
MGAT4C cDNA ORF clone, Homo sapiens (human)

Gene Symbol MGAT4C
Entrez Gene ID 25834
Full Name MGAT4 family, member C
General protein information
Preferred Names
alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C
alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C
glcNAc-T IVc
N-acetylglucosaminyltransferase IVc
N-acetylglucosaminyltransferase IV homolog
N-glycosyl-oligosaccharide-glycoprotein N-acetylglucosaminyltransferase IVc
UDP-N-acetylglucosamine:a-1,3-D-mannoside beta-1,4-N-acetylglucosaminyltransferase IV
UDP-N-acetylglucosamine: alpha-1,3-D-mannoside beta-1,4-N-acetylglucosaminyltransferase IVc
UDP-N-acetylglucosamine:a-1,3-D-mannoside beta-1,4-N-acetylglucosaminyltransferase IV-homolog
Gene Type protein-coding
Organism Homo sapiens (human)



Summary lac of sum
Disorder MIM:


Disorder Html:

The following MGAT4C gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the MGAT4C cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu66525 XM_011538149 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439.00
OHu66526 XM_011538150 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439.00
OHu66526 XM_011538151 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439.00
OHu46462 XM_011538152 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439.00
OHu46462 XM_011538153 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439.00
OHu46462 XM_005268776 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $439.00
OHu66527 XM_011538154 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X7, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu66527 XM_011538155 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X8, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu31637 XM_011538156 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X9, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu31637 XM_011538157 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X10, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu31637 XM_005268779 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X11, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu31637 XM_011538158 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X12, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu31637 XM_011538159 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X13, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu31637 XM_011538160 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X14, mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00
OHu31637 NM_013244 Homo sapiens MGAT4 family, member C (MGAT4C), mRNA. pcDNA3.1+/C-(K)DYK or customized vector 7-9 $319.00

*Business Day
**You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

CloneID OHu66525
Accession Version XM_011538149.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1584bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_029419.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)605..1432(+)
Position Chain Variation Link
11 11 a, g dbSNP:773558890
52 52 c, t dbSNP:370016958
53 53 a, g dbSNP:11103902
58 58 g, t dbSNP:558172404
68 68 a, g dbSNP:112895249
81 81 g, t dbSNP:569204614
115 115 a, t dbSNP:539021829
119 119 a, g dbSNP:551173542
124 124 c, t dbSNP:778211754
172 172 c, g dbSNP:61949048
188 188 c, t dbSNP:566302122
217 217 g, t dbSNP:539891507
219 219 g, t dbSNP:575838969
275 275 c, g dbSNP:186411772
291 291 a, g dbSNP:536177327
349 349 a, t dbSNP:755060619
379 379 c, t dbSNP:531934310
398 398 c, g, t dbSNP:561615887
411 411 c, t dbSNP:549654574
423 423 c, t dbSNP:527940128
450 450 a, c dbSNP:759053090
451 451 a, c dbSNP:548807976
460 460 a, g dbSNP:770892207
464 464 a, t dbSNP:762868613
468 468 a, g dbSNP:201584077
473 473 c, t dbSNP:769763236
484 484 c, g, t dbSNP:370869346
489 489 a, g dbSNP:772217070
509 509 c, t dbSNP:745947947
510 510 a, g dbSNP:145205649
516 516 a, c dbSNP:757749414
517 517 a, g dbSNP:749807069
524 524 g, t dbSNP:749491204
526 526 c, t dbSNP:138787902
528 528 -, g dbSNP:36069674
533 533 a, g, t dbSNP:532825428
539 539 g, t dbSNP:767169663
551 551 c, g dbSNP:754687253
566 566 c, t dbSNP:751079600
570 570 c, t dbSNP:200641508
596 596 a, g dbSNP:149974845
600 600 a, g dbSNP:764027512
601 601 -, acaa dbSNP:761066259
609 609 g, t dbSNP:759753045
626 626 c, t dbSNP:774470064
628 628 -, c dbSNP:35652293
631 631 a, g dbSNP:770979746
644 644 c, t dbSNP:762956258
645 645 a, g, t dbSNP:200651947
648 648 a, c, g dbSNP:192255840
660 660 c, t dbSNP:781516891
690 690 c, t dbSNP:768927396
698 698 a, c dbSNP:746602295
705 705 a, g dbSNP:375819261
706 706 c, t dbSNP:758123335
710 710 c, g dbSNP:749945581
716 716 a, g dbSNP:200901180
718 718 c, t dbSNP:112983335
722 722 c, t dbSNP:757238970
724 724 c, t dbSNP:111495386
737 737 c, t dbSNP:753847188
742 742 c, t dbSNP:756857554
758 758 g, t dbSNP:190762233
766 766 a, g dbSNP:777587242
770 770 c, t dbSNP:139777686
771 771 a, g dbSNP:147418986
773 773 a, g dbSNP:752431991
792 792 c, t dbSNP:767389242
796 796 c, g dbSNP:763067361
798 798 a, c dbSNP:750669561
800 800 a, g dbSNP:765264406
805 805 a, g dbSNP:761892291
809 809 a, g dbSNP:776746849
829 829 c, t dbSNP:185118551
836 836 c, g dbSNP:761281614
838 838 a, g dbSNP:775693691
860 860 c, g dbSNP:536944591
863 863 a, c, g dbSNP:539968414
868 868 a, c dbSNP:774149822
887 887 c, t dbSNP:566418071
888 888 a, g dbSNP:748796788
894 894 a, c dbSNP:777409272
897 897 c, t dbSNP:755975066
898 898 a, g dbSNP:142839367
908 908 a, g dbSNP:748169936
913 913 a, g dbSNP:780805071
916 916 c, g dbSNP:754801625
924 924 c, t dbSNP:140499591
925 925 a, g dbSNP:765429825
928 928 a, c dbSNP:757539324
945 945 a, g dbSNP:566043053
946 946 a, g dbSNP:753826277
952 952 a, g dbSNP:113387514
970 970 a, g dbSNP:764279389
1002 1002 a, g dbSNP:150545721
1009 1009 c, t dbSNP:776093722
1011 1011 a, g dbSNP:141672136
1016 1016 a, c dbSNP:759994326
1036 1036 c, t dbSNP:770595521
1037 1037 c, t dbSNP:749782221
1038 1038 a, g, t dbSNP:770702724
1052 1052 a, g dbSNP:748989192
1054 1054 a, g dbSNP:772578702
1070 1070 c, t dbSNP:769372443
1080 1080 a, g dbSNP:747999039
1086 1086 a, g dbSNP:147998015
1102 1102 c, g, t dbSNP:372911876
1106 1106 a, g dbSNP:778384478
1108 1108 a, g dbSNP:143449252
1109 1109 c, t dbSNP:746800765
1118 1118 a, g dbSNP:779860939
1124 1124 c, t dbSNP:757444701
1125 1125 a, g dbSNP:754111075
1131 1131 a, c dbSNP:75276700
1159 1159 a, t dbSNP:764040141
1161 1161 g, t dbSNP:756220458
1167 1167 c, t dbSNP:753086343
1168 1168 a, c dbSNP:768126876
1170 1170 c, t dbSNP:199811466
1190 1190 a, g dbSNP:760188889
1194 1194 a, c dbSNP:547661699
1210 1210 a, g dbSNP:368524858
1222 1222 a, t dbSNP:766900187
1225 1225 c, t dbSNP:539250548
1228 1228 a, c dbSNP:772953057
1242 1242 a, g dbSNP:769121552
1246 1246 c, t dbSNP:375386863
1249 1249 c, t dbSNP:267603706
1251 1251 a, c dbSNP:141479653
1252 1252 a, g dbSNP:371453579
1253 1253 c, g dbSNP:765452856
1254 1254 a, g dbSNP:367612551
1268 1268 g, t dbSNP:776069370
1281 1281 a, c dbSNP:200155199
