Home » Species Summary » Homo sapiens » FGFR3 cDNA ORF clone
Email to GenScript

FGFR3 cDNA ORF clone, Homo sapiens (human)

Gene Symbol FGFR3
Entrez Gene ID 2261
Full Name fibroblast growth factor receptor 3
Synonyms ACH, CD333, CEK2, HSFGFR3EX, JTK4
General protein information
Preferred Names
fibroblast growth factor receptor 3
fibroblast growth factor receptor 3
tyrosine kinase JTK4
hydroxyaryl-protein kinase
fibroblast growth factor receptor 3 variant 4
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a member of the fibroblast growth factor receptor (FGFR) family, with its amino acid sequence being highly conserved between members and among divergent species. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds acidic and basic fibroblast growth hormone and plays a role in bone development and maintenance. Mutations in this gene lead to craniosynostosis and multiple types of skeletal dysplasia. Three alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Jul 2009]. lac of sum
Disorder MIM:


Disorder Html: Achondroplasia, 100800 (3); Hypochondroplasia, 146000 (3); Thanatophoric dysplasia, type I, 187600 (3);

mRNA and Protein(s)

mRNA Protein Name
NM_001163213 NP_001156685 fibroblast growth factor receptor 3 isoform 3 precursor
XM_006713868 XP_006713931 fibroblast growth factor receptor 3 isoform X1
XM_006713869 XP_006713932 fibroblast growth factor receptor 3 isoform X2
XM_006713870 XP_006713933 fibroblast growth factor receptor 3 isoform X3
XM_006713871 XP_006713934 fibroblast growth factor receptor 3 isoform X4
XM_011513420 XP_011511722 fibroblast growth factor receptor 3 isoform X5
XM_006713872 XP_006713935 fibroblast growth factor receptor 3 isoform X6
XM_006713873 XP_006713936 fibroblast growth factor receptor 3 isoform X7
XM_011513422 XP_011511724 fibroblast growth factor receptor 3 isoform X8
NM_000142 NP_000133 fibroblast growth factor receptor 3 isoform 1 precursor
NM_022965 NP_075254 fibroblast growth factor receptor 3 isoform 2 precursor

hsa04010 MAPK signaling pathway
hsa04810 Regulation of actin cytoskeleton
hsa05219 Bladder cancer
hsa05200 Pathways in cancer
hsa04144 Endocytosis
hsa04151 PI3K-Akt signaling pathway
hsa04550 Signaling pathways regulating pluripotency of stem cells
hsa05230 Central carbon metabolism in cancer
hsa05206 MicroRNAs in cancer
hsa04014 Ras signaling pathway
hsa04015 Rap1 signaling pathway
R-HSA-5663202 Diseases of signal transduction
R-HSA-1643685 Disease
R-HSA-2033514 FGFR3 mutant receptor activation
R-HSA-2033515 t(4;14) translocations of FGFR3
R-HSA-1226099 Signaling by FGFR in disease
R-HSA-1839130 Signaling by activated point mutants of FGFR3
R-HSA-5655332 Signaling by FGFR3 in disease
R-HSA-2219530 Constitutive Signaling by Aberrant PI3K in Cancer
R-HSA-2219528 PI3K/AKT Signaling in Cancer
R-HSA-1280218 Adaptive Immune System
R-HSA-168256 Immune System
R-HSA-1168372 Downstream signaling events of B Cell Receptor (BCR)
R-HSA-983705 Signaling by the B Cell Receptor (BCR)
R-HSA-1257604 PIP3 activates AKT signaling
R-HSA-168249 Innate Immune System
R-HSA-2172127 DAP12 interactions
R-HSA-2424491 DAP12 signaling
R-HSA-2454202 Fc epsilon receptor (FCERI) signaling
R-HSA-2871796 FCERI mediated MAPK activation
R-HSA-1280215 Cytokine Signaling in Immune system
R-HSA-5673001 RAF/MAP kinase cascade
R-HSA-512988 Interleukin-3, 5 and GM-CSF signaling
R-HSA-2730905 Role of LAT2/NTAL/LAB on calcium mobilization
R-HSA-451927 Interleukin-2 signaling
R-HSA-912526 Interleukin receptor SHC signaling
R-HSA-449147 Signaling by Interleukins
R-HSA-162582 Signal Transduction
R-HSA-177929 Signaling by EGFR
R-HSA-179812 GRB2 events in EGFR signaling
R-HSA-180336 SHC1 events in EGFR signaling
R-HSA-180292 GAB1 signalosome
R-HSA-5654693 FRS-mediated FGFR1 signaling
R-HSA-5654687 Downstream signaling of activated FGFR1
R-HSA-5654736 Signaling by FGFR1
R-HSA-5654738 Signaling by FGFR2
R-HSA-190236 Signaling by FGFR
R-HSA-5654741 Signaling by FGFR3
R-HSA-5654708 Downstream signaling of activated FGFR3
R-HSA-5654700 FRS-mediated FGFR2 signaling
R-HSA-5654689 PI-3K cascade:FGFR1
R-HSA-5654695 PI-3K cascade:FGFR2
R-HSA-5654743 Signaling by FGFR4
R-HSA-74751 Insulin receptor signalling cascade
R-HSA-112399 IRS-mediated signalling
R-HSA-5654704 SHC-mediated cascade:FGFR3
R-HSA-5654712 FRS-mediated FGFR4 signaling
R-HSA-112412 SOS-mediated signalling
R-HSA-5654706 FRS-mediated FGFR3 signaling
R-HSA-167044 Signalling to RAS
R-HSA-190371 FGFR3b ligand binding and activation
R-HSA-5654720 PI-3K cascade:FGFR4
R-HSA-74752 Signaling by Insulin receptor
R-HSA-166520 Signalling by NGF
R-HSA-187037 NGF signalling via TRKA from the plasma membrane
R-HSA-109704 PI3K Cascade
R-HSA-187687 Signalling to ERKs
R-HSA-5654227 Phospholipase C-mediated cascade; FGFR3
R-HSA-5654716 Downstream signaling of activated FGFR4
R-HSA-5654696 Downstream signaling of activated FGFR2
R-HSA-190239 FGFR3 ligand binding and activation
R-HSA-190372 FGFR3c ligand binding and activation
R-HSA-186797 Signaling by PDGF
R-HSA-186763 Downstream signal transduction
R-HSA-4420097 VEGFA-VEGFR2 Pathway
R-HSA-198203 PI3K/AKT activation
R-HSA-194138 Signaling by VEGF
R-HSA-169893 Prolonged ERK activation events
R-HSA-170984 ARMS-mediated activation
R-HSA-170968 Frs2-mediated activation
R-HSA-5654710 PI-3K cascade:FGFR3
R-HSA-5654732 Negative regulation of FGFR3 signaling
R-HSA-1250196 SHC1 events in ERBB2 signaling
R-HSA-1433557 Signaling by SCF-KIT
R-HSA-1250347 SHC1 events in ERBB4 signaling
R-HSA-1963640 GRB2 events in ERBB2 signaling
R-HSA-1227986 Signaling by ERBB2
R-HSA-1963642 PI3K events in ERBB2 signaling
R-HSA-5683057 MAPK family signaling cascades
R-HSA-5684996 MAPK1/MAPK3 signaling
R-HSA-187706 Signalling to p38 via RIT and RIN
R-HSA-1236394 Signaling by ERBB4
R-HSA-5218921 VEGFR2 mediated cell proliferation
R-HSA-1250342 PI3K events in ERBB4 signaling
R-HSA-372790 Signaling by GPCR
R-HSA-881907 Gastrin-CREB signalling pathway via PKC and MAPK
R-HSA-2428928 IRS-related events triggered by IGF1R
R-HSA-2586552 Signaling by Leptin
R-HSA-2404192 Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
R-HSA-2428924 IGF1R signaling cascade
R-HSA-1266738 Developmental Biology
R-HSA-375165 NCAM signaling for neurite out-growth
R-HSA-422475 Axon guidance
WP474 Endochondral Ossification
WP51 Regulation of Actin Cytoskeleton
WP2064 Neural Crest Differentiation

Homo sapiens (human) FGFR3 NP_000133.1
Pan troglodytes (chimpanzee) FGFR3 XP_003310269.1
Macaca mulatta (Rhesus monkey) FGFR3 XP_001101108.1
Canis lupus familiaris (dog) FGFR3 XP_005618584.1
Bos taurus (cattle) FGFR3 NP_776743.1
Mus musculus (house mouse) Fgfr3 NP_001156687.1
Rattus norvegicus (Norway rat) Fgfr3 NP_445881.1
Gallus gallus (chicken) FGFR3 NP_990840.2
Danio rerio (zebrafish) fgfr3 NP_571681.1
Drosophila melanogaster (fruit fly) htl NP_732286.1
Caenorhabditis elegans egl-15 NP_001024723.1
Xenopus (Silurana) tropicalis (western clawed frog) fgfr3 NP_001135467.1


ID Name Evidence
GO:0005764 lysosome IEA
GO:0005886 plasma membrane EXP
GO:0005886 plasma membrane TAS
GO:0005887 integral to plasma membrane TAS
GO:0009898 internal side of plasma membrane IEA
GO:0016021 integral to membrane NAS
GO:0048471 perinuclear region of cytoplasm IEA


ID Name Evidence
GO:0000166 nucleotide binding IEA
GO:0004713 protein tyrosine kinase activity EXP
GO:0004713 protein tyrosine kinase activity TAS
GO:0004872 receptor activity IEA
GO:0005007 fibroblast growth factor receptor activity NAS
GO:0005515 protein binding IPI
GO:0005524 ATP binding IEA
GO:0017134 fibroblast growth factor binding IPI
GO:0042802 identical protein binding IPI


ID Name Evidence
GO:0000122 negative regulation of transcription from RNA polymerase II promoter IEA
GO:0000165 MAPKKK cascade IEA
GO:0001501 skeletal system development TAS
GO:0002009 morphogenesis of an epithelium IEA
GO:0006468 protein phosphorylation IEA
GO:0007259 JAK-STAT cascade TAS
GO:0008284 positive regulation of cell proliferation IGI
GO:0008286 insulin receptor signaling pathway TAS
GO:0008543 fibroblast growth factor receptor signaling pathway IGI
GO:0008543 fibroblast growth factor receptor signaling pathway NAS
GO:0008543 fibroblast growth factor receptor signaling pathway TAS
GO:0016049 cell growth NAS
GO:0030900 forebrain development IEA
GO:0031398 positive regulation of protein ubiquitination IEA
GO:0035121 tail morphogenesis IEA
GO:0043065 positive regulation of apoptosis IEA
GO:0045597 positive regulation of cell differentiation IEA
GO:0045879 negative regulation of smoothened signaling pathway IEA
GO:0048640 negative regulation of developmental growth ISS
GO:0050680 negative regulation of epithelial cell proliferation IEA
GO:0050731 positive regulation of peptidyl-tyrosine phosphorylation IEA
GO:0051216 cartilage development IEA
GO:0060113 inner ear receptor cell differentiation IEA
GO:0070977 bone maturation ISS
GO:0090080 positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway IEA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following FGFR3 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the FGFR3 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
NM_001163213 Homo sapiens fibroblast growth factor receptor 3 (FGFR3), transcript variant 3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Quote Price
OHu38314 XM_006713868 PREDICTED: Homo sapiens fibroblast growth factor receptor 3 (FGFR3), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu38315 XM_006713869 PREDICTED: Homo sapiens fibroblast growth factor receptor 3 (FGFR3), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu38316 XM_006713870 PREDICTED: Homo sapiens fibroblast growth factor receptor 3 (FGFR3), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu38317 XM_006713871 PREDICTED: Homo sapiens fibroblast growth factor receptor 3 (FGFR3), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu57769 XM_011513420 PREDICTED: Homo sapiens fibroblast growth factor receptor 3 (FGFR3), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu38318 XM_006713872 PREDICTED: Homo sapiens fibroblast growth factor receptor 3 (FGFR3), transcript variant X6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu38319 XM_006713873 PREDICTED: Homo sapiens fibroblast growth factor receptor 3 (FGFR3), transcript variant X7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
OHu57770 XM_011513422 PREDICTED: Homo sapiens fibroblast growth factor receptor 3 (FGFR3), transcript variant X8, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price
NM_000142 Homo sapiens fibroblast growth factor receptor 3 (FGFR3), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
Quote Price
OHu20724 NM_022965 Homo sapiens fibroblast growth factor receptor 3 (FGFR3), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 12-14 Quote Price

