
FOXG1 cDNA ORF clone, Homo sapiens (human)

Gene Symbol FOXG1
Entrez Gene ID 2290
Full Name forkhead box G1
General protein information
Preferred Names
forkhead box protein G1
forkhead box protein G1
oncogene QIN
brain factor 1
brain factor 2
forkhead-like 1
forkhead-like 2
forkhead-like 3
forkhead-like 4
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This locus encodes a member of the forked-head transcription factor family. The encoded protein, which functions as a repressor, may play a role in brain development. Mutations at this locus have been associated with Rett syndrome. [provided by RefSeq, Feb 2012]. lac of sum
Disorder MIM:


Disorder Html: Rett syndrome, congenital variant, 613454 (3)

The following FOXG1 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the FOXG1 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu22100 NM_005249 Homo sapiens forkhead box G1 (FOXG1), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319.00

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu22100
Accession Version NM_005249.4 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1470bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 10-MAY-2014
Organism Homo sapiens (human)
Product forkhead box protein G1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from X74142.1, DR001113.1, BC035020.2, AL049777.5 and U44097.1. This sequence is a reference standard in the RefSeqGene project. On Feb 10, 2012 this sequence version replaced gi:32307176. Summary: This locus encodes a member of the forked-head transcription factor family. The encoded protein, which functions as a repressor, may play a role in brain development. Mutations at this locus have been associated with Rett syndrome. [provided by RefSeq, Feb 2012]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)35..37(+)
Misc Feature(2)749..982(+)
Misc Feature(3)857..961(+)
Misc Feature(4)1355..1426(+)
Exon (1)1..3206
Gene Synonym:
Position Chain Variation Link
164 164 c, g dbSNP:746165270
180 180 c, t dbSNP:772479996
193 193 c, t dbSNP:775779501
195 195 c, t dbSNP:747532272
196 196 c, t dbSNP:751050823
202 202 c, g dbSNP:769086783
212 212 a, c dbSNP:776244220
216 216 a, c dbSNP:761420014
217 217 c, t dbSNP:764914165
234 234 a, c dbSNP:772990946
235 235 a, g dbSNP:762567782
262 262 c, t dbSNP:766174892
265 265 c, t dbSNP:372915038
280 280 c, g dbSNP:759477130
311 311 a, g dbSNP:767463607
313 313 a, g, t dbSNP:753859771
321 321 g, t dbSNP:543211742
322 322 -, cca dbSNP:756685121
333 333 c, g dbSNP:565419356
338 338 c, t dbSNP:758601231
342 342 c, t dbSNP:780437753
344 344 -, c, cc dbSNP:587783629
344 344 c, t dbSNP:786205000
346 346 -, cac dbSNP:771070072
346 346 a, g dbSNP:747367558
347 347 -, caccaccaccac dbSNP:774260872
347 347 -, caccaccac dbSNP:749704804
347 347 -, caccac dbSNP:746139309
347 347 -, cac dbSNP:778351036
353 353 c, t dbSNP:769147287
355 355 c, t dbSNP:781764900
358 358 c, t dbSNP:532508999
367 367 -, cca dbSNP:587783630
367 367 c, t dbSNP:769410384
369 369 -, cca dbSNP:786204997
370 370 -, cac dbSNP:772407998
378 378 -, acccgccgcc dbSNP:587783631
380 380 -, ccgccgccgcccgccccgcaaccg dbSNP:776633714
384 384 c, t dbSNP:772898039
389 389 c, t dbSNP:762634382
391 391 -, cgccccgcaaccgccgccgccgcc dbSNP:587783632
400 400 -, ccg dbSNP:764882380
401 401 -, ccgccgccgccgccgcagcagcagcag dbSNP:773222808
401 401 -, ccg dbSNP:761703699
402 402 c, g dbSNP:770519636
403 403 -, gccgccgccgccgcagcagcagca dbSNP:762759700