1291 1291 a, g dbSNP:768547952
1292 1292 a, c dbSNP:746994463
1298 1298 a, g dbSNP:374072925
1307 1307 c, t dbSNP:753925997
1319 1319 c, t dbSNP:771884299
1320 1320 a, g dbSNP:749402312
1327 1327 a, g dbSNP:374349115
1333 1333 c, t dbSNP:138500929
1335 1335 a, c dbSNP:752818848
1343 1343 g, t dbSNP:145889731
1349 1349 c, t dbSNP:114903783
1350 1350 a, g dbSNP:140682310
1363 1363 c, g, t dbSNP:766814115
1390 1390 a, g dbSNP:201179683
1393 1393 a, g dbSNP:749990047
1397 1397 a, g dbSNP:764935665
1404 1404 c, t dbSNP:145801611
1405 1405 a, g dbSNP:370614450
1410 1410 a, g dbSNP:768173767
1413 1413 a, c dbSNP:760563980
1415 1415 c, g dbSNP:775408430
1417 1417 a, g dbSNP:771796611
1419 1419 a, g dbSNP:745661909
1422 1422 a, g dbSNP:778640907
1436 1436 a, g dbSNP:770027343
1438 1438 a, g dbSNP:199528320
1445 1445 c, t dbSNP:180907536
1449 1449 a, g dbSNP:781372905
1451 1451 a, g dbSNP:376986836
1457 1457 -, g dbSNP:776059817
1465 1465 c, g dbSNP:755227553
1467 1467 -, c dbSNP:772624713
1475 1475 c, t dbSNP:752047649
1478 1478 c, t dbSNP:780724562
1482 1482 a, c dbSNP:758890049
1521 1521 c, t dbSNP:535303532
1530 1530 c, g dbSNP:750764518
1544 1544 -, t dbSNP:36020292
1565 1565 a, g dbSNP:34889924
1571 1571 c, g dbSNP:756883344
1573 1573 g, t dbSNP:753517104
1574 1574 a, c, g dbSNP:202157734
1577 1577 a, t dbSNP:775039626
1580 1580 a, g dbSNP:767487110
1587 1587 c, t dbSNP:759432736
1605 1605 a, t dbSNP:112713100
1609 1609 a, t dbSNP:559630993
1610 1610 a, g dbSNP:770656314
1616 1616 -, a dbSNP:779025640
1616 1616 -, a dbSNP:746398787
1622 1622 -, gtaaa dbSNP:770864945
1644 1644 a, g dbSNP:751790011
1648 1648 a, c dbSNP:540843966
1666 1666 c, t dbSNP:373806118
1671 1671 a, c dbSNP:747076027
1675 1675 a, g dbSNP:7958826
1679 1679 a, g dbSNP:565196653
1680 1680 c, t dbSNP:746382301
1683 1683 c, g dbSNP:779294242
1690 1690 c, t dbSNP:34663658
1691 1691 a, g dbSNP:369051385
1694 1694 a, g dbSNP:142800914
1702 1702 a, c dbSNP:755830364
1708 1708 a, g dbSNP:752173498
1719 1719 c, g dbSNP:766985178
1724 1724 a, g dbSNP:759471267
1725 1725 c, g dbSNP:17855890
1740 1740 c, g dbSNP:766133859
1748 1748 a, g dbSNP:750521235
1753 1753 c, t dbSNP:762857247
1756 1756 a, g dbSNP:773203393
1787 1787 a, g dbSNP:144502445
1788 1788 a, t dbSNP:140537872
1797 1797 a, g dbSNP:775586689
1802 1802 c, t dbSNP:78521308
1814 1814 a, c dbSNP:746316239
1823 1823 a, g dbSNP:779299698
1837 1837 c, g dbSNP:572756292
1838 1838 c, g dbSNP:749648790
1840 1840 a, g dbSNP:778149917
1844 1844 a, c dbSNP:374295123
1846 1846 a, g dbSNP:144062899
1873 1873 c, t dbSNP:780715327
1893 1893 c, t dbSNP:754454532
1896 1896 g, t dbSNP:370622926
1908 1908 a, g dbSNP:766217087
1915 1915 -, t dbSNP:749399472
1920 1920 c, t dbSNP:554470708
1923 1923 c, t dbSNP:750217452
1926 1926 c, t dbSNP:144593863
1927 1927 a, g, t dbSNP:376457265
1929 1929 c, g dbSNP:772130957
2002 2002 a, g dbSNP:571819913
2004 2004 c, t dbSNP:558320764
2016 2016 c, t dbSNP:536744820
2064 2064 c, t dbSNP:190102027
2065 2065 a, g dbSNP:547766766
2075 2075 g, t dbSNP:529667272
2087 2087 a, g dbSNP:565806131
2179 2179 a, g dbSNP:760351772
2219 2219 a, c dbSNP:547682225
2281 2281 a, g dbSNP:140747359
2296 2296 -, t dbSNP:376872523
2304 2304 -, t dbSNP:63172860
2305 2305 -, t dbSNP:56135820
2305 2305 g, t dbSNP:201003713
2307 2307 -, tg dbSNP:201247976
2307 2307 g, t dbSNP:201747129
2308 2308 -, g dbSNP:200496066
2324 2324 g, t dbSNP:565088480
2339 2339 a, c dbSNP:543684623
2408 2408 a, t dbSNP:771881987
2432 2432 -, a dbSNP:34017217
2466 2466 c, t dbSNP:79372569
2526 2526 a, g dbSNP:147631754
2535 2535 a, c dbSNP:561397399
2561 2561 c, t dbSNP:543016942
2631 2631 a, g dbSNP:774012894
2633 2633 g, t dbSNP:572420244
2639 2639 c, g dbSNP:554130352
2659 2659 a, g dbSNP:111896557
2660 2660 c, t dbSNP:770361266
2676 2676 c, t dbSNP:570155284
2677 2677 a, g dbSNP:7300102
2750 2750 a, c, g dbSNP:747428458
2760 2760 c, t dbSNP:578220427
2808 2808 a, g dbSNP:556707181
2866 2866 c, t dbSNP:538082475
2898 2898 c, g dbSNP:758630271
2902 2902 c, t dbSNP:750433533
2958 2958 a, g dbSNP:202199482
2962 2962 c, t dbSNP:569388804
2975 2975 a, c dbSNP:550040127
2976 2976 c, t dbSNP:554263663
3029 3029 a, g dbSNP:535809406
3038 3038 a, g dbSNP:759842333
3053 3053 c, t dbSNP:774607729
3057 3057 -, a dbSNP:770585444
3063 3063 a, c dbSNP:148442794
3122 3122 a, g dbSNP:185784088
3144 3144 a, t dbSNP:201032692
3151 3151 a, g dbSNP:533441584
3186 3186 -, gaa dbSNP:371940109
3187 3187 -, aag dbSNP:372115717
3188 3188 -, aga dbSNP:201786449
3204 3204 c, t dbSNP:532429677
3205 3205 g, t dbSNP:144552823
3236 3236 -, gtttttt dbSNP:372134652
3242 3242 -, acagcaaaaactaagggatttattataaagggaaatggaagg dbSNP:375844704
3247 3247 a, g dbSNP:12830189
3250 3250 a, c dbSNP:77243419
3285 3285 c, g dbSNP:753768505
3320 3320 a, c dbSNP:547936981
3325 3325 a, t dbSNP:549508927
3333 3333 -, ctgtgt dbSNP:773194012
3333 3333 c, g dbSNP:747666669
3334 3334 -, tgtgtgtg dbSNP:67385136
3334 3334 -, tgtgtg dbSNP:58212652
3352 3352 -, tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg dbSNP:147763218
3352 3352 -, tgtgtgtgtgtg dbSNP:766509991
3352 3352 -, tgtgtgtgtg dbSNP:751762581
3380 3380 -, tgtgtgtg dbSNP:367866196
3386 3386 (tg)8, 14, 20, 21, 22, 23, 24, 25, 26, 27 dbSNP:3219969
3412 3412 c, t dbSNP:370571115
3429 3429 c, t dbSNP:527640100
3444 3444 a, c dbSNP:560536156
3554 3554 a, c dbSNP:73392025
3562 3562 a, t dbSNP:578184469
3571 3571 c, t dbSNP:763918344
3601 3601 g, t dbSNP:564570984
3633 3633 c, t dbSNP:181528211
3634 3634 a, g dbSNP:190376900
3637 3637 a, c dbSNP:752559558
3649 3649 g, t dbSNP:573908791
3689 3689 c, g dbSNP:139854276
3706 3706 a, g dbSNP:527846727
3752 3752 g, t dbSNP:562371573
3767 3767 a, c dbSNP:376189416
3779 3779 c, g dbSNP:759270217
3825 3825 a, g dbSNP:773996332
3829 3829 a, g dbSNP:145979907
3867 3867 a, g dbSNP:542513832
3892 3892 c, t dbSNP:536345624
3923 3923 a, g dbSNP:751331151
3950 3950 c, g dbSNP:2405791
3992 3992 c, t dbSNP:373049465
3999 3999 a, c, g dbSNP:11117140
4039 4039 a, g dbSNP:776960091
4050 4050 a, g dbSNP:576500612
4113 4113 a, g dbSNP:571490847
4114 4114 c, t dbSNP:75672699
4181 4181 a, g dbSNP:118101076
4196 4196 a, g dbSNP:757482863
4200 4200 c, g dbSNP:182596158
4218 4218 c, g dbSNP:137895577
4300 4300 a, t dbSNP:527775710
4316 4316 a, c dbSNP:560415479
4321 4321 g, t dbSNP:747275916
4327 4327 g, t dbSNP:545886501
4396 4396 a, c dbSNP:772275100
4406 4406 c, t dbSNP:551729599
4413 4413 a, g dbSNP:371322545
4477 4477 a, c dbSNP:562804703
4489 4489 a, g dbSNP:544510386
4510 4510 a, g dbSNP:10863130
4540 4540 a, g dbSNP:553993027
4544 4544 c, t dbSNP:73176276
4558 4558 a, c dbSNP:572087484
4564 4564 a, g dbSNP:142014376
4579 4579 a, t dbSNP:556032382
4650 4650 g, t dbSNP:777523702
4692 4692 a, g dbSNP:538596385
4752 4752 a, g dbSNP:577722283
4754 4754 c, g dbSNP:556450915
4768 4768 a, g dbSNP:542142385
4826 4826 a, g dbSNP:756093335
4860 4860 c, g dbSNP:543182248
4878 4878 g, t dbSNP:567606122

