Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

ALX3 ALX homeobox 3 [Homo sapiens (human)]

Gene Symbol ALX3
Entrez Gene ID 257
Full Name ALX homeobox 3
Synonyms FND, FND1
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a nuclear protein with a homeobox DNA-binding domain that functions as a transcriptional regulator involved in cell-type differentiation and development. Preferential methylation of this gene's promoter is associated with advanced-stage neuroblastoma tumors. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Frontorhiny, 136760 (3)
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu19546 NM_006492 Homo sapiens ALX homeobox 3 (ALX3), mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu19546D
Sequence Information ORF Nucleotide Sequence (Length: 1032bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product homeobox protein aristaless-like 3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC113428.1. This sequence is a reference standard in the RefSeqGene project. On Aug 25, 2006 this sequence version replaced gi:5729727. Summary: This gene encodes a nuclear protein with a homeobox DNA-binding domain that functions as a transcriptional regulator involved in cell-type differentiation and development. Preferential methylation of this gene's promoter is associated with advanced-stage neuroblastoma tumors. [provided by RefSeq, Jul 2008]. ##Evidence-Data-START## Transcript exon combination :: BC113428.1, BC112007.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA962346 [ECO:0000348] ##Evidence-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)80..82(+)
Misc Feature(2)548..724(+)
Misc Feature(3)548..718(+)
Misc Feature(4)554..706(+)
Exon (1)1..365
Gene Synonym:
Exon (2)366..682
Gene Synonym:
Exon (3)683..811
Gene Synonym:
Exon (4)812..1478
Gene Synonym:
Position Chain Variation Link
43 43 c, g dbSNP:562489667
151 151 a, g dbSNP:746339603
225 225 c, g dbSNP:774644842
231 231 g, t dbSNP:769009378
243 243 c, t dbSNP:375790592
248 248 a, t dbSNP:775462465
254 254 a, c, t dbSNP:757496737
263 263 a, c dbSNP:781525090
267 267 a, g dbSNP:771353213
268 268 c, t dbSNP:555884259
279 279 c, t dbSNP:372506798
281 281 -, g dbSNP:777537752
281 281 a, g dbSNP:754614088
290 290 c, g dbSNP:12756321
292 292 c, t dbSNP:545925004
304 304 a, g dbSNP:756058496
314 314 a, c, g dbSNP:768518768
320 320 a, c, g, t dbSNP:751418045
326 326 c, g dbSNP:113980045
334 334 c, t dbSNP:764336621
335 335 c, g dbSNP:763124335
346 346 c, t dbSNP:842021
349 349 c, g dbSNP:775617106
353 353 a, g dbSNP:765289566
356 356 a, c dbSNP:760085972
371 371 -, gag dbSNP:752692366
371 371 a, g dbSNP:765502729
375 375 -, aga dbSNP:767308041
381 381 c, t dbSNP:759554226
394 394 c, t dbSNP:146519121
397 397 c, t dbSNP:766834479
401 401 -, c dbSNP:759127084
406 406 a, g dbSNP:761215609
420 420 a, c, g dbSNP:772380963
422 422 c, g dbSNP:550218304
425 425 a, g dbSNP:748547900
426 426 c, g dbSNP:774944899
432 432 a, g dbSNP:769505099
434 434 a, c, g dbSNP:372198014
