dbSNP:34607888
1761 1761 a, t dbSNP:746495409
1763 1763 a, g, t dbSNP:768464180
1767 1767 -, a dbSNP:769120755
1778 1778 a, g dbSNP:762297186
1780 1780 -, t dbSNP:776206553
1782 1782 a, g dbSNP:765535723
1794 1794 a, g, t dbSNP:148933357
1799 1799 a, t dbSNP:749724323
1801 1801 a, g dbSNP:561066051
1802 1802 a, t dbSNP:774643449
1808 1808 a, g dbSNP:760060914
1812 1812 a, g dbSNP:765738455
1813 1813 a, t dbSNP:772594065
1815 1815 c, t dbSNP:376695854
1823 1823 c, t dbSNP:760787953
1827 1827 c, t dbSNP:1799802
1839 1839 a, g dbSNP:201051665
1854 1854 c, t dbSNP:199505105
1888 1888 -, ac dbSNP:779091652
1893 1893 c, t dbSNP:147458778
1896 1896 a, c, g dbSNP:200759609
1899 1899 c, g dbSNP:751348446
1900 1900 a, g dbSNP:754994055
1902 1902 c, t dbSNP:767454772
1904 1904 a, g dbSNP:752193295
1909 1909 a, g dbSNP:762147159
1911 1911 g, t dbSNP:765513788
1935 1935 c, t dbSNP:374470560
1936 1936 a, g dbSNP:1800067
1943 1943 a, t dbSNP:762738968
1957 1957 a, g dbSNP:767408205
1958 1958 a, c dbSNP:181278137
1960 1960 a, g dbSNP:143924094
1961 1961 c, t dbSNP:144305111
1975 1975 a, c, t dbSNP:763619616
1976 1976 a, g dbSNP:3136151
1985 1985 -, c dbSNP:750512090
1986 1986 g, t dbSNP:778515954
1989 1989 c, t dbSNP:116615540
2008 2008 a, c dbSNP:758786333
2010 2010 g, t dbSNP:370344307
2013 2013 a, g dbSNP:747564755
2026 2026 a, c dbSNP:368559924
2029 2029 c, t dbSNP:776880848
2031 2031 a, g dbSNP:748206066
2034 2034 c, g dbSNP:547209644
2051 2051 c, t dbSNP:773551391
2056 2056 a, g dbSNP:759312308
2058 2058 a, g dbSNP:142332295
2062 2062 a, g dbSNP:775102285
2063 2063 c, g dbSNP:760701586
2065 2065 a, g dbSNP:763991308
2068 2068 a, c dbSNP:201179693
2071 2071 a, t dbSNP:761301503
2073 2073 a, c dbSNP:764936603
2076 2076 a, g dbSNP:750095432
2078 2078 c, t dbSNP:757930503
2083 2083 a, t dbSNP:780488548
2085 2085 c, t dbSNP:751828681
2090 2090 c, g dbSNP:372950439
2092 2092 a, g dbSNP:781758234
2094 2094 a, g dbSNP:748292174
2095 2095 c, g dbSNP:769985983
2097 2097 c, t dbSNP:777945955
2104 2104 -, c dbSNP:758567128
2107 2107 c, t dbSNP:572439259
2114 2114 c, t dbSNP:771022303
2121 2121 c, t dbSNP:41557814
2122 2122 a, g dbSNP:775398434
2123 2123 g, t dbSNP:760367072
2129 2129 c, t dbSNP:768640061
2131 2131 c, t dbSNP:776546311
2138 2138 a, g dbSNP:114077770
2139 2139 a, g dbSNP:587778286
2142 2142 a, g, t dbSNP:764739776
2149 2149 a, g dbSNP:762697491
2153 2153 -, a dbSNP:747558645
2162 2162 -, g dbSNP:34930410
2174 2174 -, aactc dbSNP:768847411
2176 2176 -, ctcaa dbSNP:397509400
2180 2180 a, c, g, t dbSNP:146601373
2184 2184 a, g, t dbSNP:140252818
2185 2185 c, t dbSNP:373587423
2186 2186 a, t dbSNP:538185672
2192 2192 a, c dbSNP:777944273
2193 2193 c, g, t dbSNP:371114175
2199 2199 a, g dbSNP:778992329
2204 2204 -, g dbSNP:781559890
2213 2213 a, c dbSNP:746890369
2215 2215 a, g dbSNP:587778288
2223 2223 a, g dbSNP:200617058
2224 2224 a, g dbSNP:761759726
2229 2229 a, g dbSNP:769679311
2231 2231 a, g dbSNP:374391979
2233 2233 a, g dbSNP:201514032
2236 2236 a, g dbSNP:766111215
2240 2240 a, g dbSNP:773866713
2241 2241 a, g dbSNP:150291286
2246 2246 a, c dbSNP:768020598
2255 2255 a, c, g dbSNP:41552412
2267 2267 c, t dbSNP:779170299
2269 2269 a, c, t dbSNP:149056863
2270 2270 a, g dbSNP:757281318
2273 2273 a, t dbSNP:200649435
2288 2288 a, g dbSNP:746104783
2298 2298 c, g dbSNP:143347563
2300 2300 a, g dbSNP:780996067
2311 2311 c, t dbSNP:368830992
2312 2312 a, g dbSNP:769817145
2323 2323 -, t dbSNP:369082850
2325 2325 a, g dbSNP:773007457
2340 2340 c, t dbSNP:139197943
2341 2341 c, t dbSNP:770347803
2346 2346 a, g dbSNP:773850619
2347 2347 c, t dbSNP:549865610
2349 2349 a, g dbSNP:376216413
2360 2360 a, g dbSNP:759296999
2368 2368 a, g dbSNP:370896187
2369 2369 c, t dbSNP:776049363
2376 2376 a, g dbSNP:55736359
2380 2380 c, g, t dbSNP:764730051
2381 2381 c, g dbSNP:553999029
2383 2383 a, g, t dbSNP:765254949
2394 2394 a, t dbSNP:758658934
2396 2396 a, g, t dbSNP:780225844
2397 2397 a, g dbSNP:755854109
2398 2398 c, t dbSNP:777553142
2403 2403 c, t dbSNP:587778287
2419 2419 c, g dbSNP:1800068
2420 2420 a, g, t dbSNP:765454246
2421 2421 -, a dbSNP:747759202
2422 2422 -, a dbSNP:397509404
2424 2424 a, g dbSNP:202186213
2426 2426 a, g dbSNP:771912352
2432 2432 g, t dbSNP:374556359
2438 2438 c, g dbSNP:775278986
2441 2441 a, g dbSNP:760310698
2450 2450 c, g dbSNP:367595904
2454 2454 a, g dbSNP:777006157
2455 2455 c, t dbSNP:371392134
2457 2457 c, t dbSNP:147105770
2458 2458 a, g dbSNP:750549531
2460 2460 c, t dbSNP:763006163
2463 2463 c, g dbSNP:766652186
2479 2479 a, c, t dbSNP:751782722
2480 2480 g, t dbSNP:374303503