Target ORF information:

RefSeq Version XM_011538149
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu66526
Accession Version XM_011538150.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1551bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_029419.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)454..1281(+)
Position Chain Variation Link
6 6 a, g dbSNP:112895249
19 19 g, t dbSNP:569204614
53 53 a, t dbSNP:539021829
57 57 a, g dbSNP:551173542
62 62 c, t dbSNP:778211754
110 110 c, g dbSNP:61949048
126 126 c, t dbSNP:566302122
198 198 a, t dbSNP:755060619
228 228 c, t dbSNP:531934310
247 247 c, g, t dbSNP:561615887
260 260 c, t dbSNP:549654574
272 272 c, t dbSNP:527940128
299 299 a, c dbSNP:759053090
300 300 a, c dbSNP:548807976
309 309 a, g dbSNP:770892207
313 313 a, t dbSNP:762868613
317 317 a, g dbSNP:201584077
322 322 c, t dbSNP:769763236
333 333 c, g, t dbSNP:370869346
338 338 a, g dbSNP:772217070
358 358 c, t dbSNP:745947947
359 359 a, g dbSNP:145205649
365 365 a, c dbSNP:757749414
366 366 a, g dbSNP:749807069
373 373 g, t dbSNP:749491204
375 375 c, t dbSNP:138787902
377 377 -, g dbSNP:36069674
382 382 a, g, t dbSNP:532825428
388 388 g, t dbSNP:767169663
400 400 c, g dbSNP:754687253
415 415 c, t dbSNP:751079600
419 419 c, t dbSNP:200641508
445 445 a, g dbSNP:149974845
449 449 a, g dbSNP:764027512
450 450 -, acaa dbSNP:761066259
458 458 g, t dbSNP:759753045
475 475 c, t dbSNP:774470064
477 477 -, c dbSNP:35652293
480 480 a, g dbSNP:770979746
493 493 c, t dbSNP:762956258
494 494 a, g, t dbSNP:200651947
497 497 a, c, g dbSNP:192255840
509 509 c, t dbSNP:781516891
539 539 c, t dbSNP:768927396
547 547 a, c dbSNP:746602295
554 554 a, g dbSNP:375819261
555 555 c, t dbSNP:758123335
559 559 c, g dbSNP:749945581
565 565 a, g dbSNP:200901180
567 567 c, t dbSNP:112983335
571 571 c, t dbSNP:757238970
573 573 c, t dbSNP:111495386
586 586 c, t dbSNP:753847188
591 591 c, t dbSNP:756857554
607 607 g, t dbSNP:190762233
615 615 a, g dbSNP:777587242
619 619 c, t dbSNP:139777686
620 620 a, g dbSNP:147418986
622 622 a, g dbSNP:752431991
641 641 c, t dbSNP:767389242
645 645 c, g dbSNP:763067361
647 647 a, c dbSNP:750669561
649 649 a, g dbSNP:765264406
654 654 a, g dbSNP:761892291
658 658 a, g dbSNP:776746849
678 678 c, t dbSNP:185118551
685 685 c, g dbSNP:761281614
687 687 a, g dbSNP:775693691
709 709 c, g dbSNP:536944591
712 712 a, c, g dbSNP:539968414
717 717 a, c dbSNP:774149822
736 736 c, t dbSNP:566418071
737 737 a, g dbSNP:748796788
743 743 a, c dbSNP:777409272
746 746 c, t dbSNP:755975066
747 747 a, g dbSNP:142839367
757 757 a, g dbSNP:748169936
762 762 a, g dbSNP:780805071
765 765 c, g dbSNP:754801625
773 773 c, t dbSNP:140499591
774 774 a, g dbSNP:765429825
777 777 a, c dbSNP:757539324
794 794 a, g dbSNP:566043053
795 795 a, g dbSNP:753826277
801 801 a, g dbSNP:113387514
819 819 a, g dbSNP:764279389
851 851 a, g dbSNP:150545721
858 858 c, t dbSNP:776093722
860 860 a, g dbSNP:141672136
865 865 a, c dbSNP:759994326
885 885 c, t dbSNP:770595521
886 886 c, t dbSNP:749782221
887 887 a, g, t dbSNP:770702724
901 901 a, g dbSNP:748989192
903 903 a, g dbSNP:772578702
919 919 c, t dbSNP:769372443
929 929 a, g dbSNP:747999039
935 935 a, g dbSNP:147998015
951 951 c, g, t dbSNP:372911876
955 955 a, g dbSNP:778384478
957 957 a, g dbSNP:143449252
958 958 c, t dbSNP:746800765
967 967 a, g dbSNP:779860939
973 973 c, t dbSNP:757444701
974 974 a, g dbSNP:754111075
980 980 a, c dbSNP:75276700
1008 1008 a, t dbSNP:764040141
1010 1010 g, t dbSNP:756220458
1016 1016 c, t dbSNP:753086343
1017 1017 a, c dbSNP:768126876
1019 1019 c, t dbSNP:199811466
1039 1039 a, g dbSNP:760188889
1043 1043 a, c dbSNP:547661699
1059 1059 a, g dbSNP:368524858
1071 1071 a, t dbSNP:766900187
1074 1074 c, t dbSNP:539250548
1077 1077 a, c dbSNP:772953057
1091 1091 a, g dbSNP:769121552
1095 1095 c, t dbSNP:375386863
1098 1098 c, t dbSNP:267603706
1100 1100 a, c dbSNP:141479653
1101 1101 a, g dbSNP:371453579
1102 1102 c, g dbSNP:765452856
1103 1103 a, g dbSNP:367612551
1117 1117 g, t dbSNP:776069370
1130 1130 a, c dbSNP:200155199
1140 1140 a, g dbSNP:768547952
1141 1141 a, c dbSNP:746994463
1147 1147 a, g dbSNP:374072925
1156 1156 c, t dbSNP:753925997
1168 1168 c, t dbSNP:771884299
1169 1169 a, g dbSNP:749402312
1176 1176 a, g dbSNP:374349115
1182 1182 c, t dbSNP:138500929
1184 1184 a, c dbSNP:752818848
1192 1192 g, t dbSNP:145889731
1198 1198 c, t dbSNP:114903783
1199 1199 a, g dbSNP:140682310
1212 1212 c, g, t dbSNP:766814115
1239 1239 a, g dbSNP:201179683
1242 1242 a, g dbSNP:749990047
1246 1246 a, g dbSNP:764935665
1253 1253 c, t dbSNP:145801611
1254 1254 a, g dbSNP:370614450
1259 1259 a, g dbSNP:768173767
1262 1262 a, c dbSNP:760563980
1264 1264 c, g dbSNP:775408430
1266 1266 a, g dbSNP:771796611
1268 1268 a, g dbSNP:745661909
1271 1271 a, g dbSNP:778640907
1285 1285 a, g dbSNP:770027343
1287 1287 a, g dbSNP:199528320
1294 1294 c, t dbSNP:180907536
1298 1298 a, g dbSNP:781372905
1300 1300 a, g dbSNP:376986836
1306 1306 -, g dbSNP:776059817
1314 1314 c, g dbSNP:755227553
1316 1316 -, c dbSNP:772624713
1324 1324 c, t dbSNP:752047649
1327 1327 c, t dbSNP:780724562
1331 1331 a, c dbSNP:758890049
1370 1370 c, t dbSNP:535303532
1379 1379 c, g dbSNP:750764518
1393 1393 -, t dbSNP:36020292
1414 1414 a, g dbSNP:34889924
1420 1420 c, g dbSNP:756883344
1422 1422 g, t dbSNP:753517104
1423 1423 a, c, g dbSNP:202157734
1426 1426 a, t dbSNP:775039626
1429 1429 a, g dbSNP:767487110
1436 1436 c, t dbSNP:759432736
1454 1454 a, t dbSNP:112713100
1458 1458 a, t dbSNP:559630993
1459 1459 a, g dbSNP:770656314
1465 1465 -, a dbSNP:779025640
1465 1465 -, a dbSNP:746398787
1471 1471 -, gtaaa dbSNP:770864945
1493 1493 a, g dbSNP:751790011
1497 1497 a, c dbSNP:540843966
1515 1515 c, t dbSNP:373806118
1520 1520 a, c dbSNP:747076027
1524 1524 a, g dbSNP:7958826
1528 1528 a, g dbSNP:565196653
1529 1529 c, t dbSNP:746382301
1532 1532 c, g dbSNP:779294242
1539 1539 c, t dbSNP:34663658
1540 1540 a, g dbSNP:369051385
1543 1543 a, g dbSNP:142800914
1551 1551 a, c dbSNP:755830364
1557 1557 a, g dbSNP:752173498
1568 1568 c, g dbSNP:766985178
1573 1573 a, g dbSNP:759471267
1574 1574 c, g dbSNP:17855890
1589 1589 c, g dbSNP:766133859
1597 1597 a, g dbSNP:750521235
1602 1602 c, t dbSNP:762857247
1605 1605 a, g dbSNP:773203393
1636 1636 a, g dbSNP:144502445
1637 1637 a, t dbSNP:140537872
1646 1646 a, g dbSNP:775586689
1651 1651 c, t dbSNP:78521308
1663 1663 a, c dbSNP:746316239
1672 1672 a, g dbSNP:779299698
1686 1686 c, g dbSNP:572756292
1687 1687 c, g dbSNP:749648790
1689 1689 a, g dbSNP:778149917
1693 1693 a, c dbSNP:374295123
1695 1695 a, g dbSNP:144062899
1722 1722 c, t dbSNP:780715327
1742 1742 c, t dbSNP:754454532
1745 1745 g, t dbSNP:370622926
1757 1757 a, g dbSNP:766217087
1764 1764 -, t dbSNP:749399472
1769 1769 c, t dbSNP:554470708
1772 1772 c, t dbSNP:750217452
1775 1775 c, t dbSNP:144593863
1776 1776 a, g, t dbSNP:376457265
1778 1778 c, g dbSNP:772130957
1851 1851 a, g dbSNP:571819913
1853 1853 c, t dbSNP:558320764
1865 1865 c, t dbSNP:536744820
1913 1913 c, t dbSNP:190102027
1914 1914 a, g dbSNP:547766766
1924 1924 g, t dbSNP:529667272
1936 1936 a, g dbSNP:565806131
2028 2028 a, g dbSNP:760351772
2068 2068 a, c dbSNP:547682225
2130 2130 a, g dbSNP:140747359
2145 2145 -, t dbSNP:376872523
2153 2153 -, t dbSNP:63172860
2154 2154 -, t dbSNP:56135820
2154 2154 g, t dbSNP:201003713
2156 2156 -, tg dbSNP:201247976
2156 2156 g, t dbSNP:201747129
2157 2157 -, g dbSNP:200496066
2173 2173 g, t dbSNP:565088480
2188 2188 a, c dbSNP:543684623
2257 2257 a, t dbSNP:771881987
2281 2281 -, a dbSNP:34017217
2315 2315 c, t dbSNP:79372569
2375 2375 a, g dbSNP:147631754
2384 2384 a, c dbSNP:561397399
2410 2410 c, t dbSNP:543016942
2480 2480 a, g dbSNP:774012894
2482 2482 g, t dbSNP:572420244
2488 2488 c, g dbSNP:554130352
2508 2508 a, g dbSNP:111896557
2509 2509 c, t dbSNP:770361266
2525 2525 c, t dbSNP:570155284
2526 2526 a, g dbSNP:7300102
2599 2599 a, c, g dbSNP:747428458
2609 2609 c, t dbSNP:578220427
2657 2657 a, g dbSNP:556707181
2715 2715 c, t dbSNP:538082475
2747 2747 c, g dbSNP:758630271
2751 2751 c, t dbSNP:750433533
2807 2807 a, g dbSNP:202199482
2811 2811 c, t dbSNP:569388804
2824 2824 a, c dbSNP:550040127
2825 2825 c, t dbSNP:554263663
2878 2878 a, g dbSNP:535809406
2887 2887 a, g dbSNP:759842333
2902 2902 c, t dbSNP:774607729
2906 2906 -, a dbSNP:770585444
2912 2912 a, c dbSNP:148442794
2971 2971 a, g dbSNP:185784088
2993 2993 a, t dbSNP:201032692
3000 3000 a, g dbSNP:533441584
3035 3035 -, gaa dbSNP:371940109
3036 3036 -, aag dbSNP:372115717
3037 3037 -, aga dbSNP:201786449
3053 3053 c, t dbSNP:532429677
3054 3054 g, t dbSNP:144552823
3085 3085 -, gtttttt dbSNP:372134652
3091 3091 -, acagcaaaaactaagggatttattataaagggaaatggaagg dbSNP:375844704
3096 3096 a, g dbSNP:12830189
3099 3099 a, c dbSNP:77243419
3134 3134 c, g dbSNP:753768505
3169 3169 a, c dbSNP:547936981
3174 3174 a, t dbSNP:549508927
3182 3182 -, ctgtgt dbSNP:773194012
3182 3182 c, g dbSNP:747666669
3183 3183 -, tgtgtgtg dbSNP:67385136
3183 3183 -, tgtgtg dbSNP:58212652
3201 3201 -, tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg dbSNP:147763218
3201 3201 -, tgtgtgtgtgtg dbSNP:766509991
3201 3201 -, tgtgtgtgtg dbSNP:751762581
3229 3229 -, tgtgtgtg dbSNP:367866196
3235 3235 (tg)8, 14, 20, 21, 22, 23, 24, 25, 26, 27 dbSNP:3219969
3261 3261 c, t dbSNP:370571115
3278 3278 c, t dbSNP:527640100
3293 3293 a, c dbSNP:560536156
3403 3403 a, c dbSNP:73392025
3411 3411 a, t dbSNP:578184469
3420 3420 c, t dbSNP:763918344
3450 3450 g, t dbSNP:564570984
3482 3482 c, t dbSNP:181528211
3483 3483 a, g dbSNP:190376900
3486 3486 a, c dbSNP:752559558
3498 3498 g, t dbSNP:573908791
3538 3538 c, g dbSNP:139854276
3555 3555 a, g dbSNP:527846727
3601 3601 g, t dbSNP:562371573
3616 3616 a, c dbSNP:376189416
3628 3628 c, g dbSNP:759270217
3674 3674 a, g dbSNP:773996332
3678 3678 a, g dbSNP:145979907
3716 3716 a, g dbSNP:542513832
3741 3741 c, t dbSNP:536345624
3772 3772 a, g dbSNP:751331151
3799 3799 c, g dbSNP:2405791
3841 3841 c, t dbSNP:373049465
3848 3848 a, c, g dbSNP:11117140
3888 3888 a, g dbSNP:776960091
3899 3899 a, g dbSNP:576500612
3962 3962 a, g dbSNP:571490847
3963 3963 c, t dbSNP:75672699
4030 4030 a, g dbSNP:118101076
4045 4045 a, g dbSNP:757482863
4049 4049 c, g dbSNP:182596158
4067 4067 c, g dbSNP:137895577
4149 4149 a, t dbSNP:527775710
4165 4165 a, c dbSNP:560415479
4170 4170 g, t dbSNP:747275916
4176 4176 g, t dbSNP:545886501
4245 4245 a, c dbSNP:772275100
4255 4255 c, t dbSNP:551729599
4262 4262 a, g dbSNP:371322545
4326 4326 a, c dbSNP:562804703
4338 4338 a, g dbSNP:544510386
4359 4359 a, g dbSNP:10863130
4389 4389 a, g dbSNP:553993027
4393 4393 c, t dbSNP:73176276
4407 4407 a, c dbSNP:572087484
4413 4413 a, g dbSNP:142014376
4428 4428 a, t dbSNP:556032382
4499 4499 g, t dbSNP:777523702
4541 4541 a, g dbSNP:538596385
4601 4601 a, g dbSNP:577722283
4603 4603 c, g dbSNP:556450915
4617 4617 a, g dbSNP:542142385
4675 4675 a, g dbSNP:756093335
4709 4709 c, g dbSNP:543182248
4727 4727 g, t dbSNP:567606122

