Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

FOXG1 forkhead box G1 [Homo sapiens (human)]

Gene Symbol FOXG1
Entrez Gene ID 2290
Full Name forkhead box G1
General protein information
Preferred Names
forkhead box protein G1
forkhead box protein G1
oncogene QIN
brain factor 1
brain factor 2
forkhead-like 1
forkhead-like 2
forkhead-like 3
forkhead-like 4
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This locus encodes a member of the forked-head transcription factor family. The encoded protein, which functions as a repressor, may play a role in brain development. Mutations at this locus have been associated with Rett syndrome. [provided by RefSeq, Feb 2012]. lac of sum
Disorder MIM:


Disorder Html: Rett syndrome, congenital variant, 613454 (3)
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu22100 NM_005249 Homo sapiens forkhead box G1 (FOXG1), mRNA. pcDNA3.1-C-(k)DYK In stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu22100D
Sequence Information ORF Nucleotide Sequence (Length: 1470bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 10-MAY-2014
Organism Homo sapiens (human)
Product forkhead box protein G1
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from X74142.1, DR001113.1, BC035020.2, AL049777.5 and U44097.1. This sequence is a reference standard in the RefSeqGene project. On Feb 10, 2012 this sequence version replaced gi:32307176. Summary: This locus encodes a member of the forked-head transcription factor family. The encoded protein, which functions as a repressor, may play a role in brain development. Mutations at this locus have been associated with Rett syndrome. [provided by RefSeq, Feb 2012]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)35..37(+)
Misc Feature(2)749..982(+)
Misc Feature(3)857..961(+)
Misc Feature(4)1355..1426(+)
Exon (1)1..3206
Gene Synonym:
Position Chain Variation Link
164 164 c, g dbSNP:746165270
180 180 c, t dbSNP:772479996
193 193 c, t dbSNP:775779501
195 195 c, t dbSNP:747532272
196 196 c, t dbSNP:751050823
202 202 c, g dbSNP:769086783
212 212 a, c dbSNP:776244220
216 216 a, c dbSNP:761420014
217 217 c, t dbSNP:764914165
234 234 a, c dbSNP:772990946
235 235 a, g dbSNP:762567782
262 262 c, t dbSNP:766174892
265 265 c, t dbSNP:372915038
280 280 c, g dbSNP:759477130
311 311 a, g dbSNP:767463607
313 313 a, g, t dbSNP:753859771
321 321 g, t dbSNP:543211742
322 322 -, cca dbSNP:756685121
333 333 c, g dbSNP:565419356
338 338 c, t dbSNP:758601231
342 342 c, t dbSNP:780437753
344 344 -, c, cc dbSNP:587783629
344 344 c, t dbSNP:786205000
346 346 -, cac dbSNP:771070072
346 346 a, g dbSNP:747367558
347 347 -, caccaccaccac dbSNP:774260872
347 347 -, caccaccac dbSNP:749704804
347 347 -, caccac dbSNP:746139309
347 347 -, cac dbSNP:778351036
353 353 c, t dbSNP:769147287
355 355 c, t dbSNP:781764900
358 358 c, t dbSNP:532508999
367 367 -, cca dbSNP:587783630
367 367 c, t dbSNP:769410384
369 369 -, cca dbSNP:786204997
370 370 -, cac dbSNP:772407998
378 378 -, acccgccgcc dbSNP:587783631
380 380 -, ccgccgccgcccgccccgcaaccg dbSNP:776633714
384 384 c, t dbSNP:772898039
389 389 c, t dbSNP:762634382
391 391 -, cgccccgcaaccgccgccgccgcc dbSNP:587783632
400 400 -, ccg dbSNP:764882380
401 401 -, ccgccgccgccgccgcagcagcagcag dbSNP:773222808
401 401 -, ccg dbSNP:761703699
402 402 c, g dbSNP:770519636
403 403 -, gccgccgccgccgcagcagcagca dbSNP:762759700
403 403 a, g dbSNP:774144312
409 409 g, t dbSNP:587780944