2485 2485 a, g dbSNP:777448181
2488 2488 c, t dbSNP:753641687
2490 2490 a, g dbSNP:755150407
2494 2494 a, c dbSNP:138532294
2499 2499 c, t dbSNP:745442045
2509 2509 a, g, t dbSNP:189463122
2512 2512 g, t dbSNP:748526617
2513 2513 g, t dbSNP:61760161
2522 2522 c, t dbSNP:763332387
2523 2523 a, g dbSNP:749814308
2532 2532 a, g dbSNP:771383745
2537 2537 a, c, g dbSNP:774347057
2542 2542 -, a dbSNP:769406369
2542 2542 a, g dbSNP:767702213
2544 2544 c, t dbSNP:373565480
2545 2545 a, g dbSNP:760922582
2546 2546 c, g dbSNP:765147177
2548 2548 a, g dbSNP:750205235
2552 2552 c, g dbSNP:758451676
2562 2562 a, c, t dbSNP:766395322
2563 2563 a, g dbSNP:180919656
2571 2571 -, aagg dbSNP:772899497
2573 2573 g, t dbSNP:780500474
2576 2576 a, g dbSNP:2020958
2588 2588 a, g, t dbSNP:546230479
2592 2592 -, ataag dbSNP:762355362
2592 2592 a, g dbSNP:533626393
2594 2594 a, g dbSNP:749634352
2595 2595 a, c dbSNP:771488066
2609 2609 a, c dbSNP:377213481
2610 2610 a, c dbSNP:762059602
2613 2613 a, g dbSNP:770771750
2617 2617 c, t dbSNP:773964691
2630 2630 a, g dbSNP:759544889
2632 2632 a, g dbSNP:112490976
2634 2634 a, g dbSNP:369471816
2635 2635 a, g dbSNP:752265539
2640 2640 g, t dbSNP:760177195
2662 2662 c, t dbSNP:763532154
2667 2667 a, g dbSNP:753506602
2668 2668 a, g dbSNP:756811179
2671 2671 a, c, t dbSNP:779366136
2675 2675 a, g dbSNP:373237850
2676 2676 c, t dbSNP:2020955
2681 2681 a, c dbSNP:747151321
2692 2692 a, c, t dbSNP:200317919
2693 2693 g, t dbSNP:781362388
2695 2695 a, t dbSNP:748400348
2697 2697 a, g dbSNP:769863971
2699 2699 g, t dbSNP:376422457
2700 2700 c, t dbSNP:139782718
2701 2701 a, g dbSNP:56129764
2704 2704 a, g dbSNP:201675333
2708 2708 c, t dbSNP:775414253
2709 2709 a, c, g dbSNP:760553358
2712 2712 a, g dbSNP:765005836
2722 2722 a, g dbSNP:370466614
2731 2731 c, t dbSNP:762607920
2738 2738 a, g dbSNP:565249189
2749 2749 c, t dbSNP:751928876
2754 2754 a, t dbSNP:755577606
2757 2757 a, c, t dbSNP:149364215
2766 2766 c, t dbSNP:756155469
2767 2767 a, g, t dbSNP:777853585
2768 2768 a, g dbSNP:757434523
2769 2769 a, g dbSNP:779865123
2770 2770 g, t dbSNP:746784825
2775 2775 a, c dbSNP:768640022
2779 2779 c, t dbSNP:752894496
2789 2789 a, c, g dbSNP:556423345
2793 2793 c, g dbSNP:772728961
2794 2794 a, g dbSNP:762543560
2797 2797 a, g dbSNP:144058769
2800 2800 g, t dbSNP:774900622
2809 2809 c, t dbSNP:1800069
2810 2810 c, t dbSNP:777766206
2814 2814 c, t dbSNP:753161715
2816 2816 a, c, t dbSNP:376391395
2817 2817 a, g dbSNP:373906926
2830 2830 c, t dbSNP:757525012
2848 2848 a, c, t dbSNP:779096061
2856 2856 a, g dbSNP:754771000
2861 2861 a, c, t dbSNP:2020959
2867 2867 a, g dbSNP:769731155
2868 2868 a, c, t dbSNP:777184889
2869 2869 a, c, g dbSNP:368096448
2878 2878 c, t dbSNP:375860375
2879 2879 c, t dbSNP:746273815
2881 2881 a, g dbSNP:772589823
2882 2882 c, t dbSNP:368274574
2888 2888 a, g dbSNP:761130884
2891 2891 c, t dbSNP:372425414
2892 2892 a, g dbSNP:753924297
2900 2900 a, g dbSNP:761878121
2907 2907 a, g dbSNP:765235917
2910 2910 c, t dbSNP:376688194
2911 2911 a, g dbSNP:758565772
2917 2917 a, g dbSNP:780880381
2925 2925 c, g, t dbSNP:12932917
2928 2928 a, c dbSNP:756050702
2932 2932 c, t dbSNP:12928616
2933 2933 c, t dbSNP:367813650
2940 2940 c, t dbSNP:374978891
2941 2941 a, g dbSNP:748870665
2952 2952 c, t dbSNP:535728795
2953 2953 a, g dbSNP:143357336
2957 2957 c, t dbSNP:555317161
2958 2958 a, g dbSNP:201501958
2969 2969 g, t dbSNP:778971103
2980 2980 c, t dbSNP:761087753
2982 2982 a, g dbSNP:146764714
2984 2984 c, t dbSNP:139406689
2988 2988 a, c dbSNP:142532415
2995 2995 c, t dbSNP:12928650
2997 2997 c, t dbSNP:373135011
2999 2999 c, t dbSNP:765321722
3006 3006 c, t dbSNP:150920741
3028 3028 c, t dbSNP:763202833
3031 3031 c, g dbSNP:766596368
3040 3040 a, g dbSNP:375263578
3050 3050 c, t dbSNP:143081574
3052 3052 a, g dbSNP:755929592
3053 3053 a, g dbSNP:763726880
3061 3061 c, t dbSNP:753851289
3067 3067 -, cacttcacttc dbSNP:775452814
3072 3072 a, c, t dbSNP:757223070
3078 3078 a, c dbSNP:772423662
3084 3084 c, g dbSNP:369736388
3086 3086 a, g dbSNP:111613748
3087 3087 c, t dbSNP:121913049
3090 3090 -, cttacacttcacttccccagactacgga dbSNP:397509401
3101 3101 c, t dbSNP:779753781
3115 3115 c, g dbSNP:746576915
3118 3118 c, t dbSNP:769080259
3119 3119 a, g dbSNP:2020960
3121 3121 a, c dbSNP:748683649
3122 3122 a, g dbSNP:770255135
3125 3125 a, g dbSNP:773329866
3128 3128 a, g dbSNP:373510515
3135 3135 c, g dbSNP:766573225
3144 3144 c, g dbSNP:774635437
3149 3149 a, c dbSNP:759616913
3154 3154 c, t dbSNP:763983833
3155 3155 a, g dbSNP:2020953
3158 3158 a, g dbSNP:757316495
