Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

CLCF1 cardiotrophin-like cytokine factor 1 [Homo sapiens (human)]

Gene Symbol CLCF1
Entrez Gene ID 23529
Full Name cardiotrophin-like cytokine factor 1
Synonyms BSF-3, BSF3, CISS2, CLC, NNT-1, NNT1, NR6
General protein information
Preferred Names
cardiotrophin-like cytokine factor 1
cardiotrophin-like cytokine factor 1
novel neurotrophin-1
B-cell stimulating factor 3
B-cell stimulatory factor 3
B-cell-stimulating factor 3
CRLF1 associated cytokine-like factor 1
neurotrophin-1/B-cell stimulating factor-3
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene is a member of the glycoprotein (gp)130 cytokine family and encodes cardiotrophin-like cytokine factor 1 (CLCF1). CLCF1 forms a heterodimer complex with cytokine receptor-like factor 1 (CRLF1). This dimer competes with ciliary neurotrophic factor (CNTF) for binding to the ciliary neurotrophic factor receptor (CNTFR) complex, and activates the Jak-STAT signaling cascade. CLCF1 can be actively secreted from cells by forming a complex with soluble type I CRLF1 or soluble CNTFR. CLCF1 is a potent neurotrophic factor, B-cell stimulatory agent and neuroendocrine modulator of pituitary corticotroph function. Defects in CLCF1 cause cold-induced sweating syndrome 2 (CISS2). This syndrome is characterized by a profuse sweating after exposure to cold as well as congenital physical abnormalities of the head and spine. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]. lac of sum
Disorder MIM:


Disorder Html: Cold-induced sweating syndrome 1, 610313 (3)
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu16287 NM_013246 Homo sapiens cardiotrophin-like cytokine factor 1 (CLCF1), transcript variant 1, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00
OHu19127 NM_001166212 Homo sapiens cardiotrophin-like cytokine factor 1 (CLCF1), transcript variant 2, mRNA. pcDNA3.1-C-(k)DYK In stock 5-7 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu16287D
Sequence Information ORF Nucleotide Sequence (Length: 678bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product cardiotrophin-like cytokine factor 1 isoform 1 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BM846622.1 and BC012939.1. On Jul 28, 2004 this sequence version replaced gi:7019350. Summary: This gene is a member of the glycoprotein (gp)130 cytokine family and encodes cardiotrophin-like cytokine factor 1 (CLCF1). CLCF1 forms a heterodimer complex with cytokine receptor-like factor 1 (CRLF1). This dimer competes with ciliary neurotrophic factor (CNTF) for binding to the ciliary neurotrophic factor receptor (CNTFR) complex, and activates the Jak-STAT signaling cascade. CLCF1 can be actively secreted from cells by forming a complex with soluble type I CRLF1 or soluble CNTFR. CLCF1 is a potent neurotrophic factor, B-cell stimulatory agent and neuroendocrine modulator of pituitary corticotroph function. Defects in CLCF1 cause cold-induced sweating syndrome 2 (CISS2). This syndrome is characterized by a profuse sweating after exposure to cold as well as congenital physical abnormalities of the head and spine. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]. Transcript Variant: This variant (1) encodes the longer isoform (1). Though this isoform has a predicted signal peptide at amino acids 1-27, experiments show it is retained within the cell. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC012939.1, AF172854.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968189, SAMEA2153427 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)110..112(+)