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu20813
Accession Version NM_001163213.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2427bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 01-AUG-2015
Organism Homo sapiens (human)
Product fibroblast growth factor receptor 3 isoform 3 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AB209441.1, AC016773.8, BC121175.2 and AW204106.1. This sequence is a reference standard in the RefSeqGene project. Summary: This gene encodes a member of the fibroblast growth factor receptor (FGFR) family, with its amino acid sequence being highly conserved between members and among divergent species. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds acidic and basic fibroblast growth hormone and plays a role in bone development and maintenance. Mutations in this gene lead to craniosynostosis and multiple types of skeletal dysplasia. Three alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Jul 2009]. Transcript Variant: This variant (3), also known as isoform IIIb, contains alternatively spliced exon 8 but lacks exon 9, compared to variant 1. The resulting protein (isoform 3) has the IIIb-type C-terminal half of the IgIII domain and is longer when it is compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMEA1968540, SAMEA1970526 [ECO:0000348] ##Evidence-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)413..586(+)
Misc Feature(2)425..586(+)
Misc Feature(3)737..991(+)
Misc Feature(4)743..757(+)
Misc Feature(5)746..781(+)
Misc Feature(6)764..961(+)
Misc Feature(7)1034..1321(+)
Misc Feature(8)1058..1324(+)
Misc Feature(9)1085..1282(+)
Misc Feature(10)1637..2638(+)
Misc Feature(11)1676..2506(+)
Misc Feature(12)1694..2167(+)
Exon (1)1..154
Gene Synonym:
Exon (2)155..365
Gene Synonym:
Exon (3)366..635
Gene Synonym:
Exon (4)636..701
Gene Synonym:
Exon (5)702..871
Gene Synonym:
Exon (6)872..995
Gene Synonym:
Exon (7)996..1186
Gene Synonym:
Exon (8)1187..1337
Gene Synonym:
Exon (9)1338..1528
Gene Synonym:
Exon (10)1529..1674
Gene Synonym:
Exon (11)1675..1796
Gene Synonym:
Exon (12)1797..1907
Gene Synonym:
Exon (13)1908..2098
Gene Synonym:
Exon (14)2099..2221
Gene Synonym:
Exon (15)2222..2292
Gene Synonym:
Exon (16)2293..2430
Gene Synonym:
Exon (17)2431..2536
Gene Synonym:
Exon (18)2537..4293
Gene Synonym:
Position Chain Variation Link
38 38 c, g dbSNP:17880408
121 121 c, t dbSNP:781380390
222 222 -, c dbSNP:35593071
243 243 c, t dbSNP:756458104
247 247 c, t dbSNP:777997357
262 262 c, t dbSNP:749527828
269 269 c, g dbSNP:771133929
277 277 c, t dbSNP:779195790
286 286 c, t dbSNP:556880169
294 294 c, t dbSNP:772001869
299 299 a, g dbSNP:573850631
316 316 a, c dbSNP:760457871
318 318 a, c dbSNP:587778351
324 324 a, g dbSNP:768338767
325 325 a, g, t dbSNP:776259575
328 328 a, c dbSNP:542572873
329 329 c, t dbSNP:749977192
331 331 a, g dbSNP:762402180
338 338 a, g dbSNP:768021369
343 343 c, g dbSNP:553265665
345 345 a, g dbSNP:756437064
346 346 c, t dbSNP:764622260
350 350 g, t dbSNP:754103775
361 361 a, g dbSNP:757606860
367 367 a, c dbSNP:747890000
372 372 c, t dbSNP:769591617
373 373 a, g dbSNP:376223299
375 375 c, g dbSNP:748963805
382 382 a, g dbSNP:770464815
383 383 c, t dbSNP:773786734
385 385 c, t dbSNP:761218109
386 386 a, g dbSNP:146080119
399 399 -, agt dbSNP:753444648
400 400 c, g dbSNP:777287621
401 401 c, g, t dbSNP:759325576
405 405 c, t dbSNP:765760358
406 406 c, t dbSNP:750641928
409 409 c, t dbSNP:763132475
410 410 a, g dbSNP:140087676
411 411 a, g dbSNP:751554185
414 414 c, g dbSNP:201433984
415 415 c, t dbSNP:143548893
416 416 a, g dbSNP:370940011
425 425 a, g dbSNP:61735064
428 428 a, g dbSNP:374561001
433 433 c, g dbSNP:373292806
436 436 c, t dbSNP:368789915
440 440 c, g, t dbSNP:533866031
441 441 c, t dbSNP:778645659
444 444 a, c, g, t dbSNP:371729802
445 445 a, c, g, t dbSNP:140377760
447 447 c, g dbSNP:763406515
448 448 c, t dbSNP:766462409
449 449 a, g dbSNP:2305178
452 452 a, g dbSNP:759546081
456 456 a, g dbSNP:369232922
457 457 c, t dbSNP:752621056
461 461 a, g dbSNP:373818958
469 469 c, g dbSNP:777597739
473 473 a, g dbSNP:753541863
481 481 c, t dbSNP:757084425
492 492 c, t dbSNP:778358980
507 507 c, t dbSNP:121913116
508 508 a, g dbSNP:367973461
523 523 a, g dbSNP:771692047
526 526 a, g, t dbSNP:779757540
528 528 c, t dbSNP:144995231
532 532 a, g dbSNP:773791381
533 533 c, t dbSNP:199968400
534 534 a, g dbSNP:771333357
544 544 a, g dbSNP:774553494
551 551 a, g dbSNP:759815430
555 555 c, g, t dbSNP:587778352
558 558 a, c dbSNP:80029045
559 559 c, t dbSNP:371715444
560 560 a, g dbSNP:558935109
568 568 c, t dbSNP:377018654
572 572 a, g dbSNP:369634049
573 573 a, c dbSNP:756994930
577 577 c, t dbSNP:368613176
585 585 a, g dbSNP:556916370
588 588 a, g dbSNP:750076470
591 591 a, g dbSNP:758163128
597 597 c, t dbSNP:779882318
599 599 c, g dbSNP:746468796
600 600 a, t dbSNP:587778769
603 603 a, g dbSNP:569221269
604 604 c, t dbSNP:2305179
605 605 a, g dbSNP:554790290
614 614 a, c dbSNP:771188160
621 621 a, g dbSNP:377198109
626 626 c, t dbSNP:199740841
627 627 a, g dbSNP:774749538
637 637 c, t dbSNP:762778478
638 638 a, g dbSNP:200300532
642 642 c, t dbSNP:751165912
645 645 c, t dbSNP:113172184
648 648 c, t dbSNP:766911583
649 649 a, g dbSNP:55662109
658 658 c, t dbSNP:199792768
659 659 a, g dbSNP:774962503
665 665 a, g dbSNP:750990333
672 672 a, c dbSNP:376268669
673 673 a, c, t dbSNP:3135867
674 674 a, c, g dbSNP:542749920
684 684 a, g dbSNP:781302593
687 687 c, g dbSNP:748192608
692 692 a, g dbSNP:770008395
695 695 c, g dbSNP:773269128
702 702 a, g dbSNP:749337219
703 703 g, t dbSNP:757414284
724 724 c, t dbSNP:778847955
729 729 a, g dbSNP:745863884
746 746 c, g dbSNP:577990843
757 757 a, g dbSNP:111455601
760 760 c, t dbSNP:543545800
769 769 c, t dbSNP:373209526
770 770 a, g dbSNP:529408918
780 780 a, g dbSNP:775241791
790 790 c, t dbSNP:567597726
791 791 a, g dbSNP:764712450
808 808 c, t dbSNP:774917626
811 811 a, c dbSNP:760000949
816 816 a, c dbSNP:767900565
829 829 c, t dbSNP:377492283
837 837 a, t dbSNP:756575558
844 844 c, t dbSNP:2305180
845 845 a, g dbSNP:754122254
853 853 c, t dbSNP:587778801
855 855 g, t dbSNP:587778353
859 859 c, t dbSNP:2305181
878 878 c, t dbSNP:769124009
886 886 a, g dbSNP:777091470
889 889 a, g dbSNP:369033272
895 895 a, g dbSNP:138707520
903 903 a, g dbSNP:750672389
907 907 c, t dbSNP:762931501
909 909 c, t dbSNP:766513208
910 910 c, g dbSNP:147769045
916 916 a, c, t dbSNP:146927248
918 918 c, t dbSNP:752393208
919 919 a, g dbSNP:114421370
922 922 c, t dbSNP:201081464
925 925 c, t dbSNP:749024125
928 928 c, t dbSNP:756820432
934 934 c, t dbSNP:141575580
937 937 c, t dbSNP:745397432
940 940 c, t dbSNP:769248723
941 941 a, c, g dbSNP:368831528
946 946 a, g dbSNP:371766123
956 956 c, t dbSNP:773302522
963 963 a, g dbSNP:200495316
968 968 c, t dbSNP:766423062
969 969 a, g dbSNP:199944818
975 975 c, t dbSNP:759641808
976 976 a, g dbSNP:369366713
980 980 a, g dbSNP:767373970
981 981 c, t dbSNP:150916178
983 983 c, t dbSNP:755846153
988 988 c, t dbSNP:764012522
995 995 a, g dbSNP:565612580
997 997 a, g dbSNP:775684769
998 998 c, t dbSNP:121913482