3166 3166 c, g dbSNP:765253522
3167 3167 a, g dbSNP:200818432
3169 3169 c, t dbSNP:141790888
3172 3172 c, t dbSNP:757931216
3177 3177 c, t dbSNP:779375310
3183 3183 a, g dbSNP:746694351
3186 3186 a, g dbSNP:754544912
3188 3188 a, g dbSNP:147083262
3192 3192 a, g, t dbSNP:138583819
3196 3196 a, c dbSNP:370258803
3197 3197 c, t dbSNP:1799801
3198 3198 a, g dbSNP:749688539
3204 3204 c, g dbSNP:771053699
3206 3206 c, t dbSNP:200069811
3209 3209 c, g, t dbSNP:200715555
3210 3210 a, g dbSNP:776625719
3211 3211 a, c dbSNP:761699907
3226 3226 a, g dbSNP:377562755
3227 3227 c, t dbSNP:750391635
3229 3229 c, t dbSNP:762753294
3237 3237 c, g dbSNP:374186605
3238 3238 a, t dbSNP:750999717
3241 3241 a, g dbSNP:754705146
3243 3243 g, t dbSNP:780805780
3248 3248 c, g dbSNP:529976681
3262 3262 a, g dbSNP:776036851
3263 3263 a, g dbSNP:111787810
3266 3266 a, g dbSNP:753126294
3271 3271 a, c dbSNP:4986933
3272 3272 a, c dbSNP:76446924
3277 3277 a, c dbSNP:202159590
3278 3278 c, t dbSNP:778051880
3279 3279 g, t dbSNP:773636525
3280 3280 c, g dbSNP:749822053
3282 3282 c, t dbSNP:587778284
3286 3286 c, t dbSNP:779099430
3287 3287 -, t dbSNP:760599709
3287 3287 c, t dbSNP:745923107
3294 3294 c, t dbSNP:548842693
3295 3295 a, c dbSNP:368064765
3296 3296 c, t dbSNP:370809250
3299 3299 c, t dbSNP:769736716
3300 3300 a, g dbSNP:562305007
3302 3302 a, t dbSNP:762984557
3307 3307 a, g dbSNP:766200743
3308 3308 c, t dbSNP:763275769
3309 3309 a, g dbSNP:2020957
3311 3311 c, t dbSNP:759042927
3313 3313 c, t dbSNP:766946690
3316 3316 a, g dbSNP:1800124
3322 3322 c, g dbSNP:755713614
3324 3324 g, t dbSNP:778153718
3333 3333 c, g dbSNP:754131812
3335 3335 a, g dbSNP:757841266
3338 3338 a, c, t dbSNP:538267970
3339 3339 a, g dbSNP:201652412
3346 3346 c, t dbSNP:772294893
3347 3347 a, g dbSNP:16963255
3351 3351 a, g dbSNP:752703922
3367 3367 a, c dbSNP:747268097
3369 3369 a, g dbSNP:201926295
3386 3386 c, t dbSNP:138296474
3387 3387 g, t dbSNP:537592259
3392 3392 c, t dbSNP:191674905
3400 3400 c, t dbSNP:770963694
3406 3406 g, t dbSNP:774160726
3409 3409 c, t dbSNP:759410779
3413 3413 a, g dbSNP:767034692
3414 3414 -, a dbSNP:765546590
3415 3415 a, t dbSNP:774939544
3416 3416 a, c, t dbSNP:3136225
3417 3417 a, c, g dbSNP:140726146
3421 3421 c, t dbSNP:765582513
3424 3424 a, g dbSNP:753734253
3426 3426 a, g dbSNP:150077735
3427 3427 a, g dbSNP:2020956
3428 3428 -, a dbSNP:750727529
3438 3438 a, c dbSNP:758936308
3441 3441 c, t dbSNP:780318166
3446 3446 a, g dbSNP:747059736
3448 3448 c, t dbSNP:755306366
3451 3451 c, t dbSNP:781261543
3454 3454 c, t dbSNP:9929524
3455 3455 a, t dbSNP:770644250
3462 3462 g, t dbSNP:574181440
3468 3468 c, t dbSNP:369845118
3469 3469 a, g dbSNP:745834636
3475 3475 a, g dbSNP:771976579
3479 3479 a, t dbSNP:775040023
3481 3481 g, t dbSNP:760175182
3486 3486 c, t dbSNP:200296085
3487 3487 a, g dbSNP:3136226
3491 3491 c, t dbSNP:761481929
3538 3538 a, g dbSNP:117384292
3601 3601 c, t dbSNP:543502035
3631 3631 a, t dbSNP:556712304
3635 3635 c, t dbSNP:536552167
3641 3641 c, t dbSNP:542176025
3651 3651 c, t dbSNP:562343456
3665 3665 c, t dbSNP:527893953
3666 3666 a, g dbSNP:543279126
3691 3691 a, g dbSNP:541600279
3703 3703 g, t dbSNP:564658450
3706 3706 c, t dbSNP:533310107
3708 3708 c, g dbSNP:550225655
3743 3743 a, g dbSNP:765296684
3761 3761 a, t dbSNP:147799208
3765 3765 a, c dbSNP:750308239
3801 3801 c, t dbSNP:762905902
3802 3802 a, g dbSNP:183465897
3854 3854 c, t dbSNP:141279442
3894 3894 c, t dbSNP:565592403
3909 3909 g, t dbSNP:534595915
3927 3927 g, t dbSNP:3743538
3952 3952 a, g dbSNP:760978837
3956 3956 c, g, t dbSNP:371345833
3960 3960 a, t dbSNP:545416742
3962 3962 a, g dbSNP:746499083
3982 3982 a, g dbSNP:565318315
4001 4001 a, c dbSNP:376791839
4059 4059 c, t dbSNP:536781995
4117 4117 c, g dbSNP:1651204
4118 4118 g, t dbSNP:1651203
4122 4122 c, g dbSNP:116246143
4143 4143 -, at dbSNP:750161593
4144 4144 a, t dbSNP:146955145
4169 4169 c, g dbSNP:2276464
4188 4188 a, c dbSNP:541739848
4251 4251 c, t dbSNP:561265785
4253 4253 a, g dbSNP:2276465
4325 4325 c, g dbSNP:187039399
4329 4329 c, t dbSNP:757335570
4334 4334 a, g dbSNP:191634336
4373 4373 c, t dbSNP:1055443
4375 4375 a, g dbSNP:112574290
4384 4384 a, c dbSNP:376982978
4390 4390 c, t dbSNP:117293226
4414 4414 c, g dbSNP:2276466
4446 4446 c, t dbSNP:764425829
4453 4453 a, g dbSNP:182347151
4456 4456 c, g dbSNP:776927829
4469 4469 c, g dbSNP:368797729
4477 4477 a, g dbSNP:528398095
4480 4480 a, t dbSNP:551248118
4494 4494 c, t dbSNP:545772856
4499 4499 a, g dbSNP:72781468
4504 4504 -, aaaag dbSNP:549984925