435 435 a, g dbSNP:373683008
436 436 c, t dbSNP:146795178
437 437 a, g dbSNP:138645472
440 440 c, t dbSNP:746998409
442 442 c, g dbSNP:777618405
453 453 a, g dbSNP:111275942
454 454 a, c dbSNP:758063471
457 457 c, t dbSNP:564074792
470 470 -, tgcctggcc dbSNP:751012067
473 473 c, t dbSNP:139794205
476 476 c, g dbSNP:75373920
481 481 c, g, t dbSNP:766497153
485 485 c, t dbSNP:761160635
491 491 c, t dbSNP:750826128
501 501 c, t dbSNP:768080424
502 502 a, g dbSNP:150660098
504 504 a, g dbSNP:199713385
515 515 g, t dbSNP:769539181
516 516 a, c dbSNP:759311249
519 519 c, t dbSNP:368492786
523 523 a, g dbSNP:750516792
525 525 g, t dbSNP:200156688
528 528 c, t dbSNP:746523989
531 531 -, a dbSNP:766193152
538 538 a, g dbSNP:777515788
546 546 a, g dbSNP:772069495
548 548 c, t dbSNP:535409677
551 551 -, cgt dbSNP:762692494
551 551 c, t dbSNP:746228217
557 557 c, t dbSNP:375422680
558 558 a, g dbSNP:755174727
562 562 a, g dbSNP:770624383
568 568 c, t dbSNP:147534614
569 569 a, g dbSNP:143366374
571 571 c, t dbSNP:756125390
576 576 c, t dbSNP:201420718
590 590 c, g dbSNP:121908167
595 595 -, gagctggag dbSNP:772935573
595 595 a, g dbSNP:202179649
598 598 c, g dbSNP:767866679
608 608 a, g dbSNP:762419542
615 615 a, t dbSNP:751847093
631 631 a, t dbSNP:121908169
635 635 c, t dbSNP:121908168
636 636 a, g, t dbSNP:776355454
652 652 c, g dbSNP:770722833
653 653 c, t dbSNP:760056467
654 654 a, g dbSNP:199983753
666 666 -, ctga dbSNP:387906319
670 670 c, g dbSNP:771876784
674 674 c, t dbSNP:121908170
675 675 g, t dbSNP:112456669
696 696 a, g dbSNP:121908166
699 699 a, g dbSNP:374651713
702 702 a, g dbSNP:705279
705 705 c, t dbSNP:761654304
708 708 a, g dbSNP:774210543
713 713 a, c, t dbSNP:749039409
714 714 a, g dbSNP:775299987
715 715 a, g dbSNP:113851340
719 719 a, c, t dbSNP:781127904
720 720 a, g dbSNP:757293052
721 721 c, t dbSNP:781367314
722 722 a, g dbSNP:778377987
725 725 c, t dbSNP:759007659
726 726 a, g dbSNP:150129126
732 732 c, g dbSNP:201764848
749 749 c, t dbSNP:765747640
750 750 a, g dbSNP:375503292
751 751 a, g dbSNP:750158911
752 752 a, t dbSNP:370985645
753 753 a, t dbSNP:538430669
755 755 c, t dbSNP:761334835
757 757 c, t dbSNP:773879847
763 763 a, g dbSNP:186135023
765 765 c, t dbSNP:140822231
768 768 c, t dbSNP:775250647
770 770 a, t dbSNP:769697275
771 771 a, g dbSNP:745653169
772 772 c, t dbSNP:776854762
774 774 a, g dbSNP:771081739
777 777 g, t dbSNP:199801560
782 782 a, g dbSNP:778041172
784 784 a, c, g dbSNP:748725555
787 787 g, t dbSNP:779144086
788 788 c, g dbSNP:12749726
790 790 a, c dbSNP:755307144
791 791 c, g, t dbSNP:145535704
792 792 a, g dbSNP:199753639
797 797 c, g dbSNP:751044375
823 823 c, g dbSNP:375181985
825 825 c, t dbSNP:769070620
835 835 c, t dbSNP:749629445
836 836 c, g, t dbSNP:145995775
837 837 c, t dbSNP:751277589
839 839 a, g dbSNP:777405716
842 842 c, t dbSNP:757845800
850 850 a, c dbSNP:752170553
869 869 g, t dbSNP:535807605
887 887 a, c dbSNP:759432791
891 891 c, t dbSNP:753646963
894 894 c, g dbSNP:766147329