414 414 -, gca dbSNP:765955111
414 414 a, c dbSNP:727503933
417 417 -, agcagcagcagccgccgccgccgccgc dbSNP:587783634
417 417 -, agcagcagcagccgccgccgccgc dbSNP:794726920
417 417 a, c dbSNP:587783633
426 426 -, gcc dbSNP:531683773
426 426 a, c dbSNP:760663911
428 428 -, agc dbSNP:398124201
444 444 -, gcc dbSNP:786200975
464 464 -, c dbSNP:786205002
464 464 a, c, t dbSNP:398124202
464 464 -, c dbSNP:786205001
471 471 -, ggggcgccccggccgc dbSNP:587783635
475 475 c, t dbSNP:794726919
506 506 -, c dbSNP:587783636
527 527 a, c dbSNP:765282843
532 532 a, g dbSNP:750512461
534 534 c, t dbSNP:398124203
575 575 c, g dbSNP:758610493
586 586 c, t dbSNP:572031458
619 619 a, c, g dbSNP:780164294
637 637 c, g dbSNP:755388144
640 640 c, g dbSNP:547825816
642 642 -, agg dbSNP:751048593
649 649 -, ggcgcc dbSNP:759245497
651 651 g, t dbSNP:781726187
654 654 c, t dbSNP:748639652
655 655 c, g, t dbSNP:112803404
664 664 a, c, g, t dbSNP:587783637
668 668 -, g dbSNP:398124204
679 679 g, t dbSNP:398124205
684 684 c, t dbSNP:773880966
691 691 a, g dbSNP:759301634
697 697 c, t dbSNP:375378714
703 703 a, c dbSNP:775314145
705 705 a, g dbSNP:760578111
706 706 c, g dbSNP:764054659
709 709 a, g dbSNP:773297334
711 711 c, g dbSNP:148157138
713 713 gg, t dbSNP:786205003
713 713 a, g dbSNP:530084654
723 723 a, g dbSNP:766545074
725 725 -, aga dbSNP:767155278
729 729 a, g dbSNP:751714163
736 736 c, t dbSNP:755296509
751 751 a, g dbSNP:767961672
754 754 a, g dbSNP:753143152
757 757 a, g dbSNP:756638761
760 760 -, c dbSNP:786205004
763 763 c, t dbSNP:778154529
771 771 c, g dbSNP:587783638
775 775 c, t dbSNP:748766934
785 785 a, g dbSNP:786205005
790 790 c, t dbSNP:756719183
802 802 c, g dbSNP:141088742
809 809 a, c dbSNP:745486814
814 814 c, t dbSNP:201191801
818 818 c, t dbSNP:786205006
829 829 c, t dbSNP:771755778
832 832 c, g, t dbSNP:267606826
851 851 c, t dbSNP:267606828
852 852 ct, tc dbSNP:786204998
854 854 c, t dbSNP:548935590
856 856 -, ttactacc dbSNP:727503934
865 865 c, t dbSNP:768525699
878 878 a, g dbSNP:727503935
880 880 c, g dbSNP:587783639
889 889 c, g dbSNP:786205012
892 892 c, t dbSNP:761866084
894 894 c, t dbSNP:199502880
897 897 a, g dbSNP:786205007
898 898 c, t dbSNP:766343459
902 902 a, t dbSNP:786205486
908 908 c, t dbSNP:786205008
937 937 c, g dbSNP:774525510
938 938 c, t dbSNP:786205009
958 958 c, t dbSNP:759790790
963 963 g, t dbSNP:587783640
965 965 a, g dbSNP:587783641
967 967 c, t dbSNP:767873754
970 970 c, g dbSNP:587783642
973 973 a, g, t dbSNP:121913678
996 996 -, acgtg dbSNP:786205010
1006 1006 c, t dbSNP:753051078
1007 1007 a, g dbSNP:587783643
1018 1018 a, g dbSNP:374673901
1042 1042 c, t dbSNP:764587853
1045 1045 c, t dbSNP:570340475
1051 1051 a, g dbSNP:757832735
1060 1060 a, g dbSNP:537686463
1066 1066 a, c dbSNP:745418016
1093 1093 c, t dbSNP:142067350
1115 1115 g, t dbSNP:779697567
1123 1123 c, t dbSNP:746727507
1132 1132 a, g dbSNP:267606827
1164 1164 c, g dbSNP:768320307
1171 1171 c, t dbSNP:781085552
1177 1177 -, c dbSNP:786205011
1185 1185 a, c, g dbSNP:748001255
1192 1192 c, t dbSNP:774246700
1197 1197 c, g dbSNP:150277632
1199 1199 a, g dbSNP:759699805
1201 1201 a, g dbSNP:772352099
1202 1202 g, t dbSNP:775851487
1207 1207 c, t dbSNP:761037576
1211 1211 c, g dbSNP:531378284
1213 1213 c, g dbSNP:368707795
1231 1231 c, t dbSNP:764343290
1234 1234 c, t dbSNP:754270265
1238 1238 a, g dbSNP:372086115
1240 1240 g, t dbSNP:765799544
1266 1266 a, g dbSNP:749879411
