×

CLCF1 cDNA ORF clone, Homo sapiens (human)

Gene Symbol CLCF1
Entrez Gene ID 23529
Full Name cardiotrophin-like cytokine factor 1
Synonyms BSF-3, BSF3, CISS2, CLC, NNT-1, NNT1, NR6
General protein information
Preferred Names
cardiotrophin-like cytokine factor 1
Names
cardiotrophin-like cytokine factor 1
novel neurotrophin-1
B-cell stimulating factor 3
B-cell stimulatory factor 3
B-cell-stimulating factor 3
CRLF1 associated cytokine-like factor 1
neurotrophin-1/B-cell stimulating factor-3
Gene Type protein-coding
Organism Homo sapiens (human)
Genome

11

11q13.3

Summary This gene is a member of the glycoprotein (gp)130 cytokine family and encodes cardiotrophin-like cytokine factor 1 (CLCF1). CLCF1 forms a heterodimer complex with cytokine receptor-like factor 1 (CRLF1). This dimer competes with ciliary neurotrophic factor (CNTF) for binding to the ciliary neurotrophic factor receptor (CNTFR) complex, and activates the Jak-STAT signaling cascade. CLCF1 can be actively secreted from cells by forming a complex with soluble type I CRLF1 or soluble CNTFR. CLCF1 is a potent neurotrophic factor, B-cell stimulatory agent and neuroendocrine modulator of pituitary corticotroph function. Defects in CLCF1 cause cold-induced sweating syndrome 2 (CISS2). This syndrome is characterized by a profuse sweating after exposure to cold as well as congenital physical abnormalities of the head and spine. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]. lac of sum
Disorder MIM:

607672

Disorder Html: Cold-induced sweating syndrome 1, 610313 (3)





The following CLCF1 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the CLCF1 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu16287 NM_013246 Homo sapiens cardiotrophin-like cytokine factor 1 (CLCF1), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
$69.30
$99.00
OHu19127 NM_001166212 Homo sapiens cardiotrophin-like cytokine factor 1 (CLCF1), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK
$139.30
$199.00

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.


CloneID OHu16287
Accession Version NM_013246.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 678bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product cardiotrophin-like cytokine factor 1 isoform 1 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BM846622.1 and BC012939.1. On Jul 28, 2004 this sequence version replaced gi:7019350. Summary: This gene is a member of the glycoprotein (gp)130 cytokine family and encodes cardiotrophin-like cytokine factor 1 (CLCF1). CLCF1 forms a heterodimer complex with cytokine receptor-like factor 1 (CRLF1). This dimer competes with ciliary neurotrophic factor (CNTF) for binding to the ciliary neurotrophic factor receptor (CNTFR) complex, and activates the Jak-STAT signaling cascade. CLCF1 can be actively secreted from cells by forming a complex with soluble type I CRLF1 or soluble CNTFR. CLCF1 is a potent neurotrophic factor, B-cell stimulatory agent and neuroendocrine modulator of pituitary corticotroph function. Defects in CLCF1 cause cold-induced sweating syndrome 2 (CISS2). This syndrome is characterized by a profuse sweating after exposure to cold as well as congenital physical abnormalities of the head and spine. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]. Transcript Variant: This variant (1) encodes the longer isoform (1). Though this isoform has a predicted signal peptide at amino acids 1-27, experiments show it is retained within the cell. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC012939.1, AF172854.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA1968189, SAMEA2153427 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
661
ATGGACCTCC GAGCAGGGGA CTCGTGGGGG ATGTTAGCGT GCCTGTGCAC GGTGCTCTGG 
CACCTCCCTG CAGTGCCAGC TCTCAATCGC ACAGGGGACC CAGGGCCTGG CCCCTCCATC
CAGAAAACCT ATGACCTCAC CCGCTACCTG GAGCACCAAC TCCGCAGCTT GGCTGGGACC
TATCTGAACT ACCTGGGCCC CCCTTTCAAC GAGCCAGACT TCAACCCTCC CCGCCTGGGG
GCAGAGACTC TGCCCAGGGC CACTGTTGAC TTGGAGGTGT GGCGAAGCCT CAATGACAAA
CTGCGGCTGA CCCAGAACTA CGAGGCCTAC AGCCACCTTC TGTGTTACTT GCGTGGCCTC
AACCGTCAGG CTGCCACTGC TGAGCTGCGC CGCAGCCTGG CCCACTTCTG CACCAGCCTC
CAGGGCCTGC TGGGCAGCAT TGCGGGCGTC ATGGCAGCTC TGGGCTACCC ACTGCCCCAG
CCGCTGCCTG GGACTGAACC CACTTGGACT CCTGGCCCTG CCCACAGTGA CTTCCTCCAG
AAGATGGACG ACTTCTGGCT GCTGAAGGAG CTGCAGACCT GGCTGTGGCG CTCGGCCAAG
GACTTCAACC GGCTCAAGAA GAAGATGCAG CCTCCAGCAG CTGCAGTCAC CCTGCACCTG
GGGGCTCATG GCTTCTGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

