
G6PD cDNA ORF clone, Homo sapiens (human)

Gene Symbol G6PD
Entrez Gene ID 2539
Full Name glucose-6-phosphate dehydrogenase
Synonyms G6PD1
General protein information
Preferred Names
glucose-6-phosphate 1-dehydrogenase
glucose-6-phosphate 1-dehydrogenase
glucose-6-phosphate dehydrogenase, G6PD
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes glucose-6-phosphate dehydrogenase. This protein is a cytosolic enzyme encoded by a housekeeping X-linked gene whose main function is to produce NADPH, a key electron donor in the defense against oxidizing agents and in reductive biosynthetic reactions. G6PD is remarkable for its genetic diversity. Many variants of G6PD, mostly produced from missense mutations, have been described with wide ranging levels of enzyme activity and associated clinical symptoms. G6PD deficiency may cause neonatal jaundice, acute hemolysis, or severe chronic non-spherocytic hemolytic anemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: G6PD deficiency (3); Favism (3); Hemolytic anemia due

mRNA and Protein(s)

mRNA Protein Name
XM_005274657 XP_005274714 glucose-6-phosphate 1-dehydrogenase isoform X1
XM_005274658 XP_005274715 glucose-6-phosphate 1-dehydrogenase isoform X2
XM_011531132 XP_011529434 glucose-6-phosphate 1-dehydrogenase isoform X3
NM_000402 NP_000393 glucose-6-phosphate 1-dehydrogenase isoform a
NM_001042351 NP_001035810 glucose-6-phosphate 1-dehydrogenase isoform b

hsa00030 Pentose phosphate pathway
hsa00480 Glutathione metabolism
hsa01100 Metabolic pathways
hsa_M00004 Pentose phosphate pathway (Pentose phosphate cycle)
hsa_M00006 Pentose phosphate pathway, oxidative phase, glucose 6P => ribulose 5P
hsa05230 Central carbon metabolism in cancer
hsa01130 Biosynthesis of antibiotics
hsa01200 Carbon metabolism
R-HSA-74160 Gene Expression
R-HSA-212436 Generic Transcription Pathway
R-HSA-1430728 Metabolism
R-HSA-71387 Metabolism of carbohydrates
R-HSA-71336 Pentose phosphate pathway (hexose monophosphate shunt)
WP100 Glutathione metabolism
WP134 Pentose Phosphate Pathway
WP692 Sulfation Biotransformation Reaction
HUMAN_PENTOSE-P-PWY pentose phosphate pathway
META_OXIDATIVEPENT-PWY pentose phosphate pathway (oxidative branch)
HUMAN_OXIDATIVEPENT-PWY-1 pentose phosphate pathway (oxidative branch)

Homo sapiens (human) G6PD NP_000393.4
Macaca mulatta (Rhesus monkey) G6PD XP_001095382.1
Canis lupus familiaris (dog) G6PD XP_538209.2
Bos taurus (cattle) G6PD NP_001231064.1
Mus musculus (house mouse) G6pdx NP_032088.1
Rattus norvegicus (Norway rat) G6pd NP_058702.1
Danio rerio (zebrafish) g6pd XP_699168.3
Drosophila melanogaster (fruit fly) Zw NP_523411.1
Caenorhabditis elegans gspd-1 NP_502129.1
Arabidopsis thaliana (thale cress) G6PD5 NP_001030780.1
Arabidopsis thaliana (thale cress) G6PD6 NP_198892.1
Xenopus (Silurana) tropicalis (western clawed frog) g6pd NP_001017312.1


ID Name Evidence
GO:0005737 cytoplasm IDA
GO:0005813 centrosome IDA
GO:0005829 cytosol IDA
GO:0005829 cytosol TAS
GO:0009898 internal side of plasma membrane IDA
GO:0043231 intracellular membrane-bounded organelle IDA


ID Name Evidence
GO:0004345 glucose-6-phosphate dehydrogenase activity IMP
GO:0005488 binding IEA
GO:0005536 glucose binding IDA
GO:0005536 glucose binding IMP
GO:0016491 oxidoreductase activity IEA
GO:0042803 protein homodimerization activity IPI
GO:0050661 NADP binding IDA