Misc Feature(2)362..832(+)
Exon (1)1..212
Gene Synonym:
Exon (2)213..379
Gene Synonym:
Exon (3)380..1842
Gene Synonym:
Position Chain Variation Link
22 22 -, a dbSNP:35544864
29 29 a, c dbSNP:573036376
58 58 -, a dbSNP:765298833
103 103 a, g dbSNP:779594800
136 136 c, t dbSNP:554428933
147 147 c, t dbSNP:747599800
157 157 c, g dbSNP:778127677
165 165 g, t dbSNP:758862272
176 176 c, g dbSNP:112054504
182 182 c, t dbSNP:765530482
187 187 c, t dbSNP:755215558
191 191 a, c dbSNP:754020360
204 204 c, t dbSNP:766488948
205 205 c, g dbSNP:760653165
215 215 -, gactcg dbSNP:768669679
216 216 a, g dbSNP:566471248
218 218 c, t dbSNP:771570860
220 220 a, g dbSNP:141954460
224 224 a, g dbSNP:145282707
225 225 a, g dbSNP:140222264
226 226 g, t dbSNP:749650966
229 229 a, g dbSNP:780404936
234 234 c, t dbSNP:369213496
235 235 a, g dbSNP:376191009
241 241 a, g dbSNP:781167028
242 242 c, t dbSNP:137853934
247 247 a, g dbSNP:200379623
250 250 c, g dbSNP:752740163
259 259 a, c dbSNP:765259754
262 262 c, t dbSNP:759478800
271 271 a, g dbSNP:753589757
278 278 c, t dbSNP:766150197
284 284 c, t dbSNP:76168219
285 285 a, g dbSNP:772890565
295 295 c, t dbSNP:771535281
300 300 g, t dbSNP:184518539
304 304 a, t dbSNP:867193
308 308 c, t dbSNP:140759579
329 329 c, g dbSNP:749743060
336 336 c, g dbSNP:201269564
337 337 c, t dbSNP:770160336
338 338 c, g, t dbSNP:372255151
339 339 a, g dbSNP:369594545
340 340 a, c dbSNP:757479653
345 345 a, t dbSNP:751692316
347 347 a, g dbSNP:777940053
359 359 c, t dbSNP:560558450
360 360 a, g dbSNP:753771467
370 370 c, t dbSNP:541825951
373 373 a, g dbSNP:766128849
375 375 c, t dbSNP:137879055
394 394 a, c, g dbSNP:767245313
395 395 c, t dbSNP:544450000
401 401 c, t dbSNP:756930235
406 406 c, g, t dbSNP:763640141
407 407 a, g dbSNP:528341431
421 421 c, t dbSNP:775926530
422 422 c, g dbSNP:765776881
428 428 c, t dbSNP:567374288
429 429 a, g dbSNP:145294376
437 437 a, g dbSNP:140383361
438 438 c, t dbSNP:747274369
444 444 c, g dbSNP:773547381
445 445 a, t dbSNP:772337610
466 466 c, t dbSNP:748257910
467 467 c, t dbSNP:778794209
472 472 a, g dbSNP:145660153
475 475 a, g dbSNP:367649677
480 480 a, g dbSNP:781002061
487 487 c, t dbSNP:150131356
489 489 a, g dbSNP:563402891
493 493 a, c dbSNP:777397541
511 511 a, g dbSNP:757920303
517 517 a, c, t dbSNP:104894198
518 518 a, g dbSNP:764602656
545 545 g, t dbSNP:760120872
547 547 a, g dbSNP:754365534
548 548 c, t dbSNP:368762582
549 549 a, g dbSNP:761109106
554 554 c, t dbSNP:140841317
558 558 a, g dbSNP:371858892
560 560 c, g, t dbSNP:761887384
561 561 a, g dbSNP:151050272
566 566 a, g dbSNP:768583993
583 583 c, g dbSNP:745851012
584 584 a, c, t dbSNP:142875118
585 585 a, g dbSNP:746809332
587 587 c, t dbSNP:140020543
588 588 a, g dbSNP:34057094
589 589 a, c dbSNP:752250486
590 590 a, g dbSNP:778526790
600 600 a, g dbSNP:754424165
625 625 g, t dbSNP:754455483
629 629 c, g dbSNP:375238966
630 630 a, g dbSNP:766990125
635 635 a, g dbSNP:761200783
639 639 c, t dbSNP:750832975
640 640 a, g dbSNP:147960206
643 643 c, t dbSNP:762129649
644 644 a, g dbSNP:373018736