RefSeqNP_037378.1
CDS197..874
Misc Feature(1)110..112(+)
Misc Feature(2)362..832(+)
Exon (1)1..212
Gene:CLCF1
Gene Synonym:
Exon (2)213..379
Gene:CLCF1
Gene Synonym:
Exon (3)380..1842
Gene:CLCF1
Gene Synonym:
Translation
Position Chain Variation Link
22 22 -, a dbSNP:35544864
29 29 a, c dbSNP:573036376
58 58 -, a dbSNP:765298833
103 103 a, g dbSNP:779594800
136 136 c, t dbSNP:554428933
147 147 c, t dbSNP:747599800
157 157 c, g dbSNP:778127677
165 165 g, t dbSNP:758862272
176 176 c, g dbSNP:112054504
182 182 c, t dbSNP:765530482
187 187 c, t dbSNP:755215558
191 191 a, c dbSNP:754020360
204 204 c, t dbSNP:766488948
205 205 c, g dbSNP:760653165
215 215 -, gactcg dbSNP:768669679
216 216 a, g dbSNP:566471248
218 218 c, t dbSNP:771570860
220 220 a, g dbSNP:141954460
224 224 a, g dbSNP:145282707
225 225 a, g dbSNP:140222264
226 226 g, t dbSNP:749650966
229 229 a, g dbSNP:780404936
234 234 c, t dbSNP:369213496
235 235 a, g dbSNP:376191009
241 241 a, g dbSNP:781167028
242 242 c, t dbSNP:137853934
247 247 a, g dbSNP:200379623
250 250 c, g dbSNP:752740163
259 259 a, c dbSNP:765259754
262 262 c, t dbSNP:759478800
271 271 a, g dbSNP:753589757
278 278 c, t dbSNP:766150197
284 284 c, t dbSNP:76168219
285 285 a, g dbSNP:772890565
295 295 c, t dbSNP:771535281
300 300 g, t dbSNP:184518539
304 304 a, t dbSNP:867193
308 308 c, t dbSNP:140759579
329 329 c, g dbSNP:749743060
336 336 c, g dbSNP:201269564
337 337 c, t dbSNP:770160336
338 338 c, g, t dbSNP:372255151
339 339 a, g dbSNP:369594545
340 340 a, c dbSNP:757479653
345 345 a, t dbSNP:751692316
347 347 a, g dbSNP:777940053
359 359 c, t dbSNP:560558450
360 360 a, g dbSNP:753771467
370 370 c, t dbSNP:541825951
373 373 a, g dbSNP:766128849
375 375 c, t dbSNP:137879055
394 394 a, c, g dbSNP:767245313
395 395 c, t dbSNP:544450000
401 401 c, t dbSNP:756930235
406 406 c, g, t dbSNP:763640141
407 407 a, g dbSNP:528341431
421 421 c, t dbSNP:775926530
422 422 c, g dbSNP:765776881
428 428 c, t dbSNP:567374288
429 429 a, g dbSNP:145294376
437 437 a, g dbSNP:140383361
438 438 c, t dbSNP:747274369
444 444 c, g dbSNP:773547381
445 445 a, t dbSNP:772337610
466 466 c, t dbSNP:748257910
467 467 c, t dbSNP:778794209
472 472 a, g dbSNP:145660153
475 475 a, g dbSNP:367649677
480 480 a, g dbSNP:781002061
487 487 c, t dbSNP:150131356
489 489 a, g dbSNP:563402891
493 493 a, c dbSNP:777397541
511 511 a, g dbSNP:757920303
517 517 a, c, t dbSNP:104894198
518 518 a, g dbSNP:764602656
545 545 g, t dbSNP:760120872
547 547 a, g dbSNP:754365534
548 548 c, t dbSNP:368762582
549 549 a, g dbSNP:761109106
554 554 c, t dbSNP:140841317
558 558 a, g dbSNP:371858892
560 560 c, g, t dbSNP:761887384
561 561 a, g dbSNP:151050272
566 566 a, g dbSNP:768583993
583 583 c, g dbSNP:745851012
584 584 a, c, t dbSNP:142875118
585 585 a, g dbSNP:746809332
587 587 c, t dbSNP:140020543
588 588 a, g dbSNP:34057094
589 589 a, c dbSNP:752250486
590 590 a, g dbSNP:778526790