ID Name Evidence
GO:0001816 cytokine production IMP
GO:0005975 carbohydrate metabolic process TAS
GO:0006098 pentose-phosphate shunt IDA
GO:0006098 pentose-phosphate shunt TAS
GO:0006629 lipid metabolic process TAS
GO:0006695 cholesterol biosynthetic process IMP
GO:0006740 NADPH regeneration IMP
GO:0006749 glutathione metabolic process IMP
GO:0009051 pentose-phosphate shunt, oxidative branch IMP
GO:0010734 negative regulation of protein glutathionylation IMP
GO:0019322 pentose biosynthetic process IDA
GO:0034599 cellular response to oxidative stress IMP
GO:0043249 erythrocyte maturation IMP
GO:0046390 ribose phosphate biosynthetic process IMP
GO:0051156 glucose 6-phosphate metabolic process IMP
GO:0055114 oxidation-reduction process IMP

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following G6PD gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the G6PD cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu54388 XM_005274657 PREDICTED: Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439.00
OHu54389 XM_005274658 PREDICTED: Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439.00
OHu57870 XM_011531132 PREDICTED: Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $199.00
OHu20602 NM_000402 Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), transcript variant 1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $459.00
NM_001042351 Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), transcript variant 2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector
in pcDNA3.1+/C-(K)DYK

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee that the protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu54388
Accession Version XM_005274657.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1641bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product glucose-6-phosphate 1-dehydrogenase isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011681.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 3, 2014 this sequence version replaced gi:530422746. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)321..1754(+)
Misc Feature(2)336..866(+)
Misc Feature(3)870..1754(+)
Position Chain Variation Link
328 328 a, g dbSNP:137852340
331 331 c, t dbSNP:398123552
336 336 -, atc dbSNP:137852338
364 364 c, g dbSNP:78478128
376 376 c, t dbSNP:76645461
405 405 a, g dbSNP:137852315
407 407 a, c, g, t dbSNP:77362384
426 426 a, g dbSNP:199474830
435 435 a, g dbSNP:1050828
437 437 a, g dbSNP:78351852
441 441 c, t dbSNP:137852349
443 443 a, c, g, t dbSNP:79171965
476 476 c, t dbSNP:77548451
550 550 c, g, t dbSNP:267606835
609 609 a, g, t dbSNP:1050829
616 616 c, t dbSNP:78365220
625 625 a, g, t dbSNP:137852341
636 636 a, g dbSNP:387906469
699 699 a, g dbSNP:137852313
723 723 a, g dbSNP:137852314
725 725 a, c, g, t dbSNP:80149725
729 729 a, g dbSNP:137852331
753 753 c, t dbSNP:137852343
772 772 a, g dbSNP:281860640
778 778 a, t dbSNP:5030872
780 780 c, t dbSNP:267606836
781 781 a, c, g dbSNP:398123549
799 799 c, t dbSNP:5030868
828 828 c, t dbSNP:137852330
829 829 a, c, g dbSNP:137852332
830 830 c, t dbSNP:76999693
873 873 c, g, t dbSNP:137852326
884 884 g, t dbSNP:137852319
911 911 c, g dbSNP:398123550
916 916 a, g, t dbSNP:137852328
1042 1042 a, g dbSNP:137852346
1080 1080 a, c, g dbSNP:137852318
1090 1090 a, g dbSNP:74575103
1095 1095 a, g dbSNP:387906471
1107 1107 a, g dbSNP:137852327
1185 1185 a, g dbSNP:137852339
1187 1187 a, c, g, t dbSNP:75675507
1193 1193 -, caaagggtacctggacgaccccac dbSNP:587776730
1200 1200 c, t dbSNP:137852347
1204 1204 c, t dbSNP:76723693
1239 1239 a, g dbSNP:5030869
1241 1241 a, c, g, t dbSNP:75090888
1260 1260 c, t dbSNP:137852342
1262 1262 c, t dbSNP:76368830
1273 1273 a, t dbSNP:398123544
1293 1293 c, t dbSNP:137852333
1295 1295 c, t dbSNP:80280508
1305 1305 c, t dbSNP:387906470
1306 1306 a, g dbSNP:387906467
1318 1318 c, t dbSNP:137852345
1325 1325 a, c dbSNP:137852329
1338 1338 a, g dbSNP:387906468
1352 1352 a, g dbSNP:2230036
1370 1370 c, t dbSNP:200195961
1389 1389 c, t dbSNP:137852322
1392 1392 a, g dbSNP:137852320
1395 1395 c, t dbSNP:137852334
1396 1396 a, g dbSNP:137852321
1414 1414 a, g dbSNP:137852316
1416 1416 c, g dbSNP:137852335
1428 1428 a, g dbSNP:137852325
1464 1464 g, t dbSNP:137852323
1465 1465 a, g dbSNP:137852336
1547 1547 c, t dbSNP:2230037
1552 1552 a, c, g dbSNP:137852337
1575 1575 a, g dbSNP:137852317
1596 1596 c, t dbSNP:398123546
1597 1597 a, g dbSNP:137852324
1612 1612 a, c, g, t dbSNP:72554665
1624 1624 a, c, g, t dbSNP:72554664
1634 1634 c, t dbSNP:398123547
1636 1636 c, g dbSNP:137852344
1677 1677 c, t dbSNP:202122673
1678 1678 c, g dbSNP:137852348
1831 1831 a, g dbSNP:398123543
1834 1834 a, g dbSNP:201294737
1846 1846 a, g dbSNP:111776132
2141 2141 a, g dbSNP:1050757

