
ALX3 cDNA ORF clone, Homo sapiens (human)

Gene Symbol ALX3
Entrez Gene ID 257
Full Name ALX homeobox 3
Synonyms FND, FND1
General protein information
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes a nuclear protein with a homeobox DNA-binding domain that functions as a transcriptional regulator involved in cell-type differentiation and development. Preferential methylation of this gene's promoter is associated with advanced-stage neuroblastoma tumors. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Frontorhiny, 136760 (3)

mRNA and Protein(s)

mRNA Protein Name
NM_006492 NP_006483 homeobox protein aristaless-like 3

Homo sapiens (human) ALX3 NP_006483.2
Pan troglodytes (chimpanzee) ALX3 XP_524801.2
Macaca mulatta (Rhesus monkey) ALX3 XP_001099295.1
Canis lupus familiaris (dog) ALX3 XP_005621859.1
Bos taurus (cattle) ALX3 NP_001179482.1
Mus musculus (house mouse) Alx3 NP_031467.1
Rattus norvegicus (Norway rat) Alx3 NP_001007013.1
Gallus gallus (chicken) ALX3 XP_003642783.2
Danio rerio (zebrafish) LOC566955 XP_005167168.1


ID Name Evidence
GO:0005634 nucleus IEA


ID Name Evidence
GO:0003700 sequence-specific DNA binding transcription factor activity IEA
GO:0043565 sequence-specific DNA binding IEA


ID Name Evidence
GO:0006355 regulation of transcription, DNA-dependent IEA
GO:0007389 pattern specification process IEA
GO:0035115 embryonic forelimb morphogenesis IEA
GO:0035116 embryonic hindlimb morphogenesis IEA
GO:0042981 regulation of apoptosis IEA
GO:0048704 embryonic skeletal system morphogenesis IEA

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following ALX3 gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the ALX3 cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu19546 NM_006492 Homo sapiens ALX homeobox 3 (ALX3), mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD $319.00