403 403 a, g dbSNP:774144312
409 409 g, t dbSNP:587780944
414 414 -, gca dbSNP:765955111
414 414 a, c dbSNP:727503933
417 417 -, agcagcagcagccgccgccgccgccgc dbSNP:587783634
417 417 -, agcagcagcagccgccgccgccgc dbSNP:794726920
417 417 a, c dbSNP:587783633
426 426 -, gcc dbSNP:531683773
426 426 a, c dbSNP:760663911
428 428 -, agc dbSNP:398124201
444 444 -, gcc dbSNP:786200975
464 464 -, c dbSNP:786205002
464 464 a, c, t dbSNP:398124202
464 464 -, c dbSNP:786205001
471 471 -, ggggcgccccggccgc dbSNP:587783635
475 475 c, t dbSNP:794726919
506 506 -, c dbSNP:587783636
527 527 a, c dbSNP:765282843
532 532 a, g dbSNP:750512461
534 534 c, t dbSNP:398124203
575 575 c, g dbSNP:758610493
586 586 c, t dbSNP:572031458
619 619 a, c, g dbSNP:780164294
637 637 c, g dbSNP:755388144
640 640 c, g dbSNP:547825816
642 642 -, agg dbSNP:751048593
649 649 -, ggcgcc dbSNP:759245497
651 651 g, t dbSNP:781726187
654 654 c, t dbSNP:748639652
655 655 c, g, t dbSNP:112803404
664 664 a, c, g, t dbSNP:587783637
668 668 -, g dbSNP:398124204
679 679 g, t dbSNP:398124205
684 684 c, t dbSNP:773880966
691 691 a, g dbSNP:759301634
697 697 c, t dbSNP:375378714
703 703 a, c dbSNP:775314145
705 705 a, g dbSNP:760578111
706 706 c, g dbSNP:764054659
709 709 a, g dbSNP:773297334
711 711 c, g dbSNP:148157138
713 713 gg, t dbSNP:786205003
713 713 a, g dbSNP:530084654
723 723 a, g dbSNP:766545074
725 725 -, aga dbSNP:767155278
729 729 a, g dbSNP:751714163
736 736 c, t dbSNP:755296509
751 751 a, g dbSNP:767961672
754 754 a, g dbSNP:753143152
757 757 a, g dbSNP:756638761
760 760 -, c dbSNP:786205004
763 763 c, t dbSNP:778154529
771 771 c, g dbSNP:587783638
775 775 c, t dbSNP:748766934
785 785 a, g dbSNP:786205005
790 790 c, t dbSNP:756719183
802 802 c, g dbSNP:141088742
809 809 a, c dbSNP:745486814
814 814 c, t dbSNP:201191801
818 818 c, t dbSNP:786205006
829 829 c, t dbSNP:771755778
832 832 c, g, t dbSNP:267606826
851 851 c, t dbSNP:267606828
852 852 ct, tc dbSNP:786204998
854 854 c, t dbSNP:548935590
856 856 -, ttactacc dbSNP:727503934
865 865 c, t dbSNP:768525699
878 878 a, g dbSNP:727503935
880 880 c, g dbSNP:587783639
889 889 c, g dbSNP:786205012
892 892 c, t dbSNP:761866084
894 894 c, t dbSNP:199502880
897 897 a, g dbSNP:786205007
898 898 c, t dbSNP:766343459
902 902 a, t dbSNP:786205486
908 908 c, t dbSNP:786205008
937 937 c, g dbSNP:774525510
938 938 c, t dbSNP:786205009
958 958 c, t dbSNP:759790790
963 963 g, t dbSNP:587783640
965 965 a, g dbSNP:587783641
967 967 c, t dbSNP:767873754
970 970 c, g dbSNP:587783642
973 973 a, g, t dbSNP:121913678
996 996 -, acgtg dbSNP:786205010
1006 1006 c, t dbSNP:753051078
1007 1007 a, g dbSNP:587783643
1018 1018 a, g dbSNP:374673901
1042 1042 c, t dbSNP:764587853
1045 1045 c, t dbSNP:570340475
1051 1051 a, g dbSNP:757832735
1060 1060 a, g dbSNP:537686463
1066 1066 a, c dbSNP:745418016
1093 1093 c, t dbSNP:142067350
1115 1115 g, t dbSNP:779697567
1123 1123 c, t dbSNP:746727507
1132 1132 a, g dbSNP:267606827
1164 1164 c, g dbSNP:768320307
1171 1171 c, t dbSNP:781085552
1177 1177 -, c dbSNP:786205011
1185 1185 a, c, g dbSNP:748001255
1192 1192 c, t dbSNP:774246700
1197 1197 c, g dbSNP:150277632
1199 1199 a, g dbSNP:759699805
1201 1201 a, g dbSNP:772352099
1202 1202 g, t dbSNP:775851487
1207 1207 c, t dbSNP:761037576
1211 1211 c, g dbSNP:531378284
1213 1213 c, g dbSNP:368707795
1231 1231 c, t dbSNP:764343290
1234 1234 c, t dbSNP:754270265
1238 1238 a, g dbSNP:372086115
1240 1240 g, t dbSNP:765799544