Target ORF information:

RefSeq Version XM_005274657
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu54389
Accession Version XM_005274658.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1551bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product glucose-6-phosphate 1-dehydrogenase isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011681.17) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Feb 3, 2014 this sequence version replaced gi:530422748. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)210..1643(+)
Misc Feature(2)225..755(+)
Misc Feature(3)759..1643(+)
Position Chain Variation Link
12 12 a, g dbSNP:111827785
217 217 a, g dbSNP:137852340
220 220 c, t dbSNP:398123552
225 225 -, atc dbSNP:137852338
253 253 c, g dbSNP:78478128
265 265 c, t dbSNP:76645461
294 294 a, g dbSNP:137852315
296 296 a, c, g, t dbSNP:77362384
315 315 a, g dbSNP:199474830
324 324 a, g dbSNP:1050828
326 326 a, g dbSNP:78351852
330 330 c, t dbSNP:137852349
332 332 a, c, g, t dbSNP:79171965
365 365 c, t dbSNP:77548451
439 439 c, g, t dbSNP:267606835
498 498 a, g, t dbSNP:1050829
505 505 c, t dbSNP:78365220
514 514 a, g, t dbSNP:137852341
525 525 a, g dbSNP:387906469
588 588 a, g dbSNP:137852313
612 612 a, g dbSNP:137852314
614 614 a, c, g, t dbSNP:80149725
618 618 a, g dbSNP:137852331
642 642 c, t dbSNP:137852343
661 661 a, g dbSNP:281860640
667 667 a, t dbSNP:5030872
669 669 c, t dbSNP:267606836
670 670 a, c, g dbSNP:398123549
688 688 c, t dbSNP:5030868
717 717 c, t dbSNP:137852330
718 718 a, c, g dbSNP:137852332
719 719 c, t dbSNP:76999693
762 762 c, g, t dbSNP:137852326
773 773 g, t dbSNP:137852319
800 800 c, g dbSNP:398123550
805 805 a, g, t dbSNP:137852328
931 931 a, g dbSNP:137852346
969 969 a, c, g dbSNP:137852318
979 979 a, g dbSNP:74575103
984 984 a, g dbSNP:387906471
996 996 a, g dbSNP:137852327
1074 1074 a, g dbSNP:137852339
1076 1076 a, c, g, t dbSNP:75675507
1082 1082 -, caaagggtacctggacgaccccac dbSNP:587776730
1089 1089 c, t dbSNP:137852347
1093 1093 c, t dbSNP:76723693
1128 1128 a, g dbSNP:5030869
1130 1130 a, c, g, t dbSNP:75090888
1149 1149 c, t dbSNP:137852342
1151 1151 c, t dbSNP:76368830
1162 1162 a, t dbSNP:398123544
1182 1182 c, t dbSNP:137852333
1184 1184 c, t dbSNP:80280508
1194 1194 c, t dbSNP:387906470
1195 1195 a, g dbSNP:387906467
1207 1207 c, t dbSNP:137852345
1214 1214 a, c dbSNP:137852329
1227 1227 a, g dbSNP:387906468
1241 1241 a, g dbSNP:2230036
1259 1259 c, t dbSNP:200195961
1278 1278 c, t dbSNP:137852322
1281 1281 a, g dbSNP:137852320
1284 1284 c, t dbSNP:137852334
1285 1285 a, g dbSNP:137852321
1303 1303 a, g dbSNP:137852316
1305 1305 c, g dbSNP:137852335
1317 1317 a, g dbSNP:137852325
1353 1353 g, t dbSNP:137852323
1354 1354 a, g dbSNP:137852336
1436 1436 c, t dbSNP:2230037
1441 1441 a, c, g dbSNP:137852337
1464 1464 a, g dbSNP:137852317
1485 1485 c, t dbSNP:398123546
1486 1486 a, g dbSNP:137852324
1501 1501 a, c, g, t dbSNP:72554665
1513 1513 a, c, g, t dbSNP:72554664
1523 1523 c, t dbSNP:398123547
1525 1525 c, g dbSNP:137852344
1566 1566 c, t dbSNP:202122673
1567 1567 c, g dbSNP:137852348
1720 1720 a, g dbSNP:398123543
1723 1723 a, g dbSNP:201294737
1735 1735 a, g dbSNP:111776132
2030 2030 a, g dbSNP:1050757