600 600 a, g dbSNP:754424165
625 625 g, t dbSNP:754455483
629 629 c, g dbSNP:375238966
630 630 a, g dbSNP:766990125
635 635 a, g dbSNP:761200783
639 639 c, t dbSNP:750832975
640 640 a, g dbSNP:147960206
643 643 c, t dbSNP:762129649
644 644 a, g dbSNP:373018736
650 650 a, g dbSNP:768834730
652 652 a, g dbSNP:369389500
660 660 a, g dbSNP:559258400
677 677 c, t dbSNP:78755659
678 678 c, t dbSNP:140991132
679 679 a, g dbSNP:573454925
680 680 c, t dbSNP:144403804
683 683 c, t dbSNP:376016004
691 691 c, t dbSNP:747883491
696 696 c, g dbSNP:149603003
705 705 c, t dbSNP:754604226
718 718 c, t dbSNP:761340220
731 731 c, t dbSNP:779655296
733 733 c, t dbSNP:756714560
737 737 a, c dbSNP:750922975
745 745 c, t dbSNP:767970190
746 746 a, g dbSNP:757544375
749 749 -, gact dbSNP:781608807
750 750 g, t dbSNP:774182313
763 763 a, g dbSNP:751873046
767 767 c, t dbSNP:764224393
768 768 c, t dbSNP:763102849
775 775 c, g dbSNP:775567718
785 785 c, g dbSNP:76654399
786 786 g, t dbSNP:104894203
789 789 c, t dbSNP:542846121
790 790 a, g dbSNP:760645462
804 804 a, g dbSNP:369390178
805 805 c, t dbSNP:771960988
806 806 c, t dbSNP:747892666
807 807 a, g dbSNP:774130036
816 816 -, a dbSNP:757753759
819 819 -, aga dbSNP:747569629
825 825 a, g dbSNP:768439765
827 827 c, g dbSNP:748903281
830 830 c, t dbSNP:557074766
833 833 c, g dbSNP:374786448
847 847 c, t dbSNP:755658215
849 849 c, t dbSNP:746440997
851 851 c, t dbSNP:139364696
856 856 -, gggggct dbSNP:140997186
857 857 a, g dbSNP:757714256
860 860 a, g dbSNP:751882287
864 864 a, g dbSNP:764469094
865 865 c, t dbSNP:758650470
872 872 c, t dbSNP:137853935
875 875 a, c dbSNP:752884798
877 877 a, t dbSNP:368623631
893 893 c, t dbSNP:759598981
894 894 c, t dbSNP:370600571
895 895 a, g dbSNP:376316748
901 901 c, g, t dbSNP:774040224
923 923 c, t dbSNP:768535294
933 933 a, g dbSNP:769623807
950 950 a, c dbSNP:553306519
954 954 c, t dbSNP:778265043
967 967 c, t dbSNP:534631042
972 972 a, g dbSNP:567601969
1000 1000 c, t dbSNP:756801506
1001 1001 a, g dbSNP:116002422
1009 1009 g, t dbSNP:530769728
1018 1018 a, g dbSNP:73503948
1050 1050 g, t dbSNP:551194179
1056 1056 c, t dbSNP:72932728
1111 1111 a, c dbSNP:771003236
1116 1116 c, t dbSNP:200395167
1129 1129 -, gtggttcaggttggtgcagagat dbSNP:373822867
1168 1168 c, t dbSNP:559107969
1335 1335 a, t dbSNP:540986690
1412 1412 a, g dbSNP:778905712
1417 1417 a, g dbSNP:148796566
1426 1426 a, g dbSNP:561274469
1443 1443 a, c dbSNP:542905374
1479 1479 a, g dbSNP:575443412
1482 1482 -, agacc dbSNP:200359845
1485 1485 a, g dbSNP:777991825
1507 1507 a, g dbSNP:563494849
1519 1519 -, c dbSNP:35385218
1520 1520 c, g dbSNP:144359415
1544 1544 c, t dbSNP:578021857
1558 1558 g, t dbSNP:758667048
1565 1565 g, t dbSNP:553178998
1580 1580 c, t dbSNP:552636928
1593 1593 c, g dbSNP:184926921
1629 1629 -, t dbSNP:140450526
1661 1661 a, g dbSNP:574081532
1703 1703 -, g dbSNP:35896036
1736 1736 -, t dbSNP:752173228