896 896 c, t dbSNP:760977295
908 908 a, t dbSNP:773504281
916 916 a, c dbSNP:772440892
917 917 a, c dbSNP:189671232
919 919 c, t dbSNP:142284688
922 922 g, t dbSNP:769180172
925 925 a, g dbSNP:749815232
932 932 c, g dbSNP:775915786
943 943 a, g dbSNP:770075558
948 948 g, t dbSNP:746242886
949 949 c, g dbSNP:777356167
957 957 c, g dbSNP:372079233
963 963 c, t dbSNP:145253023
964 964 a, g dbSNP:370347653
982 982 a, c dbSNP:778336298
985 985 c, t dbSNP:200860667
990 990 a, g dbSNP:754931220
994 994 -, catggc dbSNP:778843001
1000 1000 c, t dbSNP:753787190
1003 1003 c, t dbSNP:34775503
1004 1004 a, g dbSNP:755918125
1007 1007 -, c dbSNP:397863738
1009 1009 c, g dbSNP:750268853
1011 1011 a, g dbSNP:767813698
1012 1012 a, g dbSNP:762171706
1023 1023 c, t dbSNP:774474483
1024 1024 c, t dbSNP:764144634
1028 1028 a, c, t dbSNP:760086926
1041 1041 a, g dbSNP:551530170
1042 1042 c, t dbSNP:770308306
1047 1047 a, g, t dbSNP:376262878
1060 1060 c, t dbSNP:777021032
1063 1063 c, t dbSNP:771690383
1064 1064 a, g dbSNP:747814890
1065 1065 c, t dbSNP:373342900
1069 1069 a, g dbSNP:139199337
1073 1073 a, c dbSNP:748846506
1075 1075 c, g dbSNP:780095146
1076 1076 a, g dbSNP:756156186
1078 1078 a, g dbSNP:750217555
1084 1084 c, t dbSNP:767474422
1085 1085 a, g dbSNP:757495070
1086 1086 a, c dbSNP:141042736
1092 1092 c, t dbSNP:369347396
1094 1094 c, g dbSNP:544533452
1096 1096 c, t dbSNP:35010218
1097 1097 a, g dbSNP:775577933
1110 1110 a, g dbSNP:201913545
1113 1113 c, g dbSNP:765702189
1116 1116 a, c, t dbSNP:776967754
1117 1117 a, g, t dbSNP:372987570
1122 1122 c, t dbSNP:773821461
1123 1123 a, g, t dbSNP:199646849
1124 1124 a, g dbSNP:199955428
1125 1125 c, t dbSNP:576821902
1128 1128 a, c dbSNP:748712400
1129 1129 a, g dbSNP:544653004
1132 1132 c, g dbSNP:769836896
1133 1133 a, c dbSNP:745864846
1140 1140 a, g dbSNP:781277008
1141 1141 a, g dbSNP:756943614
1144 1144 c, g dbSNP:751390327
1146 1146 a, g dbSNP:777818047
1151 1151 c, t dbSNP:758686544
1157 1157 -, ct dbSNP:771207730
1161 1161 c, t dbSNP:752752086
1171 1171 a, g dbSNP:765360394
1177 1177 -, cccag dbSNP:71580516
1183 1183 a, c dbSNP:201416320
1184 1184 -, acaccacggaggaag, cacccctgcctggacaccacggaggaag, cc dbSNP:57429950
1187 1187 -, cctgcctggacaccacggaggaagcacc dbSNP:139173949
1188 1188 -, cctgcctggacaccacggaggaagcacc dbSNP:144523285
1189 1189 c, t dbSNP:4520416
1194 1194 c, t dbSNP:565488940
1206 1206 c, g dbSNP:9792865
1211 1211 -, cacccctgcctggacaccacggaggaag dbSNP:150626565
1233 1233 -, t dbSNP:567657678
1261 1261 a, c, t dbSNP:12042664
1284 1284 a, g dbSNP:745750730
1303 1303 a, g dbSNP:181219574
1316 1316 c, t dbSNP:552988018
1329 1329 a, g dbSNP:116760307
1334 1334 a, t dbSNP:573263899
1337 1337 c, t dbSNP:774157250
1355 1355 c, t dbSNP:45610035
1375 1375 c, g dbSNP:188259441
1422 1422 a, g dbSNP:577865252
1432 1432 c, g dbSNP:1027463

Target ORF information:

RefSeq Version NM_006492
Organism Homo sapiens (human)
Definition Homo sapiens ALX homeobox 3 (ALX3), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.