Target ORF information:

RefSeq Version XM_005274658
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu57870
Accession Version XM_011531132.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 993bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product glucose-6-phosphate 1-dehydrogenase isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_011681.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)336..866(+)
Misc Feature(2)870..>1100(+)
Position Chain Variation Link
328 328 a, g dbSNP:137852340
331 331 c, t dbSNP:398123552
336 336 -, atc dbSNP:137852338
364 364 c, g dbSNP:78478128
376 376 c, t dbSNP:76645461
405 405 a, g dbSNP:137852315
407 407 a, c, g, t dbSNP:77362384
426 426 a, g dbSNP:199474830
435 435 a, g dbSNP:1050828
437 437 a, g dbSNP:78351852
441 441 c, t dbSNP:137852349
443 443 a, c, g, t dbSNP:79171965
476 476 c, t dbSNP:77548451
550 550 c, g, t dbSNP:267606835
609 609 a, g, t dbSNP:1050829
616 616 c, t dbSNP:78365220
625 625 a, g, t dbSNP:137852341
636 636 a, g dbSNP:387906469
699 699 a, g dbSNP:137852313
723 723 a, g dbSNP:137852314
725 725 a, c, g, t dbSNP:80149725
729 729 a, g dbSNP:137852331
753 753 c, t dbSNP:137852343
772 772 a, g dbSNP:281860640
778 778 a, t dbSNP:5030872
780 780 c, t dbSNP:267606836
781 781 a, c, g dbSNP:398123549
799 799 c, t dbSNP:5030868
828 828 c, t dbSNP:137852330
829 829 a, c, g dbSNP:137852332
830 830 c, t dbSNP:76999693
873 873 c, g, t dbSNP:137852326
884 884 g, t dbSNP:137852319
911 911 c, g dbSNP:398123550
916 916 a, g, t dbSNP:137852328
1042 1042 a, g dbSNP:137852346
1080 1080 a, c, g dbSNP:137852318
1090 1090 a, g dbSNP:74575103
1095 1095 a, g dbSNP:387906471
1106 1106 c, t dbSNP:137852333
1108 1108 c, t dbSNP:80280508
1118 1118 c, t dbSNP:387906470
1119 1119 a, g dbSNP:387906467
1131 1131 c, t dbSNP:137852345
1138 1138 a, c dbSNP:137852329
1151 1151 a, g dbSNP:387906468
1165 1165 a, g dbSNP:2230036
1183 1183 c, t dbSNP:200195961
1202 1202 c, t dbSNP:137852322
1205 1205 a, g dbSNP:137852320
1208 1208 c, t dbSNP:137852334
1209 1209 a, g dbSNP:137852321
1227 1227 a, g dbSNP:137852316
1229 1229 c, g dbSNP:137852335
1241 1241 a, g dbSNP:137852325
1277 1277 g, t dbSNP:137852323
1278 1278 a, g dbSNP:137852336