1002 1002 c, g, t dbSNP:121913483
1004 1004 a, c dbSNP:373470718
1005 1005 c, g dbSNP:4647924
1006 1006 a, g dbSNP:761691291
1009 1009 c, g dbSNP:377554120
1011 1011 g, t dbSNP:750072225
1024 1024 g, t dbSNP:587778354
1027 1027 a, g dbSNP:138334098
1031 1031 c, t dbSNP:765971064
1035 1035 c, t dbSNP:751038752
1036 1036 a, g dbSNP:754448711
1046 1046 a, t dbSNP:778283906
1047 1047 c, t dbSNP:587778773
1048 1048 a, g dbSNP:754400359
1049 1049 a, g dbSNP:151254213
1050 1050 c, t dbSNP:779284979
1055 1055 c, t dbSNP:746064816
1057 1057 g, t dbSNP:587778811
1063 1063 c, t dbSNP:199614237
1064 1064 a, g dbSNP:780147591
1066 1066 c, t dbSNP:142910057
1077 1077 a, t dbSNP:768680057
1084 1084 -, g dbSNP:748608773
1089 1089 a, g dbSNP:121913115
1091 1091 a, t dbSNP:121913114
1096 1096 c, t dbSNP:776706695
1102 1102 c, g dbSNP:761883478
1103 1103 a, c dbSNP:769692611
1104 1104 c, t dbSNP:773094879
1105 1105 c, t dbSNP:762686049
1106 1106 -, c dbSNP:587776836
1109 1109 a, g dbSNP:765988008
1111 1111 c, t dbSNP:751184462
1120 1120 c, t dbSNP:146127079
1126 1126 c, t dbSNP:370518637
1129 1129 a, g dbSNP:553636095
1132 1132 a, g dbSNP:754308484
1135 1135 c, g dbSNP:757808716
1138 1138 c, t dbSNP:2234909
1141 1141 c, t dbSNP:375181682
1144 1144 c, t dbSNP:758705287
1155 1155 c, t dbSNP:780313125
1156 1156 a, g dbSNP:143723106
1159 1159 c, g, t dbSNP:377588489
1160 1160 a, g dbSNP:748261686
1161 1161 a, g dbSNP:371176140
1168 1168 c, g dbSNP:201012537
1171 1171 c, g, t dbSNP:144675978
1172 1172 a, g dbSNP:774047997
1177 1177 c, g, t dbSNP:148518372
1178 1178 a, g dbSNP:774929566
1184 1184 a, g dbSNP:760206152
1188 1188 a, c dbSNP:774934127
1189 1189 c, t dbSNP:759963900
1205 1205 g, t dbSNP:768061470
1212 1212 a, c dbSNP:752936320
1213 1213 c, t dbSNP:3135882
1214 1214 a, g dbSNP:368717324
1217 1217 a, c, g dbSNP:764395593
1220 1220 c, t dbSNP:757360105
1221 1221 a, g dbSNP:778706131
1227 1227 a, g dbSNP:750429622
1231 1231 a, g dbSNP:758162587
1233 1233 c, t dbSNP:751042118
1242 1242 c, t dbSNP:746829612
1243 1243 a, g dbSNP:538448784
1248 1248 a, g dbSNP:371310275
1252 1252 a, c, t dbSNP:555252952
1258 1258 c, t dbSNP:774715658
1259 1259 a, g dbSNP:746415876
1261 1261 a, g dbSNP:772542563
1264 1264 c, t dbSNP:374820397
1267 1267 c, t dbSNP:748962493
1272 1272 a, g dbSNP:761148037
1273 1273 a, t dbSNP:764152875
1276 1276 c, t dbSNP:776922453
1282 1282 c, t dbSNP:768126130
1286 1286 a, g dbSNP:761797267
1291 1291 c, t dbSNP:765402176
1292 1292 a, g dbSNP:750343506
1297 1297 c, t dbSNP:146818438
1298 1298 a, g dbSNP:575229727
1313 1313 c, g dbSNP:766336805
1318 1318 c, t dbSNP:751289792
1319 1319 a, g dbSNP:754817667
1324 1324 c, t dbSNP:780694351
1325 1325 c, g dbSNP:747899858
1328 1328 -, c dbSNP:770485772
1331 1331 c, g, t dbSNP:755547723
1332 1332 a, g dbSNP:542612709
1339 1339 c, t dbSNP:753880713
1340 1340 a, c, g dbSNP:757013992
1344 1344 a, c dbSNP:745683500
1355 1355 a, g dbSNP:757980849
1363 1363 c, g, t dbSNP:779695832
1364 1364 a, g dbSNP:201136923
1365 1365 a, c dbSNP:773566065
1366 1366 a, g dbSNP:749860116
1368 1368 c, t dbSNP:146970233
1369 1369 a, g dbSNP:774814331
1370 1370 g, t dbSNP:121913479
1373 1373 a, t dbSNP:121913484
1374 1374 c, g dbSNP:759980266
1380 1380 a, g dbSNP:121913485
1385 1385 g, t dbSNP:75790268
1389 1389 a, c, t dbSNP:767787097
1390 1390 c, t dbSNP:760665672
1391 1391 c, t dbSNP:764273223
1392 1392 g, t dbSNP:267606809
1399 1399 c, t dbSNP:137896792
1400 1400 a, c, g dbSNP:28931614
1403 1403 a, g dbSNP:149023204
1404 1404 a, t dbSNP:587778776
1407 1407 c, g dbSNP:750161905
1408 1408 c, t dbSNP:762689187
1410 1410 g, t dbSNP:11943863
1412 1412 a, c, t dbSNP:17881656
1415 1415 c, t dbSNP:200186825
1421 1421 a, t dbSNP:774204416
1424 1424 -, tgg dbSNP:772334224
1434 1434 a, c dbSNP:28931615
1435 1435 a, g dbSNP:148157107
1443 1443 c, t dbSNP:747694886
1444 1444 a, g, t dbSNP:771495510
1447 1447 c, t dbSNP:746217459
1451 1451 c, t dbSNP:576428377
1452 1452 a, g, t dbSNP:542210035
1453 1453 c, t dbSNP:764242973
1457 1457 c, t dbSNP:370064407
1458 1458 a, g dbSNP:761896295
1460 1460 a, g dbSNP:373034495
1461 1461 -, c dbSNP:775260779
1462 1462 -, c dbSNP:760502257
1462 1462 c, t dbSNP:750427482
1463 1463 a, c, g, t dbSNP:762705505
1465 1465 a, c dbSNP:754621427
1466 1466 a, c dbSNP:374947075
1467 1467 a, c, g dbSNP:752194597
1468 1468 a, c dbSNP:779554720
1469 1469 a, g dbSNP:373640210
1470 1470 a, g dbSNP:772301946
1471 1471 a, g dbSNP:151306939
1472 1472 a, g dbSNP:780415133
1473 1473 a, g dbSNP:747363570
1475 1475 g, t dbSNP:768867257
1476 1476 a, g dbSNP:201813356
1478 1478 c, g dbSNP:201751659
1480 1480 c, g dbSNP:187314275
1485 1485 c, t dbSNP:761877926
1486 1486 c, g, t dbSNP:769903615
1489 1489 a, c, t dbSNP:533316478
1490 1490 a, t dbSNP:751304574
1493 1493 a, g, t dbSNP:759057257
1497 1497 a, c dbSNP:752460284
1498 1498 c, t dbSNP:755650149
1499 1499 a, c dbSNP:375687485
1500 1500 a, g dbSNP:767109009
1501 1501 a, c, g dbSNP:140898926
1502 1502 a, g dbSNP:780428794
1504 1504 c, t dbSNP:143094785
1508 1508 c, t dbSNP:146114742
1515 1515 c, t dbSNP:781361431
1516 1516 a, g dbSNP:748419731
1517 1517 c, t dbSNP:770029887
1518 1518 c, t dbSNP:773239816
1521 1521 a, g dbSNP:762949938
1522 1522 g, t dbSNP:369368608
1524 1524 a, g dbSNP:587778355
1534 1534 c, t dbSNP:756532045
1536 1536 g, t dbSNP:777965130
1543 1543 c, t dbSNP:763188060
1545 1545 a, g dbSNP:138986264
1547 1547 a, g dbSNP:182935140
1549 1549 a, g dbSNP:187229103
1552 1552 c, t dbSNP:3135891
1562 1562 a, c dbSNP:772065909
1567 1567 a, g dbSNP:3135892
1569 1569 c, t dbSNP:142030909
1576 1576 a, g dbSNP:746797777
1577 1577 c, g dbSNP:749083353
1578 1578 a, g dbSNP:529493162
1582 1582 c, t dbSNP:190111780
1583 1583 a, g dbSNP:17884368
1593 1593 c, t dbSNP:761325047
1594 1594 c, t dbSNP:769521432
1601 1601 -, g dbSNP:35317612
1607 1607 c, t dbSNP:61735104
1611 1611 c, t dbSNP:56240927
1613 1613 a, c dbSNP:547391969
1616 1616 c, g, t dbSNP:3135893
1618 1618 a, c dbSNP:149555011
1625 1625 g, t dbSNP:144242294
1627 1627 c, t dbSNP:376488233
1633 1633 c, t dbSNP:199758988
1641 1641 c, t dbSNP:764488842
1646 1646 a, g dbSNP:771872811
1673 1673 c, g, t dbSNP:533045918
1681 1681 c, t dbSNP:747886434
1702 1702 g, t dbSNP:200780581
1704 1704 a, g dbSNP:769701323
1705 1705 c, t dbSNP:777256634
1711 1711 c, t dbSNP:545617229
1716 1716 a, g dbSNP:267606808
1717 1717 a, g dbSNP:377021699
1729 1729 c, g dbSNP:773808293
1736 1736 a, g dbSNP:745385417
1738 1738 c, t dbSNP:373254179
1739 1739 a, g dbSNP:777253325
1743 1743 c, t dbSNP:762079212
1748 1748 a, g dbSNP:587778359
1754 1754 c, t dbSNP:773735098
1756 1756 g, t dbSNP:763229229
1757 1757 c, g dbSNP:370646097
1759 1759 c, t dbSNP:140594137
1760 1760 a, g dbSNP:751635116
1761 1761 c, t dbSNP:755145822
1766 1766 a, c dbSNP:767356787
1770 1770 c, t dbSNP:752724806
1774 1774 c, t dbSNP:755839585
1775 1775 a, g dbSNP:144546453
1780 1780 c, t dbSNP:147823561
1786 1786 a, g dbSNP:756833829
1796 1796 a, g dbSNP:778548356
1798 1798 c, t dbSNP:754606269
1799 1799 a, g dbSNP:121913112
1800 1800 a, g dbSNP:749863914
1803 1803 c, g dbSNP:771583472