650 650 a, g dbSNP:768834730
652 652 a, g dbSNP:369389500
660 660 a, g dbSNP:559258400
677 677 c, t dbSNP:78755659
678 678 c, t dbSNP:140991132
679 679 a, g dbSNP:573454925
680 680 c, t dbSNP:144403804
683 683 c, t dbSNP:376016004
691 691 c, t dbSNP:747883491
696 696 c, g dbSNP:149603003
705 705 c, t dbSNP:754604226
718 718 c, t dbSNP:761340220
731 731 c, t dbSNP:779655296
733 733 c, t dbSNP:756714560
737 737 a, c dbSNP:750922975
745 745 c, t dbSNP:767970190
746 746 a, g dbSNP:757544375
749 749 -, gact dbSNP:781608807
750 750 g, t dbSNP:774182313
763 763 a, g dbSNP:751873046
767 767 c, t dbSNP:764224393
768 768 c, t dbSNP:763102849
775 775 c, g dbSNP:775567718
785 785 c, g dbSNP:76654399
786 786 g, t dbSNP:104894203
789 789 c, t dbSNP:542846121
790 790 a, g dbSNP:760645462
804 804 a, g dbSNP:369390178
805 805 c, t dbSNP:771960988
806 806 c, t dbSNP:747892666
807 807 a, g dbSNP:774130036
816 816 -, a dbSNP:757753759
819 819 -, aga dbSNP:747569629
825 825 a, g dbSNP:768439765
827 827 c, g dbSNP:748903281
830 830 c, t dbSNP:557074766
833 833 c, g dbSNP:374786448
847 847 c, t dbSNP:755658215
849 849 c, t dbSNP:746440997
851 851 c, t dbSNP:139364696
856 856 -, gggggct dbSNP:140997186
857 857 a, g dbSNP:757714256
860 860 a, g dbSNP:751882287
864 864 a, g dbSNP:764469094
865 865 c, t dbSNP:758650470
872 872 c, t dbSNP:137853935
875 875 a, c dbSNP:752884798
877 877 a, t dbSNP:368623631
893 893 c, t dbSNP:759598981
894 894 c, t dbSNP:370600571
895 895 a, g dbSNP:376316748
901 901 c, g, t dbSNP:774040224
923 923 c, t dbSNP:768535294
933 933 a, g dbSNP:769623807
950 950 a, c dbSNP:553306519
954 954 c, t dbSNP:778265043
967 967 c, t dbSNP:534631042
972 972 a, g dbSNP:567601969
1000 1000 c, t dbSNP:756801506
1001 1001 a, g dbSNP:116002422
1009 1009 g, t dbSNP:530769728
1018 1018 a, g dbSNP:73503948
1050 1050 g, t dbSNP:551194179
1056 1056 c, t dbSNP:72932728
1111 1111 a, c dbSNP:771003236
1116 1116 c, t dbSNP:200395167
1129 1129 -, gtggttcaggttggtgcagagat dbSNP:373822867
1168 1168 c, t dbSNP:559107969
1335 1335 a, t dbSNP:540986690
1412 1412 a, g dbSNP:778905712
1417 1417 a, g dbSNP:148796566
1426 1426 a, g dbSNP:561274469
1443 1443 a, c dbSNP:542905374
1479 1479 a, g dbSNP:575443412
1482 1482 -, agacc dbSNP:200359845
1485 1485 a, g dbSNP:777991825
1507 1507 a, g dbSNP:563494849
1519 1519 -, c dbSNP:35385218
1520 1520 c, g dbSNP:144359415
1544 1544 c, t dbSNP:578021857
1558 1558 g, t dbSNP:758667048
1565 1565 g, t dbSNP:553178998
1580 1580 c, t dbSNP:552636928
1593 1593 c, g dbSNP:184926921
1629 1629 -, t dbSNP:140450526
1661 1661 a, g dbSNP:574081532
1703 1703 -, g dbSNP:35896036
1736 1736 -, t dbSNP:752173228

Target ORF information:

RefSeq Version NM_013246
Organism Homo sapiens (human)
Definition Homo sapiens cardiotrophin-like cytokine factor 1 (CLCF1), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu19127D