Target ORF information:

RefSeq Version XM_011531132
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu20602
Accession Version NM_000402.4 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1638bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product glucose-6-phosphate 1-dehydrogenase isoform a
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from M27940.1, S58359.1, BC000337.2 and BU589629.1. This sequence is a reference standard in the RefSeqGene project. On Sep 17, 2013 this sequence version replaced gi:108773794. Summary: This gene encodes glucose-6-phosphate dehydrogenase. This protein is a cytosolic enzyme encoded by a housekeeping X-linked gene whose main function is to produce NADPH, a key electron donor in the defense against oxidizing agents and in reductive biosynthetic reactions. G6PD is remarkable for its genetic diversity. Many variants of G6PD, mostly produced from missense mutations, have been described with wide ranging levels of enzyme activity and associated clinical symptoms. G6PD deficiency may cause neonatal jaundice, acute hemolysis, or severe chronic non-spherocytic hemolytic anemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). This full-length 545 aa form has been reported to be inactive, but may be processed to the smaller (515 aa) active form (PMID:8466644). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: X03674.1, BC000337.2 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)146..148(+)
Misc Feature(2)326..1756(+)
Misc Feature(3)341..868(+)
Misc Feature(4)872..1756(+)
Misc Feature(5)1439..1441(+)
Misc Feature(6)1439..1441(+)
Misc Feature(7)1745..1747(+)
Misc Feature(8)1757..1759(+)
Exon (1)1..230
Gene Synonym:
Exon (2)231..358
Gene Synonym:
Exon (3)359..396
Gene Synonym:
Exon (4)397..505
Gene Synonym:
Exon (5)506..723
Gene Synonym:
Exon (6)724..882
Gene Synonym:
Exon (7)883..1008
Gene Synonym:
Exon (8)1009..1102
Gene Synonym:
Exon (9)1103..1289
Gene Synonym:
Exon (10)1290..1525
Gene Synonym:
Exon (11)1526..1602
Gene Synonym:
Exon (12)1603..1695
Gene Synonym:
Exon (13)1696..2396
Gene Synonym:
Position Chain Variation Link
333 333 a, g dbSNP:137852340
336 336 c, t dbSNP:398123552
341 341 -, atc dbSNP:137852338
369 369 c, g dbSNP:78478128
381 381 c, t dbSNP:76645461
410 410 a, g dbSNP:137852315
412 412 a, c, g, t dbSNP:77362384
431 431 a, g dbSNP:199474830
440 440 a, g dbSNP:1050828
442 442 a, g dbSNP:78351852
446 446 c, t dbSNP:137852349
448 448 a, c, g, t dbSNP:79171965
481 481 c, t dbSNP:77548451
555 555 c, g, t dbSNP:267606835
614 614 a, g, t dbSNP:1050829
621 621 c, t dbSNP:78365220
630 630 a, g, t dbSNP:137852341
641 641 a, g dbSNP:387906469
704 704 a, g dbSNP:137852313
725 725 a, g dbSNP:137852314
727 727 a, c, g, t dbSNP:80149725
731 731 a, g dbSNP:137852331
755 755 c, t dbSNP:137852343
774 774 a, g dbSNP:281860640
780 780 a, t dbSNP:5030872
782 782 c, t dbSNP:267606836
783 783 a, c, g dbSNP:398123549
801 801 c, t dbSNP:5030868
830 830 c, t dbSNP:137852330
831 831 a, c, g dbSNP:137852332
832 832 c, t dbSNP:76999693
875 875 c, g, t dbSNP:137852326
886 886 g, t dbSNP:137852319
913 913 c, g dbSNP:398123550
918 918 a, g, t dbSNP:137852328
1044 1044 a, g dbSNP:137852346
1082 1082 a, c, g dbSNP:137852318
1092 1092 a, g dbSNP:74575103
1097 1097 a, g dbSNP:387906471
1109 1109 a, g dbSNP:137852327
1187 1187 a, g dbSNP:137852339
1189 1189 a, c, g, t dbSNP:75675507
1195 1195 -, caaagggtacctggacgaccccac dbSNP:587776730
1202 1202 c, t dbSNP:137852347
1206 1206 c, t dbSNP:76723693
1241 1241 a, g dbSNP:5030869
1243 1243 a, c, g, t dbSNP:75090888
1262 1262 c, t dbSNP:137852342
1264 1264 c, t dbSNP:76368830
1275 1275 a, t dbSNP:398123544
1295 1295 c, t dbSNP:137852333
1297 1297 c, t dbSNP:80280508
1307 1307 c, t dbSNP:387906470
1308 1308 a, g dbSNP:387906467
1320 1320 c, t dbSNP:137852345
1327 1327 a, c dbSNP:137852329
1340 1340 a, g dbSNP:387906468
1354 1354 a, g dbSNP:2230036
1372 1372 c, t dbSNP:200195961
1391 1391 c, t dbSNP:137852322
1394 1394 a, g dbSNP:137852320
1397 1397 c, t dbSNP:137852334
1398 1398 a, g dbSNP:137852321
1416 1416 a, g dbSNP:137852316
1418 1418 c, g dbSNP:137852335
1430 1430 a, g dbSNP:137852325
1466 1466 g, t dbSNP:137852323
1467 1467 a, g dbSNP:137852336
1549 1549 c, t dbSNP:2230037
1554 1554 a, c, g dbSNP:137852337
1577 1577 a, g dbSNP:137852317
1598 1598 c, t dbSNP:398123546
1599 1599 a, g dbSNP:137852324
1614 1614 a, c, g, t dbSNP:72554665
1626 1626 a, c, g, t dbSNP:72554664
1636 1636 c, t dbSNP:398123547
1638 1638 c, g dbSNP:137852344
1679 1679 c, t dbSNP:202122673
1680 1680 c, g dbSNP:137852348
1833 1833 a, g dbSNP:398123543
1836 1836 a, g dbSNP:201294737
1848 1848 a, g dbSNP:111776132
2143 2143 a, g dbSNP:1050757