1808 1808 c, g, t dbSNP:779377617
1809 1809 a, c dbSNP:772276122
1811 1811 a, g dbSNP:560351992
1812 1812 a, g dbSNP:139707740
1813 1813 a, g dbSNP:142622642
1821 1821 c, t dbSNP:587778356
1822 1822 a, g, t dbSNP:776527776
1829 1829 c, g dbSNP:765164423
1830 1830 c, t dbSNP:750175353
1834 1834 c, t dbSNP:150945966
1838 1838 a, g dbSNP:766053734
1840 1840 a, g dbSNP:751213196
1847 1847 a, t dbSNP:754516664
1854 1854 c, t dbSNP:767090421
1858 1858 c, t dbSNP:528979086
1864 1864 a, g dbSNP:548830740
1874 1874 a, g dbSNP:80053154
1879 1879 c, t dbSNP:746228140
1881 1881 a, c, g dbSNP:77722678
1882 1882 a, c, g, t dbSNP:28933068
1883 1883 c, t dbSNP:747280749
1885 1885 a, c, g dbSNP:768897749
1886 1886 c, t dbSNP:748241961
1891 1891 c, g, t dbSNP:61735103
1892 1892 g, t dbSNP:762781471
1900 1900 a, g, t dbSNP:766139511
1906 1906 c, t dbSNP:756321317
1909 1909 c, g, t dbSNP:3135897
1912 1912 c, t dbSNP:749387483
1918 1918 c, t dbSNP:150083071
1919 1919 a, g, t dbSNP:199544087
1933 1933 c, t dbSNP:370408732
1936 1936 a, g, t dbSNP:557734169
1937 1937 c, g dbSNP:768385286
1938 1938 c, t dbSNP:775946807
1948 1948 c, t dbSNP:761445231
1949 1949 c, t dbSNP:766793731
1951 1951 a, g dbSNP:199779110
1961 1961 c, g dbSNP:759874872
1963 1963 c, g dbSNP:372367824
1965 1965 g, t dbSNP:753095502
1968 1968 c, t dbSNP:146672976
1969 1969 a, g dbSNP:778065218
1973 1973 a, c dbSNP:753846438
1976 1976 c, g, t dbSNP:757421718
1977 1977 c, t dbSNP:377141691
1980 1980 c, t dbSNP:745848425
1981 1981 a, g dbSNP:772157613
1984 1984 a, c dbSNP:538859353
1986 1986 c, t dbSNP:746824967
1987 1987 a, g dbSNP:141422828
1988 1988 g, t dbSNP:752311470
1996 1996 -, ctt dbSNP:778027676
1999 1999 c, t dbSNP:200589145
2000 2000 a, g dbSNP:761196249
2010 2010 a, g, t dbSNP:769341070
2012 2012 c, g dbSNP:759993319
2013 2013 c, t dbSNP:145183329
2014 2014 a, g dbSNP:139020690
2015 2015 c, t dbSNP:761163163
2017 2017 c, t dbSNP:764220677
2018 2018 a, g dbSNP:576023546
2020 2020 a, g dbSNP:757264596
2026 2026 a, g dbSNP:765360194
2027 2027 c, g dbSNP:587778357
2032 2032 c, g, t dbSNP:373391057
2033 2033 a, t dbSNP:746774947
2034 2034 g, t dbSNP:754840234
2035 2035 c, g, t dbSNP:780684393
2038 2038 a, g dbSNP:769464095
2041 2041 c, t dbSNP:772639573
2042 2042 c, t dbSNP:748806066
2051 2051 g, t dbSNP:772558079
2054 2054 a, g dbSNP:544955705
2056 2056 c, g dbSNP:760919924
2058 2058 a, t dbSNP:764571446
2079 2079 a, g dbSNP:776884460
2083 2083 c, t dbSNP:370203006
2088 2088 c, t dbSNP:142093553
2089 2089 c, g dbSNP:750472969
2092 2092 c, g dbSNP:758618182
2107 2107 c, t dbSNP:375856533
2113 2113 c, t dbSNP:777376852
2118 2118 c, g dbSNP:753541491
2122 2122 c, t dbSNP:756928026
2124 2124 a, g dbSNP:121913113
2138 2138 a, t dbSNP:778449048
2140 2140 c, t dbSNP:369137031
2141 2141 a, g dbSNP:200849753
2149 2149 c, t dbSNP:104886004
2161 2161 c, t dbSNP:748492424
2163 2163 c, g dbSNP:573600072
2170 2170 c, g dbSNP:104886005
2176 2176 a, g dbSNP:773733049
2185 2185 c, t dbSNP:148104605
2186 2186 a, g dbSNP:771059356
2191 2191 c, t dbSNP:774427767
2194 2194 c, t dbSNP:768341676
2197 2197 c, t dbSNP:104886006
2200 2200 c, t dbSNP:767489382
2205 2205 a, g dbSNP:587779383
2207 2207 -, aag dbSNP:746013747
2209 2209 a, g dbSNP:752674541
2210 2210 a, c, g dbSNP:78311289
2211 2211 a, c, t dbSNP:121913105
2212 2212 c, g, t dbSNP:28928868
2215 2215 a, g dbSNP:7688609
2217 2217 c, g dbSNP:753665954
2221 2221 c, g, t dbSNP:150609697
2227 2227 a, g dbSNP:772373970
2230 2230 a, g dbSNP:368518454
2246 2246 c, g dbSNP:773652498
2248 2248 a, g, t dbSNP:371563013
2254 2254 a, g dbSNP:761645676
2255 2255 g, t dbSNP:764892330
2268 2268 a, g dbSNP:773089715
2275 2275 c, t dbSNP:762445233
2279 2279 c, t dbSNP:747364567
2281 2281 a, c dbSNP:751098892
2287 2287 c, t dbSNP:200980490
2290 2290 c, t dbSNP:754598297
2297 2297 g, t dbSNP:769602256
2305 2305 a, g dbSNP:17883356
2308 2308 a, c dbSNP:771479750
2311 2311 c, g, t dbSNP:371884239
2321 2321 a, g dbSNP:759229319
2323 2323 c, t dbSNP:771762959
2329 2329 a, g dbSNP:200872971
2340 2340 c, t dbSNP:760292339
2344 2344 a, g dbSNP:765659195
2350 2350 c, t dbSNP:142884145
2351 2351 g, t dbSNP:121913480
2359 2359 c, t dbSNP:763282024
2365 2365 -, gg dbSNP:769688023
2367 2367 -, tt dbSNP:772822445
2374 2374 a, c dbSNP:376497115
2376 2376 a, g dbSNP:369813768
2387 2387 a, g dbSNP:755495007
2388 2388 a, g dbSNP:755133781
2391 2391 g, t dbSNP:104886023
2397 2397 a, g dbSNP:104886024
2407 2407 a, g dbSNP:781534447
2410 2410 c, g, t dbSNP:373967853
2411 2411 a, g dbSNP:17882190
2412 2412 c, t dbSNP:749192018
2414 2414 a, g dbSNP:587778358
2415 2415 a, g dbSNP:139773438
2419 2419 a, c dbSNP:745674688
2425 2425 c, g, t dbSNP:371088132
2437 2437 a, g dbSNP:377402598
2438 2438 a, t dbSNP:17880763
2445 2445 a, g dbSNP:149924317
2461 2461 c, t dbSNP:569462075
2462 2462 a, g dbSNP:188849608
2463 2463 c, t dbSNP:555257146
2467 2467 c, g dbSNP:145020302
2469 2469 a, c dbSNP:148631462
2472 2472 a, c dbSNP:536212792
2476 2476 a, g dbSNP:200624062
2479 2479 c, g dbSNP:377293519
2482 2482 c, t dbSNP:761006469
2484 2484 g, t dbSNP:768999235
2486 2486 a, c dbSNP:777034307
2503 2503 c, t dbSNP:142137666
2506 2506 a, g dbSNP:368790668
2510 2510 c, t dbSNP:750501941
2511 2511 a, g dbSNP:762888506
2512 2512 c, t dbSNP:375310360
2515 2515 c, t dbSNP:751365581
2521 2521 c, t dbSNP:146662137
2522 2522 a, g dbSNP:373425119
2526 2526 c, t dbSNP:752294041
2527 2527 a, c, g dbSNP:755791719
2532 2532 c, g dbSNP:748763892
2533 2533 c, t dbSNP:772623020
2534 2534 a, g dbSNP:56266857
2536 2536 c, g, t dbSNP:747369218
2549 2549 c, g dbSNP:774517056
2553 2553 c, t dbSNP:759398915
2554 2554 a, g, t dbSNP:767453505
2556 2556 c, t dbSNP:140211846
2559 2559 c, t dbSNP:763774428
2563 2563 c, t dbSNP:540549001
2564 2564 a, g dbSNP:560280646
2571 2571 a, g dbSNP:764614806
2572 2572 c, g dbSNP:367757357
2574 2574 c, g, t dbSNP:755526507
2576 2576 c, g dbSNP:748492376
2577 2577 a, c, t dbSNP:756484252
2578 2578 a, g, t dbSNP:200629304
2580 2580 a, c, g dbSNP:773197447
2588 2588 g, t dbSNP:771994959
2592 2592 a, c, t dbSNP:775451126
2593 2593 c, t dbSNP:189264142
2599 2599 c, t dbSNP:776520979
2601 2601 c, g dbSNP:140616343
2604 2604 a, g dbSNP:764958279
2611 2611 -, ag dbSNP:759113408
2611 2611 a, c dbSNP:749947486
2612 2612 a, g dbSNP:531915147
2615 2615 g, t dbSNP:768114770
2617 2617 c, t dbSNP:753206367
2618 2618 a, g, t dbSNP:548817695
2623 2623 c, t dbSNP:754239704
2624 2624 a, g dbSNP:371433215
2632 2632 c, g dbSNP:138078624
2635 2635 a, c, t dbSNP:576131994
2636 2636 a, g dbSNP:376043260
2642 2642 a, c dbSNP:772193113
2643 2643 ga, t dbSNP:121913481
2647 2647 c, t dbSNP:369424084
2648 2648 c, t dbSNP:746909556
2649 2649 c, g, t dbSNP:768644781
2650 2650 a, c, g dbSNP:761733326
2658 2658 c, t dbSNP:150452037
2659 2659 a, c, t dbSNP:372401311
2673 2673 c, t dbSNP:751115449
2674 2674 a, g dbSNP:375563964
2675 2675 c, t dbSNP:369758941
2676 2676 a, g dbSNP:754152095
2679 2679 c, t dbSNP:374547489
2680 2680 a, g dbSNP:779088139
2681 2681 a, c, g, t dbSNP:121913101
2682 2682 g, t dbSNP:397515514
2683 2683 a, c, g, t dbSNP:121913103