Target ORF information:

RefSeq Version XM_011538150
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu66526
Accession Version XM_011538151.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1551bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_029419.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)370..1197(+)
Position Chain Variation Link
1 1 a, c dbSNP:558034898
24 24 g, t dbSNP:765371348
30 30 a, g dbSNP:762060081
114 114 a, t dbSNP:755060619
144 144 c, t dbSNP:531934310
163 163 c, g, t dbSNP:561615887
176 176 c, t dbSNP:549654574
188 188 c, t dbSNP:527940128
215 215 a, c dbSNP:759053090
216 216 a, c dbSNP:548807976
225 225 a, g dbSNP:770892207
229 229 a, t dbSNP:762868613
233 233 a, g dbSNP:201584077
238 238 c, t dbSNP:769763236
249 249 c, g, t dbSNP:370869346
254 254 a, g dbSNP:772217070
274 274 c, t dbSNP:745947947
275 275 a, g dbSNP:145205649
281 281 a, c dbSNP:757749414
282 282 a, g dbSNP:749807069
289 289 g, t dbSNP:749491204
291 291 c, t dbSNP:138787902
293 293 -, g dbSNP:36069674
298 298 a, g, t dbSNP:532825428
304 304 g, t dbSNP:767169663
316 316 c, g dbSNP:754687253
331 331 c, t dbSNP:751079600
335 335 c, t dbSNP:200641508
361 361 a, g dbSNP:149974845
365 365 a, g dbSNP:764027512
366 366 -, acaa dbSNP:761066259
374 374 g, t dbSNP:759753045
391 391 c, t dbSNP:774470064
393 393 -, c dbSNP:35652293
396 396 a, g dbSNP:770979746
409 409 c, t dbSNP:762956258
410 410 a, g, t dbSNP:200651947
413 413 a, c, g dbSNP:192255840
425 425 c, t dbSNP:781516891
455 455 c, t dbSNP:768927396
463 463 a, c dbSNP:746602295
470 470 a, g dbSNP:375819261
471 471 c, t dbSNP:758123335
475 475 c, g dbSNP:749945581
481 481 a, g dbSNP:200901180
483 483 c, t dbSNP:112983335
487 487 c, t dbSNP:757238970
489 489 c, t dbSNP:111495386
502 502 c, t dbSNP:753847188
507 507 c, t dbSNP:756857554
523 523 g, t dbSNP:190762233
531 531 a, g dbSNP:777587242
535 535 c, t dbSNP:139777686
536 536 a, g dbSNP:147418986
538 538 a, g dbSNP:752431991
557 557 c, t dbSNP:767389242
561 561 c, g dbSNP:763067361
563 563 a, c dbSNP:750669561
565 565 a, g dbSNP:765264406
570 570 a, g dbSNP:761892291
574 574 a, g dbSNP:776746849
594 594 c, t dbSNP:185118551
601 601 c, g dbSNP:761281614
603 603 a, g dbSNP:775693691
625 625 c, g dbSNP:536944591
628 628 a, c, g dbSNP:539968414
633 633 a, c dbSNP:774149822
652 652 c, t dbSNP:566418071
653 653 a, g dbSNP:748796788
659 659 a, c dbSNP:777409272
662 662 c, t dbSNP:755975066
663 663 a, g dbSNP:142839367
673 673 a, g dbSNP:748169936
678 678 a, g dbSNP:780805071
681 681 c, g dbSNP:754801625
689 689 c, t dbSNP:140499591
690 690 a, g dbSNP:765429825
693 693 a, c dbSNP:757539324
710 710 a, g dbSNP:566043053
711 711 a, g dbSNP:753826277
717 717 a, g dbSNP:113387514
735 735 a, g dbSNP:764279389
767 767 a, g dbSNP:150545721
774 774 c, t dbSNP:776093722
776 776 a, g dbSNP:141672136
781 781 a, c dbSNP:759994326
801 801 c, t dbSNP:770595521
802 802 c, t dbSNP:749782221
803 803 a, g, t dbSNP:770702724
817 817 a, g dbSNP:748989192
819 819 a, g dbSNP:772578702
835 835 c, t dbSNP:769372443
845 845 a, g dbSNP:747999039
851 851 a, g dbSNP:147998015
867 867 c, g, t dbSNP:372911876
871 871 a, g dbSNP:778384478
873 873 a, g dbSNP:143449252
874 874 c, t dbSNP:746800765
883 883 a, g dbSNP:779860939
889 889 c, t dbSNP:757444701
890 890 a, g dbSNP:754111075
896 896 a, c dbSNP:75276700
924 924 a, t dbSNP:764040141
926 926 g, t dbSNP:756220458
932 932 c, t dbSNP:753086343
933 933 a, c dbSNP:768126876
935 935 c, t dbSNP:199811466
955 955 a, g dbSNP:760188889
959 959 a, c dbSNP:547661699
975 975 a, g dbSNP:368524858
987 987 a, t dbSNP:766900187
990 990 c, t dbSNP:539250548
993 993 a, c dbSNP:772953057
1007 1007 a, g dbSNP:769121552
1011 1011 c, t dbSNP:375386863
1014 1014 c, t dbSNP:267603706
1016 1016 a, c dbSNP:141479653
1017 1017 a, g dbSNP:371453579
1018 1018 c, g dbSNP:765452856
1019 1019 a, g dbSNP:367612551
1033 1033 g, t dbSNP:776069370
1046 1046 a, c dbSNP:200155199
1056 1056 a, g dbSNP:768547952
1057 1057 a, c dbSNP:746994463
1063 1063 a, g dbSNP:374072925
1072 1072 c, t dbSNP:753925997
1084 1084 c, t dbSNP:771884299
1085 1085 a, g dbSNP:749402312
1092 1092 a, g dbSNP:374349115
1098 1098 c, t dbSNP:138500929
1100 1100 a, c dbSNP:752818848
1108 1108 g, t dbSNP:145889731
1114 1114 c, t dbSNP:114903783
1115 1115 a, g dbSNP:140682310
1128 1128 c, g, t dbSNP:766814115
1155 1155 a, g dbSNP:201179683
1158 1158 a, g dbSNP:749990047
1162 1162 a, g dbSNP:764935665
1169 1169 c, t dbSNP:145801611
1170 1170 a, g dbSNP:370614450
1175 1175 a, g dbSNP:768173767
1178 1178 a, c dbSNP:760563980
1180 1180 c, g dbSNP:775408430
1182 1182 a, g dbSNP:771796611
1184 1184 a, g dbSNP:745661909
1187 1187 a, g dbSNP:778640907
1201 1201 a, g dbSNP:770027343
1203 1203 a, g dbSNP:199528320
1210 1210 c, t dbSNP:180907536
1214 1214 a, g dbSNP:781372905
1216 1216 a, g dbSNP:376986836
1222 1222 -, g dbSNP:776059817
1230 1230 c, g dbSNP:755227553
1232 1232 -, c dbSNP:772624713
1240 1240 c, t dbSNP:752047649
1243 1243 c, t dbSNP:780724562
1247 1247 a, c dbSNP:758890049
1286 1286 c, t dbSNP:535303532
1295 1295 c, g dbSNP:750764518
1309 1309 -, t dbSNP:36020292
1330 1330 a, g dbSNP:34889924
1336 1336 c, g dbSNP:756883344
1338 1338 g, t dbSNP:753517104
1339 1339 a, c, g dbSNP:202157734
1342 1342 a, t dbSNP:775039626
1345 1345 a, g dbSNP:767487110
1352 1352 c, t dbSNP:759432736
1370 1370 a, t dbSNP:112713100
1374 1374 a, t dbSNP:559630993
1375 1375 a, g dbSNP:770656314
1381 1381 -, a dbSNP:779025640
1381 1381 -, a dbSNP:746398787
1387 1387 -, gtaaa dbSNP:770864945
1409 1409 a, g dbSNP:751790011
1413 1413 a, c dbSNP:540843966
1431 1431 c, t dbSNP:373806118
1436 1436 a, c dbSNP:747076027
1440 1440 a, g dbSNP:7958826
1444 1444 a, g dbSNP:565196653
1445 1445 c, t dbSNP:746382301
1448 1448 c, g dbSNP:779294242
1455 1455 c, t dbSNP:34663658
1456 1456 a, g dbSNP:369051385
1459 1459 a, g dbSNP:142800914
1467 1467 a, c dbSNP:755830364
1473 1473 a, g dbSNP:752173498
1484 1484 c, g dbSNP:766985178
1489 1489 a, g dbSNP:759471267
1490 1490 c, g dbSNP:17855890
1505 1505 c, g dbSNP:766133859
1513 1513 a, g dbSNP:750521235
1518 1518 c, t dbSNP:762857247
1521 1521 a, g dbSNP:773203393
1552 1552 a, g dbSNP:144502445
1553 1553 a, t dbSNP:140537872
1562 1562 a, g dbSNP:775586689
1567 1567 c, t dbSNP:78521308
1579 1579 a, c dbSNP:746316239
1588 1588 a, g dbSNP:779299698
1602 1602 c, g dbSNP:572756292
1603 1603 c, g dbSNP:749648790
1605 1605 a, g dbSNP:778149917
1609 1609 a, c dbSNP:374295123
1611 1611 a, g dbSNP:144062899
1638 1638 c, t dbSNP:780715327
1658 1658 c, t dbSNP:754454532
1661 1661 g, t dbSNP:370622926
1673 1673 a, g dbSNP:766217087
1680 1680 -, t dbSNP:749399472
1685 1685 c, t dbSNP:554470708
1688 1688 c, t dbSNP:750217452
1691 1691 c, t dbSNP:144593863
1692 1692 a, g, t dbSNP:376457265
1694 1694 c, g dbSNP:772130957
1767 1767 a, g dbSNP:571819913
1769 1769 c, t dbSNP:558320764
1781 1781 c, t dbSNP:536744820
1829 1829 c, t dbSNP:190102027
1830 1830 a, g dbSNP:547766766
1840 1840 g, t dbSNP:529667272
1852 1852 a, g dbSNP:565806131
1944 1944 a, g dbSNP:760351772
1984 1984 a, c dbSNP:547682225
2046 2046 a, g dbSNP:140747359
2061 2061 -, t dbSNP:376872523
2069 2069 -, t dbSNP:63172860
2070 2070 -, t dbSNP:56135820
2070 2070 g, t dbSNP:201003713
2072 2072 -, tg dbSNP:201247976
2072 2072 g, t dbSNP:201747129
2073 2073 -, g dbSNP:200496066
2089 2089 g, t dbSNP:565088480
2104 2104 a, c dbSNP:543684623
2173 2173 a, t dbSNP:771881987
2197 2197 -, a dbSNP:34017217
2231 2231 c, t dbSNP:79372569
2291 2291 a, g dbSNP:147631754
2300 2300 a, c dbSNP:561397399
2326 2326 c, t dbSNP:543016942
2396 2396 a, g dbSNP:774012894
2398 2398 g, t dbSNP:572420244
2404 2404 c, g dbSNP:554130352
2424 2424 a, g dbSNP:111896557
2425 2425 c, t dbSNP:770361266
2441 2441 c, t dbSNP:570155284
2442 2442 a, g dbSNP:7300102
2515 2515 a, c, g dbSNP:747428458
2525 2525 c, t dbSNP:578220427
2573 2573 a, g dbSNP:556707181
2631 2631 c, t dbSNP:538082475
2663 2663 c, g dbSNP:758630271
2667 2667 c, t dbSNP:750433533
2723 2723 a, g dbSNP:202199482
2727 2727 c, t dbSNP:569388804
2740 2740 a, c dbSNP:550040127
2741 2741 c, t dbSNP:554263663
2794 2794 a, g dbSNP:535809406
2803 2803 a, g dbSNP:759842333
2818 2818 c, t dbSNP:774607729
2822 2822 -, a dbSNP:770585444
2828 2828 a, c dbSNP:148442794
2887 2887 a, g dbSNP:185784088
2909 2909 a, t dbSNP:201032692
2916 2916 a, g dbSNP:533441584
2951 2951 -, gaa dbSNP:371940109
2952 2952 -, aag dbSNP:372115717
2953 2953 -, aga dbSNP:201786449
2969 2969 c, t dbSNP:532429677
2970 2970 g, t dbSNP:144552823
3001 3001 -, gtttttt dbSNP:372134652
3007 3007 -, acagcaaaaactaagggatttattataaagggaaatggaagg dbSNP:375844704
3012 3012 a, g dbSNP:12830189
3015 3015 a, c dbSNP:77243419
3050 3050 c, g dbSNP:753768505
3085 3085 a, c dbSNP:547936981
3090 3090 a, t dbSNP:549508927
3098 3098 -, ctgtgt dbSNP:773194012
3098 3098 c, g dbSNP:747666669
3099 3099 -, tgtgtgtg dbSNP:67385136
3099 3099 -, tgtgtg dbSNP:58212652
3117 3117 -, tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg dbSNP:147763218
3117 3117 -, tgtgtgtgtgtg dbSNP:766509991
3117 3117 -, tgtgtgtgtg dbSNP:751762581
3145 3145 -, tgtgtgtg dbSNP:367866196
3151 3151 (tg)8, 14, 20, 21, 22, 23, 24, 25, 26, 27 dbSNP:3219969
3177 3177 c, t dbSNP:370571115
3194 3194 c, t dbSNP:527640100
3209 3209 a, c dbSNP:560536156
3319 3319 a, c dbSNP:73392025
3327 3327 a, t dbSNP:578184469
3336 3336 c, t dbSNP:763918344
3366 3366 g, t dbSNP:564570984
3398 3398 c, t dbSNP:181528211
3399 3399 a, g dbSNP:190376900
3402 3402 a, c dbSNP:752559558
3414 3414 g, t dbSNP:573908791
3454 3454 c, g dbSNP:139854276
3471 3471 a, g dbSNP:527846727
3517 3517 g, t dbSNP:562371573
3532 3532 a, c dbSNP:376189416
3544 3544 c, g dbSNP:759270217
3590 3590 a, g dbSNP:773996332
3594 3594 a, g dbSNP:145979907
3632 3632 a, g dbSNP:542513832
3657 3657 c, t dbSNP:536345624
3688 3688 a, g dbSNP:751331151
3715 3715 c, g dbSNP:2405791
3757 3757 c, t dbSNP:373049465
3764 3764 a, c, g dbSNP:11117140
3804 3804 a, g dbSNP:776960091
3815 3815 a, g dbSNP:576500612
3878 3878 a, g dbSNP:571490847
3879 3879 c, t dbSNP:75672699
3946 3946 a, g dbSNP:118101076
3961 3961 a, g dbSNP:757482863
3965 3965 c, g dbSNP:182596158
3983 3983 c, g dbSNP:137895577
4065 4065 a, t dbSNP:527775710
4081 4081 a, c dbSNP:560415479
4086 4086 g, t dbSNP:747275916
4092 4092 g, t dbSNP:545886501
4161 4161 a, c dbSNP:772275100
4171 4171 c, t dbSNP:551729599
4178 4178 a, g dbSNP:371322545
4242 4242 a, c dbSNP:562804703
4254 4254 a, g dbSNP:544510386
4275 4275 a, g dbSNP:10863130
4305 4305 a, g dbSNP:553993027
4309 4309 c, t dbSNP:73176276
4323 4323 a, c dbSNP:572087484
4329 4329 a, g dbSNP:142014376
4344 4344 a, t dbSNP:556032382
4415 4415 g, t dbSNP:777523702
4457 4457 a, g dbSNP:538596385
4517 4517 a, g dbSNP:577722283
4519 4519 c, g dbSNP:556450915
4533 4533 a, g dbSNP:542142385
4591 4591 a, g dbSNP:756093335
4625 4625 c, g dbSNP:543182248
4643 4643 g, t dbSNP:567606122