Sequence Information ORF Nucleotide Sequence (Length: 648bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product cardiotrophin-like cytokine factor 1 isoform 2 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC393345.1, AK298052.1 and BC012939.1. This sequence is a reference standard in the RefSeqGene project. Summary: This gene is a member of the glycoprotein (gp)130 cytokine family and encodes cardiotrophin-like cytokine factor 1 (CLCF1). CLCF1 forms a heterodimer complex with cytokine receptor-like factor 1 (CRLF1). This dimer competes with ciliary neurotrophic factor (CNTF) for binding to the ciliary neurotrophic factor receptor (CNTFR) complex, and activates the Jak-STAT signaling cascade. CLCF1 can be actively secreted from cells by forming a complex with soluble type I CRLF1 or soluble CNTFR. CLCF1 is a potent neurotrophic factor, B-cell stimulatory agent and neuroendocrine modulator of pituitary corticotroph function. Defects in CLCF1 cause cold-induced sweating syndrome 2 (CISS2). This syndrome is characterized by a profuse sweating after exposure to cold as well as congenital physical abnormalities of the head and spine. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]. Transcript Variant: This variant (2) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (2) has a shorter N-terminus when compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK298052.1, BX497225.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1968189, SAMEA2145240 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)281..751(+)
Exon (1)1..131
Gene Synonym:
Exon (2)132..298
Gene Synonym:
Exon (3)299..1761
Gene Synonym:
Position Chain Variation Link
19 19 a, t dbSNP:573079554
71 71 a, g dbSNP:527916761
101 101 a, g dbSNP:547164488
134 134 -, gactcg dbSNP:768669679
135 135 a, g dbSNP:566471248
137 137 c, t dbSNP:771570860
139 139 a, g dbSNP:141954460
143 143 a, g dbSNP:145282707
144 144 a, g dbSNP:140222264
145 145 g, t dbSNP:749650966
148 148 a, g dbSNP:780404936
153 153 c, t dbSNP:369213496
154 154 a, g dbSNP:376191009
160 160 a, g dbSNP:781167028
161 161 c, t dbSNP:137853934
166 166 a, g dbSNP:200379623
169 169 c, g dbSNP:752740163
178 178 a, c dbSNP:765259754
181 181 c, t dbSNP:759478800
190 190 a, g dbSNP:753589757
197 197 c, t dbSNP:766150197
203 203 c, t dbSNP:76168219
204 204 a, g dbSNP:772890565
214 214 c, t dbSNP:771535281
219 219 g, t dbSNP:184518539
223 223 a, t dbSNP:867193
227 227 c, t dbSNP:140759579
248 248 c, g dbSNP:749743060
255 255 c, g dbSNP:201269564
256 256 c, t dbSNP:770160336
257 257 c, g, t dbSNP:372255151
258 258 a, g dbSNP:369594545
259 259 a, c dbSNP:757479653
264 264 a, t dbSNP:751692316
266 266 a, g dbSNP:777940053
278 278 c, t dbSNP:560558450
279 279 a, g dbSNP:753771467
289 289 c, t dbSNP:541825951
292 292 a, g dbSNP:766128849
294 294 c, t dbSNP:137879055
313 313 a, c, g dbSNP:767245313
314 314 c, t dbSNP:544450000
320 320 c, t dbSNP:756930235
325 325 c, g, t dbSNP:763640141
326 326 a, g dbSNP:528341431
340 340 c, t dbSNP:775926530
341 341 c, g dbSNP:765776881
347 347 c, t dbSNP:567374288
348 348 a, g dbSNP:145294376
356 356 a, g dbSNP:140383361
357 357 c, t dbSNP:747274369
363 363 c, g dbSNP:773547381
364 364 a, t dbSNP:772337610
385 385 c, t dbSNP:748257910
386 386 c, t dbSNP:778794209
391 391 a, g dbSNP:145660153
394 394 a, g dbSNP:367649677
399 399 a, g dbSNP:781002061
406 406 c, t dbSNP:150131356
408 408 a, g dbSNP:563402891
412 412 a, c dbSNP:777397541
430 430 a, g dbSNP:757920303
436 436 a, c, t dbSNP:104894198
437 437 a, g dbSNP:764602656
464 464 g, t dbSNP:760120872
466 466 a, g dbSNP:754365534
467 467 c, t dbSNP:368762582
468 468 a, g dbSNP:761109106
473 473 c, t dbSNP:140841317
477 477 a, g dbSNP:371858892
479 479 c, g, t dbSNP:761887384
480 480 a, g dbSNP:151050272