4533 4533 a, g dbSNP:537224795
4584 4584 a, g dbSNP:186586436
4589 4589 c, t dbSNP:567315876
4645 4645 g, t dbSNP:536346195
4650 4650 g, t dbSNP:193289721
4661 4661 a, g dbSNP:572852406
4694 4694 c, t dbSNP:532485638
4699 4699 c, g dbSNP:373479879
4729 4729 a, g dbSNP:185626419
4730 4730 c, t dbSNP:535372156
4731 4731 a, g dbSNP:143188036
4736 4736 a, g dbSNP:375218385
4787 4787 -, t dbSNP:34388983
4789 4789 c, t dbSNP:750161345
4796 4796 a, g dbSNP:77401662
4798 4798 a, g dbSNP:543949045
4853 4853 a, g dbSNP:766219203
4858 4858 c, t dbSNP:548735957
4864 4864 g, t dbSNP:76447723
4915 4915 c, t dbSNP:112742002
4921 4921 c, t dbSNP:754423213
4962 4962 g, t dbSNP:542690728
4998 4998 c, t dbSNP:190536009
5044 5044 c, t dbSNP:747753243
5080 5080 c, t dbSNP:568549113
5089 5089 c, g dbSNP:372528374
5118 5118 c, t dbSNP:570169244
5122 5122 a, g dbSNP:537527346
5127 5127 a, g dbSNP:148155845
5142 5142 c, t dbSNP:747649934
5147 5147 a, g dbSNP:755744665
5151 5151 a, g dbSNP:528435639
5153 5153 c, t dbSNP:746216891
5177 5177 c, t dbSNP:551285375
5217 5217 c, t dbSNP:772694607
5218 5218 a, g dbSNP:773340693
5239 5239 c, t dbSNP:565142105
5245 5245 c, t dbSNP:537535365
5246 5246 a, g dbSNP:530629612
5301 5301 c, t dbSNP:775803860
5305 5305 c, t dbSNP:550794794
5323 5323 c, t dbSNP:112776898
5337 5337 a, g dbSNP:192910261
5347 5347 a, g dbSNP:770921381
5359 5359 -, c dbSNP:34866586
5379 5379 a, g dbSNP:115472788
5434 5434 a, t dbSNP:567966619
5470 5470 g, t dbSNP:538608476
5518 5518 a, g dbSNP:558169438
5566 5566 g, t dbSNP:774315575
5578 5578 a, g dbSNP:578166086
5582 5582 a, c dbSNP:140019040
5617 5617 a, g dbSNP:9925509
5622 5622 c, t dbSNP:111651288
5714 5714 a, g dbSNP:573881501
5807 5807 a, g dbSNP:542729521
5845 5845 a, g dbSNP:559394290
5857 5857 a, t dbSNP:572906300
5858 5858 a, g dbSNP:549968233
5869 5869 a, t dbSNP:768817193
5885 5885 g, t dbSNP:565128975
5888 5888 a, t dbSNP:777015670
5889 5889 a, g dbSNP:530884886
5896 5896 a, g dbSNP:567813836
5920 5920 -, a dbSNP:563490201
5954 5954 a, g dbSNP:184381372
5956 5956 a, c dbSNP:11075223
5957 5957 a, g dbSNP:553578280
5982 5982 a, g dbSNP:115526695
6015 6015 -, c dbSNP:61422086
6019 6019 a, cc dbSNP:386789300
6020 6020 a, c dbSNP:56012340
6030 6030 a, t dbSNP:76963262
6031 6031 a, g dbSNP:188840787
6086 6086 -, g dbSNP:373646296
6090 6090 a, g dbSNP:532153427
6092 6092 a, t dbSNP:376328949
6106 6106 c, t dbSNP:558811254
6155 6155 c, t dbSNP:552190642
6164 6164 a, t dbSNP:762639164
6180 6180 a, g dbSNP:142073142
6187 6187 a, t dbSNP:12325236
6194 6194 a, g dbSNP:751428407
6202 6202 c, t dbSNP:776910274
6226 6226 a, g dbSNP:545748696
6259 6259 a, t dbSNP:146325817
6292 6292 a, g dbSNP:567543133
6322 6322 a, c dbSNP:181178937
6335 6335 c, g dbSNP:376334296
6373 6373 a, g dbSNP:573044100
6384 6384 g, t dbSNP:545171920
6429 6429 a, t dbSNP:558935375
6448 6448 c, g dbSNP:115605700
6464 6464 g, t dbSNP:767067212
6468 6468 a, g dbSNP:544513268
6475 6475 g, t dbSNP:4781562
6536 6536 c, t dbSNP:183916977
6568 6568 a, g dbSNP:115183774
6573 6573 c, t dbSNP:189232031
6614 6614 a, c, t dbSNP:180762894
6627 6627 a, g dbSNP:577306350
6638 6638 a, g dbSNP:4781563
6643 6643 a, g dbSNP:8056393
6646 6646 a, g dbSNP:114059834
6710 6710 a, g dbSNP:187182207
6742 6742 a, g dbSNP:551258089
6762 6762 a, g dbSNP:567578149
6765 6765 c, t dbSNP:536535885
6770 6770 a, g dbSNP:535056033
6862 6862 c, g dbSNP:543593100
6882 6882 a, g dbSNP:192113185
6919 6919 c, t dbSNP:539159846
6936 6936 c, t dbSNP:79560972
6980 6980 c, t dbSNP:113073720
7001 7001 -, t dbSNP:34103244
7038 7038 c, t dbSNP:544234052
7039 7039 a, g dbSNP:554914070
7043 7043 -, a dbSNP:34282104
7063 7063 c, t dbSNP:117678596
7159 7159 a, g dbSNP:370469183
7170 7170 g, t dbSNP:560338292
7233 7233 a, g dbSNP:545911330
7244 7244 c, t dbSNP:113403633
7249 7249 -, ttgtat dbSNP:748796519
7257 7257 a, c, g dbSNP:181872627
7354 7354 c, t dbSNP:552082015
7356 7356 c, g dbSNP:112259692
7364 7364 a, c dbSNP:773246781
7389 7389 -, t dbSNP:3837752
7396 7396 -, t dbSNP:397778750
7403 7403 a, g dbSNP:531344901
7420 7420 a, c dbSNP:762808427
7436 7436 c, t dbSNP:530337169

Target ORF information:

RefSeq Version XM_011522425
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens excision repair cross-complementation group 4 (ERCC4), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu57571D
Sequence Information ORF Nucleotide Sequence (Length: 1962bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product DNA repair endonuclease XPF isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_010393.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)101..2029(+)
