Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

MGAT4C MGAT4 family, member C [Homo sapiens (human)]

Gene Symbol MGAT4C
Entrez Gene ID 25834
Full Name MGAT4 family, member C
General protein information
Preferred Names
alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C
alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C
glcNAc-T IVc
N-acetylglucosaminyltransferase IVc
N-acetylglucosaminyltransferase IV homolog
N-glycosyl-oligosaccharide-glycoprotein N-acetylglucosaminyltransferase IVc
UDP-N-acetylglucosamine:a-1,3-D-mannoside beta-1,4-N-acetylglucosaminyltransferase IV
UDP-N-acetylglucosamine: alpha-1,3-D-mannoside beta-1,4-N-acetylglucosaminyltransferase IVc
UDP-N-acetylglucosamine:a-1,3-D-mannoside beta-1,4-N-acetylglucosaminyltransferase IV-homolog
Gene Type protein-coding
Organism Homo sapiens (human)



Summary lac of sum
Disorder MIM:


Disorder Html:
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu66525 XM_011538149 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu66526 XM_011538150 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu66526 XM_011538151 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu46462 XM_011538152 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X4, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu46462 XM_011538153 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X5, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu46462 XM_005268776 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X6, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu66527 XM_011538154 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X7, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu66527 XM_011538155 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X8, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu31637 XM_011538156 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X9, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu31637 XM_011538157 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X10, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu31637 XM_005268779 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X11, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu31637 XM_011538158 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X12, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu31637 XM_011538159 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X13, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu31637 XM_011538160 PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X14, mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00
OHu31637 NM_013244 Homo sapiens MGAT4 family, member C (MGAT4C), mRNA. pcDNA3.1-C-(k)DYK Not in stock 7-9 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu66525D
Sequence Information ORF Nucleotide Sequence (Length: 1584bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_029419.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)605..1432(+)
Position Chain Variation Link
11 11 a, g dbSNP:773558890
52 52 c, t dbSNP:370016958
53 53 a, g dbSNP:11103902
58 58 g, t dbSNP:558172404
68 68 a, g dbSNP:112895249
81 81 g, t dbSNP:569204614
115 115 a, t dbSNP:539021829
119 119 a, g dbSNP:551173542
124 124 c, t dbSNP:778211754
172 172 c, g dbSNP:61949048
188 188 c, t dbSNP:566302122
217 217 g, t dbSNP:539891507
219 219 g, t dbSNP:575838969
275 275 c, g dbSNP:186411772
291 291 a, g dbSNP:536177327
349 349 a, t dbSNP:755060619
379 379 c, t dbSNP:531934310
398 398 c, g, t dbSNP:561615887
411 411 c, t dbSNP:549654574
423 423 c, t dbSNP:527940128
450 450 a, c dbSNP:759053090
451 451 a, c dbSNP:548807976
460 460 a, g dbSNP:770892207
464 464 a, t dbSNP:762868613
468 468 a, g dbSNP:201584077
473 473 c, t dbSNP:769763236
484 484 c, g, t dbSNP:370869346
489 489 a, g dbSNP:772217070
509 509 c, t dbSNP:745947947
510 510 a, g dbSNP:145205649
516 516 a, c dbSNP:757749414
517 517 a, g dbSNP:749807069
524 524 g, t dbSNP:749491204
526 526 c, t dbSNP:138787902
528 528 -, g dbSNP:36069674
533 533 a, g, t dbSNP:532825428
539 539 g, t dbSNP:767169663
551 551 c, g dbSNP:754687253
566 566 c, t dbSNP:751079600
570 570 c, t dbSNP:200641508
596 596 a, g dbSNP:149974845
600 600 a, g dbSNP:764027512
601 601 -, acaa dbSNP:761066259
609 609 g, t dbSNP:759753045
626 626 c, t dbSNP:774470064
628 628 -, c dbSNP:35652293
631 631 a, g dbSNP:770979746
644 644 c, t dbSNP:762956258
645 645 a, g, t dbSNP:200651947
648 648 a, c, g dbSNP:192255840
660 660 c, t dbSNP:781516891
690 690 c, t dbSNP:768927396
698 698 a, c dbSNP:746602295
705 705 a, g dbSNP:375819261
706 706 c, t dbSNP:758123335
710 710 c, g dbSNP:749945581
716 716 a, g dbSNP:200901180
718 718 c, t dbSNP:112983335
722 722 c, t dbSNP:757238970
724 724 c, t dbSNP:111495386
737 737 c, t dbSNP:753847188
742 742 c, t dbSNP:756857554
758 758 g, t dbSNP:190762233
766 766 a, g dbSNP:777587242
770 770 c, t dbSNP:139777686
771 771 a, g dbSNP:147418986
773 773 a, g dbSNP:752431991
792 792 c, t dbSNP:767389242
796 796 c, g dbSNP:763067361
798 798 a, c dbSNP:750669561
800 800 a, g dbSNP:765264406
805 805 a, g dbSNP:761892291
809 809 a, g dbSNP:776746849
829 829 c, t dbSNP:185118551
836 836 c, g dbSNP:761281614
838 838 a, g dbSNP:775693691
860 860 c, g dbSNP:536944591
863 863 a, c, g dbSNP:539968414
868 868 a, c dbSNP:774149822
887 887 c, t dbSNP:566418071
888 888 a, g dbSNP:748796788
894 894 a, c dbSNP:777409272
897 897 c, t dbSNP:755975066
898 898 a, g dbSNP:142839367
908 908 a, g dbSNP:748169936
913 913 a, g dbSNP:780805071
916 916 c, g dbSNP:754801625
924 924 c, t dbSNP:140499591
925 925 a, g dbSNP:765429825
928 928 a, c dbSNP:757539324
945 945 a, g dbSNP:566043053
946 946 a, g dbSNP:753826277
952 952 a, g dbSNP:113387514
970 970 a, g dbSNP:764279389
1002 1002 a, g dbSNP:150545721
1009 1009 c, t dbSNP:776093722
1011 1011 a, g dbSNP:141672136
1016 1016 a, c dbSNP:759994326
1036 1036 c, t dbSNP:770595521
1037 1037 c, t dbSNP:749782221
1038 1038 a, g, t dbSNP:770702724
1052 1052 a, g dbSNP:748989192
1054 1054 a, g dbSNP:772578702
1070 1070 c, t dbSNP:769372443
1080 1080 a, g dbSNP:747999039
1086 1086 a, g dbSNP:147998015
1102 1102 c, g, t dbSNP:372911876
1106 1106 a, g dbSNP:778384478
1108 1108 a, g dbSNP:143449252
1109 1109 c, t dbSNP:746800765
1118 1118 a, g dbSNP:779860939
1124 1124 c, t dbSNP:757444701
1125 1125 a, g dbSNP:754111075
1131 1131 a, c dbSNP:75276700
1159 1159 a, t dbSNP:764040141
1161 1161 g, t dbSNP:756220458
1167 1167 c, t dbSNP:753086343
1168 1168 a, c dbSNP:768126876
1170 1170 c, t dbSNP:199811466
1190 1190 a, g dbSNP:760188889
1194 1194 a, c dbSNP:547661699
1210 1210 a, g dbSNP:368524858
1222 1222 a, t dbSNP:766900187
1225 1225 c, t dbSNP:539250548
1228 1228 a, c dbSNP:772953057
1242 1242 a, g dbSNP:769121552
1246 1246 c, t dbSNP:375386863
1249 1249 c, t dbSNP:267603706
1251 1251 a, c dbSNP:141479653
1252 1252 a, g dbSNP:371453579
1253 1253 c, g dbSNP:765452856
1254 1254 a, g dbSNP:367612551
1268 1268 g, t dbSNP:776069370
1281 1281 a, c dbSNP:200155199
1291 1291 a, g dbSNP:768547952
1292 1292 a, c dbSNP:746994463
1298 1298 a, g dbSNP:374072925
1307 1307 c, t dbSNP:753925997
1319 1319 c, t dbSNP:771884299
1320 1320 a, g dbSNP:749402312
1327 1327 a, g dbSNP:374349115
1333 1333 c, t dbSNP:138500929
1335 1335 a, c dbSNP:752818848
1343 1343 g, t dbSNP:145889731
1349 1349 c, t dbSNP:114903783
1350 1350 a, g dbSNP:140682310