Target ORF information:

RefSeq Version XM_011538151
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu46462
Accession Version XM_011538152.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1524bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C isoform X4
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_029419.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)656..1483(+)
Position Chain Variation Link
17 17 c, g dbSNP:550075042
26 26 g, t dbSNP:561614020
28 28 c, t dbSNP:541835785
34 34 c, g, t dbSNP:571733939
37 37 a, g dbSNP:766885112
44 44 c, t dbSNP:557804308
47 47 c, t dbSNP:763411438
49 49 c, g, t dbSNP:146407145
53 53 -, gcc dbSNP:761406464
54 54 c, t dbSNP:766143562
62 62 a, g dbSNP:773382527
88 88 a, g dbSNP:571130576
107 107 a, g dbSNP:138834123
118 118 a, g dbSNP:531265838
141 141 c, t dbSNP:567026502
154 154 a, g dbSNP:545399064
157 157 a, g dbSNP:770834628
159 159 -, aacaat dbSNP:752508138
177 177 a, g dbSNP:376082316
180 180 -, c dbSNP:35015230
245 245 a, t dbSNP:779572975
260 260 c, t dbSNP:771412010
274 274 a, c dbSNP:558034898
297 297 g, t dbSNP:765371348
303 303 a, g dbSNP:762060081
402 402 a, g dbSNP:759421317
423 423 c, t dbSNP:774378533
424 424 a, g dbSNP:564862144
437 437 g, t dbSNP:770566369
441 441 a, g dbSNP:756067228
449 449 c, g dbSNP:543297194
501 501 a, c dbSNP:759053090
502 502 a, c dbSNP:548807976
511 511 a, g dbSNP:770892207
515 515 a, t dbSNP:762868613
519 519 a, g dbSNP:201584077
524 524 c, t dbSNP:769763236
535 535 c, g, t dbSNP:370869346
540 540 a, g dbSNP:772217070
560 560 c, t dbSNP:745947947
561 561 a, g dbSNP:145205649
567 567 a, c dbSNP:757749414
568 568 a, g dbSNP:749807069
575 575 g, t dbSNP:749491204
577 577 c, t dbSNP:138787902
579 579 -, g dbSNP:36069674
584 584 a, g, t dbSNP:532825428
590 590 g, t dbSNP:767169663
602 602 c, g dbSNP:754687253
617 617 c, t dbSNP:751079600
621 621 c, t dbSNP:200641508
647 647 a, g dbSNP:149974845
651 651 a, g dbSNP:764027512
652 652 -, acaa dbSNP:761066259
660 660 g, t dbSNP:759753045
677 677 c, t dbSNP:774470064
679 679 -, c dbSNP:35652293
682 682 a, g dbSNP:770979746
695 695 c, t dbSNP:762956258
696 696 a, g, t dbSNP:200651947
699 699 a, c, g dbSNP:192255840
711 711 c, t dbSNP:781516891
741 741 c, t dbSNP:768927396
749 749 a, c dbSNP:746602295
756 756 a, g dbSNP:375819261
757 757 c, t dbSNP:758123335
761 761 c, g dbSNP:749945581
767 767 a, g dbSNP:200901180
769 769 c, t dbSNP:112983335
773 773 c, t dbSNP:757238970
775 775 c, t dbSNP:111495386
788 788 c, t dbSNP:753847188
793 793 c, t dbSNP:756857554
809 809 g, t dbSNP:190762233
817 817 a, g dbSNP:777587242
821 821 c, t dbSNP:139777686
822 822 a, g dbSNP:147418986
824 824 a, g dbSNP:752431991
843 843 c, t dbSNP:767389242
847 847 c, g dbSNP:763067361
849 849 a, c dbSNP:750669561
851 851 a, g dbSNP:765264406
856 856 a, g dbSNP:761892291
860 860 a, g dbSNP:776746849
880 880 c, t dbSNP:185118551
887 887 c, g dbSNP:761281614
889 889 a, g dbSNP:775693691
911 911 c, g dbSNP:536944591
914 914 a, c, g dbSNP:539968414
919 919 a, c dbSNP:774149822
938 938 c, t dbSNP:566418071
939 939 a, g dbSNP:748796788
945 945 a, c dbSNP:777409272
948 948 c, t dbSNP:755975066
949 949 a, g dbSNP:142839367
959 959 a, g dbSNP:748169936
964 964 a, g dbSNP:780805071
967 967 c, g dbSNP:754801625
975 975 c, t dbSNP:140499591
976 976 a, g dbSNP:765429825
979 979 a, c dbSNP:757539324
996 996 a, g dbSNP:566043053
997 997 a, g dbSNP:753826277
1003 1003 a, g dbSNP:113387514
1021 1021 a, g dbSNP:764279389
1053 1053 a, g dbSNP:150545721
1060 1060 c, t dbSNP:776093722
1062 1062 a, g dbSNP:141672136
1067 1067 a, c dbSNP:759994326
1087 1087 c, t dbSNP:770595521
1088 1088 c, t dbSNP:749782221
1089 1089 a, g, t dbSNP:770702724
1103 1103 a, g dbSNP:748989192
1105 1105 a, g dbSNP:772578702
1121 1121 c, t dbSNP:769372443
1131 1131 a, g dbSNP:747999039
1137 1137 a, g dbSNP:147998015
1153 1153 c, g, t dbSNP:372911876
1157 1157 a, g dbSNP:778384478
1159 1159 a, g dbSNP:143449252
1160 1160 c, t dbSNP:746800765
1169 1169 a, g dbSNP:779860939
1175 1175 c, t dbSNP:757444701
1176 1176 a, g dbSNP:754111075
1182 1182 a, c dbSNP:75276700
1210 1210 a, t dbSNP:764040141
1212 1212 g, t dbSNP:756220458
1218 1218 c, t dbSNP:753086343
1219 1219 a, c dbSNP:768126876
1221 1221 c, t dbSNP:199811466
1241 1241 a, g dbSNP:760188889
1245 1245 a, c dbSNP:547661699
1261 1261 a, g dbSNP:368524858
1273 1273 a, t dbSNP:766900187
1276 1276 c, t dbSNP:539250548
1279 1279 a, c dbSNP:772953057
1293 1293 a, g dbSNP:769121552
1297 1297 c, t dbSNP:375386863
1300 1300 c, t dbSNP:267603706
1302 1302 a, c dbSNP:141479653
1303 1303 a, g dbSNP:371453579
1304 1304 c, g dbSNP:765452856
1305 1305 a, g dbSNP:367612551
1319 1319 g, t dbSNP:776069370
1332 1332 a, c dbSNP:200155199
1342 1342 a, g dbSNP:768547952
1343 1343 a, c dbSNP:746994463
1349 1349 a, g dbSNP:374072925
1358 1358 c, t dbSNP:753925997
1370 1370 c, t dbSNP:771884299
1371 1371 a, g dbSNP:749402312
1378 1378 a, g dbSNP:374349115
1384 1384 c, t dbSNP:138500929
1386 1386 a, c dbSNP:752818848
1394 1394 g, t dbSNP:145889731
1400 1400 c, t dbSNP:114903783
1401 1401 a, g dbSNP:140682310
1414 1414 c, g, t dbSNP:766814115
1441 1441 a, g dbSNP:201179683
1444 1444 a, g dbSNP:749990047
1448 1448 a, g dbSNP:764935665
1455 1455 c, t dbSNP:145801611
1456 1456 a, g dbSNP:370614450
1461 1461 a, g dbSNP:768173767
1464 1464 a, c dbSNP:760563980
1466 1466 c, g dbSNP:775408430
1468 1468 a, g dbSNP:771796611
1470 1470 a, g dbSNP:745661909
1473 1473 a, g dbSNP:778640907
1487 1487 a, g dbSNP:770027343
1489 1489 a, g dbSNP:199528320
1496 1496 c, t dbSNP:180907536
1500 1500 a, g dbSNP:781372905
1502 1502 a, g dbSNP:376986836
1508 1508 -, g dbSNP:776059817
1516 1516 c, g dbSNP:755227553
1518 1518 -, c dbSNP:772624713
1526 1526 c, t dbSNP:752047649
1529 1529 c, t dbSNP:780724562
1533 1533 a, c dbSNP:758890049
1572 1572 c, t dbSNP:535303532
1581 1581 c, g dbSNP:750764518
1595 1595 -, t dbSNP:36020292
1616 1616 a, g dbSNP:34889924
1622 1622 c, g dbSNP:756883344
1624 1624 g, t dbSNP:753517104
1625 1625 a, c, g dbSNP:202157734
1628 1628 a, t dbSNP:775039626
1631 1631 a, g dbSNP:767487110
1638 1638 c, t dbSNP:759432736
1656 1656 a, t dbSNP:112713100
1660 1660 a, t dbSNP:559630993
1661 1661 a, g dbSNP:770656314
1667 1667 -, a dbSNP:779025640
1667 1667 -, a dbSNP:746398787
1673 1673 -, gtaaa dbSNP:770864945
1695 1695 a, g dbSNP:751790011
1699 1699 a, c dbSNP:540843966
1717 1717 c, t dbSNP:373806118
1722 1722 a, c dbSNP:747076027
1726 1726 a, g dbSNP:7958826
1730 1730 a, g dbSNP:565196653
1731 1731 c, t dbSNP:746382301
1734 1734 c, g dbSNP:779294242
1741 1741 c, t dbSNP:34663658
1742 1742 a, g dbSNP:369051385
1745 1745 a, g dbSNP:142800914
1753 1753 a, c dbSNP:755830364
1759 1759 a, g dbSNP:752173498
1770 1770 c, g dbSNP:766985178
1775 1775 a, g dbSNP:759471267
1776 1776 c, g dbSNP:17855890
1791 1791 c, g dbSNP:766133859
1799 1799 a, g dbSNP:750521235
1804 1804 c, t dbSNP:762857247
1807 1807 a, g dbSNP:773203393
1838 1838 a, g dbSNP:144502445
1839 1839 a, t dbSNP:140537872
1848 1848 a, g dbSNP:775586689
1853 1853 c, t dbSNP:78521308
1865 1865 a, c dbSNP:746316239
1874 1874 a, g dbSNP:779299698
1888 1888 c, g dbSNP:572756292
1889 1889 c, g dbSNP:749648790
1891 1891 a, g dbSNP:778149917
1895 1895 a, c dbSNP:374295123
1897 1897 a, g dbSNP:144062899
1924 1924 c, t dbSNP:780715327
1944 1944 c, t dbSNP:754454532
1947 1947 g, t dbSNP:370622926
1959 1959 a, g dbSNP:766217087
1966 1966 -, t dbSNP:749399472
1971 1971 c, t dbSNP:554470708
1974 1974 c, t dbSNP:750217452
1977 1977 c, t dbSNP:144593863
1978 1978 a, g, t dbSNP:376457265
1980 1980 c, g dbSNP:772130957
2053 2053 a, g dbSNP:571819913
2055 2055 c, t dbSNP:558320764
2067 2067 c, t dbSNP:536744820
2115 2115 c, t dbSNP:190102027
2116 2116 a, g dbSNP:547766766
2126 2126 g, t dbSNP:529667272
2138 2138 a, g dbSNP:565806131
2230 2230 a, g dbSNP:760351772
2270 2270 a, c dbSNP:547682225
2332 2332 a, g dbSNP:140747359
2347 2347 -, t dbSNP:376872523
2355 2355 -, t dbSNP:63172860
2356 2356 -, t dbSNP:56135820
2356 2356 g, t dbSNP:201003713
2358 2358 -, tg dbSNP:201247976
2358 2358 g, t dbSNP:201747129
2359 2359 -, g dbSNP:200496066
2375 2375 g, t dbSNP:565088480
2390 2390 a, c dbSNP:543684623
2459 2459 a, t dbSNP:771881987
2483 2483 -, a dbSNP:34017217
2517 2517 c, t dbSNP:79372569
2577 2577 a, g dbSNP:147631754
2586 2586 a, c dbSNP:561397399
2612 2612 c, t dbSNP:543016942
2682 2682 a, g dbSNP:774012894
2684 2684 g, t dbSNP:572420244
2690 2690 c, g dbSNP:554130352
2710 2710 a, g dbSNP:111896557
2711 2711 c, t dbSNP:770361266
2727 2727 c, t dbSNP:570155284
2728 2728 a, g dbSNP:7300102
2801 2801 a, c, g dbSNP:747428458
2811 2811 c, t dbSNP:578220427
2859 2859 a, g dbSNP:556707181
2917 2917 c, t dbSNP:538082475
2949 2949 c, g dbSNP:758630271
2953 2953 c, t dbSNP:750433533
3009 3009 a, g dbSNP:202199482
3013 3013 c, t dbSNP:569388804
3026 3026 a, c dbSNP:550040127
3027 3027 c, t dbSNP:554263663
3080 3080 a, g dbSNP:535809406
3089 3089 a, g dbSNP:759842333
3104 3104 c, t dbSNP:774607729
3108 3108 -, a dbSNP:770585444
3114 3114 a, c dbSNP:148442794
3173 3173 a, g dbSNP:185784088
3195 3195 a, t dbSNP:201032692
3202 3202 a, g dbSNP:533441584
3237 3237 -, gaa dbSNP:371940109
3238 3238 -, aag dbSNP:372115717
3239 3239 -, aga dbSNP:201786449
3255 3255 c, t dbSNP:532429677
3256 3256 g, t dbSNP:144552823
3287 3287 -, gtttttt dbSNP:372134652
3293 3293 -, acagcaaaaactaagggatttattataaagggaaatggaagg dbSNP:375844704
3298 3298 a, g dbSNP:12830189
3301 3301 a, c dbSNP:77243419
3336 3336 c, g dbSNP:753768505
3371 3371 a, c dbSNP:547936981
3376 3376 a, t dbSNP:549508927
3384 3384 -, ctgtgt dbSNP:773194012
3384 3384 c, g dbSNP:747666669
3385 3385 -, tgtgtgtg dbSNP:67385136
3385 3385 -, tgtgtg dbSNP:58212652
3403 3403 -, tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg dbSNP:147763218
3403 3403 -, tgtgtgtgtgtg dbSNP:766509991
3403 3403 -, tgtgtgtgtg dbSNP:751762581
3431 3431 -, tgtgtgtg dbSNP:367866196
3437 3437 (tg)8, 14, 20, 21, 22, 23, 24, 25, 26, 27 dbSNP:3219969
3463 3463 c, t dbSNP:370571115
3480 3480 c, t dbSNP:527640100
3495 3495 a, c dbSNP:560536156
3605 3605 a, c dbSNP:73392025
3613 3613 a, t dbSNP:578184469
3622 3622 c, t dbSNP:763918344
3652 3652 g, t dbSNP:564570984
3684 3684 c, t dbSNP:181528211
3685 3685 a, g dbSNP:190376900
3688 3688 a, c dbSNP:752559558
3700 3700 g, t dbSNP:573908791
3740 3740 c, g dbSNP:139854276
3757 3757 a, g dbSNP:527846727
3803 3803 g, t dbSNP:562371573
3818 3818 a, c dbSNP:376189416
3830 3830 c, g dbSNP:759270217
3876 3876 a, g dbSNP:773996332
3880 3880 a, g dbSNP:145979907
3918 3918 a, g dbSNP:542513832
3943 3943 c, t dbSNP:536345624
3974 3974 a, g dbSNP:751331151
4001 4001 c, g dbSNP:2405791
4043 4043 c, t dbSNP:373049465
4050 4050 a, c, g dbSNP:11117140
4090 4090 a, g dbSNP:776960091
4101 4101 a, g dbSNP:576500612
4164 4164 a, g dbSNP:571490847
4165 4165 c, t dbSNP:75672699
4232 4232 a, g dbSNP:118101076
4247 4247 a, g dbSNP:757482863
4251 4251 c, g dbSNP:182596158
4269 4269 c, g dbSNP:137895577
4351 4351 a, t dbSNP:527775710
4367 4367 a, c dbSNP:560415479
4372 4372 g, t dbSNP:747275916
4378 4378 g, t dbSNP:545886501
4447 4447 a, c dbSNP:772275100
4457 4457 c, t dbSNP:551729599
4464 4464 a, g dbSNP:371322545
4528 4528 a, c dbSNP:562804703
4540 4540 a, g dbSNP:544510386
4561 4561 a, g dbSNP:10863130
4591 4591 a, g dbSNP:553993027
4595 4595 c, t dbSNP:73176276
4609 4609 a, c dbSNP:572087484
4615 4615 a, g dbSNP:142014376
4630 4630 a, t dbSNP:556032382
4701 4701 g, t dbSNP:777523702
4743 4743 a, g dbSNP:538596385
4803 4803 a, g dbSNP:577722283
4805 4805 c, g dbSNP:556450915
4819 4819 a, g dbSNP:542142385
4877 4877 a, g dbSNP:756093335
4911 4911 c, g dbSNP:543182248
4929 4929 g, t dbSNP:567606122