Misc Feature(2)1364..1756(+)
Position Chain Variation Link
13 13 a, g dbSNP:537462553
80 80 a, c dbSNP:544617095
106 106 c, g dbSNP:746106147
107 107 c, t dbSNP:373570729
108 108 a, g, t dbSNP:143479220
130 130 a, g dbSNP:769764837
133 133 c, t dbSNP:773131349
154 154 a, g dbSNP:200536315
162 162 c, t dbSNP:765930617
164 164 c, t dbSNP:750971687
182 182 c, t dbSNP:759268826
183 183 a, g dbSNP:202243691
194 194 c, t dbSNP:753149023
195 195 a, g dbSNP:756540416
197 197 a, t dbSNP:778480216
210 210 a, g dbSNP:754408222
212 212 g, t dbSNP:757636398
214 214 c, t dbSNP:148003381
220 220 c, t dbSNP:564247394
221 221 a, g dbSNP:772385411
223 223 -, a dbSNP:772432152
228 228 a, t dbSNP:780219730
231 231 a, t dbSNP:141961015
242 242 g, t dbSNP:200596978
245 245 -, t dbSNP:780647908
246 246 c, t dbSNP:150244523
251 251 g, t dbSNP:762885572
256 256 a, g dbSNP:770736492
258 258 a, g dbSNP:773938568
265 265 -, t dbSNP:747327001
271 271 g, t dbSNP:758933707
272 272 c, g dbSNP:767264265
274 274 -, t dbSNP:35090754
284 284 g, t dbSNP:760433983
289 289 a, g dbSNP:763789717
296 296 c, g dbSNP:587778285
297 297 a, c dbSNP:777183693
299 299 a, t dbSNP:762052950
306 306 c, t dbSNP:765840370
309 309 c, t dbSNP:750883282
311 311 a, g dbSNP:758884625
327 327 a, g dbSNP:753728949
330 330 c, g dbSNP:373229910
333 333 a, g dbSNP:267604416
335 335 g, t dbSNP:755219554
339 339 a, g, t dbSNP:145851520
343 343 c, t dbSNP:756986546
353 353 a, g dbSNP:201410515
366 366 a, t dbSNP:569926448
370 370 a, g dbSNP:745796159
374 374 a, g dbSNP:772092631
376 376 a, c dbSNP:775161827
377 377 -, a dbSNP:34607888
377 377 a, t dbSNP:746495409
379 379 a, g, t dbSNP:768464180
383 383 -, a dbSNP:769120755
394 394 a, g dbSNP:762297186
396 396 -, t dbSNP:776206553
398 398 a, g dbSNP:765535723
410 410 a, g, t dbSNP:148933357
415 415 a, t dbSNP:749724323
417 417 a, g dbSNP:561066051
418 418 a, t dbSNP:774643449
424 424 a, g dbSNP:760060914
428 428 a, g dbSNP:765738455
429 429 a, t dbSNP:772594065
431 431 c, t dbSNP:376695854
439 439 c, t dbSNP:760787953
443 443 c, t dbSNP:1799802
455 455 a, g dbSNP:201051665
470 470 c, t dbSNP:199505105
504 504 -, ac dbSNP:779091652
509 509 c, t dbSNP:147458778
512 512 a, c, g dbSNP:200759609
515 515 c, g dbSNP:751348446
516 516 a, g dbSNP:754994055
518 518 c, t dbSNP:767454772
520 520 a, g dbSNP:752193295
525 525 a, g dbSNP:762147159
527 527 g, t dbSNP:765513788
551 551 c, t dbSNP:374470560
552 552 a, g dbSNP:1800067
559 559 a, t dbSNP:762738968
573 573 a, g dbSNP:767408205
574 574 a, c dbSNP:181278137
576 576 a, g dbSNP:143924094
577 577 c, t dbSNP:144305111
591 591 a, c, t dbSNP:763619616
592 592 a, g dbSNP:3136151
601 601 -, c dbSNP:750512090
602 602 g, t dbSNP:778515954
605 605 c, t dbSNP:116615540
624 624 a, c dbSNP:758786333
626 626 g, t dbSNP:370344307
629 629 a, g dbSNP:747564755
642 642 a, c dbSNP:368559924
645 645 c, t dbSNP:776880848
647 647 a, g dbSNP:748206066
650 650 c, g dbSNP:547209644
667 667 c, t dbSNP:773551391
672 672 a, g dbSNP:759312308
674 674 a, g dbSNP:142332295
678 678 a, g dbSNP:775102285
679 679 c, g dbSNP:760701586
681 681 a, g dbSNP:763991308
684 684 a, c dbSNP:201179693
687 687 a, t dbSNP:761301503
689 689 a, c dbSNP:764936603
692 692 a, g dbSNP:750095432
694 694 c, t dbSNP:757930503
699 699 a, t dbSNP:780488548
701 701 c, t dbSNP:751828681
706 706 c, g dbSNP:372950439
708 708 a, g dbSNP:781758234
710 710 a, g dbSNP:748292174
711 711 c, g dbSNP:769985983
713 713 c, t dbSNP:777945955
720 720 -, c dbSNP:758567128
723 723 c, t dbSNP:572439259
730 730 c, t dbSNP:771022303
737 737 c, t dbSNP:41557814
738 738 a, g dbSNP:775398434
739 739 g, t dbSNP:760367072
745 745 c, t dbSNP:768640061
747 747 c, t dbSNP:776546311
754 754 a, g dbSNP:114077770
755 755 a, g dbSNP:587778286
758 758 a, g, t dbSNP:764739776
765 765 a, g dbSNP:762697491
769 769 -, a dbSNP:747558645
778 778 -, g dbSNP:34930410
790 790 -, aactc dbSNP:768847411
792 792 -, ctcaa dbSNP:397509400
796 796 a, c, g, t dbSNP:146601373
800 800 a, g, t dbSNP:140252818
801 801 c, t dbSNP:373587423
802 802 a, t dbSNP:538185672
808 808 a, c dbSNP:777944273
809 809 c, g, t dbSNP:371114175
815 815 a, g dbSNP:778992329
820 820 -, g dbSNP:781559890
829 829 a, c dbSNP:746890369
831 831 a, g dbSNP:587778288
839 839 a, g dbSNP:200617058
840 840 a, g dbSNP:761759726
845 845 a, g dbSNP:769679311
847 847 a, g dbSNP:374391979
849 849 a, g dbSNP:201514032
852 852 a, g dbSNP:766111215
856 856 a, g dbSNP:773866713
857 857 a, g dbSNP:150291286
862 862 a, c dbSNP:768020598
871 871 a, c, g dbSNP:41552412
883 883 c, t dbSNP:779170299