1363 1363 c, g, t dbSNP:766814115
1390 1390 a, g dbSNP:201179683
1393 1393 a, g dbSNP:749990047
1397 1397 a, g dbSNP:764935665
1404 1404 c, t dbSNP:145801611
1405 1405 a, g dbSNP:370614450
1410 1410 a, g dbSNP:768173767
1413 1413 a, c dbSNP:760563980
1415 1415 c, g dbSNP:775408430
1417 1417 a, g dbSNP:771796611
1419 1419 a, g dbSNP:745661909
1422 1422 a, g dbSNP:778640907
1436 1436 a, g dbSNP:770027343
1438 1438 a, g dbSNP:199528320
1445 1445 c, t dbSNP:180907536
1449 1449 a, g dbSNP:781372905
1451 1451 a, g dbSNP:376986836
1457 1457 -, g dbSNP:776059817
1465 1465 c, g dbSNP:755227553
1467 1467 -, c dbSNP:772624713
1475 1475 c, t dbSNP:752047649
1478 1478 c, t dbSNP:780724562
1482 1482 a, c dbSNP:758890049
1521 1521 c, t dbSNP:535303532
1530 1530 c, g dbSNP:750764518
1544 1544 -, t dbSNP:36020292
1565 1565 a, g dbSNP:34889924
1571 1571 c, g dbSNP:756883344
1573 1573 g, t dbSNP:753517104
1574 1574 a, c, g dbSNP:202157734
1577 1577 a, t dbSNP:775039626
1580 1580 a, g dbSNP:767487110
1587 1587 c, t dbSNP:759432736
1605 1605 a, t dbSNP:112713100
1609 1609 a, t dbSNP:559630993
1610 1610 a, g dbSNP:770656314
1616 1616 -, a dbSNP:779025640
1616 1616 -, a dbSNP:746398787
1622 1622 -, gtaaa dbSNP:770864945
1644 1644 a, g dbSNP:751790011
1648 1648 a, c dbSNP:540843966
1666 1666 c, t dbSNP:373806118
1671 1671 a, c dbSNP:747076027
1675 1675 a, g dbSNP:7958826
1679 1679 a, g dbSNP:565196653
1680 1680 c, t dbSNP:746382301
1683 1683 c, g dbSNP:779294242
1690 1690 c, t dbSNP:34663658
1691 1691 a, g dbSNP:369051385
1694 1694 a, g dbSNP:142800914
1702 1702 a, c dbSNP:755830364
1708 1708 a, g dbSNP:752173498
1719 1719 c, g dbSNP:766985178
1724 1724 a, g dbSNP:759471267
1725 1725 c, g dbSNP:17855890
1740 1740 c, g dbSNP:766133859
1748 1748 a, g dbSNP:750521235
1753 1753 c, t dbSNP:762857247
1756 1756 a, g dbSNP:773203393
1787 1787 a, g dbSNP:144502445
1788 1788 a, t dbSNP:140537872
1797 1797 a, g dbSNP:775586689
1802 1802 c, t dbSNP:78521308
1814 1814 a, c dbSNP:746316239
1823 1823 a, g dbSNP:779299698
1837 1837 c, g dbSNP:572756292
1838 1838 c, g dbSNP:749648790
1840 1840 a, g dbSNP:778149917
1844 1844 a, c dbSNP:374295123
1846 1846 a, g dbSNP:144062899
1873 1873 c, t dbSNP:780715327
1893 1893 c, t dbSNP:754454532
1896 1896 g, t dbSNP:370622926
1908 1908 a, g dbSNP:766217087
1915 1915 -, t dbSNP:749399472
1920 1920 c, t dbSNP:554470708
1923 1923 c, t dbSNP:750217452
1926 1926 c, t dbSNP:144593863
1927 1927 a, g, t dbSNP:376457265
1929 1929 c, g dbSNP:772130957
2002 2002 a, g dbSNP:571819913
2004 2004 c, t dbSNP:558320764
2016 2016 c, t dbSNP:536744820
2064 2064 c, t dbSNP:190102027
2065 2065 a, g dbSNP:547766766
2075 2075 g, t dbSNP:529667272
2087 2087 a, g dbSNP:565806131
2179 2179 a, g dbSNP:760351772
2219 2219 a, c dbSNP:547682225
2281 2281 a, g dbSNP:140747359
2296 2296 -, t dbSNP:376872523
2304 2304 -, t dbSNP:63172860
2305 2305 -, t dbSNP:56135820
2305 2305 g, t dbSNP:201003713
2307 2307 -, tg dbSNP:201247976
2307 2307 g, t dbSNP:201747129
2308 2308 -, g dbSNP:200496066
2324 2324 g, t dbSNP:565088480
2339 2339 a, c dbSNP:543684623
2408 2408 a, t dbSNP:771881987
2432 2432 -, a dbSNP:34017217
2466 2466 c, t dbSNP:79372569
2526 2526 a, g dbSNP:147631754
2535 2535 a, c dbSNP:561397399
2561 2561 c, t dbSNP:543016942
2631 2631 a, g dbSNP:774012894
2633 2633 g, t dbSNP:572420244
2639 2639 c, g dbSNP:554130352
2659 2659 a, g dbSNP:111896557
2660 2660 c, t dbSNP:770361266
2676 2676 c, t dbSNP:570155284
2677 2677 a, g dbSNP:7300102
2750 2750 a, c, g dbSNP:747428458
2760 2760 c, t dbSNP:578220427
2808 2808 a, g dbSNP:556707181
2866 2866 c, t dbSNP:538082475
2898 2898 c, g dbSNP:758630271
2902 2902 c, t dbSNP:750433533
2958 2958 a, g dbSNP:202199482
2962 2962 c, t dbSNP:569388804
2975 2975 a, c dbSNP:550040127
2976 2976 c, t dbSNP:554263663
3029 3029 a, g dbSNP:535809406
3038 3038 a, g dbSNP:759842333
3053 3053 c, t dbSNP:774607729
3057 3057 -, a dbSNP:770585444
3063 3063 a, c dbSNP:148442794
3122 3122 a, g dbSNP:185784088
3144 3144 a, t dbSNP:201032692
3151 3151 a, g dbSNP:533441584
3186 3186 -, gaa dbSNP:371940109
3187 3187 -, aag dbSNP:372115717
3188 3188 -, aga dbSNP:201786449
3204 3204 c, t dbSNP:532429677
3205 3205 g, t dbSNP:144552823
3236 3236 -, gtttttt dbSNP:372134652
3242 3242 -, acagcaaaaactaagggatttattataaagggaaatggaagg dbSNP:375844704
3247 3247 a, g dbSNP:12830189
3250 3250 a, c dbSNP:77243419
3285 3285 c, g dbSNP:753768505
3320 3320 a, c dbSNP:547936981
3325 3325 a, t dbSNP:549508927
3333 3333 -, ctgtgt dbSNP:773194012
3333 3333 c, g dbSNP:747666669
3334 3334 -, tgtgtgtg dbSNP:67385136
3334 3334 -, tgtgtg dbSNP:58212652
3352 3352 -, tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg dbSNP:147763218
3352 3352 -, tgtgtgtgtgtg dbSNP:766509991
3352 3352 -, tgtgtgtgtg dbSNP:751762581
3380 3380 -, tgtgtgtg dbSNP:367866196
3386 3386 (tg)8, 14, 20, 21, 22, 23, 24, 25, 26, 27 dbSNP:3219969
3412 3412 c, t dbSNP:370571115
3429 3429 c, t dbSNP:527640100
3444 3444 a, c dbSNP:560536156
3554 3554 a, c dbSNP:73392025
3562 3562 a, t dbSNP:578184469
3571 3571 c, t dbSNP:763918344
3601 3601 g, t dbSNP:564570984
3633 3633 c, t dbSNP:181528211
3634 3634 a, g dbSNP:190376900
3637 3637 a, c dbSNP:752559558
3649 3649 g, t dbSNP:573908791
3689 3689 c, g dbSNP:139854276
3706 3706 a, g dbSNP:527846727
3752 3752 g, t dbSNP:562371573
3767 3767 a, c dbSNP:376189416
3779 3779 c, g dbSNP:759270217
3825 3825 a, g dbSNP:773996332
3829 3829 a, g dbSNP:145979907
3867 3867 a, g dbSNP:542513832
3892 3892 c, t dbSNP:536345624
3923 3923 a, g dbSNP:751331151
3950 3950 c, g dbSNP:2405791
3992 3992 c, t dbSNP:373049465
3999 3999 a, c, g dbSNP:11117140
4039 4039 a, g dbSNP:776960091
4050 4050 a, g dbSNP:576500612
4113 4113 a, g dbSNP:571490847
4114 4114 c, t dbSNP:75672699
4181 4181 a, g dbSNP:118101076
4196 4196 a, g dbSNP:757482863
4200 4200 c, g dbSNP:182596158
4218 4218 c, g dbSNP:137895577
4300 4300 a, t dbSNP:527775710
4316 4316 a, c dbSNP:560415479
4321 4321 g, t dbSNP:747275916
4327 4327 g, t dbSNP:545886501
4396 4396 a, c dbSNP:772275100
4406 4406 c, t dbSNP:551729599
4413 4413 a, g dbSNP:371322545
4477 4477 a, c dbSNP:562804703
4489 4489 a, g dbSNP:544510386
4510 4510 a, g dbSNP:10863130
4540 4540 a, g dbSNP:553993027
4544 4544 c, t dbSNP:73176276
4558 4558 a, c dbSNP:572087484
4564 4564 a, g dbSNP:142014376
4579 4579 a, t dbSNP:556032382
4650 4650 g, t dbSNP:777523702
4692 4692 a, g dbSNP:538596385
4752 4752 a, g dbSNP:577722283
4754 4754 c, g dbSNP:556450915
4768 4768 a, g dbSNP:542142385
4826 4826 a, g dbSNP:756093335
4860 4860 c, g dbSNP:543182248
4878 4878 g, t dbSNP:567606122

Target ORF information:

RefSeq Version XM_011538149
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu66526D
Sequence Information ORF Nucleotide Sequence (Length: 1551bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_029419.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)454..1281(+)
Position Chain Variation Link
6 6 a, g dbSNP:112895249
19 19 g, t dbSNP:569204614
53 53 a, t dbSNP:539021829
57 57 a, g dbSNP:551173542
62 62 c, t dbSNP:778211754
110 110 c, g dbSNP:61949048
126 126 c, t dbSNP:566302122
198 198 a, t dbSNP:755060619
228 228 c, t dbSNP:531934310
247 247 c, g, t dbSNP:561615887
260 260 c, t dbSNP:549654574
272 272 c, t dbSNP:527940128
299 299 a, c dbSNP:759053090
300 300 a, c dbSNP:548807976
309 309 a, g dbSNP:770892207
313 313 a, t dbSNP:762868613