Target ORF information:

RefSeq Version XM_011538152
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu46462
Accession Version XM_011538153.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1524bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C isoform X4
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_029419.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)659..1486(+)
Position Chain Variation Link
17 17 c, g dbSNP:550075042
26 26 g, t dbSNP:561614020
28 28 c, t dbSNP:541835785
34 34 c, g, t dbSNP:571733939
37 37 a, g dbSNP:766885112
44 44 c, t dbSNP:557804308
47 47 c, t dbSNP:763411438
49 49 c, g, t dbSNP:146407145
53 53 -, gcc dbSNP:761406464
54 54 c, t dbSNP:766143562
62 62 a, g dbSNP:773382527
88 88 a, g dbSNP:571130576
107 107 a, g dbSNP:138834123
118 118 a, g dbSNP:531265838
141 141 c, t dbSNP:567026502
154 154 a, g dbSNP:545399064
157 157 a, g dbSNP:770834628
159 159 -, aacaat dbSNP:752508138
177 177 a, g dbSNP:376082316
180 180 -, c dbSNP:35015230
245 245 a, t dbSNP:779572975
260 260 c, t dbSNP:771412010
274 274 a, c dbSNP:558034898
297 297 g, t dbSNP:765371348
303 303 a, g dbSNP:762060081
405 405 a, g dbSNP:759421317
426 426 c, t dbSNP:774378533
427 427 a, g dbSNP:564862144
440 440 g, t dbSNP:770566369
444 444 a, g dbSNP:756067228
452 452 c, g dbSNP:543297194
504 504 a, c dbSNP:759053090
505 505 a, c dbSNP:548807976
514 514 a, g dbSNP:770892207
518 518 a, t dbSNP:762868613
522 522 a, g dbSNP:201584077
527 527 c, t dbSNP:769763236
538 538 c, g, t dbSNP:370869346
543 543 a, g dbSNP:772217070
563 563 c, t dbSNP:745947947
564 564 a, g dbSNP:145205649
570 570 a, c dbSNP:757749414
571 571 a, g dbSNP:749807069
578 578 g, t dbSNP:749491204
580 580 c, t dbSNP:138787902
582 582 -, g dbSNP:36069674
587 587 a, g, t dbSNP:532825428
593 593 g, t dbSNP:767169663
605 605 c, g dbSNP:754687253
620 620 c, t dbSNP:751079600
624 624 c, t dbSNP:200641508
650 650 a, g dbSNP:149974845
654 654 a, g dbSNP:764027512
655 655 -, acaa dbSNP:761066259
663 663 g, t dbSNP:759753045
680 680 c, t dbSNP:774470064
682 682 -, c dbSNP:35652293
685 685 a, g dbSNP:770979746
698 698 c, t dbSNP:762956258
699 699 a, g, t dbSNP:200651947
702 702 a, c, g dbSNP:192255840
714 714 c, t dbSNP:781516891
744 744 c, t dbSNP:768927396
752 752 a, c dbSNP:746602295
759 759 a, g dbSNP:375819261
760 760 c, t dbSNP:758123335
764 764 c, g dbSNP:749945581
770 770 a, g dbSNP:200901180
772 772 c, t dbSNP:112983335
776 776 c, t dbSNP:757238970
778 778 c, t dbSNP:111495386
791 791 c, t dbSNP:753847188
796 796 c, t dbSNP:756857554
812 812 g, t dbSNP:190762233
820 820 a, g dbSNP:777587242
824 824 c, t dbSNP:139777686
825 825 a, g dbSNP:147418986
827 827 a, g dbSNP:752431991
846 846 c, t dbSNP:767389242
850 850 c, g dbSNP:763067361
852 852 a, c dbSNP:750669561
854 854 a, g dbSNP:765264406
859 859 a, g dbSNP:761892291
863 863 a, g dbSNP:776746849
883 883 c, t dbSNP:185118551
890 890 c, g dbSNP:761281614
892 892 a, g dbSNP:775693691
914 914 c, g dbSNP:536944591
917 917 a, c, g dbSNP:539968414
922 922 a, c dbSNP:774149822
941 941 c, t dbSNP:566418071
942 942 a, g dbSNP:748796788
948 948 a, c dbSNP:777409272
951 951 c, t dbSNP:755975066
952 952 a, g dbSNP:142839367
962 962 a, g dbSNP:748169936
967 967 a, g dbSNP:780805071
970 970 c, g dbSNP:754801625
978 978 c, t dbSNP:140499591
979 979 a, g dbSNP:765429825
982 982 a, c dbSNP:757539324
999 999 a, g dbSNP:566043053
1000 1000 a, g dbSNP:753826277
1006 1006 a, g dbSNP:113387514
1024 1024 a, g dbSNP:764279389
1056 1056 a, g dbSNP:150545721
1063 1063 c, t dbSNP:776093722
1065 1065 a, g dbSNP:141672136
1070 1070 a, c dbSNP:759994326
1090 1090 c, t dbSNP:770595521
1091 1091 c, t dbSNP:749782221
1092 1092 a, g, t dbSNP:770702724
1106 1106 a, g dbSNP:748989192
1108 1108 a, g dbSNP:772578702
1124 1124 c, t dbSNP:769372443
1134 1134 a, g dbSNP:747999039
1140 1140 a, g dbSNP:147998015
1156 1156 c, g, t dbSNP:372911876
1160 1160 a, g dbSNP:778384478
1162 1162 a, g dbSNP:143449252
1163 1163 c, t dbSNP:746800765
1172 1172 a, g dbSNP:779860939
1178 1178 c, t dbSNP:757444701
1179 1179 a, g dbSNP:754111075
1185 1185 a, c dbSNP:75276700
1213 1213 a, t dbSNP:764040141
1215 1215 g, t dbSNP:756220458
1221 1221 c, t dbSNP:753086343
1222 1222 a, c dbSNP:768126876
1224 1224 c, t dbSNP:199811466
1244 1244 a, g dbSNP:760188889
1248 1248 a, c dbSNP:547661699
1264 1264 a, g dbSNP:368524858
1276 1276 a, t dbSNP:766900187
1279 1279 c, t dbSNP:539250548
1282 1282 a, c dbSNP:772953057
1296 1296 a, g dbSNP:769121552
1300 1300 c, t dbSNP:375386863
1303 1303 c, t dbSNP:267603706
1305 1305 a, c dbSNP:141479653
1306 1306 a, g dbSNP:371453579
1307 1307 c, g dbSNP:765452856
1308 1308 a, g dbSNP:367612551
1322 1322 g, t dbSNP:776069370
1335 1335 a, c dbSNP:200155199
1345 1345 a, g dbSNP:768547952
1346 1346 a, c dbSNP:746994463
1352 1352 a, g dbSNP:374072925
1361 1361 c, t dbSNP:753925997
1373 1373 c, t dbSNP:771884299
1374 1374 a, g dbSNP:749402312
1381 1381 a, g dbSNP:374349115
1387 1387 c, t dbSNP:138500929
1389 1389 a, c dbSNP:752818848
1397 1397 g, t dbSNP:145889731
1403 1403 c, t dbSNP:114903783
1404 1404 a, g dbSNP:140682310
1417 1417 c, g, t dbSNP:766814115
1444 1444 a, g dbSNP:201179683
1447 1447 a, g dbSNP:749990047
1451 1451 a, g dbSNP:764935665
1458 1458 c, t dbSNP:145801611
1459 1459 a, g dbSNP:370614450
1464 1464 a, g dbSNP:768173767
1467 1467 a, c dbSNP:760563980
1469 1469 c, g dbSNP:775408430
1471 1471 a, g dbSNP:771796611
1473 1473 a, g dbSNP:745661909
1476 1476 a, g dbSNP:778640907
1490 1490 a, g dbSNP:770027343
1492 1492 a, g dbSNP:199528320
1499 1499 c, t dbSNP:180907536
1503 1503 a, g dbSNP:781372905
1505 1505 a, g dbSNP:376986836
1511 1511 -, g dbSNP:776059817
1519 1519 c, g dbSNP:755227553
1521 1521 -, c dbSNP:772624713
1529 1529 c, t dbSNP:752047649
1532 1532 c, t dbSNP:780724562
1536 1536 a, c dbSNP:758890049
1575 1575 c, t dbSNP:535303532