885 885 a, c, t dbSNP:149056863
886 886 a, g dbSNP:757281318
889 889 a, t dbSNP:200649435
904 904 a, g dbSNP:746104783
914 914 c, g dbSNP:143347563
916 916 a, g dbSNP:780996067
927 927 c, t dbSNP:368830992
928 928 a, g dbSNP:769817145
939 939 -, t dbSNP:369082850
941 941 a, g dbSNP:773007457
956 956 c, t dbSNP:139197943
957 957 c, t dbSNP:770347803
962 962 a, g dbSNP:773850619
963 963 c, t dbSNP:549865610
965 965 a, g dbSNP:376216413
976 976 a, g dbSNP:759296999
984 984 a, g dbSNP:370896187
985 985 c, t dbSNP:776049363
992 992 a, g dbSNP:55736359
996 996 c, g, t dbSNP:764730051
997 997 c, g dbSNP:553999029
999 999 a, g, t dbSNP:765254949
1010 1010 a, t dbSNP:758658934
1012 1012 a, g, t dbSNP:780225844
1013 1013 a, g dbSNP:755854109
1014 1014 c, t dbSNP:777553142
1019 1019 c, t dbSNP:587778287
1035 1035 c, g dbSNP:1800068
1036 1036 a, g, t dbSNP:765454246
1037 1037 -, a dbSNP:747759202
1038 1038 -, a dbSNP:397509404
1040 1040 a, g dbSNP:202186213
1042 1042 a, g dbSNP:771912352
1048 1048 g, t dbSNP:374556359
1054 1054 c, g dbSNP:775278986
1057 1057 a, g dbSNP:760310698
1066 1066 c, g dbSNP:367595904
1070 1070 a, g dbSNP:777006157
1071 1071 c, t dbSNP:371392134
1073 1073 c, t dbSNP:147105770
1074 1074 a, g dbSNP:750549531
1076 1076 c, t dbSNP:763006163
1079 1079 c, g dbSNP:766652186
1095 1095 a, c, t dbSNP:751782722
1096 1096 g, t dbSNP:374303503
1101 1101 a, g dbSNP:777448181
1104 1104 c, t dbSNP:753641687
1106 1106 a, g dbSNP:755150407
1110 1110 a, c dbSNP:138532294
1115 1115 c, t dbSNP:745442045
1125 1125 a, g, t dbSNP:189463122
1128 1128 g, t dbSNP:748526617
1129 1129 g, t dbSNP:61760161
1138 1138 c, t dbSNP:763332387
1139 1139 a, g dbSNP:749814308
1148 1148 a, g dbSNP:771383745
1153 1153 a, c, g dbSNP:774347057
1158 1158 -, a dbSNP:769406369
1158 1158 a, g dbSNP:767702213
1160 1160 c, t dbSNP:373565480
1161 1161 a, g dbSNP:760922582
1162 1162 c, g dbSNP:765147177
1164 1164 a, g dbSNP:750205235
1168 1168 c, g dbSNP:758451676
1178 1178 a, c, t dbSNP:766395322
1179 1179 a, g dbSNP:180919656
1187 1187 -, aagg dbSNP:772899497
1189 1189 g, t dbSNP:780500474
1192 1192 a, g dbSNP:2020958
1204 1204 a, g, t dbSNP:546230479
1208 1208 -, ataag dbSNP:762355362
1208 1208 a, g dbSNP:533626393
1210 1210 a, g dbSNP:749634352
1211 1211 a, c dbSNP:771488066
1225 1225 a, c dbSNP:377213481
1226 1226 a, c dbSNP:762059602
1229 1229 a, g dbSNP:770771750
1233 1233 c, t dbSNP:773964691
1246 1246 a, g dbSNP:759544889
1248 1248 a, g dbSNP:112490976
1250 1250 a, g dbSNP:369471816
1251 1251 a, g dbSNP:752265539
1256 1256 g, t dbSNP:760177195
1278 1278 c, t dbSNP:763532154
1283 1283 a, g dbSNP:753506602
1284 1284 a, g dbSNP:756811179
1287 1287 a, c, t dbSNP:779366136
1291 1291 a, g dbSNP:373237850
1292 1292 c, t dbSNP:2020955
1297 1297 a, c dbSNP:747151321
1308 1308 a, c, t dbSNP:200317919
1309 1309 g, t dbSNP:781362388
1311 1311 a, t dbSNP:748400348
1313 1313 a, g dbSNP:769863971
1315 1315 g, t dbSNP:376422457
1316 1316 c, t dbSNP:139782718
1317 1317 a, g dbSNP:56129764
1320 1320 a, g dbSNP:201675333
1324 1324 c, t dbSNP:775414253
1325 1325 a, c, g dbSNP:760553358
1328 1328 a, g dbSNP:765005836
1338 1338 a, g dbSNP:370466614
1347 1347 c, t dbSNP:762607920
1354 1354 a, g dbSNP:565249189
1365 1365 c, t dbSNP:751928876
1370 1370 a, t dbSNP:755577606
1373 1373 a, c, t dbSNP:149364215
1382 1382 c, t dbSNP:756155469
1383 1383 a, g, t dbSNP:777853585
1384 1384 a, g dbSNP:757434523
1385 1385 a, g dbSNP:779865123
1386 1386 g, t dbSNP:746784825
1391 1391 a, c dbSNP:768640022
1395 1395 c, t dbSNP:752894496
1405 1405 a, c, g dbSNP:556423345
1409 1409 c, g dbSNP:772728961
1410 1410 a, g dbSNP:762543560
1413 1413 a, g dbSNP:144058769
1416 1416 g, t dbSNP:774900622
1425 1425 c, t dbSNP:1800069
1426 1426 c, t dbSNP:777766206
1430 1430 c, t dbSNP:753161715
1432 1432 a, c, t dbSNP:376391395
1433 1433 a, g dbSNP:373906926
1446 1446 c, t dbSNP:757525012
1464 1464 a, c, t dbSNP:779096061
1472 1472 a, g dbSNP:754771000
1477 1477 a, c, t dbSNP:2020959
1483 1483 a, g dbSNP:769731155
1484 1484 a, c, t dbSNP:777184889
1485 1485 a, c, g dbSNP:368096448
1494 1494 c, t dbSNP:375860375
1495 1495 c, t dbSNP:746273815
1497 1497 a, g dbSNP:772589823
1498 1498 c, t dbSNP:368274574
1504 1504 a, g dbSNP:761130884
1507 1507 c, t dbSNP:372425414
1508 1508 a, g dbSNP:753924297
1516 1516 a, g dbSNP:761878121
1523 1523 a, g dbSNP:765235917
1526 1526 c, t dbSNP:376688194
1527 1527 a, g dbSNP:758565772
1533 1533 a, g dbSNP:780880381
1541 1541 c, g, t dbSNP:12932917
1544 1544 a, c dbSNP:756050702
1548 1548 c, t dbSNP:12928616
1549 1549 c, t dbSNP:367813650