317 317 a, g dbSNP:201584077
322 322 c, t dbSNP:769763236
333 333 c, g, t dbSNP:370869346
338 338 a, g dbSNP:772217070
358 358 c, t dbSNP:745947947
359 359 a, g dbSNP:145205649
365 365 a, c dbSNP:757749414
366 366 a, g dbSNP:749807069
373 373 g, t dbSNP:749491204
375 375 c, t dbSNP:138787902
377 377 -, g dbSNP:36069674
382 382 a, g, t dbSNP:532825428
388 388 g, t dbSNP:767169663
400 400 c, g dbSNP:754687253
415 415 c, t dbSNP:751079600
419 419 c, t dbSNP:200641508
445 445 a, g dbSNP:149974845
449 449 a, g dbSNP:764027512
450 450 -, acaa dbSNP:761066259
458 458 g, t dbSNP:759753045
475 475 c, t dbSNP:774470064
477 477 -, c dbSNP:35652293
480 480 a, g dbSNP:770979746
493 493 c, t dbSNP:762956258
494 494 a, g, t dbSNP:200651947
497 497 a, c, g dbSNP:192255840
509 509 c, t dbSNP:781516891
539 539 c, t dbSNP:768927396
547 547 a, c dbSNP:746602295
554 554 a, g dbSNP:375819261
555 555 c, t dbSNP:758123335
559 559 c, g dbSNP:749945581
565 565 a, g dbSNP:200901180
567 567 c, t dbSNP:112983335
571 571 c, t dbSNP:757238970
573 573 c, t dbSNP:111495386
586 586 c, t dbSNP:753847188
591 591 c, t dbSNP:756857554
607 607 g, t dbSNP:190762233
615 615 a, g dbSNP:777587242
619 619 c, t dbSNP:139777686
620 620 a, g dbSNP:147418986
622 622 a, g dbSNP:752431991
641 641 c, t dbSNP:767389242
645 645 c, g dbSNP:763067361
647 647 a, c dbSNP:750669561
649 649 a, g dbSNP:765264406
654 654 a, g dbSNP:761892291
658 658 a, g dbSNP:776746849
678 678 c, t dbSNP:185118551
685 685 c, g dbSNP:761281614
687 687 a, g dbSNP:775693691
709 709 c, g dbSNP:536944591
712 712 a, c, g dbSNP:539968414
717 717 a, c dbSNP:774149822
736 736 c, t dbSNP:566418071
737 737 a, g dbSNP:748796788
743 743 a, c dbSNP:777409272
746 746 c, t dbSNP:755975066
747 747 a, g dbSNP:142839367
757 757 a, g dbSNP:748169936
762 762 a, g dbSNP:780805071
765 765 c, g dbSNP:754801625
773 773 c, t dbSNP:140499591
774 774 a, g dbSNP:765429825
777 777 a, c dbSNP:757539324
794 794 a, g dbSNP:566043053
795 795 a, g dbSNP:753826277
801 801 a, g dbSNP:113387514
819 819 a, g dbSNP:764279389
851 851 a, g dbSNP:150545721
858 858 c, t dbSNP:776093722
860 860 a, g dbSNP:141672136
865 865 a, c dbSNP:759994326
885 885 c, t dbSNP:770595521
886 886 c, t dbSNP:749782221
887 887 a, g, t dbSNP:770702724
901 901 a, g dbSNP:748989192
903 903 a, g dbSNP:772578702
919 919 c, t dbSNP:769372443
929 929 a, g dbSNP:747999039
935 935 a, g dbSNP:147998015
951 951 c, g, t dbSNP:372911876
955 955 a, g dbSNP:778384478
957 957 a, g dbSNP:143449252
958 958 c, t dbSNP:746800765
967 967 a, g dbSNP:779860939
973 973 c, t dbSNP:757444701
974 974 a, g dbSNP:754111075
980 980 a, c dbSNP:75276700
1008 1008 a, t dbSNP:764040141
1010 1010 g, t dbSNP:756220458
1016 1016 c, t dbSNP:753086343
1017 1017 a, c dbSNP:768126876
1019 1019 c, t dbSNP:199811466
1039 1039 a, g dbSNP:760188889
1043 1043 a, c dbSNP:547661699
1059 1059 a, g dbSNP:368524858
1071 1071 a, t dbSNP:766900187
1074 1074 c, t dbSNP:539250548
1077 1077 a, c dbSNP:772953057
1091 1091 a, g dbSNP:769121552
1095 1095 c, t dbSNP:375386863
1098 1098 c, t dbSNP:267603706
1100 1100 a, c dbSNP:141479653
1101 1101 a, g dbSNP:371453579
1102 1102 c, g dbSNP:765452856
1103 1103 a, g dbSNP:367612551
1117 1117 g, t dbSNP:776069370
1130 1130 a, c dbSNP:200155199
1140 1140 a, g dbSNP:768547952
1141 1141 a, c dbSNP:746994463
1147 1147 a, g dbSNP:374072925
1156 1156 c, t dbSNP:753925997
1168 1168 c, t dbSNP:771884299
1169 1169 a, g dbSNP:749402312
1176 1176 a, g dbSNP:374349115
1182 1182 c, t dbSNP:138500929
1184 1184 a, c dbSNP:752818848
1192 1192 g, t dbSNP:145889731
1198 1198 c, t dbSNP:114903783
1199 1199 a, g dbSNP:140682310
1212 1212 c, g, t dbSNP:766814115
1239 1239 a, g dbSNP:201179683
1242 1242 a, g dbSNP:749990047
1246 1246 a, g dbSNP:764935665
1253 1253 c, t dbSNP:145801611
1254 1254 a, g dbSNP:370614450
1259 1259 a, g dbSNP:768173767
1262 1262 a, c dbSNP:760563980
1264 1264 c, g dbSNP:775408430
1266 1266 a, g dbSNP:771796611
1268 1268 a, g dbSNP:745661909
1271 1271 a, g dbSNP:778640907
1285 1285 a, g dbSNP:770027343
1287 1287 a, g dbSNP:199528320
1294 1294 c, t dbSNP:180907536
1298 1298 a, g dbSNP:781372905
1300 1300 a, g dbSNP:376986836
1306 1306 -, g dbSNP:776059817
1314 1314 c, g dbSNP:755227553
1316 1316 -, c dbSNP:772624713
1324 1324 c, t dbSNP:752047649
1327 1327 c, t dbSNP:780724562
1331 1331 a, c dbSNP:758890049
1370 1370 c, t dbSNP:535303532
1379 1379 c, g dbSNP:750764518
1393 1393 -, t dbSNP:36020292
1414 1414 a, g dbSNP:34889924
1420 1420 c, g dbSNP:756883344
1422 1422 g, t dbSNP:753517104
1423 1423 a, c, g dbSNP:202157734
1426 1426 a, t dbSNP:775039626
1429 1429 a, g dbSNP:767487110
1436 1436 c, t dbSNP:759432736
1454 1454 a, t dbSNP:112713100
1458 1458 a, t dbSNP:559630993
1459 1459 a, g dbSNP:770656314
1465 1465 -, a dbSNP:779025640
1465 1465 -, a dbSNP:746398787
1471 1471 -, gtaaa dbSNP:770864945
1493 1493 a, g dbSNP:751790011
1497 1497 a, c dbSNP:540843966
1515 1515 c, t dbSNP:373806118
1520 1520 a, c dbSNP:747076027
1524 1524 a, g dbSNP:7958826
1528 1528 a, g dbSNP:565196653
1529 1529 c, t dbSNP:746382301
1532 1532 c, g dbSNP:779294242
1539 1539 c, t dbSNP:34663658
1540 1540 a, g dbSNP:369051385
1543 1543 a, g dbSNP:142800914
1551 1551 a, c dbSNP:755830364
1557 1557 a, g dbSNP:752173498
1568 1568 c, g dbSNP:766985178
1573 1573 a, g dbSNP:759471267
1574 1574 c, g dbSNP:17855890
1589 1589 c, g dbSNP:766133859
1597 1597 a, g dbSNP:750521235
1602 1602 c, t dbSNP:762857247
1605 1605 a, g dbSNP:773203393
1636 1636 a, g dbSNP:144502445
1637 1637 a, t dbSNP:140537872
1646 1646 a, g dbSNP:775586689
1651 1651 c, t dbSNP:78521308
1663 1663 a, c dbSNP:746316239
1672 1672 a, g dbSNP:779299698
1686 1686 c, g dbSNP:572756292
1687 1687 c, g dbSNP:749648790
1689 1689 a, g dbSNP:778149917
1693 1693 a, c dbSNP:374295123
1695 1695 a, g dbSNP:144062899
1722 1722 c, t dbSNP:780715327
1742 1742 c, t dbSNP:754454532
1745 1745 g, t dbSNP:370622926
1757 1757 a, g dbSNP:766217087
1764 1764 -, t dbSNP:749399472
1769 1769 c, t dbSNP:554470708
1772 1772 c, t dbSNP:750217452
1775 1775 c, t dbSNP:144593863
1776 1776 a, g, t dbSNP:376457265
1778 1778 c, g dbSNP:772130957
1851 1851 a, g dbSNP:571819913
1853 1853 c, t dbSNP:558320764
1865 1865 c, t dbSNP:536744820
1913 1913 c, t dbSNP:190102027
1914 1914 a, g dbSNP:547766766
1924 1924 g, t dbSNP:529667272
1936 1936 a, g dbSNP:565806131
2028 2028 a, g dbSNP:760351772
2068 2068 a, c dbSNP:547682225
2130 2130 a, g dbSNP:140747359
2145 2145 -, t dbSNP:376872523
2153 2153 -, t dbSNP:63172860
2154 2154 -, t dbSNP:56135820
2154 2154 g, t dbSNP:201003713
2156 2156 -, tg dbSNP:201247976
2156 2156 g, t dbSNP:201747129
2157 2157 -, g dbSNP:200496066
2173 2173 g, t dbSNP:565088480
2188 2188 a, c dbSNP:543684623
2257 2257 a, t dbSNP:771881987
2281 2281 -, a dbSNP:34017217
2315 2315 c, t dbSNP:79372569
2375 2375 a, g dbSNP:147631754
2384 2384 a, c dbSNP:561397399
2410 2410 c, t dbSNP:543016942
2480 2480 a, g dbSNP:774012894
2482 2482 g, t dbSNP:572420244
2488 2488 c, g dbSNP:554130352
2508 2508 a, g dbSNP:111896557
2509 2509 c, t dbSNP:770361266
2525 2525 c, t dbSNP:570155284
2526 2526 a, g dbSNP:7300102
2599 2599 a, c, g dbSNP:747428458
2609 2609 c, t dbSNP:578220427
2657 2657 a, g dbSNP:556707181
2715 2715 c, t dbSNP:538082475
2747 2747 c, g dbSNP:758630271
2751 2751 c, t dbSNP:750433533
2807 2807 a, g dbSNP:202199482