2688 2688 c, g dbSNP:17879364
2695 2695 c, t dbSNP:758650628
2697 2697 c, g, t dbSNP:149119664
2700 2700 a, c dbSNP:747126217
2701 2701 a, c, g dbSNP:768467199
2704 2704 -, tg dbSNP:764459020
2705 2705 c, t dbSNP:747872029
2706 2706 a, g dbSNP:143130353
2713 2713 a, g dbSNP:769662278
2715 2715 c, g dbSNP:148257939
2719 2719 a, g dbSNP:3135900
2721 2721 c, t dbSNP:748878733
2727 2727 a, c dbSNP:770716902
2730 2730 c, t dbSNP:773982546
2736 2736 c, t dbSNP:147471896
2738 2738 a, g dbSNP:759149879
2743 2743 a, c, g dbSNP:375248814
2744 2744 c, t dbSNP:777247381
2746 2746 a, g dbSNP:538257316
2747 2747 a, c dbSNP:138412839
2748 2748 c, g dbSNP:765546868
2749 2749 a, c dbSNP:558185092
2754 2754 c, t dbSNP:758559632
2755 2755 c, t dbSNP:766648143
2759 2759 a, g dbSNP:143797885
2767 2767 c, t dbSNP:565001558
2768 2768 a, g dbSNP:751560318
2777 2777 g, t dbSNP:575008984
2778 2778 a, g dbSNP:537582388
2782 2782 a, g dbSNP:781152611
2787 2787 a, c dbSNP:150623219
2799 2799 c, t dbSNP:139961981
2800 2800 -, t dbSNP:35582695
2804 2804 -, tg dbSNP:757773888
2804 2804 c, g dbSNP:748078057
2805 2805 -, tgtgtgtgtgtgtgtgcgtg dbSNP:758422706
2805 2805 -, tgtgtgtgtgtg dbSNP:750480041
2805 2805 -, tgtg dbSNP:779435521
2805 2805 -, tg dbSNP:754209375
2811 2811 -, gc dbSNP:780114078
2814 2814 -, gtgtgtgc dbSNP:747197773
2814 2814 a, g dbSNP:756121492
2815 2815 c, t dbSNP:149863736
2816 2816 -, gtgtgc dbSNP:768819011
2817 2817 c, t dbSNP:78260022
2818 2818 -, gtgc dbSNP:781036706
2819 2819 c, t dbSNP:574622446
2820 2820 -, gc dbSNP:747937861
2821 2821 -, gt dbSNP:770496031
2821 2821 c, t dbSNP:73202816
2822 2822 -, gtgtgtgtgtgt dbSNP:774008828
2822 2822 -, gtgtgt dbSNP:763019421
2822 2822 -, gtgt dbSNP:776445794
2822 2822 -, gt dbSNP:34562534
2823 2823 -, gtgtgtgtgtgtgtgc, tg dbSNP:34003391
2823 2823 c, t dbSNP:777922470
2825 2825 c, t dbSNP:774095140
2830 2830 a, g dbSNP:745351152
2837 2837 c, t dbSNP:771564788
2839 2839 -, gc, tg dbSNP:397821865
2839 2839 c, t dbSNP:774898004
2848 2848 a, g dbSNP:112613951
2849 2849 c, t dbSNP:765747483
2850 2850 a, g dbSNP:745704841
2856 2856 c, t dbSNP:773554802
2863 2863 c, t dbSNP:758061231
2867 2867 c, t dbSNP:3135901
2868 2868 a, g dbSNP:577261362
2876 2876 c, t dbSNP:766564331
2880 2880 a, c dbSNP:751754704
2881 2881 a, g dbSNP:139656072
2885 2885 a, g dbSNP:3135902
2887 2887 -, ag dbSNP:541119317
2894 2894 c, g dbSNP:146843671
2896 2896 c, g dbSNP:17884965
2904 2904 c, g dbSNP:756103476
2906 2906 c, t dbSNP:777921453
2907 2907 c, t dbSNP:749058497
2908 2908 g, t dbSNP:768684592
2910 2910 c, t dbSNP:778598106
2914 2914 a, c, g dbSNP:745496661
2920 2920 c, t dbSNP:548694307
2921 2921 a, c, g dbSNP:746580452
2922 2922 c, g dbSNP:146686766
2930 2930 a, c dbSNP:562140611
2933 2933 c, g, t dbSNP:763472649
2939 2939 a, g dbSNP:774583097
2942 2942 a, g dbSNP:759742370
2947 2947 a, g dbSNP:776334107
2950 2950 c, g dbSNP:752814871
2952 2952 -, g dbSNP:36110512
2953 2953 c, t dbSNP:140307141
2961 2961 c, g dbSNP:764103109
2962 2962 -, g dbSNP:765610441
2963 2963 a, g dbSNP:753781260
2967 2967 a, g dbSNP:142499367
2970 2970 c, t dbSNP:17882030
2973 2973 a, g dbSNP:750202398
2981 2981 -, tgtaagt dbSNP:758920556
2982 2982 c, t dbSNP:758059842
2991 2991 c, g dbSNP:547734987
2996 2996 c, g dbSNP:746494257
2998 2998 c, t dbSNP:768103837
2999 2999 a, g dbSNP:780708053
3003 3003 a, g dbSNP:150943855
3004 3004 c, g dbSNP:140878423
3006 3006 c, t dbSNP:376272599
3009 3009 a, c dbSNP:774764362
3010 3010 c, t dbSNP:570813728
3024 3024 a, c, t dbSNP:150156689
3028 3028 c, g dbSNP:138933598
3031 3031 c, t dbSNP:775902246
3032 3032 a, g dbSNP:761002580
3041 3041 c, t dbSNP:764231473
3042 3042 c, t dbSNP:370938444
3043 3043 a, g, t dbSNP:17881782
3045 3045 c, t dbSNP:141307773
3046 3046 c, t dbSNP:750232146
3050 3050 -, g dbSNP:766435200
3051 3051 c, t dbSNP:146988530
3052 3052 c, t dbSNP:758169923
3062 3062 c, t dbSNP:779919338
3063 3063 a, g dbSNP:751169261
3064 3064 a, g dbSNP:138377208
3067 3067 c, t dbSNP:149595424
3072 3072 a, c, t dbSNP:551739335
3073 3073 a, g dbSNP:747714203
3081 3081 c, t dbSNP:144231750
3082 3082 c, t dbSNP:757777764
3084 3084 c, t dbSNP:373601917
3086 3086 -, g dbSNP:34288608
3089 3089 c, t dbSNP:148309209
3090 3090 c, t dbSNP:746219955
3094 3094 c, t dbSNP:772277557
3096 3096 a, c dbSNP:776031013
3097 3097 a, g dbSNP:747163554
3099 3099 c, t dbSNP:141419414
3100 3100 c, g dbSNP:200015882
3104 3104 a, g, t dbSNP:150892094
3106 3106 c, t dbSNP:761868905
3109 3109 a, g dbSNP:765193733
3110 3110 c, t dbSNP:139770971
3114 3114 a, c dbSNP:773074995
3118 3118 a, g dbSNP:142940849
3121 3121 a, g dbSNP:146131833
3132 3132 c, t dbSNP:762976265
3135 3135 a, g, t dbSNP:367689136
3146 3146 -, c dbSNP:34583865
3148 3148 -, g dbSNP:751657062
3149 3149 a, g, t dbSNP:751365286
3150 3150 g, t dbSNP:139197142
3151 3151 a, g dbSNP:767224419
3165 3165 a, g dbSNP:574504441
3181 3181 a, g dbSNP:17880626
3203 3203 c, t dbSNP:144268232
3204 3204 c, t dbSNP:759466924
3205 3205 c, g dbSNP:3135903
3212 3212 a, g dbSNP:530215149
3221 3221 a, t dbSNP:149915836
3229 3229 c, t dbSNP:577227997
3250 3250 c, t dbSNP:17878568
3286 3286 a, g dbSNP:562851497
3303 3303 c, g dbSNP:760073016
3305 3305 a, g dbSNP:184903110
3311 3311 a, g dbSNP:541948785
3328 3328 -, a dbSNP:775234937
3335 3335 a, t dbSNP:562221192
3339 3339 -, at dbSNP:550148323
3341 3341 a, g dbSNP:767989545
3343 3343 -, at dbSNP:17878315
3359 3359 c, t dbSNP:144953313
3368 3368 c, t dbSNP:548487199
3383 3383 -, c, t dbSNP:34750071
3383 3383 -, c dbSNP:35222799
3389 3389 a, g dbSNP:752796817
3400 3400 a, g dbSNP:527836723
3414 3414 c, g dbSNP:148600108
3423 3423 -, g dbSNP:571651117
3425 3425 a, g dbSNP:113572688
3429 3429 g, t dbSNP:551428212
3430 3430 c, t dbSNP:560249836
3481 3481 c, t dbSNP:3135904
3535 3535 a, g dbSNP:764379572
3539 3539 a, g dbSNP:754066531
3546 3546 c, t dbSNP:189748716
3547 3547 c, t dbSNP:763717776
3567 3567 c, t dbSNP:376155579
3588 3588 g, t dbSNP:376062760
3597 3597 a, g dbSNP:180944260
3601 3601 c, t dbSNP:185946582
3614 3614 -, t dbSNP:139431979
3645 3645 c, t dbSNP:199807707
3663 3663 a, g dbSNP:757651823
3690 3690 c, t dbSNP:779754240
3691 3691 a, g dbSNP:781573474
3705 3705 c, t dbSNP:568504092
3721 3721 g, t dbSNP:537854144
3724 3724 c, t dbSNP:191993060
3797 3797 a, g dbSNP:17883581
3798 3798 c, t dbSNP:746376439
3811 3811 g, t dbSNP:546526332
3816 3816 a, g dbSNP:552245062
3855 3855 c, t dbSNP:754991883
3914 3914 a, g dbSNP:756578124
3921 3921 c, t dbSNP:781240258
3968 3968 c, t dbSNP:533715128
3972 3972 -, tata dbSNP:17882393
3986 3986 c, g, t dbSNP:370751685
4017 4017 c, t dbSNP:570690371
4026 4026 c, t dbSNP:539744295
4044 4044 c, t dbSNP:2121456
4085 4085 c, t dbSNP:556538642
4091 4091 g, t dbSNP:76953537
4092 4092 g, t dbSNP:78424000
4093 4093 c, g dbSNP:74995745
4098 4098 g, t dbSNP:769375190
4102 4102 c, t dbSNP:758331417
4103 4103 a, g dbSNP:181727722
4117 4117 c, t dbSNP:570813958
4131 4131 c, t dbSNP:542211235
4159 4159 g, t dbSNP:555552048
4162 4162 c, t dbSNP:4647929
4169 4169 c, t dbSNP:572485456
4216 4216 a, g dbSNP:541193957
4250 4250 c, t dbSNP:564336183