Target ORF information:

RefSeq Version NM_013246
Organism Homo sapiens (human)
Definition Homo sapiens cardiotrophin-like cytokine factor 1 (CLCF1), transcript variant 1, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_013246

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
661
ATGGACCTCC GAGCAGGGGA CTCGTGGGGG ATGTTAGCGT GCCTGTGCAC GGTGCTCTGG 
CACCTCCCTG CAGTGCCAGC TCTCAATCGC ACAGGGGACC CAGGGCCTGG CCCCTCCATC
CAGAAAACCT ATGACCTCAC CCGCTACCTG GAGCACCAAC TCCGCAGCTT GGCTGGGACC
TATCTGAACT ACCTGGGCCC CCCTTTCAAC GAGCCAGACT TCAACCCTCC CCGCCTGGGG
GCAGAGACTC TGCCCAGGGC CACTGTTGAC TTGGAGGTGT GGCGAAGCCT CAATGACAAA
CTGCGGCTGA CCCAGAACTA CGAGGCCTAC AGCCACCTTC TGTGTTACTT GCGTGGCCTC
AACCGTCAGG CTGCCACTGC TGAGCTGCGC CGCAGCCTGG CCCACTTCTG CACCAGCCTC
CAGGGCCTGC TGGGCAGCAT TGCGGGCGTC ATGGCAGCTC TGGGCTACCC ACTGCCCCAG
CCGCTGCCTG GGACTGAACC CACTTGGACT CCTGGCCCTG CCCACAGTGA CTTCCTCCAG
AAGATGGACG ACTTCTGGCT GCTGAAGGAG CTGCAGACCT GGCTGTGGCG CTCGGCCAAG
GACTTCAACC GGCTCAAGAA GAAGATGCAG CCTCCAGCAG CTGCAGTCAC CCTGCACCTG
GGGGCTCATG GCTTCTGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu19127
Accession Version NM_001166212.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 648bp)
Protein sequence
SNP
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product cardiotrophin-like cytokine factor 1 isoform 2 precursor
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC393345.1, AK298052.1 and BC012939.1. This sequence is a reference standard in the RefSeqGene project. Summary: This gene is a member of the glycoprotein (gp)130 cytokine family and encodes cardiotrophin-like cytokine factor 1 (CLCF1). CLCF1 forms a heterodimer complex with cytokine receptor-like factor 1 (CRLF1). This dimer competes with ciliary neurotrophic factor (CNTF) for binding to the ciliary neurotrophic factor receptor (CNTFR) complex, and activates the Jak-STAT signaling cascade. CLCF1 can be actively secreted from cells by forming a complex with soluble type I CRLF1 or soluble CNTFR. CLCF1 is a potent neurotrophic factor, B-cell stimulatory agent and neuroendocrine modulator of pituitary corticotroph function. Defects in CLCF1 cause cold-induced sweating syndrome 2 (CISS2). This syndrome is characterized by a profuse sweating after exposure to cold as well as congenital physical abnormalities of the head and spine. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]. Transcript Variant: This variant (2) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (2) has a shorter N-terminus when compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK298052.1, BX497225.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1968189, SAMEA2145240 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.