2811 2811 c, t dbSNP:569388804
2824 2824 a, c dbSNP:550040127
2825 2825 c, t dbSNP:554263663
2878 2878 a, g dbSNP:535809406
2887 2887 a, g dbSNP:759842333
2902 2902 c, t dbSNP:774607729
2906 2906 -, a dbSNP:770585444
2912 2912 a, c dbSNP:148442794
2971 2971 a, g dbSNP:185784088
2993 2993 a, t dbSNP:201032692
3000 3000 a, g dbSNP:533441584
3035 3035 -, gaa dbSNP:371940109
3036 3036 -, aag dbSNP:372115717
3037 3037 -, aga dbSNP:201786449
3053 3053 c, t dbSNP:532429677
3054 3054 g, t dbSNP:144552823
3085 3085 -, gtttttt dbSNP:372134652
3091 3091 -, acagcaaaaactaagggatttattataaagggaaatggaagg dbSNP:375844704
3096 3096 a, g dbSNP:12830189
3099 3099 a, c dbSNP:77243419
3134 3134 c, g dbSNP:753768505
3169 3169 a, c dbSNP:547936981
3174 3174 a, t dbSNP:549508927
3182 3182 -, ctgtgt dbSNP:773194012
3182 3182 c, g dbSNP:747666669
3183 3183 -, tgtgtgtg dbSNP:67385136
3183 3183 -, tgtgtg dbSNP:58212652
3201 3201 -, tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg dbSNP:147763218
3201 3201 -, tgtgtgtgtgtg dbSNP:766509991
3201 3201 -, tgtgtgtgtg dbSNP:751762581
3229 3229 -, tgtgtgtg dbSNP:367866196
3235 3235 (tg)8, 14, 20, 21, 22, 23, 24, 25, 26, 27 dbSNP:3219969
3261 3261 c, t dbSNP:370571115
3278 3278 c, t dbSNP:527640100
3293 3293 a, c dbSNP:560536156
3403 3403 a, c dbSNP:73392025
3411 3411 a, t dbSNP:578184469
3420 3420 c, t dbSNP:763918344
3450 3450 g, t dbSNP:564570984
3482 3482 c, t dbSNP:181528211
3483 3483 a, g dbSNP:190376900
3486 3486 a, c dbSNP:752559558
3498 3498 g, t dbSNP:573908791
3538 3538 c, g dbSNP:139854276
3555 3555 a, g dbSNP:527846727
3601 3601 g, t dbSNP:562371573
3616 3616 a, c dbSNP:376189416
3628 3628 c, g dbSNP:759270217
3674 3674 a, g dbSNP:773996332
3678 3678 a, g dbSNP:145979907
3716 3716 a, g dbSNP:542513832
3741 3741 c, t dbSNP:536345624
3772 3772 a, g dbSNP:751331151
3799 3799 c, g dbSNP:2405791
3841 3841 c, t dbSNP:373049465
3848 3848 a, c, g dbSNP:11117140
3888 3888 a, g dbSNP:776960091
3899 3899 a, g dbSNP:576500612
3962 3962 a, g dbSNP:571490847
3963 3963 c, t dbSNP:75672699
4030 4030 a, g dbSNP:118101076
4045 4045 a, g dbSNP:757482863
4049 4049 c, g dbSNP:182596158
4067 4067 c, g dbSNP:137895577
4149 4149 a, t dbSNP:527775710
4165 4165 a, c dbSNP:560415479
4170 4170 g, t dbSNP:747275916
4176 4176 g, t dbSNP:545886501
4245 4245 a, c dbSNP:772275100
4255 4255 c, t dbSNP:551729599
4262 4262 a, g dbSNP:371322545
4326 4326 a, c dbSNP:562804703
4338 4338 a, g dbSNP:544510386
4359 4359 a, g dbSNP:10863130
4389 4389 a, g dbSNP:553993027
4393 4393 c, t dbSNP:73176276
4407 4407 a, c dbSNP:572087484
4413 4413 a, g dbSNP:142014376
4428 4428 a, t dbSNP:556032382
4499 4499 g, t dbSNP:777523702
4541 4541 a, g dbSNP:538596385
4601 4601 a, g dbSNP:577722283
4603 4603 c, g dbSNP:556450915
4617 4617 a, g dbSNP:542142385
4675 4675 a, g dbSNP:756093335
4709 4709 c, g dbSNP:543182248
4727 4727 g, t dbSNP:567606122

Target ORF information:

RefSeq Version XM_011538150
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X2, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu66526D
Sequence Information ORF Nucleotide Sequence (Length: 1551bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C isoform X3
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_029419.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)370..1197(+)
Position Chain Variation Link
1 1 a, c dbSNP:558034898
24 24 g, t dbSNP:765371348
30 30 a, g dbSNP:762060081
114 114 a, t dbSNP:755060619
144 144 c, t dbSNP:531934310
163 163 c, g, t dbSNP:561615887
176 176 c, t dbSNP:549654574
188 188 c, t dbSNP:527940128
215 215 a, c dbSNP:759053090
216 216 a, c dbSNP:548807976
225 225 a, g dbSNP:770892207
229 229 a, t dbSNP:762868613
233 233 a, g dbSNP:201584077
238 238 c, t dbSNP:769763236
249 249 c, g, t dbSNP:370869346
254 254 a, g dbSNP:772217070
274 274 c, t dbSNP:745947947
275 275 a, g dbSNP:145205649
281 281 a, c dbSNP:757749414
282 282 a, g dbSNP:749807069
289 289 g, t dbSNP:749491204
291 291 c, t dbSNP:138787902
293 293 -, g dbSNP:36069674
298 298 a, g, t dbSNP:532825428
304 304 g, t dbSNP:767169663
316 316 c, g dbSNP:754687253
331 331 c, t dbSNP:751079600
335 335 c, t dbSNP:200641508
361 361 a, g dbSNP:149974845
365 365 a, g dbSNP:764027512
366 366 -, acaa dbSNP:761066259
374 374 g, t dbSNP:759753045
391 391 c, t dbSNP:774470064
393 393 -, c dbSNP:35652293
396 396 a, g dbSNP:770979746
409 409 c, t dbSNP:762956258
410 410 a, g, t dbSNP:200651947
413 413 a, c, g dbSNP:192255840
425 425 c, t dbSNP:781516891
455 455 c, t dbSNP:768927396
463 463 a, c dbSNP:746602295
470 470 a, g dbSNP:375819261
471 471 c, t dbSNP:758123335
475 475 c, g dbSNP:749945581
481 481 a, g dbSNP:200901180
483 483 c, t dbSNP:112983335
487 487 c, t dbSNP:757238970
489 489 c, t dbSNP:111495386
502 502 c, t dbSNP:753847188
507 507 c, t dbSNP:756857554
523 523 g, t dbSNP:190762233
531 531 a, g dbSNP:777587242
535 535 c, t dbSNP:139777686
536 536 a, g dbSNP:147418986
538 538 a, g dbSNP:752431991
557 557 c, t dbSNP:767389242
561 561 c, g dbSNP:763067361
563 563 a, c dbSNP:750669561
565 565 a, g dbSNP:765264406
570 570 a, g dbSNP:761892291
574 574 a, g dbSNP:776746849
594 594 c, t dbSNP:185118551
601 601 c, g dbSNP:761281614
603 603 a, g dbSNP:775693691
625 625 c, g dbSNP:536944591
628 628 a, c, g dbSNP:539968414
633 633 a, c dbSNP:774149822
652 652 c, t dbSNP:566418071
653 653 a, g dbSNP:748796788
659 659 a, c dbSNP:777409272
662 662 c, t dbSNP:755975066
663 663 a, g dbSNP:142839367
673 673 a, g dbSNP:748169936
678 678 a, g dbSNP:780805071
681 681 c, g dbSNP:754801625
689 689 c, t dbSNP:140499591
690 690 a, g dbSNP:765429825
693 693 a, c dbSNP:757539324
710 710 a, g dbSNP:566043053
711 711 a, g dbSNP:753826277
717 717 a, g dbSNP:113387514
735 735 a, g dbSNP:764279389
767 767 a, g dbSNP:150545721
774 774 c, t dbSNP:776093722
776 776 a, g dbSNP:141672136
781 781 a, c dbSNP:759994326
801 801 c, t dbSNP:770595521
802 802 c, t dbSNP:749782221
803 803 a, g, t dbSNP:770702724
817 817 a, g dbSNP:748989192
819 819 a, g dbSNP:772578702
835 835 c, t dbSNP:769372443
845 845 a, g dbSNP:747999039
851 851 a, g dbSNP:147998015
867 867 c, g, t dbSNP:372911876
871 871 a, g dbSNP:778384478
873 873 a, g dbSNP:143449252
874 874 c, t dbSNP:746800765
883 883 a, g dbSNP:779860939
889 889 c, t dbSNP:757444701
890 890 a, g dbSNP:754111075
896 896 a, c dbSNP:75276700
924 924 a, t dbSNP:764040141
926 926 g, t dbSNP:756220458
932 932 c, t dbSNP:753086343
933 933 a, c dbSNP:768126876
935 935 c, t dbSNP:199811466
955 955 a, g dbSNP:760188889
959 959 a, c dbSNP:547661699
975 975 a, g dbSNP:368524858
987 987 a, t dbSNP:766900187
990 990 c, t dbSNP:539250548
993 993 a, c dbSNP:772953057
1007 1007 a, g dbSNP:769121552
1011 1011 c, t dbSNP:375386863
1014 1014 c, t dbSNP:267603706
1016 1016 a, c dbSNP:141479653
1017 1017 a, g dbSNP:371453579
1018 1018 c, g dbSNP:765452856
1019 1019 a, g dbSNP:367612551
1033 1033 g, t dbSNP:776069370
1046 1046 a, c dbSNP:200155199
1056 1056 a, g dbSNP:768547952
1057 1057 a, c dbSNP:746994463
1063 1063 a, g dbSNP:374072925
1072 1072 c, t dbSNP:753925997
1084 1084 c, t dbSNP:771884299
1085 1085 a, g dbSNP:749402312
1092 1092 a, g dbSNP:374349115
1098 1098 c, t dbSNP:138500929
1100 1100 a, c dbSNP:752818848
1108 1108 g, t dbSNP:145889731
1114 1114 c, t dbSNP:114903783
1115 1115 a, g dbSNP:140682310
1128 1128 c, g, t dbSNP:766814115
1155 1155 a, g dbSNP:201179683