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu19546
Accession Version NM_006492.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1032bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 15-MAR-2015
Organism Homo sapiens (human)
Product homeobox protein aristaless-like 3
Comment REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from BC113428.1. This sequence is a reference standard in the RefSeqGene project. On Aug 25, 2006 this sequence version replaced gi:5729727. Summary: This gene encodes a nuclear protein with a homeobox DNA-binding domain that functions as a transcriptional regulator involved in cell-type differentiation and development. Preferential methylation of this gene's promoter is associated with advanced-stage neuroblastoma tumors. [provided by RefSeq, Jul 2008]. ##Evidence-Data-START## Transcript exon combination :: BC113428.1, BC112007.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA962346 [ECO:0000348] ##Evidence-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)80..82(+)
Misc Feature(2)548..724(+)
Misc Feature(3)548..718(+)
Misc Feature(4)554..706(+)
Exon (1)1..365
Gene Synonym:
Exon (2)366..682
Gene Synonym:
Exon (3)683..811
Gene Synonym:
Exon (4)812..1478
Gene Synonym:
Position Chain Variation Link
43 43 c, g dbSNP:562489667
151 151 a, g dbSNP:746339603
225 225 c, g dbSNP:774644842
231 231 g, t dbSNP:769009378
243 243 c, t dbSNP:375790592
248 248 a, t dbSNP:775462465
254 254 a, c, t dbSNP:757496737
263 263 a, c dbSNP:781525090
267 267 a, g dbSNP:771353213
268 268 c, t dbSNP:555884259
279 279 c, t dbSNP:372506798
281 281 -, g dbSNP:777537752
281 281 a, g dbSNP:754614088
290 290 c, g dbSNP:12756321
292 292 c, t dbSNP:545925004
304 304 a, g dbSNP:756058496
314 314 a, c, g dbSNP:768518768
320 320 a, c, g, t dbSNP:751418045
326 326 c, g dbSNP:113980045
334 334 c, t dbSNP:764336621
335 335 c, g dbSNP:763124335
346 346 c, t dbSNP:842021
349 349 c, g dbSNP:775617106
353 353 a, g dbSNP:765289566
356 356 a, c dbSNP:760085972
371 371 -, gag dbSNP:752692366
371 371 a, g dbSNP:765502729
375 375 -, aga dbSNP:767308041
381 381 c, t dbSNP:759554226
394 394 c, t dbSNP:146519121
397 397 c, t dbSNP:766834479
401 401 -, c dbSNP:759127084
406 406 a, g dbSNP:761215609
420 420 a, c, g dbSNP:772380963
422 422 c, g dbSNP:550218304
425 425 a, g dbSNP:748547900
426 426 c, g dbSNP:774944899
432 432 a, g dbSNP:769505099
434 434 a, c, g dbSNP:372198014
435 435 a, g dbSNP:373683008
436 436 c, t dbSNP:146795178
437 437 a, g dbSNP:138645472
440 440 c, t dbSNP:746998409
442 442 c, g dbSNP:777618405
453 453 a, g dbSNP:111275942
454 454 a, c dbSNP:758063471
457 457 c, t dbSNP:564074792
470 470 -, tgcctggcc dbSNP:751012067
473 473 c, t dbSNP:139794205
476 476 c, g dbSNP:75373920
481 481 c, g, t dbSNP:766497153
485 485 c, t dbSNP:761160635
491 491 c, t dbSNP:750826128
501 501 c, t dbSNP:768080424
502 502 a, g dbSNP:150660098
504 504 a, g dbSNP:199713385
515 515 g, t dbSNP:769539181
516 516 a, c dbSNP:759311249
519 519 c, t dbSNP:368492786
523 523 a, g dbSNP:750516792
525 525 g, t dbSNP:200156688
528 528 c, t dbSNP:746523989
531 531 -, a dbSNP:766193152
538 538 a, g dbSNP:777515788
546 546 a, g dbSNP:772069495
548 548 c, t dbSNP:535409677
551 551 -, cgt dbSNP:762692494
551 551 c, t dbSNP:746228217
557 557 c, t dbSNP:375422680
558 558 a, g dbSNP:755174727
562 562 a, g dbSNP:770624383
568 568 c, t dbSNP:147534614
569 569 a, g dbSNP:143366374
571 571 c, t dbSNP:756125390
576 576 c, t dbSNP:201420718
590 590 c, g dbSNP:121908167
595 595 -, gagctggag dbSNP:772935573
595 595 a, g dbSNP:202179649
598 598 c, g dbSNP:767866679
608 608 a, g dbSNP:762419542
615 615 a, t dbSNP:751847093
631 631 a, t dbSNP:121908169
635 635 c, t dbSNP:121908168
636 636 a, g, t dbSNP:776355454
652 652 c, g dbSNP:770722833
653 653 c, t dbSNP:760056467
654 654 a, g dbSNP:199983753
666 666 -, ctga dbSNP:387906319
670 670 c, g dbSNP:771876784
674 674 c, t dbSNP:121908170
675 675 g, t dbSNP:112456669
696 696 a, g dbSNP:121908166
699 699 a, g dbSNP:374651713
702 702 a, g dbSNP:705279
705 705 c, t dbSNP:761654304
708 708 a, g dbSNP:774210543
713 713 a, c, t dbSNP:749039409