1
61
121
181
241
301
361
421
481
541
601
ATGTTAGCGT GCCTGTGCAC GGTGCTCTGG CACCTCCCTG CAGTGCCAGC TCTCAATCGC 
ACAGGGGACC CAGGGCCTGG CCCCTCCATC CAGAAAACCT ATGACCTCAC CCGCTACCTG
GAGCACCAAC TCCGCAGCTT GGCTGGGACC TATCTGAACT ACCTGGGCCC CCCTTTCAAC
GAGCCAGACT TCAACCCTCC CCGCCTGGGG GCAGAGACTC TGCCCAGGGC CACTGTTGAC
TTGGAGGTGT GGCGAAGCCT CAATGACAAA CTGCGGCTGA CCCAGAACTA CGAGGCCTAC
AGCCACCTTC TGTGTTACTT GCGTGGCCTC AACCGTCAGG CTGCCACTGC TGAGCTGCGC
CGCAGCCTGG CCCACTTCTG CACCAGCCTC CAGGGCCTGC TGGGCAGCAT TGCGGGCGTC
ATGGCAGCTC TGGGCTACCC ACTGCCCCAG CCGCTGCCTG GGACTGAACC CACTTGGACT
CCTGGCCCTG CCCACAGTGA CTTCCTCCAG AAGATGGACG ACTTCTGGCT GCTGAAGGAG
CTGCAGACCT GGCTGTGGCG CTCGGCCAAG GACTTCAACC GGCTCAAGAA GAAGATGCAG
CCTCCAGCAG CTGCAGTCAC CCTGCACCTG GGGGCTCATG GCTTCTGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