1158 1158 a, g dbSNP:749990047
1162 1162 a, g dbSNP:764935665
1169 1169 c, t dbSNP:145801611
1170 1170 a, g dbSNP:370614450
1175 1175 a, g dbSNP:768173767
1178 1178 a, c dbSNP:760563980
1180 1180 c, g dbSNP:775408430
1182 1182 a, g dbSNP:771796611
1184 1184 a, g dbSNP:745661909
1187 1187 a, g dbSNP:778640907
1201 1201 a, g dbSNP:770027343
1203 1203 a, g dbSNP:199528320
1210 1210 c, t dbSNP:180907536
1214 1214 a, g dbSNP:781372905
1216 1216 a, g dbSNP:376986836
1222 1222 -, g dbSNP:776059817
1230 1230 c, g dbSNP:755227553
1232 1232 -, c dbSNP:772624713
1240 1240 c, t dbSNP:752047649
1243 1243 c, t dbSNP:780724562
1247 1247 a, c dbSNP:758890049
1286 1286 c, t dbSNP:535303532
1295 1295 c, g dbSNP:750764518
1309 1309 -, t dbSNP:36020292
1330 1330 a, g dbSNP:34889924
1336 1336 c, g dbSNP:756883344
1338 1338 g, t dbSNP:753517104
1339 1339 a, c, g dbSNP:202157734
1342 1342 a, t dbSNP:775039626
1345 1345 a, g dbSNP:767487110
1352 1352 c, t dbSNP:759432736
1370 1370 a, t dbSNP:112713100
1374 1374 a, t dbSNP:559630993
1375 1375 a, g dbSNP:770656314
1381 1381 -, a dbSNP:779025640
1381 1381 -, a dbSNP:746398787
1387 1387 -, gtaaa dbSNP:770864945
1409 1409 a, g dbSNP:751790011
1413 1413 a, c dbSNP:540843966
1431 1431 c, t dbSNP:373806118
1436 1436 a, c dbSNP:747076027
1440 1440 a, g dbSNP:7958826
1444 1444 a, g dbSNP:565196653
1445 1445 c, t dbSNP:746382301
1448 1448 c, g dbSNP:779294242
1455 1455 c, t dbSNP:34663658
1456 1456 a, g dbSNP:369051385
1459 1459 a, g dbSNP:142800914
1467 1467 a, c dbSNP:755830364
1473 1473 a, g dbSNP:752173498
1484 1484 c, g dbSNP:766985178
1489 1489 a, g dbSNP:759471267
1490 1490 c, g dbSNP:17855890
1505 1505 c, g dbSNP:766133859
1513 1513 a, g dbSNP:750521235
1518 1518 c, t dbSNP:762857247
1521 1521 a, g dbSNP:773203393
1552 1552 a, g dbSNP:144502445
1553 1553 a, t dbSNP:140537872
1562 1562 a, g dbSNP:775586689
1567 1567 c, t dbSNP:78521308
1579 1579 a, c dbSNP:746316239
1588 1588 a, g dbSNP:779299698
1602 1602 c, g dbSNP:572756292
1603 1603 c, g dbSNP:749648790
1605 1605 a, g dbSNP:778149917
1609 1609 a, c dbSNP:374295123
1611 1611 a, g dbSNP:144062899
1638 1638 c, t dbSNP:780715327
1658 1658 c, t dbSNP:754454532
1661 1661 g, t dbSNP:370622926
1673 1673 a, g dbSNP:766217087
1680 1680 -, t dbSNP:749399472
1685 1685 c, t dbSNP:554470708
1688 1688 c, t dbSNP:750217452
1691 1691 c, t dbSNP:144593863
1692 1692 a, g, t dbSNP:376457265
1694 1694 c, g dbSNP:772130957
1767 1767 a, g dbSNP:571819913
1769 1769 c, t dbSNP:558320764
1781 1781 c, t dbSNP:536744820
1829 1829 c, t dbSNP:190102027
1830 1830 a, g dbSNP:547766766
1840 1840 g, t dbSNP:529667272
1852 1852 a, g dbSNP:565806131
1944 1944 a, g dbSNP:760351772
1984 1984 a, c dbSNP:547682225
2046 2046 a, g dbSNP:140747359
2061 2061 -, t dbSNP:376872523
2069 2069 -, t dbSNP:63172860
2070 2070 -, t dbSNP:56135820
2070 2070 g, t dbSNP:201003713
2072 2072 -, tg dbSNP:201247976
2072 2072 g, t dbSNP:201747129
2073 2073 -, g dbSNP:200496066
2089 2089 g, t dbSNP:565088480
2104 2104 a, c dbSNP:543684623
2173 2173 a, t dbSNP:771881987
2197 2197 -, a dbSNP:34017217
2231 2231 c, t dbSNP:79372569
2291 2291 a, g dbSNP:147631754
2300 2300 a, c dbSNP:561397399
2326 2326 c, t dbSNP:543016942
2396 2396 a, g dbSNP:774012894
2398 2398 g, t dbSNP:572420244
2404 2404 c, g dbSNP:554130352
2424 2424 a, g dbSNP:111896557
2425 2425 c, t dbSNP:770361266
2441 2441 c, t dbSNP:570155284
2442 2442 a, g dbSNP:7300102
2515 2515 a, c, g dbSNP:747428458
2525 2525 c, t dbSNP:578220427
2573 2573 a, g dbSNP:556707181
2631 2631 c, t dbSNP:538082475
2663 2663 c, g dbSNP:758630271
2667 2667 c, t dbSNP:750433533
2723 2723 a, g dbSNP:202199482
2727 2727 c, t dbSNP:569388804
2740 2740 a, c dbSNP:550040127
2741 2741 c, t dbSNP:554263663
2794 2794 a, g dbSNP:535809406
2803 2803 a, g dbSNP:759842333
2818 2818 c, t dbSNP:774607729
2822 2822 -, a dbSNP:770585444
2828 2828 a, c dbSNP:148442794
2887 2887 a, g dbSNP:185784088
2909 2909 a, t dbSNP:201032692
2916 2916 a, g dbSNP:533441584
2951 2951 -, gaa dbSNP:371940109
2952 2952 -, aag dbSNP:372115717
2953 2953 -, aga dbSNP:201786449
2969 2969 c, t dbSNP:532429677
2970 2970 g, t dbSNP:144552823
3001 3001 -, gtttttt dbSNP:372134652
3007 3007 -, acagcaaaaactaagggatttattataaagggaaatggaagg dbSNP:375844704
3012 3012 a, g dbSNP:12830189
3015 3015 a, c dbSNP:77243419
3050 3050 c, g dbSNP:753768505
3085 3085 a, c dbSNP:547936981
3090 3090 a, t dbSNP:549508927
3098 3098 -, ctgtgt dbSNP:773194012
3098 3098 c, g dbSNP:747666669
3099 3099 -, tgtgtgtg dbSNP:67385136
3099 3099 -, tgtgtg dbSNP:58212652
3117 3117 -, tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg dbSNP:147763218
3117 3117 -, tgtgtgtgtgtg dbSNP:766509991
3117 3117 -, tgtgtgtgtg dbSNP:751762581
3145 3145 -, tgtgtgtg dbSNP:367866196
3151 3151 (tg)8, 14, 20, 21, 22, 23, 24, 25, 26, 27 dbSNP:3219969
3177 3177 c, t dbSNP:370571115
3194 3194 c, t dbSNP:527640100
3209 3209 a, c dbSNP:560536156
3319 3319 a, c dbSNP:73392025
3327 3327 a, t dbSNP:578184469
3336 3336 c, t dbSNP:763918344
3366 3366 g, t dbSNP:564570984
3398 3398 c, t dbSNP:181528211
3399 3399 a, g dbSNP:190376900
3402 3402 a, c dbSNP:752559558
3414 3414 g, t dbSNP:573908791
3454 3454 c, g dbSNP:139854276
3471 3471 a, g dbSNP:527846727
3517 3517 g, t dbSNP:562371573
3532 3532 a, c dbSNP:376189416
3544 3544 c, g dbSNP:759270217
3590 3590 a, g dbSNP:773996332
3594 3594 a, g dbSNP:145979907
3632 3632 a, g dbSNP:542513832
3657 3657 c, t dbSNP:536345624
3688 3688 a, g dbSNP:751331151
3715 3715 c, g dbSNP:2405791
3757 3757 c, t dbSNP:373049465
3764 3764 a, c, g dbSNP:11117140
3804 3804 a, g dbSNP:776960091
3815 3815 a, g dbSNP:576500612
3878 3878 a, g dbSNP:571490847
3879 3879 c, t dbSNP:75672699
3946 3946 a, g dbSNP:118101076
3961 3961 a, g dbSNP:757482863
3965 3965 c, g dbSNP:182596158
3983 3983 c, g dbSNP:137895577
4065 4065 a, t dbSNP:527775710
4081 4081 a, c dbSNP:560415479
4086 4086 g, t dbSNP:747275916
4092 4092 g, t dbSNP:545886501
4161 4161 a, c dbSNP:772275100
4171 4171 c, t dbSNP:551729599
4178 4178 a, g dbSNP:371322545
4242 4242 a, c dbSNP:562804703
4254 4254 a, g dbSNP:544510386
4275 4275 a, g dbSNP:10863130
4305 4305 a, g dbSNP:553993027
4309 4309 c, t dbSNP:73176276
4323 4323 a, c dbSNP:572087484
4329 4329 a, g dbSNP:142014376
4344 4344 a, t dbSNP:556032382
4415 4415 g, t dbSNP:777523702
4457 4457 a, g dbSNP:538596385
4517 4517 a, g dbSNP:577722283
4519 4519 c, g dbSNP:556450915
4533 4533 a, g dbSNP:542142385
4591 4591 a, g dbSNP:756093335
4625 4625 c, g dbSNP:543182248
4643 4643 g, t dbSNP:567606122

Target ORF information:

RefSeq Version XM_011538151
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X3, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu46462D
Sequence Information ORF Nucleotide Sequence (Length: 1524bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C isoform X4
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_029419.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)656..1483(+)
Position Chain Variation Link
17 17 c, g dbSNP:550075042
26 26 g, t dbSNP:561614020
28 28 c, t dbSNP:541835785
34 34 c, g, t dbSNP:571733939
37 37 a, g dbSNP:766885112
44 44 c, t dbSNP:557804308
47 47 c, t dbSNP:763411438
49 49 c, g, t dbSNP:146407145
53 53 -, gcc dbSNP:761406464
54 54 c, t dbSNP:766143562
62 62 a, g dbSNP:773382527
88 88 a, g dbSNP:571130576
107 107 a, g dbSNP:138834123