485 485 a, g dbSNP:768583993
502 502 c, g dbSNP:745851012
503 503 a, c, t dbSNP:142875118
504 504 a, g dbSNP:746809332
506 506 c, t dbSNP:140020543
507 507 a, g dbSNP:34057094
508 508 a, c dbSNP:752250486
509 509 a, g dbSNP:778526790
519 519 a, g dbSNP:754424165
544 544 g, t dbSNP:754455483
548 548 c, g dbSNP:375238966
549 549 a, g dbSNP:766990125
554 554 a, g dbSNP:761200783
558 558 c, t dbSNP:750832975
559 559 a, g dbSNP:147960206
562 562 c, t dbSNP:762129649
563 563 a, g dbSNP:373018736
569 569 a, g dbSNP:768834730
571 571 a, g dbSNP:369389500
579 579 a, g dbSNP:559258400
596 596 c, t dbSNP:78755659
597 597 c, t dbSNP:140991132
598 598 a, g dbSNP:573454925
599 599 c, t dbSNP:144403804
602 602 c, t dbSNP:376016004
610 610 c, t dbSNP:747883491
615 615 c, g dbSNP:149603003
624 624 c, t dbSNP:754604226
637 637 c, t dbSNP:761340220
650 650 c, t dbSNP:779655296
652 652 c, t dbSNP:756714560
656 656 a, c dbSNP:750922975
664 664 c, t dbSNP:767970190
665 665 a, g dbSNP:757544375
668 668 -, gact dbSNP:781608807
669 669 g, t dbSNP:774182313
682 682 a, g dbSNP:751873046
686 686 c, t dbSNP:764224393
687 687 c, t dbSNP:763102849
694 694 c, g dbSNP:775567718
704 704 c, g dbSNP:76654399
705 705 g, t dbSNP:104894203
708 708 c, t dbSNP:542846121
709 709 a, g dbSNP:760645462
723 723 a, g dbSNP:369390178
724 724 c, t dbSNP:771960988
725 725 c, t dbSNP:747892666
726 726 a, g dbSNP:774130036
735 735 -, a dbSNP:757753759
738 738 -, aga dbSNP:747569629
744 744 a, g dbSNP:768439765
746 746 c, g dbSNP:748903281
749 749 c, t dbSNP:557074766
752 752 c, g dbSNP:374786448
766 766 c, t dbSNP:755658215
768 768 c, t dbSNP:746440997
770 770 c, t dbSNP:139364696
775 775 -, gggggct dbSNP:140997186
776 776 a, g dbSNP:757714256
779 779 a, g dbSNP:751882287
783 783 a, g dbSNP:764469094
784 784 c, t dbSNP:758650470
791 791 c, t dbSNP:137853935
794 794 a, c dbSNP:752884798
796 796 a, t dbSNP:368623631
812 812 c, t dbSNP:759598981
813 813 c, t dbSNP:370600571
814 814 a, g dbSNP:376316748
820 820 c, g, t dbSNP:774040224
842 842 c, t dbSNP:768535294
852 852 a, g dbSNP:769623807
869 869 a, c dbSNP:553306519
873 873 c, t dbSNP:778265043
886 886 c, t dbSNP:534631042
891 891 a, g dbSNP:567601969
919 919 c, t dbSNP:756801506
920 920 a, g dbSNP:116002422
928 928 g, t dbSNP:530769728
937 937 a, g dbSNP:73503948
969 969 g, t dbSNP:551194179
975 975 c, t dbSNP:72932728
1030 1030 a, c dbSNP:771003236
1035 1035 c, t dbSNP:200395167
1048 1048 -, gtggttcaggttggtgcagagat dbSNP:373822867
1087 1087 c, t dbSNP:559107969
1254 1254 a, t dbSNP:540986690
1331 1331 a, g dbSNP:778905712
1336 1336 a, g dbSNP:148796566
1345 1345 a, g dbSNP:561274469
1362 1362 a, c dbSNP:542905374
1398 1398 a, g dbSNP:575443412
1401 1401 -, agacc dbSNP:200359845
1404 1404 a, g dbSNP:777991825
1426 1426 a, g dbSNP:563494849
1438 1438 -, c dbSNP:35385218
1439 1439 c, g dbSNP:144359415
1463 1463 c, t dbSNP:578021857
1477 1477 g, t dbSNP:758667048
1484 1484 g, t dbSNP:553178998
1499 1499 c, t dbSNP:552636928
1512 1512 c, g dbSNP:184926921
1548 1548 -, t dbSNP:140450526
1580 1580 a, g dbSNP:574081532
1622 1622 -, g dbSNP:35896036
1655 1655 -, t dbSNP:752173228

Target ORF information:

RefSeq Version NM_001166212
Organism Homo sapiens (human)
Definition Homo sapiens cardiotrophin-like cytokine factor 1 (CLCF1), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.