Target ORF information:

RefSeq Version NM_000402
Organism Homo sapiens (human)
Definition Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), transcript variant 1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu27509
Accession Version NM_001042351.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1548bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags COA
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product glucose-6-phosphate 1-dehydrogenase isoform b
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC394789.1, AL560686.3, BC000337.2 and BU589629.1. This sequence is a reference standard in the RefSeqGene project. On Sep 17, 2013 this sequence version replaced gi:108773792. Summary: This gene encodes glucose-6-phosphate dehydrogenase. This protein is a cytosolic enzyme encoded by a housekeeping X-linked gene whose main function is to produce NADPH, a key electron donor in the defense against oxidizing agents and in reductive biosynthetic reactions. G6PD is remarkable for its genetic diversity. Many variants of G6PD, mostly produced from missense mutations, have been described with wide ranging levels of enzyme activity and associated clinical symptoms. G6PD deficiency may cause neonatal jaundice, acute hemolysis, or severe chronic non-spherocytic hemolytic anemia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) differs in the 5' UTR and CDS compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## CDS exon combination :: BC000337.2, M21248.1 [ECO:0000331] RNAseq introns :: mixed/partial sample support SAMEA1965299, SAMEA1966682 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end.


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)131..133(+)
Misc Feature(2)215..1645(+)
Misc Feature(3)230..757(+)
Misc Feature(4)392..394(+)
Misc Feature(5)638..640(+)
Misc Feature(6)728..742(+)
Misc Feature(7)761..1645(+)
Misc Feature(8)1328..1330(+)
Misc Feature(9)1328..1330(+)
Misc Feature(10)1334..1336(+)
Misc Feature(11)1421..1423(+)
Misc Feature(12)1616..1618(+)
Misc Feature(13)1634..1636(+)
Misc Feature(14)1646..1648(+)
Exon (1)1..119
Gene Synonym:
Exon (2)120..247
Gene Synonym:
Exon (3)248..285
Gene Synonym:
Exon (4)286..394
Gene Synonym:
Exon (5)395..612
Gene Synonym:
Exon (6)613..771
Gene Synonym:
Exon (7)772..897
Gene Synonym:
Exon (8)898..991
Gene Synonym:
Exon (9)992..1178
Gene Synonym:
Exon (10)1179..1414
Gene Synonym:
Exon (11)1415..1491
Gene Synonym:
Exon (12)1492..1584
Gene Synonym:
Exon (13)1585..2285
Gene Synonym:
Position Chain Variation Link
17 17 a, g dbSNP:111827785
222 222 a, g dbSNP:137852340
225 225 c, t dbSNP:398123552
230 230 -, atc dbSNP:137852338
258 258 c, g dbSNP:78478128