714 714 a, g dbSNP:775299987
715 715 a, g dbSNP:113851340
719 719 a, c, t dbSNP:781127904
720 720 a, g dbSNP:757293052
721 721 c, t dbSNP:781367314
722 722 a, g dbSNP:778377987
725 725 c, t dbSNP:759007659
726 726 a, g dbSNP:150129126
732 732 c, g dbSNP:201764848
749 749 c, t dbSNP:765747640
750 750 a, g dbSNP:375503292
751 751 a, g dbSNP:750158911
752 752 a, t dbSNP:370985645
753 753 a, t dbSNP:538430669
755 755 c, t dbSNP:761334835
757 757 c, t dbSNP:773879847
763 763 a, g dbSNP:186135023
765 765 c, t dbSNP:140822231
768 768 c, t dbSNP:775250647
770 770 a, t dbSNP:769697275
771 771 a, g dbSNP:745653169
772 772 c, t dbSNP:776854762
774 774 a, g dbSNP:771081739
777 777 g, t dbSNP:199801560
782 782 a, g dbSNP:778041172
784 784 a, c, g dbSNP:748725555
787 787 g, t dbSNP:779144086
788 788 c, g dbSNP:12749726
790 790 a, c dbSNP:755307144
791 791 c, g, t dbSNP:145535704
792 792 a, g dbSNP:199753639
797 797 c, g dbSNP:751044375
823 823 c, g dbSNP:375181985
825 825 c, t dbSNP:769070620
835 835 c, t dbSNP:749629445
836 836 c, g, t dbSNP:145995775
837 837 c, t dbSNP:751277589
839 839 a, g dbSNP:777405716
842 842 c, t dbSNP:757845800
850 850 a, c dbSNP:752170553
869 869 g, t dbSNP:535807605
887 887 a, c dbSNP:759432791
891 891 c, t dbSNP:753646963
894 894 c, g dbSNP:766147329
896 896 c, t dbSNP:760977295
908 908 a, t dbSNP:773504281
916 916 a, c dbSNP:772440892
917 917 a, c dbSNP:189671232
919 919 c, t dbSNP:142284688
922 922 g, t dbSNP:769180172
925 925 a, g dbSNP:749815232
932 932 c, g dbSNP:775915786
943 943 a, g dbSNP:770075558
948 948 g, t dbSNP:746242886
949 949 c, g dbSNP:777356167
957 957 c, g dbSNP:372079233
963 963 c, t dbSNP:145253023
964 964 a, g dbSNP:370347653
982 982 a, c dbSNP:778336298
985 985 c, t dbSNP:200860667
990 990 a, g dbSNP:754931220
994 994 -, catggc dbSNP:778843001
1000 1000 c, t dbSNP:753787190
1003 1003 c, t dbSNP:34775503
1004 1004 a, g dbSNP:755918125
1007 1007 -, c dbSNP:397863738
1009 1009 c, g dbSNP:750268853
1011 1011 a, g dbSNP:767813698
1012 1012 a, g dbSNP:762171706
1023 1023 c, t dbSNP:774474483
1024 1024 c, t dbSNP:764144634
1028 1028 a, c, t dbSNP:760086926
1041 1041 a, g dbSNP:551530170
1042 1042 c, t dbSNP:770308306
1047 1047 a, g, t dbSNP:376262878
1060 1060 c, t dbSNP:777021032
1063 1063 c, t dbSNP:771690383
1064 1064 a, g dbSNP:747814890
1065 1065 c, t dbSNP:373342900
1069 1069 a, g dbSNP:139199337
1073 1073 a, c dbSNP:748846506
1075 1075 c, g dbSNP:780095146
1076 1076 a, g dbSNP:756156186
1078 1078 a, g dbSNP:750217555
1084 1084 c, t dbSNP:767474422
1085 1085 a, g dbSNP:757495070
1086 1086 a, c dbSNP:141042736
1092 1092 c, t dbSNP:369347396
1094 1094 c, g dbSNP:544533452
1096 1096 c, t dbSNP:35010218
1097 1097 a, g dbSNP:775577933
1110 1110 a, g dbSNP:201913545
1113 1113 c, g dbSNP:765702189
1116 1116 a, c, t dbSNP:776967754
1117 1117 a, g, t dbSNP:372987570
1122 1122 c, t dbSNP:773821461
1123 1123 a, g, t dbSNP:199646849
1124 1124 a, g dbSNP:199955428
1125 1125 c, t dbSNP:576821902
1128 1128 a, c dbSNP:748712400
1129 1129 a, g dbSNP:544653004
1132 1132 c, g dbSNP:769836896
1133 1133 a, c dbSNP:745864846
1140 1140 a, g dbSNP:781277008
1141 1141 a, g dbSNP:756943614
1144 1144 c, g dbSNP:751390327
1146 1146 a, g dbSNP:777818047
1151 1151 c, t dbSNP:758686544
1157 1157 -, ct dbSNP:771207730
1161 1161 c, t dbSNP:752752086
1171 1171 a, g dbSNP:765360394
1177 1177 -, cccag dbSNP:71580516
1183 1183 a, c dbSNP:201416320
1184 1184 -, acaccacggaggaag, cacccctgcctggacaccacggaggaag, cc dbSNP:57429950
1187 1187 -, cctgcctggacaccacggaggaagcacc dbSNP:139173949
1188 1188 -, cctgcctggacaccacggaggaagcacc dbSNP:144523285
1189 1189 c, t dbSNP:4520416
1194 1194 c, t dbSNP:565488940
1206 1206 c, g dbSNP:9792865
1211 1211 -, cacccctgcctggacaccacggaggaag dbSNP:150626565
1233 1233 -, t dbSNP:567657678
1261 1261 a, c, t dbSNP:12042664
1284 1284 a, g dbSNP:745750730
1303 1303 a, g dbSNP:181219574
1316 1316 c, t dbSNP:552988018
1329 1329 a, g dbSNP:116760307
1334 1334 a, t dbSNP:573263899
1337 1337 c, t dbSNP:774157250
1355 1355 c, t dbSNP:45610035
1375 1375 c, g dbSNP:188259441
1422 1422 a, g dbSNP:577865252
1432 1432 c, g dbSNP:1027463