1556 1556 c, t dbSNP:374978891
1557 1557 a, g dbSNP:748870665
1568 1568 c, t dbSNP:535728795
1569 1569 a, g dbSNP:143357336
1573 1573 c, t dbSNP:555317161
1574 1574 a, g dbSNP:201501958
1585 1585 g, t dbSNP:778971103
1596 1596 c, t dbSNP:761087753
1598 1598 a, g dbSNP:146764714
1600 1600 c, t dbSNP:139406689
1604 1604 a, c dbSNP:142532415
1611 1611 c, t dbSNP:12928650
1613 1613 c, t dbSNP:373135011
1615 1615 c, t dbSNP:765321722
1622 1622 c, t dbSNP:150920741
1644 1644 c, t dbSNP:763202833
1647 1647 c, g dbSNP:766596368
1656 1656 a, g dbSNP:375263578
1666 1666 c, t dbSNP:143081574
1668 1668 a, g dbSNP:755929592
1669 1669 a, g dbSNP:763726880
1677 1677 c, t dbSNP:753851289
1683 1683 -, cacttcacttc dbSNP:775452814
1688 1688 a, c, t dbSNP:757223070
1694 1694 a, c dbSNP:772423662
1700 1700 c, g dbSNP:369736388
1702 1702 a, g dbSNP:111613748
1703 1703 c, t dbSNP:121913049
1706 1706 -, cttacacttcacttccccagactacgga dbSNP:397509401
1717 1717 c, t dbSNP:779753781
1731 1731 c, g dbSNP:746576915
1734 1734 c, t dbSNP:769080259
1735 1735 a, g dbSNP:2020960
1737 1737 a, c dbSNP:748683649
1738 1738 a, g dbSNP:770255135
1741 1741 a, g dbSNP:773329866
1744 1744 a, g dbSNP:373510515
1751 1751 c, g dbSNP:766573225
1760 1760 c, g dbSNP:774635437
1765 1765 a, c dbSNP:759616913
1770 1770 c, t dbSNP:763983833
1771 1771 a, g dbSNP:2020953
1774 1774 a, g dbSNP:757316495
1782 1782 c, g dbSNP:765253522
1783 1783 a, g dbSNP:200818432
1785 1785 c, t dbSNP:141790888
1788 1788 c, t dbSNP:757931216
1793 1793 c, t dbSNP:779375310
1799 1799 a, g dbSNP:746694351
1802 1802 a, g dbSNP:754544912
1804 1804 a, g dbSNP:147083262
1808 1808 a, g, t dbSNP:138583819
1812 1812 a, c dbSNP:370258803
1813 1813 c, t dbSNP:1799801
1814 1814 a, g dbSNP:749688539
1820 1820 c, g dbSNP:771053699
1822 1822 c, t dbSNP:200069811
1825 1825 c, g, t dbSNP:200715555
1826 1826 a, g dbSNP:776625719
1827 1827 a, c dbSNP:761699907
1842 1842 a, g dbSNP:377562755
1843 1843 c, t dbSNP:750391635
1845 1845 c, t dbSNP:762753294
1853 1853 c, g dbSNP:374186605
1854 1854 a, t dbSNP:750999717
1857 1857 a, g dbSNP:754705146
1859 1859 g, t dbSNP:780805780
1864 1864 c, g dbSNP:529976681
1878 1878 a, g dbSNP:776036851
1879 1879 a, g dbSNP:111787810
1882 1882 a, g dbSNP:753126294
1887 1887 a, c dbSNP:4986933
1888 1888 a, c dbSNP:76446924
1893 1893 a, c dbSNP:202159590
1894 1894 c, t dbSNP:778051880
1895 1895 g, t dbSNP:773636525
1896 1896 c, g dbSNP:749822053
1898 1898 c, t dbSNP:587778284
1902 1902 c, t dbSNP:779099430
1903 1903 -, t dbSNP:760599709
1903 1903 c, t dbSNP:745923107
1910 1910 c, t dbSNP:548842693
1911 1911 a, c dbSNP:368064765
1912 1912 c, t dbSNP:370809250
1915 1915 c, t dbSNP:769736716
1916 1916 a, g dbSNP:562305007
1918 1918 a, t dbSNP:762984557
1923 1923 a, g dbSNP:766200743
1924 1924 c, t dbSNP:763275769
1925 1925 a, g dbSNP:2020957
1927 1927 c, t dbSNP:759042927
1929 1929 c, t dbSNP:766946690
1932 1932 a, g dbSNP:1800124
1938 1938 c, g dbSNP:755713614
1940 1940 g, t dbSNP:778153718
1949 1949 c, g dbSNP:754131812
1951 1951 a, g dbSNP:757841266
1954 1954 a, c, t dbSNP:538267970
1955 1955 a, g dbSNP:201652412
1962 1962 c, t dbSNP:772294893
1963 1963 a, g dbSNP:16963255
1967 1967 a, g dbSNP:752703922
1983 1983 a, c dbSNP:747268097
1985 1985 a, g dbSNP:201926295
2002 2002 c, t dbSNP:138296474
2003 2003 g, t dbSNP:537592259
2008 2008 c, t dbSNP:191674905
2016 2016 c, t dbSNP:770963694
2022 2022 g, t dbSNP:774160726
2025 2025 c, t dbSNP:759410779
2029 2029 a, g dbSNP:767034692
2030 2030 -, a dbSNP:765546590
2031 2031 a, t dbSNP:774939544
2032 2032 a, c, t dbSNP:3136225
2033 2033 a, c, g dbSNP:140726146
2037 2037 c, t dbSNP:765582513
2040 2040 a, g dbSNP:753734253
2042 2042 a, g dbSNP:150077735
2043 2043 a, g dbSNP:2020956
2044 2044 -, a dbSNP:750727529
2054 2054 a, c dbSNP:758936308
2057 2057 c, t dbSNP:780318166
2062 2062 a, g dbSNP:747059736
2064 2064 c, t dbSNP:755306366
2067 2067 c, t dbSNP:781261543
2070 2070 c, t dbSNP:9929524
2071 2071 a, t dbSNP:770644250
2078 2078 g, t dbSNP:574181440
2084 2084 c, t dbSNP:369845118
2085 2085 a, g dbSNP:745834636
2091 2091 a, g dbSNP:771976579
2095 2095 a, t dbSNP:775040023
2097 2097 g, t dbSNP:760175182
2102 2102 c, t dbSNP:200296085
2103 2103 a, g dbSNP:3136226
2107 2107 c, t dbSNP:761481929
2154 2154 a, g dbSNP:117384292
2217 2217 c, t dbSNP:543502035
2247 2247 a, t dbSNP:556712304
2251 2251 c, t dbSNP:536552167
2257 2257 c, t dbSNP:542176025
2267 2267 c, t dbSNP:562343456
2281 2281 c, t dbSNP:527893953
2282 2282 a, g dbSNP:543279126
2307 2307 a, g dbSNP:541600279
2319 2319 g, t dbSNP:564658450