118 118 a, g dbSNP:531265838
141 141 c, t dbSNP:567026502
154 154 a, g dbSNP:545399064
157 157 a, g dbSNP:770834628
159 159 -, aacaat dbSNP:752508138
177 177 a, g dbSNP:376082316
180 180 -, c dbSNP:35015230
245 245 a, t dbSNP:779572975
260 260 c, t dbSNP:771412010
274 274 a, c dbSNP:558034898
297 297 g, t dbSNP:765371348
303 303 a, g dbSNP:762060081
402 402 a, g dbSNP:759421317
423 423 c, t dbSNP:774378533
424 424 a, g dbSNP:564862144
437 437 g, t dbSNP:770566369
441 441 a, g dbSNP:756067228
449 449 c, g dbSNP:543297194
501 501 a, c dbSNP:759053090
502 502 a, c dbSNP:548807976
511 511 a, g dbSNP:770892207
515 515 a, t dbSNP:762868613
519 519 a, g dbSNP:201584077
524 524 c, t dbSNP:769763236
535 535 c, g, t dbSNP:370869346
540 540 a, g dbSNP:772217070
560 560 c, t dbSNP:745947947
561 561 a, g dbSNP:145205649
567 567 a, c dbSNP:757749414
568 568 a, g dbSNP:749807069
575 575 g, t dbSNP:749491204
577 577 c, t dbSNP:138787902
579 579 -, g dbSNP:36069674
584 584 a, g, t dbSNP:532825428
590 590 g, t dbSNP:767169663
602 602 c, g dbSNP:754687253
617 617 c, t dbSNP:751079600
621 621 c, t dbSNP:200641508
647 647 a, g dbSNP:149974845
651 651 a, g dbSNP:764027512
652 652 -, acaa dbSNP:761066259
660 660 g, t dbSNP:759753045
677 677 c, t dbSNP:774470064
679 679 -, c dbSNP:35652293
682 682 a, g dbSNP:770979746
695 695 c, t dbSNP:762956258
696 696 a, g, t dbSNP:200651947
699 699 a, c, g dbSNP:192255840
711 711 c, t dbSNP:781516891
741 741 c, t dbSNP:768927396
749 749 a, c dbSNP:746602295
756 756 a, g dbSNP:375819261
757 757 c, t dbSNP:758123335
761 761 c, g dbSNP:749945581
767 767 a, g dbSNP:200901180
769 769 c, t dbSNP:112983335
773 773 c, t dbSNP:757238970
775 775 c, t dbSNP:111495386
788 788 c, t dbSNP:753847188
793 793 c, t dbSNP:756857554
809 809 g, t dbSNP:190762233
817 817 a, g dbSNP:777587242
821 821 c, t dbSNP:139777686
822 822 a, g dbSNP:147418986
824 824 a, g dbSNP:752431991
843 843 c, t dbSNP:767389242
847 847 c, g dbSNP:763067361
849 849 a, c dbSNP:750669561
851 851 a, g dbSNP:765264406
856 856 a, g dbSNP:761892291
860 860 a, g dbSNP:776746849
880 880 c, t dbSNP:185118551
887 887 c, g dbSNP:761281614
889 889 a, g dbSNP:775693691
911 911 c, g dbSNP:536944591
914 914 a, c, g dbSNP:539968414
919 919 a, c dbSNP:774149822
938 938 c, t dbSNP:566418071
939 939 a, g dbSNP:748796788
945 945 a, c dbSNP:777409272
948 948 c, t dbSNP:755975066
949 949 a, g dbSNP:142839367
959 959 a, g dbSNP:748169936
964 964 a, g dbSNP:780805071
967 967 c, g dbSNP:754801625
975 975 c, t dbSNP:140499591
976 976 a, g dbSNP:765429825
979 979 a, c dbSNP:757539324
996 996 a, g dbSNP:566043053
997 997 a, g dbSNP:753826277
1003 1003 a, g dbSNP:113387514
1021 1021 a, g dbSNP:764279389
1053 1053 a, g dbSNP:150545721
1060 1060 c, t dbSNP:776093722
1062 1062 a, g dbSNP:141672136
1067 1067 a, c dbSNP:759994326
1087 1087 c, t dbSNP:770595521
1088 1088 c, t dbSNP:749782221
1089 1089 a, g, t dbSNP:770702724
1103 1103 a, g dbSNP:748989192
1105 1105 a, g dbSNP:772578702
1121 1121 c, t dbSNP:769372443
1131 1131 a, g dbSNP:747999039
1137 1137 a, g dbSNP:147998015
1153 1153 c, g, t dbSNP:372911876
1157 1157 a, g dbSNP:778384478
1159 1159 a, g dbSNP:143449252
1160 1160 c, t dbSNP:746800765
1169 1169 a, g dbSNP:779860939
1175 1175 c, t dbSNP:757444701
1176 1176 a, g dbSNP:754111075
1182 1182 a, c dbSNP:75276700
1210 1210 a, t dbSNP:764040141
1212 1212 g, t dbSNP:756220458
1218 1218 c, t dbSNP:753086343
1219 1219 a, c dbSNP:768126876
1221 1221 c, t dbSNP:199811466
1241 1241 a, g dbSNP:760188889
1245 1245 a, c dbSNP:547661699
1261 1261 a, g dbSNP:368524858
1273 1273 a, t dbSNP:766900187
1276 1276 c, t dbSNP:539250548
1279 1279 a, c dbSNP:772953057
1293 1293 a, g dbSNP:769121552
1297 1297 c, t dbSNP:375386863
1300 1300 c, t dbSNP:267603706
1302 1302 a, c dbSNP:141479653
1303 1303 a, g dbSNP:371453579
1304 1304 c, g dbSNP:765452856
1305 1305 a, g dbSNP:367612551
1319 1319 g, t dbSNP:776069370
1332 1332 a, c dbSNP:200155199
1342 1342 a, g dbSNP:768547952
1343 1343 a, c dbSNP:746994463
1349 1349 a, g dbSNP:374072925
1358 1358 c, t dbSNP:753925997
1370 1370 c, t dbSNP:771884299
1371 1371 a, g dbSNP:749402312
1378 1378 a, g dbSNP:374349115
1384 1384 c, t dbSNP:138500929
1386 1386 a, c dbSNP:752818848
1394 1394 g, t dbSNP:145889731
1400 1400 c, t dbSNP:114903783
1401 1401 a, g dbSNP:140682310
1414 1414 c, g, t dbSNP:766814115
1441 1441 a, g dbSNP:201179683
1444 1444 a, g dbSNP:749990047
1448 1448 a, g dbSNP:764935665
1455 1455 c, t dbSNP:145801611
1456 1456 a, g dbSNP:370614450
1461 1461 a, g dbSNP:768173767
1464 1464 a, c dbSNP:760563980
1466 1466 c, g dbSNP:775408430
1468 1468 a, g dbSNP:771796611
1470 1470 a, g dbSNP:745661909
1473 1473 a, g dbSNP:778640907
1487 1487 a, g dbSNP:770027343
1489 1489 a, g dbSNP:199528320
1496 1496 c, t dbSNP:180907536
1500 1500 a, g dbSNP:781372905
1502 1502 a, g dbSNP:376986836
1508 1508 -, g dbSNP:776059817
1516 1516 c, g dbSNP:755227553
1518 1518 -, c dbSNP:772624713
1526 1526 c, t dbSNP:752047649
1529 1529 c, t dbSNP:780724562
1533 1533 a, c dbSNP:758890049
1572 1572 c, t dbSNP:535303532
1581 1581 c, g dbSNP:750764518
1595 1595 -, t dbSNP:36020292
1616 1616 a, g dbSNP:34889924
1622 1622 c, g dbSNP:756883344
1624 1624 g, t dbSNP:753517104
1625 1625 a, c, g dbSNP:202157734
1628 1628 a, t dbSNP:775039626
1631 1631 a, g dbSNP:767487110
1638 1638 c, t dbSNP:759432736
1656 1656 a, t dbSNP:112713100
1660 1660 a, t dbSNP:559630993
1661 1661 a, g dbSNP:770656314
1667 1667 -, a dbSNP:779025640
1667 1667 -, a dbSNP:746398787
1673 1673 -, gtaaa dbSNP:770864945
1695 1695 a, g dbSNP:751790011
1699 1699 a, c dbSNP:540843966
1717 1717 c, t dbSNP:373806118
1722 1722 a, c dbSNP:747076027
1726 1726 a, g dbSNP:7958826
1730 1730 a, g dbSNP:565196653
1731 1731 c, t dbSNP:746382301
1734 1734 c, g dbSNP:779294242
1741 1741 c, t dbSNP:34663658
1742 1742 a, g dbSNP:369051385
1745 1745 a, g dbSNP:142800914
1753 1753 a, c dbSNP:755830364
1759 1759 a, g dbSNP:752173498
1770 1770 c, g dbSNP:766985178
1775 1775 a, g dbSNP:759471267
1776 1776 c, g dbSNP:17855890
1791 1791 c, g dbSNP:766133859
1799 1799 a, g dbSNP:750521235
1804 1804 c, t dbSNP:762857247
1807 1807 a, g dbSNP:773203393
1838 1838 a, g dbSNP:144502445
1839 1839 a, t dbSNP:140537872
1848 1848 a, g dbSNP:775586689
1853 1853 c, t dbSNP:78521308
1865 1865 a, c dbSNP:746316239
1874 1874 a, g dbSNP:779299698
1888 1888 c, g dbSNP:572756292
1889 1889 c, g dbSNP:749648790
1891 1891 a, g dbSNP:778149917
1895 1895 a, c dbSNP:374295123
1897 1897 a, g dbSNP:144062899
1924 1924 c, t dbSNP:780715327
1944 1944 c, t dbSNP:754454532
1947 1947 g, t dbSNP:370622926
1959 1959 a, g dbSNP:766217087
1966 1966 -, t dbSNP:749399472
1971 1971 c, t dbSNP:554470708
1974 1974 c, t dbSNP:750217452
1977 1977 c, t dbSNP:144593863
1978 1978 a, g, t dbSNP:376457265
1980 1980 c, g dbSNP:772130957
2053 2053 a, g dbSNP:571819913
2055 2055 c, t dbSNP:558320764
2067 2067 c, t dbSNP:536744820
2115 2115 c, t dbSNP:190102027
2116 2116 a, g dbSNP:547766766
2126 2126 g, t dbSNP:529667272
2138 2138 a, g dbSNP:565806131
2230 2230 a, g dbSNP:760351772
2270 2270 a, c dbSNP:547682225
2332 2332 a, g dbSNP:140747359
2347 2347 -, t dbSNP:376872523
2355 2355 -, t dbSNP:63172860
2356 2356 -, t dbSNP:56135820
2356 2356 g, t dbSNP:201003713
2358 2358 -, tg dbSNP:201247976
2358 2358 g, t dbSNP:201747129
2359 2359 -, g dbSNP:200496066
2375 2375 g, t dbSNP:565088480