RefSeqNP_001159684.1
CDS146..793
Misc Feature(1)281..751(+)
Exon (1)1..131
Gene:CLCF1
Gene Synonym:
Exon (2)132..298
Gene:CLCF1
Gene Synonym:
Exon (3)299..1761
Gene:CLCF1
Gene Synonym:
Translation
Position Chain Variation Link
19 19 a, t dbSNP:573079554
71 71 a, g dbSNP:527916761
101 101 a, g dbSNP:547164488
134 134 -, gactcg dbSNP:768669679
135 135 a, g dbSNP:566471248
137 137 c, t dbSNP:771570860
139 139 a, g dbSNP:141954460
143 143 a, g dbSNP:145282707
144 144 a, g dbSNP:140222264
145 145 g, t dbSNP:749650966
148 148 a, g dbSNP:780404936
153 153 c, t dbSNP:369213496
154 154 a, g dbSNP:376191009
160 160 a, g dbSNP:781167028
161 161 c, t dbSNP:137853934
166 166 a, g dbSNP:200379623
169 169 c, g dbSNP:752740163
178 178 a, c dbSNP:765259754
181 181 c, t dbSNP:759478800
190 190 a, g dbSNP:753589757
197 197 c, t dbSNP:766150197
203 203 c, t dbSNP:76168219
204 204 a, g dbSNP:772890565
214 214 c, t dbSNP:771535281
219 219 g, t dbSNP:184518539
223 223 a, t dbSNP:867193
227 227 c, t dbSNP:140759579
248 248 c, g dbSNP:749743060
255 255 c, g dbSNP:201269564
256 256 c, t dbSNP:770160336
257 257 c, g, t dbSNP:372255151
258 258 a, g dbSNP:369594545
259 259 a, c dbSNP:757479653
264 264 a, t dbSNP:751692316
266 266 a, g dbSNP:777940053
278 278 c, t dbSNP:560558450
279 279 a, g dbSNP:753771467
289 289 c, t dbSNP:541825951
292 292 a, g dbSNP:766128849
294 294 c, t dbSNP:137879055
313 313 a, c, g dbSNP:767245313
314 314 c, t dbSNP:544450000
320 320 c, t dbSNP:756930235
325 325 c, g, t dbSNP:763640141
326 326 a, g dbSNP:528341431
340 340 c, t dbSNP:775926530
341 341 c, g dbSNP:765776881
347 347 c, t dbSNP:567374288
348 348 a, g dbSNP:145294376
356 356 a, g dbSNP:140383361
357 357 c, t dbSNP:747274369
363 363 c, g dbSNP:773547381
364 364 a, t dbSNP:772337610
385 385 c, t dbSNP:748257910
386 386 c, t dbSNP:778794209
391 391 a, g dbSNP:145660153
394 394 a, g dbSNP:367649677
399 399 a, g dbSNP:781002061
406 406 c, t dbSNP:150131356
408 408 a, g dbSNP:563402891
412 412 a, c dbSNP:777397541
430 430 a, g dbSNP:757920303
436 436 a, c, t dbSNP:104894198
437 437 a, g dbSNP:764602656
464 464 g, t dbSNP:760120872
466 466 a, g dbSNP:754365534
467 467 c, t dbSNP:368762582
468 468 a, g dbSNP:761109106
473 473 c, t dbSNP:140841317
477 477 a, g dbSNP:371858892
479 479 c, g, t dbSNP:761887384
480 480 a, g dbSNP:151050272
485 485 a, g dbSNP:768583993
502 502 c, g dbSNP:745851012
503 503 a, c, t dbSNP:142875118
504 504 a, g dbSNP:746809332
506 506 c, t dbSNP:140020543
507 507 a, g dbSNP:34057094
508 508 a, c dbSNP:752250486
509 509 a, g dbSNP:778526790
519 519 a, g dbSNP:754424165
544 544 g, t dbSNP:754455483
548 548 c, g dbSNP:375238966
549 549 a, g dbSNP:766990125
554 554 a, g dbSNP:761200783
558 558 c, t dbSNP:750832975
559 559 a, g dbSNP:147960206
562 562 c, t dbSNP:762129649
563 563 a, g dbSNP:373018736
569 569 a, g dbSNP:768834730
571 571 a, g dbSNP:369389500
579 579 a, g dbSNP:559258400
596 596 c, t dbSNP:78755659
597 597 c, t dbSNP:140991132
598 598 a, g dbSNP:573454925
599 599 c, t dbSNP:144403804
602 602 c, t dbSNP:376016004
610 610 c, t dbSNP:747883491
615 615 c, g dbSNP:149603003
624 624 c, t dbSNP:754604226
637 637 c, t dbSNP:761340220
650 650 c, t dbSNP:779655296
652 652 c, t dbSNP:756714560
656 656 a, c dbSNP:750922975
664 664 c, t dbSNP:767970190
665 665 a, g dbSNP:757544375
668 668 -, gact dbSNP:781608807
669 669 g, t dbSNP:774182313
682 682 a, g dbSNP:751873046
686 686 c, t dbSNP:764224393
687 687 c, t dbSNP:763102849
694 694 c, g dbSNP:775567718
704 704 c, g dbSNP:76654399
705 705 g, t dbSNP:104894203
708 708 c, t dbSNP:542846121
709 709 a, g dbSNP:760645462
723 723 a, g dbSNP:369390178
724 724 c, t dbSNP:771960988
725 725 c, t dbSNP:747892666
726 726 a, g dbSNP:774130036
735 735 -, a dbSNP:757753759
738 738 -, aga dbSNP:747569629
744 744 a, g dbSNP:768439765
746 746 c, g dbSNP:748903281
749 749 c, t dbSNP:557074766
752 752 c, g dbSNP:374786448
766 766 c, t dbSNP:755658215
768 768 c, t dbSNP:746440997
770 770 c, t dbSNP:139364696
775 775 -, gggggct dbSNP:140997186
776 776 a, g dbSNP:757714256
779 779 a, g dbSNP:751882287
783 783 a, g dbSNP:764469094
784 784 c, t dbSNP:758650470
791 791 c, t dbSNP:137853935
794 794 a, c dbSNP:752884798
796 796 a, t dbSNP:368623631
812 812 c, t dbSNP:759598981
813 813 c, t dbSNP:370600571
814 814 a, g dbSNP:376316748
820 820 c, g, t dbSNP:774040224
842 842 c, t dbSNP:768535294
852 852 a, g dbSNP:769623807
869 869 a, c dbSNP:553306519
873 873 c, t dbSNP:778265043
886 886 c, t dbSNP:534631042
891 891 a, g dbSNP:567601969
919 919 c, t dbSNP:756801506
920 920 a, g dbSNP:116002422
928 928 g, t dbSNP:530769728
937 937 a, g dbSNP:73503948
969 969 g, t dbSNP:551194179
975 975 c, t dbSNP:72932728
1030 1030 a, c dbSNP:771003236
1035 1035 c, t dbSNP:200395167
1048 1048 -, gtggttcaggttggtgcagagat dbSNP:373822867
1087 1087 c, t dbSNP:559107969
1254 1254 a, t dbSNP:540986690
1331 1331 a, g dbSNP:778905712
1336 1336 a, g dbSNP:148796566
1345 1345 a, g dbSNP:561274469
1362 1362 a, c dbSNP:542905374
1398 1398 a, g dbSNP:575443412
1401 1401 -, agacc dbSNP:200359845
1404 1404 a, g dbSNP:777991825
1426 1426 a, g dbSNP:563494849
1438 1438 -, c dbSNP:35385218
1439 1439 c, g dbSNP:144359415
1463 1463 c, t dbSNP:578021857
1477 1477 g, t dbSNP:758667048
1484 1484 g, t dbSNP:553178998
1499 1499 c, t dbSNP:552636928
1512 1512 c, g dbSNP:184926921
1548 1548 -, t dbSNP:140450526
1580 1580 a, g dbSNP:574081532
1622 1622 -, g dbSNP:35896036
1655 1655 -, t dbSNP:752173228