Target ORF information:

RefSeq Version NM_001163213
Organism Homo sapiens (human)
Definition Homo sapiens fibroblast growth factor receptor 3 (FGFR3), transcript variant 3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu38314
Accession Version XM_006713868.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2436bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product fibroblast growth factor receptor 3 isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_006051.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)426..599(+)
Misc Feature(2)438..599(+)
Misc Feature(3)750..1004(+)
Misc Feature(4)756..770(+)
Misc Feature(5)759..794(+)
Misc Feature(6)777..974(+)
Misc Feature(7)1047..1334(+)
Misc Feature(8)1071..1337(+)
Misc Feature(9)1098..1295(+)
Misc Feature(10)1656..2660(+)
Misc Feature(11)1695..2525(+)
Misc Feature(12)1713..2186(+)
Position Chain Variation Link
51 51 c, g dbSNP:17880408
134 134 c, t dbSNP:781380390
235 235 -, c dbSNP:35593071
256 256 c, t dbSNP:756458104
260 260 c, t dbSNP:777997357
275 275 c, t dbSNP:749527828
282 282 c, g dbSNP:771133929
290 290 c, t dbSNP:779195790
299 299 c, t dbSNP:556880169
307 307 c, t dbSNP:772001869
312 312 a, g dbSNP:573850631
329 329 a, c dbSNP:760457871
331 331 a, c dbSNP:587778351
337 337 a, g dbSNP:768338767
338 338 a, g, t dbSNP:776259575
341 341 a, c dbSNP:542572873
342 342 c, t dbSNP:749977192
344 344 a, g dbSNP:762402180
351 351 a, g dbSNP:768021369
356 356 c, g dbSNP:553265665
358 358 a, g dbSNP:756437064
359 359 c, t dbSNP:764622260
363 363 g, t dbSNP:754103775
374 374 a, g dbSNP:757606860
380 380 a, c dbSNP:747890000
385 385 c, t dbSNP:769591617
386 386 a, g dbSNP:376223299
388 388 c, g dbSNP:748963805
395 395 a, g dbSNP:770464815
396 396 c, t dbSNP:773786734
398 398 c, t dbSNP:761218109
399 399 a, g dbSNP:146080119
412 412 -, agt dbSNP:753444648
413 413 c, g dbSNP:777287621
414 414 c, g, t dbSNP:759325576
418 418 c, t dbSNP:765760358
419 419 c, t dbSNP:750641928
422 422 c, t dbSNP:763132475
423 423 a, g dbSNP:140087676
424 424 a, g dbSNP:751554185
427 427 c, g dbSNP:201433984
428 428 c, t dbSNP:143548893
429 429 a, g dbSNP:370940011
438 438 a, g dbSNP:61735064
441 441 a, g dbSNP:374561001
446 446 c, g dbSNP:373292806
449 449 c, t dbSNP:368789915
453 453 c, g, t dbSNP:533866031
454 454 c, t dbSNP:778645659
457 457 a, c, g, t dbSNP:371729802
458 458 a, c, g, t dbSNP:140377760
460 460 c, g dbSNP:763406515
461 461 c, t dbSNP:766462409
462 462 a, g dbSNP:2305178
465 465 a, g dbSNP:759546081
469 469 a, g dbSNP:369232922
470 470 c, t dbSNP:752621056
474 474 a, g dbSNP:373818958
482 482 c, g dbSNP:777597739
486 486 a, g dbSNP:753541863
494 494 c, t dbSNP:757084425
505 505 c, t dbSNP:778358980
520 520 c, t dbSNP:121913116
521 521 a, g dbSNP:367973461
536 536 a, g dbSNP:771692047
539 539 a, g, t dbSNP:779757540
541 541 c, t dbSNP:144995231
545 545 a, g dbSNP:773791381
546 546 c, t dbSNP:199968400
547 547 a, g dbSNP:771333357
557 557 a, g dbSNP:774553494
564 564 a, g dbSNP:759815430
568 568 c, g, t dbSNP:587778352
571 571 a, c dbSNP:80029045
572 572 c, t dbSNP:371715444
573 573 a, g dbSNP:558935109
581 581 c, t dbSNP:377018654
585 585 a, g dbSNP:369634049
586 586 a, c dbSNP:756994930
590 590 c, t dbSNP:368613176
598 598 a, g dbSNP:556916370
601 601 a, g dbSNP:750076470
604 604 a, g dbSNP:758163128
610 610 c, t dbSNP:779882318
612 612 c, g dbSNP:746468796
613 613 a, t dbSNP:587778769
616 616 a, g dbSNP:569221269
617 617 c, t dbSNP:2305179
618 618 a, g dbSNP:554790290
627 627 a, c dbSNP:771188160
634 634 a, g dbSNP:377198109
639 639 c, t dbSNP:199740841
640 640 a, g dbSNP:774749538
650 650 c, t dbSNP:762778478
651 651 a, g dbSNP:200300532
655 655 c, t dbSNP:751165912
658 658 c, t dbSNP:113172184
661 661 c, t dbSNP:766911583
662 662 a, g dbSNP:55662109
671 671 c, t dbSNP:199792768
672 672 a, g dbSNP:774962503
678 678 a, g dbSNP:750990333
685 685 a, c dbSNP:376268669
686 686 a, c, t dbSNP:3135867
687 687 a, c, g dbSNP:542749920
697 697 a, g dbSNP:781302593
700 700 c, g dbSNP:748192608
705 705 a, g dbSNP:770008395
708 708 c, g dbSNP:773269128
715 715 a, g dbSNP:749337219
716 716 g, t dbSNP:757414284
737 737 c, t dbSNP:778847955
742 742 a, g dbSNP:745863884
759 759 c, g dbSNP:577990843
770 770 a, g dbSNP:111455601
773 773 c, t dbSNP:543545800
782 782 c, t dbSNP:373209526
783 783 a, g dbSNP:529408918
793 793 a, g dbSNP:775241791
803 803 c, t dbSNP:567597726
804 804 a, g dbSNP:764712450
821 821 c, t dbSNP:774917626
824 824 a, c dbSNP:760000949
829 829 a, c dbSNP:767900565
842 842 c, t dbSNP:377492283
850 850 a, t dbSNP:756575558
857 857 c, t dbSNP:2305180
858 858 a, g dbSNP:754122254
866 866 c, t dbSNP:587778801
868 868 g, t dbSNP:587778353
872 872 c, t dbSNP:2305181
891 891 c, t dbSNP:769124009
899 899 a, g dbSNP:777091470
902 902 a, g dbSNP:369033272
908 908 a, g dbSNP:138707520
916 916 a, g dbSNP:750672389
920 920 c, t dbSNP:762931501
922 922 c, t dbSNP:766513208
923 923 c, g dbSNP:147769045
929 929 a, c, t dbSNP:146927248
931 931 c, t dbSNP:752393208
932 932 a, g dbSNP:114421370
935 935 c, t dbSNP:201081464
938 938 c, t dbSNP:749024125
941 941 c, t dbSNP:756820432
947 947 c, t dbSNP:141575580
950 950 c, t dbSNP:745397432
953 953 c, t dbSNP:769248723
954 954 a, c, g dbSNP:368831528
959 959 a, g dbSNP:371766123
969 969 c, t dbSNP:773302522
976 976 a, g dbSNP:200495316
981 981 c, t dbSNP:766423062
982 982 a, g dbSNP:199944818
988 988 c, t dbSNP:759641808
989 989 a, g dbSNP:369366713
993 993 a, g dbSNP:767373970
994 994 c, t dbSNP:150916178
996 996 c, t dbSNP:755846153
1001 1001 c, t dbSNP:764012522
1008 1008 a, g dbSNP:565612580
1010 1010 a, g dbSNP:775684769
1011 1011 c, t dbSNP:121913482
1015 1015 c, g, t dbSNP:121913483
1017 1017 a, c dbSNP:373470718
1018 1018 c, g dbSNP:4647924
1019 1019 a, g dbSNP:761691291
1022 1022 c, g dbSNP:377554120
1024 1024 g, t dbSNP:750072225
1037 1037 g, t dbSNP:587778354
1040 1040 a, g dbSNP:138334098
1044 1044 c, t dbSNP:765971064
1048 1048 c, t dbSNP:751038752
1049 1049 a, g dbSNP:754448711
1059 1059 a, t dbSNP:778283906
1060 1060 c, t dbSNP:587778773
1061 1061 a, g dbSNP:754400359
1062 1062 a, g dbSNP:151254213
1063 1063 c, t dbSNP:779284979
1068 1068 c, t dbSNP:746064816
1070 1070 g, t dbSNP:587778811
1076 1076 c, t dbSNP:199614237
1077 1077 a, g dbSNP:780147591
1079 1079 c, t dbSNP:142910057
1090 1090 a, t dbSNP:768680057
1097 1097 -, g dbSNP:748608773
1102 1102 a, g dbSNP:121913115
1104 1104 a, t dbSNP:121913114
1109 1109 c, t dbSNP:776706695
1115 1115 c, g dbSNP:761883478
1116 1116 a, c dbSNP:769692611
1117 1117 c, t dbSNP:773094879
1118 1118 c, t dbSNP:762686049
1119 1119 -, c dbSNP:587776836
1122 1122 a, g dbSNP:765988008
1124 1124 c, t dbSNP:751184462
1133 1133 c, t dbSNP:146127079
1139 1139 c, t dbSNP:370518637
1142 1142 a, g dbSNP:553636095
1145 1145 a, g dbSNP:754308484
1148 1148 c, g dbSNP:757808716
1151 1151 c, t dbSNP:2234909
1154 1154 c, t dbSNP:375181682
1157 1157 c, t dbSNP:758705287
1168 1168 c, t dbSNP:780313125
1169 1169 a, g dbSNP:143723106
1172 1172 c, g, t dbSNP:377588489
1173 1173 a, g dbSNP:748261686
1174 1174 a, g dbSNP:371176140
1181 1181 c, g dbSNP:201012537
1184 1184 c, g, t dbSNP:144675978
1185 1185 a, g dbSNP:774047997
1190 1190 c, g, t dbSNP:148518372
1191 1191 a, g dbSNP:774929566
1197 1197 a, g dbSNP:760206152
1201 1201 a, c dbSNP:774934127
1202 1202 c, t dbSNP:759963900
1218 1218 g, t dbSNP:768061470
1225 1225 a, c dbSNP:752936320
1226 1226 c, t dbSNP:3135882
1227 1227 a, g dbSNP:368717324
1230 1230 a, c, g dbSNP:764395593
1233 1233 c, t dbSNP:757360105
1234 1234 a, g dbSNP:778706131
1240 1240 a, g dbSNP:750429622
1244 1244 a, g dbSNP:758162587
1246 1246 c, t dbSNP:751042118
1255 1255 c, t dbSNP:746829612
1256 1256 a, g dbSNP:538448784
1261 1261 a, g dbSNP:371310275
1265 1265 a, c, t dbSNP:555252952
1271 1271 c, t dbSNP:774715658
1272 1272 a, g dbSNP:746415876
1274 1274 a, g dbSNP:772542563
1277 1277 c, t dbSNP:374820397
1280 1280 c, t dbSNP:748962493
1285 1285 a, g dbSNP:761148037
1286 1286 a, t dbSNP:764152875
1289 1289 c, t dbSNP:776922453
1295 1295 c, t dbSNP:768126130
1299 1299 a, g dbSNP:761797267
1304 1304 c, t dbSNP:765402176
1305 1305 a, g dbSNP:750343506
1310 1310 c, t dbSNP:146818438
1311 1311 a, g dbSNP:575229727
1326 1326 c, g dbSNP:766336805
1331 1331 c, t dbSNP:751289792
1332 1332 a, g dbSNP:754817667
1337 1337 c, t dbSNP:780694351
1338 1338 c, g dbSNP:747899858
1341 1341 -, c dbSNP:770485772
1344 1344 c, g, t dbSNP:755547723
1345 1345 a, g dbSNP:542612709
1352 1352 c, t dbSNP:753880713
1353 1353 a, c, g dbSNP:757013992
1357 1357 a, c dbSNP:745683500
1368 1368 a, g dbSNP:757980849
1376 1376 c, g, t dbSNP:779695832
1377 1377 a, g dbSNP:201136923
1378 1378 a, c dbSNP:773566065
1379 1379 a, g dbSNP:749860116
1381 1381 c, t dbSNP:146970233
1382 1382 a, g dbSNP:774814331
1383 1383 g, t dbSNP:121913479
1386 1386 a, t dbSNP:121913484
1387 1387 c, g dbSNP:759980266
1393 1393 a, g dbSNP:121913485
1398 1398 g, t dbSNP:75790268
1402 1402 a, c, t dbSNP:767787097
1403 1403 c, t dbSNP:760665672
1404 1404 c, t dbSNP:764273223
1405 1405 g, t dbSNP:267606809
1412 1412 c, t dbSNP:137896792
1413 1413 a, c, g dbSNP:28931614
1416 1416 a, g dbSNP:149023204
1417 1417 a, t dbSNP:587778776
1420 1420 c, g dbSNP:750161905
1421 1421 c, t dbSNP:762689187
1423 1423 g, t dbSNP:11943863
1425 1425 a, c, t dbSNP:17881656