2322 2322 c, t dbSNP:533310107
2324 2324 c, g dbSNP:550225655
2359 2359 a, g dbSNP:765296684
2377 2377 a, t dbSNP:147799208
2381 2381 a, c dbSNP:750308239
2417 2417 c, t dbSNP:762905902
2418 2418 a, g dbSNP:183465897
2470 2470 c, t dbSNP:141279442
2510 2510 c, t dbSNP:565592403
2525 2525 g, t dbSNP:534595915
2543 2543 g, t dbSNP:3743538
2568 2568 a, g dbSNP:760978837
2572 2572 c, g, t dbSNP:371345833
2576 2576 a, t dbSNP:545416742
2578 2578 a, g dbSNP:746499083
2598 2598 a, g dbSNP:565318315
2617 2617 a, c dbSNP:376791839
2675 2675 c, t dbSNP:536781995
2733 2733 c, g dbSNP:1651204
2734 2734 g, t dbSNP:1651203
2738 2738 c, g dbSNP:116246143
2759 2759 -, at dbSNP:750161593
2760 2760 a, t dbSNP:146955145
2785 2785 c, g dbSNP:2276464
2804 2804 a, c dbSNP:541739848
2867 2867 c, t dbSNP:561265785
2869 2869 a, g dbSNP:2276465
2941 2941 c, g dbSNP:187039399
2945 2945 c, t dbSNP:757335570
2950 2950 a, g dbSNP:191634336
2989 2989 c, t dbSNP:1055443
2991 2991 a, g dbSNP:112574290
3000 3000 a, c dbSNP:376982978
3006 3006 c, t dbSNP:117293226
3030 3030 c, g dbSNP:2276466
3062 3062 c, t dbSNP:764425829
3069 3069 a, g dbSNP:182347151
3072 3072 c, g dbSNP:776927829
3085 3085 c, g dbSNP:368797729
3093 3093 a, g dbSNP:528398095
3096 3096 a, t dbSNP:551248118
3110 3110 c, t dbSNP:545772856
3115 3115 a, g dbSNP:72781468
3120 3120 -, aaaag dbSNP:549984925
3149 3149 a, g dbSNP:537224795
3200 3200 a, g dbSNP:186586436
3205 3205 c, t dbSNP:567315876
3261 3261 g, t dbSNP:536346195
3266 3266 g, t dbSNP:193289721
3277 3277 a, g dbSNP:572852406
3310 3310 c, t dbSNP:532485638
3315 3315 c, g dbSNP:373479879
3345 3345 a, g dbSNP:185626419
3346 3346 c, t dbSNP:535372156
3347 3347 a, g dbSNP:143188036
3352 3352 a, g dbSNP:375218385
3403 3403 -, t dbSNP:34388983
3405 3405 c, t dbSNP:750161345
3412 3412 a, g dbSNP:77401662
3414 3414 a, g dbSNP:543949045
3469 3469 a, g dbSNP:766219203
3474 3474 c, t dbSNP:548735957
3480 3480 g, t dbSNP:76447723
3531 3531 c, t dbSNP:112742002
3537 3537 c, t dbSNP:754423213
3578 3578 g, t dbSNP:542690728
3614 3614 c, t dbSNP:190536009
3660 3660 c, t dbSNP:747753243
3696 3696 c, t dbSNP:568549113
3705 3705 c, g dbSNP:372528374
3734 3734 c, t dbSNP:570169244
3738 3738 a, g dbSNP:537527346
3743 3743 a, g dbSNP:148155845
3758 3758 c, t dbSNP:747649934
3763 3763 a, g dbSNP:755744665
3767 3767 a, g dbSNP:528435639
3769 3769 c, t dbSNP:746216891
3793 3793 c, t dbSNP:551285375
3833 3833 c, t dbSNP:772694607
3834 3834 a, g dbSNP:773340693
3855 3855 c, t dbSNP:565142105
3861 3861 c, t dbSNP:537535365
3862 3862 a, g dbSNP:530629612
3917 3917 c, t dbSNP:775803860
3921 3921 c, t dbSNP:550794794
3939 3939 c, t dbSNP:112776898
3953 3953 a, g dbSNP:192910261
3963 3963 a, g dbSNP:770921381
3975 3975 -, c dbSNP:34866586
3995 3995 a, g dbSNP:115472788
4050 4050 a, t dbSNP:567966619
4086 4086 g, t dbSNP:538608476
4134 4134 a, g dbSNP:558169438
4182 4182 g, t dbSNP:774315575
4194 4194 a, g dbSNP:578166086
4198 4198 a, c dbSNP:140019040
4233 4233 a, g dbSNP:9925509
4238 4238 c, t dbSNP:111651288
4330 4330 a, g dbSNP:573881501
4423 4423 a, g dbSNP:542729521
4461 4461 a, g dbSNP:559394290
4473 4473 a, t dbSNP:572906300
4474 4474 a, g dbSNP:549968233
4485 4485 a, t dbSNP:768817193
4501 4501 g, t dbSNP:565128975
4504 4504 a, t dbSNP:777015670
4505 4505 a, g dbSNP:530884886
4512 4512 a, g dbSNP:567813836
4536 4536 -, a dbSNP:563490201
4570 4570 a, g dbSNP:184381372
4572 4572 a, c dbSNP:11075223
4573 4573 a, g dbSNP:553578280
4598 4598 a, g dbSNP:115526695
4631 4631 -, c dbSNP:61422086
4635 4635 a, cc dbSNP:386789300
4636 4636 a, c dbSNP:56012340
4646 4646 a, t dbSNP:76963262
4647 4647 a, g dbSNP:188840787
4702 4702 -, g dbSNP:373646296
4706 4706 a, g dbSNP:532153427
4708 4708 a, t dbSNP:376328949
4722 4722 c, t dbSNP:558811254
4771 4771 c, t dbSNP:552190642
4780 4780 a, t dbSNP:762639164
4796 4796 a, g dbSNP:142073142
4803 4803 a, t dbSNP:12325236
4810 4810 a, g dbSNP:751428407
4818 4818 c, t dbSNP:776910274
4842 4842 a, g dbSNP:545748696
4875 4875 a, t dbSNP:146325817
4908 4908 a, g dbSNP:567543133
4938 4938 a, c dbSNP:181178937
4951 4951 c, g dbSNP:376334296
4989 4989 a, g dbSNP:573044100
5000 5000 g, t dbSNP:545171920
5045 5045 a, t dbSNP:558935375
5064 5064 c, g dbSNP:115605700
5080 5080 g, t dbSNP:767067212
5084 5084 a, g dbSNP:544513268
5091 5091 g, t dbSNP:4781562
5152 5152 c, t dbSNP:183916977
5184 5184 a, g dbSNP:115183774
5189 5189 c, t dbSNP:189232031
5230 5230 a, c, t dbSNP:180762894
5243 5243 a, g dbSNP:577306350
5254 5254 a, g dbSNP:4781563
5259 5259 a, g dbSNP:8056393
5262 5262 a, g dbSNP:114059834
5326 5326 a, g