Target ORF information:

RefSeq Version NM_001166212
Organism Homo sapiens (human)
Definition Homo sapiens cardiotrophin-like cytokine factor 1 (CLCF1), transcript variant 2, mRNA.

Target ORF information:

Epitope DYKDDDDK
Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK
NM_001166212

ORF Insert Sequence:

1
61
121
181
241
301
361
421
481
541
601
ATGTTAGCGT GCCTGTGCAC GGTGCTCTGG CACCTCCCTG CAGTGCCAGC TCTCAATCGC 
ACAGGGGACC CAGGGCCTGG CCCCTCCATC CAGAAAACCT ATGACCTCAC CCGCTACCTG
GAGCACCAAC TCCGCAGCTT GGCTGGGACC TATCTGAACT ACCTGGGCCC CCCTTTCAAC
GAGCCAGACT TCAACCCTCC CCGCCTGGGG GCAGAGACTC TGCCCAGGGC CACTGTTGAC
TTGGAGGTGT GGCGAAGCCT CAATGACAAA CTGCGGCTGA CCCAGAACTA CGAGGCCTAC
AGCCACCTTC TGTGTTACTT GCGTGGCCTC AACCGTCAGG CTGCCACTGC TGAGCTGCGC
CGCAGCCTGG CCCACTTCTG CACCAGCCTC CAGGGCCTGC TGGGCAGCAT TGCGGGCGTC
ATGGCAGCTC TGGGCTACCC ACTGCCCCAG CCGCTGCCTG GGACTGAACC CACTTGGACT
CCTGGCCCTG CCCACAGTGA CTTCCTCCAG AAGATGGACG ACTTCTGGCT GCTGAAGGAG
CTGCAGACCT GGCTGTGGCG CTCGGCCAAG GACTTCAACC GGCTCAAGAA GAAGATGCAG
CCTCCAGCAG CTGCAGTCAC CCTGCACCTG GGGGCTCATG GCTTCTGA

The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

 
*
*
*
*