1428 1428 c, t dbSNP:200186825
1434 1434 a, t dbSNP:774204416
1437 1437 -, tgg dbSNP:772334224
1447 1447 a, c dbSNP:28931615
1448 1448 a, g dbSNP:148157107
1456 1456 c, t dbSNP:747694886
1457 1457 a, g, t dbSNP:771495510
1460 1460 c, t dbSNP:746217459
1464 1464 c, t dbSNP:576428377
1465 1465 a, g, t dbSNP:542210035
1466 1466 c, t dbSNP:764242973
1470 1470 c, t dbSNP:370064407
1471 1471 a, g dbSNP:761896295
1473 1473 a, g dbSNP:373034495
1474 1474 -, c dbSNP:775260779
1475 1475 -, c dbSNP:760502257
1475 1475 c, t dbSNP:750427482
1476 1476 a, c, g, t dbSNP:762705505
1478 1478 a, c dbSNP:754621427
1479 1479 a, c dbSNP:374947075
1480 1480 a, c, g dbSNP:752194597
1481 1481 a, c dbSNP:779554720
1482 1482 a, g dbSNP:373640210
1483 1483 a, g dbSNP:772301946
1484 1484 a, g dbSNP:151306939
1485 1485 a, g dbSNP:780415133
1486 1486 a, g dbSNP:747363570
1488 1488 g, t dbSNP:768867257
1489 1489 a, g dbSNP:201813356
1491 1491 c, g dbSNP:201751659
1493 1493 c, g dbSNP:187314275
1498 1498 c, t dbSNP:761877926
1499 1499 c, g, t dbSNP:769903615
1502 1502 a, c, t dbSNP:533316478
1503 1503 a, t dbSNP:751304574
1506 1506 a, g, t dbSNP:759057257
1510 1510 a, c dbSNP:752460284
1511 1511 c, t dbSNP:755650149
1512 1512 a, c dbSNP:375687485
1513 1513 a, g dbSNP:767109009
1514 1514 a, c, g dbSNP:140898926
1515 1515 a, g dbSNP:780428794
1517 1517 c, t dbSNP:143094785
1521 1521 c, t dbSNP:146114742
1528 1528 c, t dbSNP:781361431
1529 1529 a, g dbSNP:748419731
1530 1530 c, t dbSNP:770029887
1531 1531 c, t dbSNP:773239816
1534 1534 a, g dbSNP:762949938
1535 1535 g, t dbSNP:369368608
1537 1537 a, g dbSNP:587778355
1546 1546 c, t dbSNP:372823935
1553 1553 c, t dbSNP:756532045
1555 1555 g, t dbSNP:777965130
1562 1562 c, t dbSNP:763188060
1564 1564 a, g dbSNP:138986264
1566 1566 a, g dbSNP:182935140
1568 1568 a, g dbSNP:187229103
1571 1571 c, t dbSNP:3135891
1581 1581 a, c dbSNP:772065909
1586 1586 a, g dbSNP:3135892
1588 1588 c, t dbSNP:142030909
1595 1595 a, g dbSNP:746797777
1596 1596 c, g dbSNP:749083353
1597 1597 a, g dbSNP:529493162
1601 1601 c, t dbSNP:190111780
1602 1602 a, g dbSNP:17884368
1612 1612 c, t dbSNP:761325047
1613 1613 c, t dbSNP:769521432
1620 1620 -, g dbSNP:35317612
1626 1626 c, t dbSNP:61735104
1630 1630 c, t dbSNP:56240927
1632 1632 a, c dbSNP:547391969
1635 1635 c, g, t dbSNP:3135893
1637 1637 a, c dbSNP:149555011
1644 1644 g, t dbSNP:144242294
1646 1646 c, t dbSNP:376488233
1652 1652 c, t dbSNP:199758988
1660 1660 c, t dbSNP:764488842
1665 1665 a, g dbSNP:771872811
1692 1692 c, g, t dbSNP:533045918
1700 1700 c, t dbSNP:747886434
1721 1721 g, t dbSNP:200780581
1723 1723 a, g dbSNP:769701323
1724 1724 c, t dbSNP:777256634
1730 1730 c, t dbSNP:545617229
1735 1735 a, g dbSNP:267606808
1736 1736 a, g dbSNP:377021699
1748 1748 c, g dbSNP:773808293
1755 1755 a, g dbSNP:745385417
1757 1757 c, t dbSNP:373254179
1758 1758 a, g dbSNP:777253325
1762 1762 c, t dbSNP:762079212
1767 1767 a, g dbSNP:587778359
1773 1773 c, t dbSNP:773735098
1775 1775 g, t dbSNP:763229229
1776 1776 c, g dbSNP:370646097
1778 1778 c, t dbSNP:140594137
1779 1779 a, g dbSNP:751635116
1780 1780 c, t dbSNP:755145822
1785 1785 a, c dbSNP:767356787
1789 1789 c, t dbSNP:752724806
1793 1793 c, t dbSNP:755839585
1794 1794 a, g dbSNP:144546453
1799 1799 c, t dbSNP:147823561
1805 1805 a, g dbSNP:756833829
1815 1815 a, g dbSNP:778548356
1817 1817 c, t dbSNP:754606269
1818 1818 a, g dbSNP:121913112
1819 1819 a, g dbSNP:749863914
1822 1822 c, g dbSNP:771583472
1827 1827 c, g, t dbSNP:779377617
1828 1828 a, c dbSNP:772276122
1830 1830 a, g dbSNP:560351992
1831 1831 a, g dbSNP:139707740
1832 1832 a, g dbSNP:142622642
1840 1840 c, t dbSNP:587778356
1841 1841 a, g, t dbSNP:776527776
1848 1848 c, g dbSNP:765164423
1849 1849 c, t dbSNP:750175353
1853 1853 c, t dbSNP:150945966
1857 1857 a, g dbSNP:766053734
1859 1859 a, g dbSNP:751213196
1866 1866 a, t dbSNP:754516664
1873 1873 c, t dbSNP:767090421
1877 1877 c, t dbSNP:528979086
1883 1883 a, g dbSNP:548830740
1893 1893 a, g dbSNP:80053154
1898 1898 c, t dbSNP:746228140
1900 1900 a, c, g dbSNP:77722678
1901 1901 a, c, g, t dbSNP:28933068
1902 1902 c, t dbSNP:747280749
1904 1904 a, c, g dbSNP:768897749
1905 1905 c, t dbSNP:748241961
1910 1910 c, g, t dbSNP:61735103
1911 1911 g, t dbSNP:762781471
1919 1919 a, g, t dbSNP:766139511
1925 1925 c, t dbSNP:756321317
1928 1928 c, g, t dbSNP:3135897
1931 1931 c, t dbSNP:749387483
1937 1937 c, t dbSNP:150083071
1938 1938 a, g, t dbSNP:199544087
1952 1952 c, t dbSNP:370408732
1955 1955 a, g, t dbSNP:557734169
1956 1956 c, g dbSNP:768385286
1957 1957 c, t dbSNP:775946807
1967 1967 c, t dbSNP:761445231
1968 1968 c, t dbSNP:766793731
1970 1970 a, g dbSNP:199779110
1980 1980 c, g dbSNP:759874872
1982 1982 c, g dbSNP:372367824
1984 1984 g, t dbSNP:753095502
1987 1987 c, t dbSNP:146672976
1988 1988 a, g dbSNP:778065218
1992 1992 a, c dbSNP:753846438
1995 1995 c, g, t dbSNP:757421718
1996 1996 c, t dbSNP:377141691
1999 1999 c, t dbSNP:745848425
2000 2000 a, g dbSNP:772157613
2003 2003 a, c dbSNP:538859353
2005 2005 c, t dbSNP:746824967
2006 2006 a, g dbSNP:141422828
2007 2007 g, t dbSNP:752311470
2015 2015 -, ctt dbSNP:778027676
2018 2018 c, t dbSNP:200589145
2019 2019 a, g dbSNP:761196249
2029 2029 a, g, t dbSNP:769341070
2031 2031 c, g dbSNP:759993319
2032 2032 c, t dbSNP:145183329
2033 2033 a, g dbSNP:139020690
2034 2034 c, t dbSNP:761163163
2036 2036 c, t dbSNP:764220677
2037 2037 a, g dbSNP:576023546
2039 2039 a, g dbSNP:757264596
2045 2045 a, g dbSNP:765360194
2046 2046 c, g dbSNP:587778357
2051 2051 c, g, t dbSNP:373391057
2052 2052 a, t dbSNP:746774947
2053 2053 g, t dbSNP:754840234
2054 2054 c, g, t dbSNP:780684393
2057 2057 a, g dbSNP:769464095
2060 2060 c, t dbSNP:772639573
2061 2061 c, t dbSNP:748806066
2070 2070 g, t dbSNP:772558079
2073 2073 a, g dbSNP:544955705
2075 2075 c, g dbSNP:760919924
2077 2077 a, t dbSNP:764571446
2098 2098 a, g dbSNP:776884460
2102 2102 c, t dbSNP:370203006
2107 2107 c, t dbSNP:142093553
2108 2108 c, g dbSNP:750472969
2111 2111 c, g dbSNP:758618182
2126 2126 c, t dbSNP:375856533
2132 2132 c, t dbSNP:777376852
2137 2137 c, g dbSNP:753541491
2141 2141 c, t dbSNP:756928026
2143 2143 a, g dbSNP:121913113
2157 2157 a, t dbSNP:778449048
2159 2159 c, t dbSNP:369137031
2160 2160 a, g dbSNP:200849753
2168 2168 c, t dbSNP:104886004
2180 2180 c, t dbSNP:748492424
2182 2182 c, g dbSNP:573600072
2189 2189 c, g dbSNP:104886005
2195 2195 a, g dbSNP:773733049
2204 2204 c, t dbSNP:148104605
2205 2205 a, g dbSNP:771059356
2210 2210 c, t dbSNP:774427767
2213 2213 c, t dbSNP:768341676
2216 2216 c, t dbSNP:104886006
2219 2219 c, t dbSNP:767489382
2224 2224 a, g dbSNP:587779383
2226 2226 -, aag dbSNP:746013747
2228 2228 a, g dbSNP:752674541
2229 2229 a, c, g dbSNP:78311289
2230 2230 a, c, t dbSNP:121913105
2231 2231 c, g, t dbSNP:28928868
2234 2234 a, g dbSNP:7688609
2236 2236 c, g dbSNP:753665954
2240 2240 c, g, t dbSNP:150609697
2246 2246 a, g dbSNP:772373970
2249 2249 a, g dbSNP:368518454
2265 2265 c, g dbSNP:773652498
2267 2267 a, g, t dbSNP:371563013
2273 2273 a, g dbSNP:761645676
2274 2274 g, t dbSNP:764892330
2287 2287 a, g dbSNP:773089715
2294 2294 c, t dbSNP:762445233
2298 2298 c, t dbSNP:747364567
2300 2300 a, c dbSNP:751098892
2306 2306 c, t dbSNP:200980490
2309 2309 c, t dbSNP:754598297
2316 2316 g, t dbSNP:769602256
2324 2324 a, g dbSNP:17883356
2327 2327 a, c dbSNP:771479750
2330 2330 c, g, t dbSNP:371884239
2340 2340 a, g dbSNP:759229319
2342 2342 c, t dbSNP:771762959
2348 2348 a, g dbSNP:200872971
2359 2359 c, t dbSNP:760292339
2363 2363 a, g dbSNP:765659195
2369 2369 c, t dbSNP:142884145
2370 2370 g, t dbSNP:121913480
2378 2378 c, t dbSNP:763282024
2384 2384 -, gg dbSNP:769688023
2386 2386 -, tt dbSNP:772822445
2393 2393 a, c dbSNP:376497115
2395 2395 a, g dbSNP:369813768
2406 2406 a, g dbSNP:755495007
2407 2407 a, g dbSNP:755133781
2410 2410 g, t dbSNP:104886023
2416 2416 a, g dbSNP:104886024
2426 2426 a, g dbSNP:781534447
2429 2429 c, g, t dbSNP:373967853
2430 2430 a, g dbSNP:17882190
2431 2431 c, t dbSNP:749192018
2433 2433 a, g dbSNP:587778358
2434 2434 a, g dbSNP:139773438
2438 2438 a, c dbSNP:745674688
2444 2444 c, g, t dbSNP:371088132
2456 2456 a, g dbSNP:377402598
2457 2457 a, t dbSNP:17880763
2464 2464 a, g dbSNP:149924317
2480 2480 c, t dbSNP:569462075
2481 2481 a, g dbSNP:188849608
2482 2482 c, t dbSNP:555257146
2486 2486 c, g dbSNP:145020302
2488 2488 a, c dbSNP:148631462
2491 2491 a, c dbSNP:536212792
2495 2495 a, g dbSNP:200624062
2498 2498 c, g dbSNP:377293519
2501 2501 c, t dbSNP:761006469
2503 2503 g, t dbSNP:768999235
2505 2505 a, c dbSNP:777034307
2522 2522 c, t dbSNP:142137666
2525 2525 a, g dbSNP:368790668
2529 2529 c, t dbSNP:750501941
2530 2530 a, g dbSNP:762888506
2531 2531 c, t dbSNP:375310360
2534 2534 c, t dbSNP:751365581
2540 2540 c, t dbSNP:146662137
2541 2541 a, g dbSNP:373425119
2545 2545 c, t dbSNP:752294041
2546 2546 a, c, g dbSNP:755791719
2551 2551 c, g dbSNP:748763892
2552 2552 c, t dbSNP:772623020
2553 2553 a, g dbSNP:56266857
2555 2555 c, g, t dbSNP:747369218
2556 2556 c, t dbSNP:770863154
2571 2571 c, g dbSNP:774517056
2575 2575 c, t dbSNP:759398915
2576 2576 a, g, t dbSNP:767453505
2578 2578 c, t dbSNP:140211846
2581 2581 c, t dbSNP:763774428
2585 2585 c, t dbSNP:540549001
2586 2586 a, g dbSNP:560280646