2390 2390 a, c dbSNP:543684623
2459 2459 a, t dbSNP:771881987
2483 2483 -, a dbSNP:34017217
2517 2517 c, t dbSNP:79372569
2577 2577 a, g dbSNP:147631754
2586 2586 a, c dbSNP:561397399
2612 2612 c, t dbSNP:543016942
2682 2682 a, g dbSNP:774012894
2684 2684 g, t dbSNP:572420244
2690 2690 c, g dbSNP:554130352
2710 2710 a, g dbSNP:111896557
2711 2711 c, t dbSNP:770361266
2727 2727 c, t dbSNP:570155284
2728 2728 a, g dbSNP:7300102
2801 2801 a, c, g dbSNP:747428458
2811 2811 c, t dbSNP:578220427
2859 2859 a, g dbSNP:556707181
2917 2917 c, t dbSNP:538082475
2949 2949 c, g dbSNP:758630271
2953 2953 c, t dbSNP:750433533
3009 3009 a, g dbSNP:202199482
3013 3013 c, t dbSNP:569388804
3026 3026 a, c dbSNP:550040127
3027 3027 c, t dbSNP:554263663
3080 3080 a, g dbSNP:535809406
3089 3089 a, g dbSNP:759842333
3104 3104 c, t dbSNP:774607729
3108 3108 -, a dbSNP:770585444
3114 3114 a, c dbSNP:148442794
3173 3173 a, g dbSNP:185784088
3195 3195 a, t dbSNP:201032692
3202 3202 a, g dbSNP:533441584
3237 3237 -, gaa dbSNP:371940109
3238 3238 -, aag dbSNP:372115717
3239 3239 -, aga dbSNP:201786449
3255 3255 c, t dbSNP:532429677
3256 3256 g, t dbSNP:144552823
3287 3287 -, gtttttt dbSNP:372134652
3293 3293 -, acagcaaaaactaagggatttattataaagggaaatggaagg dbSNP:375844704
3298 3298 a, g dbSNP:12830189
3301 3301 a, c dbSNP:77243419
3336 3336 c, g dbSNP:753768505
3371 3371 a, c dbSNP:547936981
3376 3376 a, t dbSNP:549508927
3384 3384 -, ctgtgt dbSNP:773194012
3384 3384 c, g dbSNP:747666669
3385 3385 -, tgtgtgtg dbSNP:67385136
3385 3385 -, tgtgtg dbSNP:58212652
3403 3403 -, tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg dbSNP:147763218
3403 3403 -, tgtgtgtgtgtg dbSNP:766509991
3403 3403 -, tgtgtgtgtg dbSNP:751762581
3431 3431 -, tgtgtgtg dbSNP:367866196
3437 3437 (tg)8, 14, 20, 21, 22, 23, 24, 25, 26, 27 dbSNP:3219969
3463 3463 c, t dbSNP:370571115
3480 3480 c, t dbSNP:527640100
3495 3495 a, c dbSNP:560536156
3605 3605 a, c dbSNP:73392025
3613 3613 a, t dbSNP:578184469
3622 3622 c, t dbSNP:763918344
3652 3652 g, t dbSNP:564570984
3684 3684 c, t dbSNP:181528211
3685 3685 a, g dbSNP:190376900
3688 3688 a, c dbSNP:752559558
3700 3700 g, t dbSNP:573908791
3740 3740 c, g dbSNP:139854276
3757 3757 a, g dbSNP:527846727
3803 3803 g, t dbSNP:562371573
3818 3818 a, c dbSNP:376189416
3830 3830 c, g dbSNP:759270217
3876 3876 a, g dbSNP:773996332
3880 3880 a, g dbSNP:145979907
3918 3918 a, g dbSNP:542513832
3943 3943 c, t dbSNP:536345624
3974 3974 a, g dbSNP:751331151
4001 4001 c, g dbSNP:2405791
4043 4043 c, t dbSNP:373049465
4050 4050 a, c, g dbSNP:11117140
4090 4090 a, g dbSNP:776960091
4101 4101 a, g dbSNP:576500612
4164 4164 a, g dbSNP:571490847
4165 4165 c, t dbSNP:75672699
4232 4232 a, g dbSNP:118101076
4247 4247 a, g dbSNP:757482863
4251 4251 c, g dbSNP:182596158
4269 4269 c, g dbSNP:137895577
4351 4351 a, t dbSNP:527775710
4367 4367 a, c dbSNP:560415479
4372 4372 g, t dbSNP:747275916
4378 4378 g, t dbSNP:545886501
4447 4447 a, c dbSNP:772275100
4457 4457 c, t dbSNP:551729599
4464 4464 a, g dbSNP:371322545
4528 4528 a, c dbSNP:562804703
4540 4540 a, g dbSNP:544510386
4561 4561 a, g dbSNP:10863130
4591 4591 a, g dbSNP:553993027
4595 4595 c, t dbSNP:73176276
4609 4609 a, c dbSNP:572087484
4615 4615 a, g dbSNP:142014376
4630 4630 a, t dbSNP:556032382
4701 4701 g, t dbSNP:777523702
4743 4743 a, g dbSNP:538596385
4803 4803 a, g dbSNP:577722283
4805 4805 c, g dbSNP:556450915
4819 4819 a, g dbSNP:542142385
4877 4877 a, g dbSNP:756093335
4911 4911 c, g dbSNP:543182248
4929 4929 g, t dbSNP:567606122

Target ORF information:

RefSeq Version XM_011538152
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X4, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu46462D
Sequence Information ORF Nucleotide Sequence (Length: 1524bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C isoform X4
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_029419.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)659..1486(+)
Position Chain Variation Link
17 17 c, g dbSNP:550075042
26 26 g, t dbSNP:561614020
28 28 c, t dbSNP:541835785
34 34 c, g, t dbSNP:571733939
37 37 a, g dbSNP:766885112
44 44 c, t dbSNP:557804308
47 47 c, t dbSNP:763411438
49 49 c, g, t dbSNP:146407145
53 53 -, gcc dbSNP:761406464
54 54 c, t dbSNP:766143562
62 62 a, g dbSNP:773382527
88 88 a, g dbSNP:571130576
107 107 a, g dbSNP:138834123
118 118 a, g dbSNP:531265838
141 141 c, t dbSNP:567026502
154 154 a, g dbSNP:545399064
157 157 a, g dbSNP:770834628
159 159 -, aacaat dbSNP:752508138
177 177 a, g dbSNP:376082316
180 180 -, c dbSNP:35015230
245 245 a, t dbSNP:779572975
260 260 c, t dbSNP:771412010
274 274 a, c dbSNP:558034898
297 297 g, t dbSNP:765371348
303 303 a, g dbSNP:762060081
405 405 a, g dbSNP:759421317
426 426 c, t dbSNP:774378533
427 427 a, g dbSNP:564862144
440 440 g, t dbSNP:770566369
444 444 a, g dbSNP:756067228
452 452 c, g dbSNP:543297194
504 504 a, c dbSNP:759053090
505 505 a, c dbSNP:548807976
514 514 a, g dbSNP:770892207
518 518 a, t dbSNP:762868613
522 522 a, g dbSNP:201584077
527 527 c, t dbSNP:769763236
538 538 c, g, t dbSNP:370869346
543 543 a, g dbSNP:772217070
563 563 c, t dbSNP:745947947
564 564 a, g dbSNP:145205649
570 570 a, c dbSNP:757749414
571 571 a, g dbSNP:749807069
578 578 g, t dbSNP:749491204
580 580 c, t dbSNP:138787902
582 582 -, g dbSNP:36069674
587 587 a, g, t dbSNP:532825428
593 593 g, t dbSNP:767169663
605 605 c, g dbSNP:754687253
620 620 c, t dbSNP:751079600
624 624 c, t dbSNP:200641508
650 650 a, g dbSNP:149974845
654 654 a, g dbSNP:764027512
655 655 -, acaa dbSNP:761066259
663 663 g, t dbSNP:759753045
680 680 c, t dbSNP:774470064
682 682 -, c dbSNP:35652293
685 685 a, g dbSNP:770979746
698 698 c, t dbSNP:762956258
699 699 a, g, t dbSNP:200651947
702 702 a, c, g dbSNP:192255840
714 714 c, t dbSNP:781516891
744 744 c, t dbSNP:768927396
752 752 a, c dbSNP:746602295
759 759 a, g dbSNP:375819261
760 760 c, t dbSNP:758123335
764 764 c, g dbSNP:749945581
770 770 a, g dbSNP:200901180
772 772 c, t dbSNP:112983335
776 776 c, t dbSNP:757238970
778 778 c, t dbSNP:111495386
791 791 c, t dbSNP:753847188
796 796 c, t dbSNP:756857554
812 812 g, t dbSNP:190762233
820 820 a, g dbSNP:777587242
824 824 c, t dbSNP:139777686
825 825 a, g dbSNP:147418986
827 827 a, g dbSNP:752431991
846 846 c, t dbSNP:767389242
850 850 c, g dbSNP:763067361
852 852 a, c dbSNP:750669561
854 854 a, g dbSNP:765264406
859 859 a, g dbSNP:761892291
863 863 a, g dbSNP:776746849
883 883 c, t dbSNP:185118551
890 890 c, g dbSNP:761281614
892 892 a, g dbSNP:775693691
914 914 c, g dbSNP:536944591
917 917 a, c, g dbSNP:539968414
922 922 a, c dbSNP:774149822
941 941 c, t dbSNP:566418071
942 942 a, g dbSNP:748796788
948 948 a, c dbSNP:777409272
951 951 c, t dbSNP:755975066
952 952 a, g dbSNP:142839367
962 962 a, g dbSNP:748169936
967 967 a, g dbSNP:780805071
970 970 c, g dbSNP:754801625
978 978 c, t dbSNP:140499591
979 979 a, g dbSNP:765429825
982 982 a, c dbSNP:757539324
999 999 a, g dbSNP:566043053
1000 1000 a, g dbSNP:753826277
1006 1006 a, g dbSNP:113387514
1024 1024 a, g dbSNP:764279389
1056 1056 a, g dbSNP:150545721
1063 1063 c, t dbSNP:776093722
1065 1065 a, g dbSNP:141672136
1070 1070 a, c dbSNP:759994326
1090 1090 c, t dbSNP:770595521
1091 1091 c, t dbSNP:749782221
1092 1092 a, g, t dbSNP:770702724
1106 1106 a, g dbSNP:748989192
1108 1108 a, g dbSNP:772578702