1584 1584 c, g dbSNP:750764518
1598 1598 -, t dbSNP:36020292
1619 1619 a, g dbSNP:34889924
1625 1625 c, g dbSNP:756883344
1627 1627 g, t dbSNP:753517104
1628 1628 a, c, g dbSNP:202157734
1631 1631 a, t dbSNP:775039626
1634 1634 a, g dbSNP:767487110
1641 1641 c, t dbSNP:759432736
1659 1659 a, t dbSNP:112713100
1663 1663 a, t dbSNP:559630993
1664 1664 a, g dbSNP:770656314
1670 1670 -, a dbSNP:779025640
1670 1670 -, a dbSNP:746398787
1676 1676 -, gtaaa dbSNP:770864945
1698 1698 a, g dbSNP:751790011
1702 1702 a, c dbSNP:540843966
1720 1720 c, t dbSNP:373806118
1725 1725 a, c dbSNP:747076027
1729 1729 a, g dbSNP:7958826
1733 1733 a, g dbSNP:565196653
1734 1734 c, t dbSNP:746382301
1737 1737 c, g dbSNP:779294242
1744 1744 c, t dbSNP:34663658
1745 1745 a, g dbSNP:369051385
1748 1748 a, g dbSNP:142800914
1756 1756 a, c dbSNP:755830364
1762 1762 a, g dbSNP:752173498
1773 1773 c, g dbSNP:766985178
1778 1778 a, g dbSNP:759471267
1779 1779 c, g dbSNP:17855890
1794 1794 c, g dbSNP:766133859
1802 1802 a, g dbSNP:750521235
1807 1807 c, t dbSNP:762857247
1810 1810 a, g dbSNP:773203393
1841 1841 a, g dbSNP:144502445
1842 1842 a, t dbSNP:140537872
1851 1851 a, g dbSNP:775586689
1856 1856 c, t dbSNP:78521308
1868 1868 a, c dbSNP:746316239
1877 1877 a, g dbSNP:779299698
1891 1891 c, g dbSNP:572756292
1892 1892 c, g dbSNP:749648790
1894 1894 a, g dbSNP:778149917
1898 1898 a, c dbSNP:374295123
1900 1900 a, g dbSNP:144062899
1927 1927 c, t dbSNP:780715327
1947 1947 c, t dbSNP:754454532
1950 1950 g, t dbSNP:370622926
1962 1962 a, g dbSNP:766217087
1969 1969 -, t dbSNP:749399472
1974 1974 c, t dbSNP:554470708
1977 1977 c, t dbSNP:750217452
1980 1980 c, t dbSNP:144593863
1981 1981 a, g, t dbSNP:376457265
1983 1983 c, g dbSNP:772130957
2056 2056 a, g dbSNP:571819913
2058 2058 c, t dbSNP:558320764
2070 2070 c, t dbSNP:536744820
2118 2118 c, t dbSNP:190102027
2119 2119 a, g dbSNP:547766766
2129 2129 g, t dbSNP:529667272
2141 2141 a, g dbSNP:565806131
2233 2233 a, g dbSNP:760351772
2273 2273 a, c dbSNP:547682225
2335 2335 a, g dbSNP:140747359
2350 2350 -, t dbSNP:376872523
2358 2358 -, t dbSNP:63172860
2359 2359 -, t dbSNP:56135820
2359 2359 g, t dbSNP:201003713
2361 2361 -, tg dbSNP:201247976
2361 2361 g, t dbSNP:201747129
2362 2362 -, g dbSNP:200496066
2378 2378 g, t dbSNP:565088480
2393 2393 a, c dbSNP:543684623
2462 2462 a, t dbSNP:771881987
2486 2486 -, a dbSNP:34017217
2520 2520 c, t dbSNP:79372569
2580 2580 a, g dbSNP:147631754
2589 2589 a, c dbSNP:561397399
2615 2615 c, t dbSNP:543016942
2685 2685 a, g dbSNP:774012894
2687 2687 g, t dbSNP:572420244
2693 2693 c, g dbSNP:554130352
2713 2713 a, g dbSNP:111896557
2714 2714 c, t dbSNP:770361266
2730 2730 c, t dbSNP:570155284
2731 2731 a, g dbSNP:7300102
2804 2804 a, c, g dbSNP:747428458
2814 2814 c, t dbSNP:578220427
2862 2862 a, g dbSNP:556707181
2920 2920 c, t dbSNP:538082475
2952 2952 c, g dbSNP:758630271
2956 2956 c, t dbSNP:750433533
3012 3012 a, g dbSNP:202199482
3016 3016 c, t dbSNP:569388804
3029 3029 a, c dbSNP:550040127
3030 3030 c, t dbSNP:554263663
3083 3083 a, g dbSNP:535809406
3092 3092 a, g dbSNP:759842333
3107 3107 c, t dbSNP:774607729
3111 3111 -, a dbSNP:770585444
3117 3117 a, c dbSNP:148442794
3176 3176 a, g dbSNP:185784088
3198 3198 a, t dbSNP:201032692
3205 3205 a, g dbSNP:533441584
3240 3240 -, gaa dbSNP:371940109
3241 3241 -, aag dbSNP:372115717
3242 3242 -, aga dbSNP:201786449
3258 3258 c, t dbSNP:532429677
3259 3259 g, t dbSNP:144552823
3290 3290 -, gtttttt dbSNP:372134652
3296 3296 -, acagcaaaaactaagggatttattataaagggaaatggaagg dbSNP:375844704
3301 3301 a, g dbSNP:12830189
3304 3304 a, c dbSNP:77243419
3339 3339 c, g dbSNP:753768505
3374 3374 a, c dbSNP:547936981
3379 3379 a, t dbSNP:549508927
3387 3387 -, ctgtgt dbSNP:773194012
3387 3387 c, g dbSNP:747666669
3388 3388 -, tgtgtgtg dbSNP:67385136
3388 3388 -, tgtgtg dbSNP:58212652
3406 3406 -, tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg dbSNP:147763218
3406 3406 -, tgtgtgtgtgtg dbSNP:766509991
3406 3406 -, tgtgtgtgtg dbSNP:751762581
3434 3434 -, tgtgtgtg dbSNP:367866196
3440 3440 (tg)8, 14, 20, 21, 22, 23, 24, 25, 26, 27 dbSNP:3219969
3466 3466 c, t dbSNP:370571115
3483 3483 c, t dbSNP:527640100
3498 3498 a, c dbSNP:560536156
3608 3608 a, c dbSNP:73392025
3616 3616 a, t dbSNP:578184469
3625 3625 c, t dbSNP:763918344
3655 3655 g, t dbSNP:564570984
3687 3687 c, t dbSNP:181528211
3688 3688 a, g dbSNP:190376900
3691 3691 a, c dbSNP:752559558
3703 3703 g, t dbSNP:573908791
3743 3743 c, g dbSNP:139854276
3760 3760 a, g dbSNP:527846727
3806 3806 g, t dbSNP:562371573
3821 3821 a, c dbSNP:376189416
3833 3833 c, g dbSNP:759270217
3879 3879 a, g dbSNP:773996332
3883 3883 a, g dbSNP:145979907
3921 3921 a, g dbSNP:542513832
3946 3946 c, t dbSNP:536345624
3977 3977 a, g dbSNP:751331151
4004 4004 c, g dbSNP:2405791
4046 4046 c, t dbSNP:373049465
4053 4053 a, c, g dbSNP:11117140
4093 4093 a, g dbSNP:776960091
4104 4104 a, g dbSNP:576500612
4167 4167 a, g dbSNP:571490847
4168 4168 c, t dbSNP:75672699
4235 4235 a, g dbSNP:118101076
4250 4250 a, g dbSNP:757482863
4254 4254 c, g dbSNP:182596158
4272 4272 c, g dbSNP:137895577
4354 4354 a, t dbSNP:527775710
4370 4370 a, c dbSNP:560415479
4375 4375 g, t dbSNP:747275916
4381 4381 g, t dbSNP:545886501
4450 4450 a, c dbSNP:772275100
4460 4460 c, t dbSNP:551729599
4467 4467 a, g dbSNP:371322545
4531 4531 a, c dbSNP:562804703
4543 4543 a, g dbSNP:544510386
4564 4564 a, g dbSNP:10863130
4594 4594 a, g dbSNP:553993027
4598 4598 c, t dbSNP:73176276
4612 4612 a, c dbSNP:572087484
4618 4618 a, g dbSNP:142014376
4633 4633 a, t dbSNP:556032382
4704 4704 g, t dbSNP:777523702
4746 4746 a, g dbSNP:538596385
4806 4806 a, g dbSNP:577722283
4808 4808 c, g dbSNP:556450915
4822 4822 a, g dbSNP:542142385
4880 4880 a, g dbSNP:756093335
4914 4914 c, g dbSNP:543182248
4932 4932 g, t dbSNP:567606122