2593 2593 a, g dbSNP:764614806
2594 2594 c, g dbSNP:367757357
2596 2596 c, g, t dbSNP:755526507
2598 2598 c, g dbSNP:748492376
2599 2599 a, c, t dbSNP:756484252
2600 2600 a, g, t dbSNP:200629304
2602 2602 a, c, g dbSNP:773197447
2610 2610 g, t dbSNP:771994959
2614 2614 a, c, t dbSNP:775451126
2615 2615 c, t dbSNP:189264142
2621 2621 c, t dbSNP:776520979
2623 2623 c, g dbSNP:140616343
2626 2626 a, g dbSNP:764958279
2633 2633 -, ag dbSNP:759113408
2633 2633 a, c dbSNP:749947486
2634 2634 a, g dbSNP:531915147
2637 2637 g, t dbSNP:768114770
2639 2639 c, t dbSNP:753206367
2640 2640 a, g, t dbSNP:548817695
2645 2645 c, t dbSNP:754239704
2646 2646 a, g dbSNP:371433215
2654 2654 c, g dbSNP:138078624
2657 2657 a, c, t dbSNP:576131994
2658 2658 a, g dbSNP:376043260
2664 2664 a, c dbSNP:772193113
2665 2665 ga, t dbSNP:121913481
2669 2669 c, t dbSNP:369424084
2670 2670 c, t dbSNP:746909556
2671 2671 c, g, t dbSNP:768644781
2672 2672 a, c, g dbSNP:761733326
2680 2680 c, t dbSNP:150452037
2681 2681 a, c, t dbSNP:372401311
2695 2695 c, t dbSNP:751115449
2696 2696 a, g dbSNP:375563964
2697 2697 c, t dbSNP:369758941
2698 2698 a, g dbSNP:754152095
2701 2701 c, t dbSNP:374547489
2702 2702 a, g dbSNP:779088139
2703 2703 a, c, g, t dbSNP:121913101
2704 2704 g, t dbSNP:397515514
2705 2705 a, c, g, t dbSNP:121913103
2710 2710 c, g dbSNP:17879364
2717 2717 c, t dbSNP:758650628
2719 2719 c, g, t dbSNP:149119664
2722 2722 a, c dbSNP:747126217
2723 2723 a, c, g dbSNP:768467199
2726 2726 -, tg dbSNP:764459020
2727 2727 c, t dbSNP:747872029
2728 2728 a, g dbSNP:143130353
2735 2735 a, g dbSNP:769662278
2737 2737 c, g dbSNP:148257939
2741 2741 a, g dbSNP:3135900
2743 2743 c, t dbSNP:748878733
2749 2749 a, c dbSNP:770716902
2752 2752 c, t dbSNP:773982546
2758 2758 c, t dbSNP:147471896
2760 2760 a, g dbSNP:759149879
2765 2765 a, c, g dbSNP:375248814
2766 2766 c, t dbSNP:777247381
2768 2768 a, g dbSNP:538257316
2769 2769 a, c dbSNP:138412839
2770 2770 c, g dbSNP:765546868
2771 2771 a, c dbSNP:558185092
2776 2776 c, t dbSNP:758559632
2777 2777 c, t dbSNP:766648143
2781 2781 a, g dbSNP:143797885
2789 2789 c, t dbSNP:565001558
2790 2790 a, g dbSNP:751560318
2799 2799 g, t dbSNP:575008984
2800 2800 a, g dbSNP:537582388
2804 2804 a, g dbSNP:781152611
2809 2809 a, c dbSNP:150623219
2821 2821 c, t dbSNP:139961981
2822 2822 -, t dbSNP:35582695
2826 2826 -, tg dbSNP:757773888
2826 2826 c, g dbSNP:748078057
2827 2827 -, tgtgtgtgtgtgtgtgcgtg dbSNP:758422706
2827 2827 -, tgtgtgtgtgtg dbSNP:750480041
2827 2827 -, tgtg dbSNP:779435521
2827 2827 -, tg dbSNP:754209375
2833 2833 -, gc dbSNP:780114078
2836 2836 -, gtgtgtgc dbSNP:747197773
2836 2836 a, g dbSNP:756121492
2837 2837 c, t dbSNP:149863736
2838 2838 -, gtgtgc dbSNP:768819011
2839 2839 c, t dbSNP:78260022
2840 2840 -, gtgc dbSNP:781036706
2841 2841 c, t dbSNP:574622446
2842 2842 -, gc dbSNP:747937861
2843 2843 -, gt dbSNP:770496031
2843 2843 c, t dbSNP:73202816
2844 2844 -, gtgtgtgtgtgt dbSNP:774008828
2844 2844 -, gtgtgt dbSNP:763019421
2844 2844 -, gtgt dbSNP:776445794
2844 2844 -, gt dbSNP:34562534
2845 2845 -, gtgtgtgtgtgtgtgc, tg dbSNP:34003391
2845 2845 c, t dbSNP:777922470
2847 2847 c, t dbSNP:774095140
2852 2852 a, g dbSNP:745351152
2859 2859 c, t dbSNP:771564788
2861 2861 -, gc, tg dbSNP:397821865
2861 2861 c, t dbSNP:774898004
2870 2870 a, g dbSNP:112613951
2871 2871 c, t dbSNP:765747483
2872 2872 a, g dbSNP:745704841
2878 2878 c, t dbSNP:773554802
2885 2885 c, t dbSNP:758061231
2889 2889 c, t dbSNP:3135901
2890 2890 a, g dbSNP:577261362
2898 2898 c, t dbSNP:766564331
2902 2902 a, c dbSNP:751754704
2903 2903 a, g dbSNP:139656072
2907 2907 a, g dbSNP:3135902
2909 2909 -, ag dbSNP:541119317
2916 2916 c, g dbSNP:146843671
2918 2918 c, g dbSNP:17884965
2926 2926 c, g dbSNP:756103476
2928 2928 c, t dbSNP:777921453
2929 2929 c, t dbSNP:749058497
2930 2930 g, t dbSNP:768684592
2932 2932 c, t dbSNP:778598106
2936 2936 a, c, g dbSNP:745496661
2942 2942 c, t dbSNP:548694307
2943 2943 a, c, g dbSNP:746580452
2944 2944 c, g dbSNP:146686766
2952 2952 a, c dbSNP:562140611
2955 2955 c, g, t dbSNP:763472649
2961 2961 a, g dbSNP:774583097
2964 2964 a, g dbSNP:759742370
2969 2969 a, g dbSNP:776334107
2972 2972 c, g dbSNP:752814871
2974 2974 -, g dbSNP:36110512
2975 2975 c, t dbSNP:140307141
2983 2983 c, g dbSNP:764103109
2984 2984 -, g dbSNP:765610441
2985 2985 a, g dbSNP:753781260
2989 2989 a, g dbSNP:142499367
2992 2992 c, t dbSNP:17882030
2995 2995 a, g dbSNP:750202398
3003 3003 -, tgtaagt dbSNP:758920556
3004 3004 c, t dbSNP:758059842
3013 3013 c, g dbSNP:547734987
3018 3018 c, g dbSNP:746494257
3020 3020 c, t dbSNP:768103837
3021 3021 a, g dbSNP:780708053
3025 3025 a, g dbSNP:150943855
3026 3026 c, g dbSNP:140878423
3028 3028 c, t dbSNP:376272599
3031 3031 a, c dbSNP:774764362
3032 3032 c, t dbSNP:570813728
3046 3046 a, c, t dbSNP:150156689
3050 3050 c, g dbSNP:138933598
3053 3053 c, t dbSNP:775902246
3054 3054 a, g dbSNP:761002580
3063 3063 c, t dbSNP:764231473
3064 3064 c, t dbSNP:370938444
3065 3065 a, g, t dbSNP:17881782
3067 3067 c, t dbSNP:141307773
3068 3068 c, t dbSNP:750232146
3072 3072 -, g dbSNP:766435200
3073 3073 c, t dbSNP:146988530
3074 3074 c, t dbSNP:758169923
3084 3084 c, t dbSNP:779919338
3085 3085 a, g dbSNP:751169261
3086 3086 a, g dbSNP:138377208
3089 3089 c, t dbSNP:149595424
3094 3094 a, c, t dbSNP:551739335
3095 3095 a, g dbSNP:747714203
3103 3103 c, t dbSNP:144231750
3104 3104 c, t dbSNP:757777764
3106 3106 c, t dbSNP:373601917
3108 3108 -, g dbSNP:34288608
3111 3111 c, t dbSNP:148309209
3112 3112 c, t dbSNP:746219955
3116 3116 c, t dbSNP:772277557
3118 3118 a, c dbSNP:776031013
3119 3119 a, g dbSNP:747163554
3121 3121 c, t dbSNP:141419414
3122 3122 c, g dbSNP:200015882
3126 3126 a, g, t dbSNP:150892094
3128 3128 c, t dbSNP:761868905
3131 3131 a, g dbSNP:765193733
3132 3132 c, t dbSNP:139770971
3136 3136 a, c dbSNP:773074995
3140 3140 a, g dbSNP:142940849
3143 3143 a, g dbSNP:146131833
3154 3154 c, t dbSNP:762976265
3157 3157 a, g, t dbSNP:367689136
3168 3168 -, c dbSNP:34583865
3170 3170 -, g dbSNP:751657062
3171 3171 a, g, t dbSNP:751365286
3172 3172 g, t dbSNP:139197142
3173 3173 a, g dbSNP:767224419
3187 3187 a, g dbSNP:574504441
3203 3203 a, g dbSNP:17880626
3225 3225 c, t dbSNP:144268232
3226 3226 c, t dbSNP:759466924
3227 3227 c, g dbSNP:3135903
3234 3234 a, g dbSNP:530215149
3243 3243 a, t dbSNP:149915836
3251 3251 c, t dbSNP:577227997
3272 3272 c, t dbSNP:17878568
3308 3308 a, g dbSNP:562851497
3325 3325 c, g dbSNP:760073016
3327 3327 a, g dbSNP:184903110
3333 3333 a, g dbSNP:541948785
3350 3350 -, a dbSNP:775234937
3357 3357 a, t dbSNP:562221192
3361 3361 -, at dbSNP:550148323
3363 3363 a, g dbSNP:767989545
3365 3365 -, at dbSNP:17878315
3381 3381 c, t dbSNP:144953313
3390 3390 c, t dbSNP:548487199
3405 3405 -, c, t dbSNP:34750071
3405 3405 -, c dbSNP:35222799
3411 3411 a, g dbSNP:752796817
3422 3422 a, g dbSNP:527836723
3436 3436 c, g dbSNP:148600108
3445 3445 -, g dbSNP:571651117
3447 3447 a, g dbSNP:113572688
3451 3451 g, t dbSNP:551428212
3452 3452 c, t dbSNP:560249836
3503 3503 c, t dbSNP:3135904
3557 3557 a, g dbSNP:764379572
3561 3561 a, g dbSNP:754066531
3568 3568 c, t dbSNP:189748716
3569 3569 c, t dbSNP:763717776
3589 3589 c, t dbSNP:376155579
3610 3610 g, t dbSNP:376062760
3619 3619 a, g dbSNP:180944260
3623 3623 c, t dbSNP:185946582
3636 3636 -, t dbSNP:139431979
3667 3667 c, t dbSNP:199807707
3685 3685 a, g dbSNP:757651823
3712 3712 c, t dbSNP:779754240
3713 3713 a, g dbSNP:781573474
3727 3727 c, t dbSNP:568504092
3743 3743 g, t dbSNP:537854144
3746 3746 c, t dbSNP:191993060
3819 3819 a, g dbSNP:17883581
3820 3820 c, t dbSNP:746376439
3833 3833 g, t dbSNP:546526332
3838 3838 a, g dbSNP:552245062
3877 3877 c, t dbSNP:754991883
3936 3936 a, g dbSNP:756578124
3943 3943 c, t dbSNP:781240258
3990 3990 c, t dbSNP:533715128
3994 3994 -, tata dbSNP:17882393
4008 4008 c, g, t dbSNP:370751685
4039 4039 c, t dbSNP:570690371
4048 4048 c, t dbSNP:539744295
4066 4066 c, t dbSNP:2121456
4107 4107 c, t dbSNP:556538642
4113 4113 g, t dbSNP:76953537
4114 4114 g, t dbSNP:78424000
4115 4115 c, g dbSNP:74995745
4120 4120 g, t dbSNP:769375190
4124 4124 c, t dbSNP:758331417
4125 4125 a, g dbSNP:181727722
4139 4139 c, t dbSNP:570813958
4153 4153 c, t dbSNP:542211235
4181 4181 g, t dbSNP:555552048
4184 4184 c, t dbSNP:4647929
4191 4191 c, t dbSNP:572485456
4238 4238 a, g dbSNP:541193957
4272 4272 c, t dbSNP:564336183

Target ORF information:

RefSeq Version XM_006713868
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens fibroblast growth factor receptor 3 (FGFR3), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu38315
Accession Version XM_006713869.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 2433bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product fibroblast growth factor receptor 3 isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_006051.19) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)426..599(+)
Misc Feature(2)438..599(+)
Misc Feature(3)750..1004(+)
Misc Feature(4)756..770(+)
Misc Feature(5)759..794(+)
Misc Feature(6)777..974(+)
Misc Feature(7)1047..1334(+)
Misc Feature(8)1071..1337(+)
Misc Feature(9)1098..1295(+)
Misc Feature(10)1656..2657(+)
Misc Feature(11)1695..2525(+)
Misc Feature(12)1713..2186(+)
Position Chain Variation Link
51 51 c, g