1266 1266 a, g dbSNP:749879411
1279 1279 c, t dbSNP:758683336
1294 1294 a, g dbSNP:570981209
1306 1306 g, t dbSNP:139237860
1311 1311 g, t dbSNP:754695105
1312 1312 a, c dbSNP:780806885
1315 1315 c, t dbSNP:747996412
1327 1327 a, g dbSNP:538358023
1330 1330 c, t dbSNP:777855975
1351 1351 c, g dbSNP:749304229
1354 1354 c, g dbSNP:772266402
1355 1355 a, g dbSNP:202157686
1357 1357 c, g dbSNP:760777087
1358 1358 c, t dbSNP:768955242
1366 1366 c, g, t dbSNP:143223844
1369 1369 a, g dbSNP:147154860
1373 1373 c, t dbSNP:369673538
1390 1390 g, t dbSNP:750929202
1396 1396 c, t dbSNP:763497415
1403 1403 a, t dbSNP:765839485
1408 1408 a, c, g, t dbSNP:138747073
1411 1411 c, t dbSNP:201024952
1426 1426 c, g dbSNP:587783628
1441 1441 a, g dbSNP:34654108
1450 1450 c, t dbSNP:752366627
1456 1456 c, g dbSNP:786204999
1457 1457 c, t dbSNP:755931562
1462 1462 c, t dbSNP:777770149
1471 1471 c, g dbSNP:373079213
1480 1480 a, g dbSNP:757300535
1481 1481 c, t dbSNP:780242359
1486 1486 a, g dbSNP:747138265
1504 1504 a, g dbSNP:768706649
1519 1519 a, g dbSNP:776918484
1521 1521 c, t dbSNP:376242569
1524 1524 c, t dbSNP:770118439
1531 1531 c, t dbSNP:144434028
1537 1537 g, t dbSNP:763407540
1549 1549 c, t dbSNP:200639648
1556 1556 a, c dbSNP:1126890
1564 1564 c, t dbSNP:773791918
1573 1573 c, t dbSNP:759088580
1581 1581 c, g dbSNP:767003141
1592 1592 a, g dbSNP:752379833
1600 1600 c, g dbSNP:755772051
1603 1603 a, c, g dbSNP:369183477
1607 1607 c, t dbSNP:371279404
1608 1608 c, t dbSNP:779009924
1609 1609 c, g dbSNP:746997498
1619 1619 c, t dbSNP:755084543
1622 1622 c, t dbSNP:781189964
1636 1636 a, t dbSNP:748366405
1647 1647 a, g dbSNP:148410675
1652 1652 -, tct dbSNP:752282095
1657 1657 a, c, g, t dbSNP:142688661
1680 1680 a, t dbSNP:771359224
1682 1682 c, t dbSNP:774917687
1685 1685 c, t dbSNP:760019330
1686 1686 g, t dbSNP:373961431
1691 1691 a, c dbSNP:151157846
1696 1696 c, t dbSNP:377726805
1703 1703 -, a dbSNP:756488909
1706 1706 c, t dbSNP:760366406
1771 1771 -, c dbSNP:571467776
1771 1771 -, c dbSNP:68024132
1771 1771 c, g dbSNP:756027379
1778 1778 -, c dbSNP:397788971
1789 1789 c, g dbSNP:777601651
1801 1801 a, c dbSNP:749024013
1818 1818 a, c dbSNP:767550406
1835 1835 c, t dbSNP:111723999
1837 1837 a, g dbSNP:541185010
1895 1895 c, g dbSNP:757129013
1911 1911 a, g dbSNP:778907838
1942 1942 a, c dbSNP:559872899
2046 2046 c, g dbSNP:530143174
2066 2066 a, t dbSNP:754820747
2098 2098 -, a dbSNP:35458312
2106 2106 c, t dbSNP:548597291
2127 2127 c, t dbSNP:564009126
2151 2151 -, ctttt dbSNP:759727255
2152 2152 -, ctttt dbSNP:138317321
2156 2156 -, tcttt dbSNP:75768168
2169 2169 -, t dbSNP:547248498
2189 2189 c, t dbSNP:531237261
2222 2222 a, g dbSNP:1042761
2225 2225 c, t dbSNP:375413059
2233 2233 g, t dbSNP:191019765
2278 2278 a, g dbSNP:1042762
2290 2290 a, g dbSNP:565555663
2303 2303 a, g dbSNP:373061437
2412 2412 c, t dbSNP:540893672
2487 2487 c, t dbSNP:189418563
2515 2515 a, g dbSNP:554445894
2568 2568 a, g dbSNP:535183687
2571 2571 g, t dbSNP:1042766
2664 2664 a, g dbSNP:775044607
2789 2789 -, a dbSNP:372395431
2794 2794 c, t dbSNP:567312195
2847 2847 a, g dbSNP:181934041
2948 2948 c, t dbSNP:547209293
3044 3044 a, g dbSNP:565436089
3051 3051 c, t dbSNP:535885298
3055 3055 c, g dbSNP:554153484
3074 3074 a, g dbSNP:752609373

Target ORF information:

RefSeq Version NM_005249
Organism Homo sapiens (human)
Definition Homo sapiens forkhead box G1 (FOXG1), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