Target ORF information:

RefSeq Version NM_006492
Organism Homo sapiens (human)
Definition Homo sapiens ALX homeobox 3 (ALX3), mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.


Exclusion of mutations in TGIF, ALX3, and ALX4 genes in patients with the syndrome of frontonasal dysgenesis, callosal agenesis, basal encephalocele, and eye anomalies
Am. J. Med. Genet. A 158A (5), 1233-1235 (2012)
Ribeiro-Bicudo LA, Quiezi RG, Guion-Almeida ML, Legnaro C and Richieri-Costa A.


Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women
PLoS Genet. 8 (5), E1002695 (2012)
Fox CS, Liu Y, White CC, Feitosa M, Smith AV, Heard-Costa N, Lohman K, Johnson AD, Foster MC, Greenawalt DM, Griffin P, Ding J, Newman AB, Tylavsky F, Miljkovic I, Kritchevsky SB, Launer L, Garcia M, Eiriksdottir G, Carr JJ, Gudnason V, Harris TB, Cupples LA and Borecki IB.


Clinical and genetic characterization of frontorhiny: report of 3 novel cases and discussion of the surgical management
Arch Facial Plast Surg 13 (6), 415-420 (2011)
Pham NS, Rafii A, Liu J, Boyadjiev SA and Tollefson TT.


Maternal genes and facial clefts in offspring: a comprehensive search for genetic associations in two population-based cleft studies from Scandinavia
PLoS ONE 5 (7), E11493 (2010)
Jugessur A, Shi M, Gjessing HK, Lie RT, Wilcox AJ, Weinberg CR, Christensen K, Boyles AL, Daack-Hirsch S, Nguyen TT, Christiansen L, Lidral AC and Murray JC.


Frontorhiny, a distinctive presentation of frontonasal dysplasia caused by recessive mutations in the ALX3 homeobox gene
Am. J. Hum. Genet. 84 (5), 698-705 (2009)
Twigg SR, Versnel SL, Nurnberg G, Lees MM, Bhat M, Hammond P, Hennekam RC, Hoogeboom AJ, Hurst JA, Johnson D, Robinson AA, Scambler PJ, Gerrelli D, Nurnberg P, Mathijssen IM and Wilkie AO.


The homeoprotein Alx3 expressed in pancreatic beta-cells regulates insulin gene transcription by interacting with the basic helix-loop-helix protein E47
Mol. Endocrinol. 20 (11), 2876-2889 (2006)
Mirasierra M and Vallejo M.


The homeoprotein Alx3 contains discrete functional domains and exhibits cell-specific and selective monomeric binding and transactivation
J. Biol. Chem. 279 (36), 38062-38071 (2004)
Perez-Villamil B, Mirasierra M and Vallejo M.


Combined restriction landmark genomic scanning and virtual genome scans identify a novel human homeobox gene, ALX3, that is hypermethylated in neuroblastoma
Genes Chromosomes Cancer 33 (3), 285-294 (2002)
Wimmer K, Zhu Xx XX, Rouillard JM, Ambros PF, Lamb BJ, Kuick R, Eckart M, Weinhausl A, Fonatsch C and Hanash SM.


Pancreatic beta cells express a diverse set of homeobox genes
Proc. Natl. Acad. Sci. U.S.A. 91 (25), 12203-12207 (1994)
Rudnick A, Ling TY, Odagiri H, Rutter WJ and German MS.