270 270 c, t dbSNP:76645461
299 299 a, g dbSNP:137852315
301 301 a, c, g, t dbSNP:77362384
320 320 a, g dbSNP:199474830
329 329 a, g dbSNP:1050828
331 331 a, g dbSNP:78351852
335 335 c, t dbSNP:137852349
337 337 a, c, g, t dbSNP:79171965
370 370 c, t dbSNP:77548451
444 444 c, g, t dbSNP:267606835
503 503 a, g, t dbSNP:1050829
510 510 c, t dbSNP:78365220
519 519 a, g, t dbSNP:137852341
530 530 a, g dbSNP:387906469
593 593 a, g dbSNP:137852313
614 614 a, g dbSNP:137852314
616 616 a, c, g, t dbSNP:80149725
620 620 a, g dbSNP:137852331
644 644 c, t dbSNP:137852343
663 663 a, g dbSNP:281860640
669 669 a, t dbSNP:5030872
671 671 c, t dbSNP:267606836
672 672 a, c, g dbSNP:398123549
690 690 c, t dbSNP:5030868
719 719 c, t dbSNP:137852330
720 720 a, c, g dbSNP:137852332
721 721 c, t dbSNP:76999693
764 764 c, g, t dbSNP:137852326
775 775 g, t dbSNP:137852319
802 802 c, g dbSNP:398123550
807 807 a, g, t dbSNP:137852328
933 933 a, g dbSNP:137852346
971 971 a, c, g dbSNP:137852318
981 981 a, g dbSNP:74575103
986 986 a, g dbSNP:387906471
998 998 a, g dbSNP:137852327
1076 1076 a, g dbSNP:137852339
1078 1078 a, c, g, t dbSNP:75675507
1084 1084 -, caaagggtacctggacgaccccac dbSNP:587776730
1091 1091 c, t dbSNP:137852347
1095 1095 c, t dbSNP:76723693
1130 1130 a, g dbSNP:5030869
1132 1132 a, c, g, t dbSNP:75090888
1151 1151 c, t dbSNP:137852342
1153 1153 c, t dbSNP:76368830
1164 1164 a, t dbSNP:398123544
1184 1184 c, t dbSNP:137852333
1186 1186 c, t dbSNP:80280508
1196 1196 c, t dbSNP:387906470
1197 1197 a, g dbSNP:387906467
1209 1209 c, t dbSNP:137852345
1216 1216 a, c dbSNP:137852329
1229 1229 a, g dbSNP:387906468
1243 1243 a, g dbSNP:2230036
1261 1261 c, t dbSNP:200195961
1280 1280 c, t dbSNP:137852322
1283 1283 a, g dbSNP:137852320
1286 1286 c, t dbSNP:137852334
1287 1287 a, g dbSNP:137852321
1305 1305 a, g dbSNP:137852316
1307 1307 c, g dbSNP:137852335
1319 1319 a, g dbSNP:137852325
1355 1355 g, t dbSNP:137852323
1356 1356 a, g dbSNP:137852336
1438 1438 c, t dbSNP:2230037
1443 1443 a, c, g dbSNP:137852337
1466 1466 a, g dbSNP:137852317
1487 1487 c, t dbSNP:398123546
1488 1488 a, g dbSNP:137852324
1503 1503 a, c, g, t dbSNP:72554665
1515 1515 a, c, g, t dbSNP:72554664
1525 1525 c, t dbSNP:398123547
1527 1527 c, g dbSNP:137852344
1568 1568 c, t dbSNP:202122673
1569 1569 c, g dbSNP:137852348
1722 1722 a, g dbSNP:398123543
1725 1725 a, g dbSNP:201294737
1737 1737 a, g dbSNP:111776132
2032 2032 a, g dbSNP:1050757

Target ORF information:

RefSeq Version NM_001042351
Organism Homo sapiens (human)
Definition Homo sapiens glucose-6-phosphate dehydrogenase (G6PD), transcript variant 2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.