Target ORF information:

RefSeq Version XM_011538153
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X5, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu46462
Accession Version XM_005268776.3 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 1524bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C isoform X4
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_029419.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578823549. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)529..1356(+)
Position Chain Variation Link
11 11 a, g dbSNP:773558890
52 52 c, t dbSNP:370016958
53 53 a, g dbSNP:11103902
58 58 g, t dbSNP:558172404
68 68 a, g dbSNP:112895249
81 81 g, t dbSNP:569204614
115 115 a, t dbSNP:539021829
119 119 a, g dbSNP:551173542
124 124 c, t dbSNP:778211754
172 172 c, g dbSNP:61949048
188 188 c, t dbSNP:566302122
275 275 a, g dbSNP:759421317
296 296 c, t dbSNP:774378533
297 297 a, g dbSNP:564862144
310 310 g, t dbSNP:770566369
314 314 a, g dbSNP:756067228
322 322 c, g dbSNP:543297194
374 374 a, c dbSNP:759053090
375 375 a, c dbSNP:548807976
384 384 a, g dbSNP:770892207
388 388 a, t dbSNP:762868613
392 392 a, g dbSNP:201584077
397 397 c, t dbSNP:769763236
408 408 c, g, t dbSNP:370869346
413 413 a, g dbSNP:772217070
433 433 c, t dbSNP:745947947
434 434 a, g dbSNP:145205649
440 440 a, c dbSNP:757749414
441 441 a, g dbSNP:749807069
448 448 g, t dbSNP:749491204
450 450 c, t dbSNP:138787902
452 452 -, g dbSNP:36069674
457 457 a, g, t dbSNP:532825428
463 463 g, t dbSNP:767169663
475 475 c, g dbSNP:754687253
490 490 c, t dbSNP:751079600
494 494 c, t dbSNP:200641508
520 520 a, g dbSNP:149974845
524 524 a, g dbSNP:764027512
525 525 -, acaa dbSNP:761066259
533 533 g, t dbSNP:759753045
550 550 c, t dbSNP:774470064
552 552 -, c dbSNP:35652293
555 555 a, g dbSNP:770979746
568 568 c, t dbSNP:762956258
569 569 a, g, t dbSNP:200651947
572 572 a, c, g dbSNP:192255840
584 584 c, t dbSNP:781516891
614 614 c, t dbSNP:768927396
622 622 a, c dbSNP:746602295
629 629