1279 1279 c, t dbSNP:758683336
1294 1294 a, g dbSNP:570981209
1306 1306 g, t dbSNP:139237860
1311 1311 g, t dbSNP:754695105
1312 1312 a, c dbSNP:780806885
1315 1315 c, t dbSNP:747996412
1327 1327 a, g dbSNP:538358023
1330 1330 c, t dbSNP:777855975
1351 1351 c, g dbSNP:749304229
1354 1354 c, g dbSNP:772266402
1355 1355 a, g dbSNP:202157686
1357 1357 c, g dbSNP:760777087
1358 1358 c, t dbSNP:768955242
1366 1366 c, g, t dbSNP:143223844
1369 1369 a, g dbSNP:147154860
1373 1373 c, t dbSNP:369673538
1390 1390 g, t dbSNP:750929202
1396 1396 c, t dbSNP:763497415
1403 1403 a, t dbSNP:765839485
1408 1408 a, c, g, t dbSNP:138747073
1411 1411 c, t dbSNP:201024952
1426 1426 c, g dbSNP:587783628
1441 1441 a, g dbSNP:34654108
1450 1450 c, t dbSNP:752366627
1456 1456 c, g dbSNP:786204999
1457 1457 c, t dbSNP:755931562
1462 1462 c, t dbSNP:777770149
1471 1471 c, g dbSNP:373079213
1480 1480 a, g dbSNP:757300535
1481 1481 c, t dbSNP:780242359
1486 1486 a, g dbSNP:747138265
1504 1504 a, g dbSNP:768706649
1519 1519 a, g dbSNP:776918484
1521 1521 c, t dbSNP:376242569
1524 1524 c, t dbSNP:770118439
1531 1531 c, t dbSNP:144434028
1537 1537 g, t dbSNP:763407540
1549 1549 c, t dbSNP:200639648
1556 1556 a, c dbSNP:1126890
1564 1564 c, t dbSNP:773791918
1573 1573 c, t dbSNP:759088580
1581 1581 c, g dbSNP:767003141
1592 1592 a, g dbSNP:752379833
1600 1600 c, g dbSNP:755772051
1603 1603 a, c, g dbSNP:369183477
1607 1607 c, t dbSNP:371279404
1608 1608 c, t dbSNP:779009924
1609 1609 c, g dbSNP:746997498
1619 1619 c, t dbSNP:755084543
1622 1622 c, t dbSNP:781189964
1636 1636 a, t dbSNP:748366405
1647 1647 a, g dbSNP:148410675
1652 1652 -, tct dbSNP:752282095
1657 1657 a, c, g, t dbSNP:142688661
1680 1680 a, t dbSNP:771359224
1682 1682 c, t dbSNP:774917687
1685 1685 c, t dbSNP:760019330
1686 1686 g, t dbSNP:373961431
1691 1691 a, c dbSNP:151157846
1696 1696 c, t dbSNP:377726805
1703 1703 -, a dbSNP:756488909
1706 1706 c, t dbSNP:760366406
1771 1771 -, c dbSNP:571467776
1771 1771 -, c dbSNP:68024132
1771 1771 c, g dbSNP:756027379
1778 1778 -, c dbSNP:397788971
1789 1789 c, g dbSNP:777601651
1801 1801 a, c dbSNP:749024013
1818 1818 a, c dbSNP:767550406
1835 1835 c, t dbSNP:111723999
1837 1837 a, g dbSNP:541185010
1895 1895 c, g dbSNP:757129013
1911 1911 a, g dbSNP:778907838
1942 1942 a, c dbSNP:559872899
2046 2046 c, g dbSNP:530143174
2066 2066 a, t dbSNP:754820747
2098 2098 -, a dbSNP:35458312
2106 2106 c, t dbSNP:548597291
2127 2127 c, t dbSNP:564009126
2151 2151 -, ctttt dbSNP:759727255
2152 2152 -, ctttt dbSNP:138317321
2156 2156 -, tcttt dbSNP:75768168
2169 2169 -, t dbSNP:547248498
2189 2189 c, t dbSNP:531237261
2222 2222 a, g dbSNP:1042761
2225 2225 c, t dbSNP:375413059
2233 2233 g, t dbSNP:191019765
2278 2278 a, g dbSNP:1042762
2290 2290 a, g dbSNP:565555663
2303 2303 a, g dbSNP:373061437
2412 2412 c, t dbSNP:540893672
2487 2487 c, t dbSNP:189418563
2515 2515 a, g dbSNP:554445894
2568 2568 a, g dbSNP:535183687
2571 2571 g, t dbSNP:1042766
2664 2664 a, g dbSNP:775044607
2789 2789 -, a dbSNP:372395431
2794 2794 c, t dbSNP:567312195
2847 2847 a, g dbSNP:181934041
2948 2948 c, t dbSNP:547209293
3044 3044 a, g dbSNP:565436089
3051 3051 c, t dbSNP:535885298
3055 3055 c, g dbSNP:554153484
3074 3074 a, g dbSNP:752609373

Target ORF information:

RefSeq Version NM_005249
Organism Homo sapiens (human)
Definition Homo sapiens forkhead box G1 (FOXG1), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.