1124 1124 c, t dbSNP:769372443
1134 1134 a, g dbSNP:747999039
1140 1140 a, g dbSNP:147998015
1156 1156 c, g, t dbSNP:372911876
1160 1160 a, g dbSNP:778384478
1162 1162 a, g dbSNP:143449252
1163 1163 c, t dbSNP:746800765
1172 1172 a, g dbSNP:779860939
1178 1178 c, t dbSNP:757444701
1179 1179 a, g dbSNP:754111075
1185 1185 a, c dbSNP:75276700
1213 1213 a, t dbSNP:764040141
1215 1215 g, t dbSNP:756220458
1221 1221 c, t dbSNP:753086343
1222 1222 a, c dbSNP:768126876
1224 1224 c, t dbSNP:199811466
1244 1244 a, g dbSNP:760188889
1248 1248 a, c dbSNP:547661699
1264 1264 a, g dbSNP:368524858
1276 1276 a, t dbSNP:766900187
1279 1279 c, t dbSNP:539250548
1282 1282 a, c dbSNP:772953057
1296 1296 a, g dbSNP:769121552
1300 1300 c, t dbSNP:375386863
1303 1303 c, t dbSNP:267603706
1305 1305 a, c dbSNP:141479653
1306 1306 a, g dbSNP:371453579
1307 1307 c, g dbSNP:765452856
1308 1308 a, g dbSNP:367612551
1322 1322 g, t dbSNP:776069370
1335 1335 a, c dbSNP:200155199
1345 1345 a, g dbSNP:768547952
1346 1346 a, c dbSNP:746994463
1352 1352 a, g dbSNP:374072925
1361 1361 c, t dbSNP:753925997
1373 1373 c, t dbSNP:771884299
1374 1374 a, g dbSNP:749402312
1381 1381 a, g dbSNP:374349115
1387 1387 c, t dbSNP:138500929
1389 1389 a, c dbSNP:752818848
1397 1397 g, t dbSNP:145889731
1403 1403 c, t dbSNP:114903783
1404 1404 a, g dbSNP:140682310
1417 1417 c, g, t dbSNP:766814115
1444 1444 a, g dbSNP:201179683
1447 1447 a, g dbSNP:749990047
1451 1451 a, g dbSNP:764935665
1458 1458 c, t dbSNP:145801611
1459 1459 a, g dbSNP:370614450
1464 1464 a, g dbSNP:768173767
1467 1467 a, c dbSNP:760563980
1469 1469 c, g dbSNP:775408430
1471 1471 a, g dbSNP:771796611
1473 1473 a, g dbSNP:745661909
1476 1476 a, g dbSNP:778640907
1490 1490 a, g dbSNP:770027343
1492 1492 a, g dbSNP:199528320
1499 1499 c, t dbSNP:180907536
1503 1503 a, g dbSNP:781372905
1505 1505 a, g dbSNP:376986836
1511 1511 -, g dbSNP:776059817
1519 1519 c, g dbSNP:755227553
1521 1521 -, c dbSNP:772624713
1529 1529 c, t dbSNP:752047649
1532 1532 c, t dbSNP:780724562
1536 1536 a, c dbSNP:758890049
1575 1575 c, t dbSNP:535303532
1584 1584 c, g dbSNP:750764518
1598 1598 -, t dbSNP:36020292
1619 1619 a, g dbSNP:34889924
1625 1625 c, g dbSNP:756883344
1627 1627 g, t dbSNP:753517104
1628 1628 a, c, g dbSNP:202157734
1631 1631 a, t dbSNP:775039626
1634 1634 a, g dbSNP:767487110
1641 1641 c, t dbSNP:759432736
1659 1659 a, t dbSNP:112713100
1663 1663 a, t dbSNP:559630993
1664 1664 a, g dbSNP:770656314
1670 1670 -, a dbSNP:779025640
1670 1670 -, a dbSNP:746398787
1676 1676 -, gtaaa dbSNP:770864945
1698 1698 a, g dbSNP:751790011
1702 1702 a, c dbSNP:540843966
1720 1720 c, t dbSNP:373806118
1725 1725 a, c dbSNP:747076027
1729 1729 a, g dbSNP:7958826
1733 1733 a, g dbSNP:565196653
1734 1734 c, t dbSNP:746382301
1737 1737 c, g dbSNP:779294242
1744 1744 c, t dbSNP:34663658
1745 1745 a, g dbSNP:369051385
1748 1748 a, g dbSNP:142800914
1756 1756 a, c dbSNP:755830364
1762 1762 a, g dbSNP:752173498
1773 1773 c, g dbSNP:766985178
1778 1778 a, g dbSNP:759471267
1779 1779 c, g dbSNP:17855890
1794 1794 c, g dbSNP:766133859
1802 1802 a, g dbSNP:750521235
1807 1807 c, t dbSNP:762857247
1810 1810 a, g dbSNP:773203393
1841 1841 a, g dbSNP:144502445
1842 1842 a, t dbSNP:140537872
1851 1851 a, g dbSNP:775586689
1856 1856 c, t dbSNP:78521308
1868 1868 a, c dbSNP:746316239
1877 1877 a, g dbSNP:779299698
1891 1891 c, g dbSNP:572756292
1892 1892 c, g dbSNP:749648790
1894 1894 a, g dbSNP:778149917
1898 1898 a, c dbSNP:374295123
1900 1900 a, g dbSNP:144062899
1927 1927 c, t dbSNP:780715327
1947 1947 c, t dbSNP:754454532
1950 1950 g, t dbSNP:370622926
1962 1962 a, g dbSNP:766217087
1969 1969 -, t dbSNP:749399472
1974 1974 c, t dbSNP:554470708
1977 1977 c, t dbSNP:750217452
1980 1980 c, t dbSNP:144593863
1981 1981 a, g, t dbSNP:376457265
1983 1983 c, g dbSNP:772130957
2056 2056 a, g dbSNP:571819913
2058 2058 c, t dbSNP:558320764
2070 2070 c, t dbSNP:536744820
2118 2118 c, t dbSNP:190102027
2119 2119 a, g dbSNP:547766766
2129 2129 g, t dbSNP:529667272
2141 2141 a, g dbSNP:565806131
2233 2233 a, g dbSNP:760351772
2273 2273 a, c dbSNP:547682225
2335 2335 a, g dbSNP:140747359
2350 2350 -, t dbSNP:376872523
2358 2358 -, t dbSNP:63172860
2359 2359 -, t dbSNP:56135820
2359 2359 g, t dbSNP:201003713
2361 2361 -, tg dbSNP:201247976
2361 2361 g, t dbSNP:201747129
2362 2362 -, g dbSNP:200496066
2378 2378 g, t dbSNP:565088480
2393 2393 a, c dbSNP:543684623
2462 2462 a, t dbSNP:771881987
2486 2486 -, a dbSNP:34017217
2520 2520 c, t dbSNP:79372569
2580 2580 a, g dbSNP:147631754
2589 2589 a, c dbSNP:561397399
2615 2615 c, t dbSNP:543016942
2685 2685 a, g dbSNP:774012894
2687 2687 g, t dbSNP:572420244
2693 2693 c, g dbSNP:554130352
2713 2713 a, g dbSNP:111896557
2714 2714 c, t dbSNP:770361266
2730 2730 c, t dbSNP:570155284
2731 2731 a, g dbSNP:7300102
2804 2804 a, c, g dbSNP:747428458
2814 2814 c, t dbSNP:578220427
2862 2862 a, g dbSNP:556707181
2920 2920 c, t dbSNP:538082475
2952 2952 c, g dbSNP:758630271
2956 2956 c, t dbSNP:750433533
3012 3012 a, g dbSNP:202199482
3016 3016 c, t dbSNP:569388804
3029 3029 a, c dbSNP:550040127
3030 3030 c, t dbSNP:554263663
3083 3083 a, g dbSNP:535809406
3092 3092 a, g dbSNP:759842333
3107 3107 c, t dbSNP:774607729
3111 3111 -, a dbSNP:770585444
3117 3117 a, c dbSNP:148442794
3176 3176 a, g dbSNP:185784088
3198 3198 a, t dbSNP:201032692
3205 3205 a, g dbSNP:533441584
3240 3240 -, gaa dbSNP:371940109
3241 3241 -, aag dbSNP:372115717
3242 3242 -, aga dbSNP:201786449
3258 3258 c, t dbSNP:532429677
3259 3259 g, t dbSNP:144552823
3290 3290 -, gtttttt dbSNP:372134652
3296 3296 -, acagcaaaaactaagggatttattataaagggaaatggaagg dbSNP:375844704
3301 3301 a, g dbSNP:12830189
3304 3304 a, c dbSNP:77243419
3339 3339 c, g dbSNP:753768505
3374 3374 a, c dbSNP:547936981
3379 3379 a, t dbSNP:549508927
3387 3387 -, ctgtgt dbSNP:773194012
3387 3387 c, g dbSNP:747666669
3388 3388 -, tgtgtgtg dbSNP:67385136
3388 3388 -, tgtgtg dbSNP:58212652
3406 3406 -, tgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg dbSNP:147763218
3406 3406 -, tgtgtgtgtgtg dbSNP:766509991
3406 3406 -, tgtgtgtgtg dbSNP:751762581
3434 3434 -, tgtgtgtg dbSNP:367866196
3440 3440 (tg)8, 14, 20, 21, 22, 23, 24, 25, 26, 27 dbSNP:3219969
3466 3466 c, t dbSNP:370571115
3483 3483 c, t dbSNP:527640100
3498 3498 a, c dbSNP:560536156
3608 3608 a, c dbSNP:73392025
3616 3616 a, t dbSNP:578184469
3625 3625 c, t dbSNP:763918344
3655 3655 g, t dbSNP:564570984
3687 3687 c, t dbSNP:181528211
3688 3688 a, g dbSNP:190376900
3691 3691 a, c dbSNP:752559558
3703 3703 g, t dbSNP:573908791
3743 3743 c, g dbSNP:139854276
3760 3760 a, g dbSNP:527846727
3806 3806 g, t dbSNP:562371573
3821 3821 a, c dbSNP:376189416
3833 3833 c, g dbSNP:759270217
3879 3879 a, g dbSNP:773996332
3883 3883 a, g dbSNP:145979907
3921 3921 a, g dbSNP:542513832
3946 3946 c, t dbSNP:536345624
3977 3977 a, g dbSNP:751331151
4004 4004 c, g dbSNP:2405791
4046 4046 c, t dbSNP:373049465
4053 4053 a, c, g dbSNP:11117140
4093 4093 a, g dbSNP:776960091
4104 4104 a, g dbSNP:576500612
4167 4167 a, g dbSNP:571490847
4168 4168 c, t dbSNP:75672699
4235 4235 a, g dbSNP:118101076
4250 4250 a, g dbSNP:757482863
4254 4254 c, g dbSNP:182596158
4272 4272 c, g dbSNP:137895577
4354 4354 a, t dbSNP:527775710
4370 4370 a, c dbSNP:560415479
4375 4375 g, t dbSNP:747275916
4381 4381 g, t dbSNP:545886501
4450 4450 a, c dbSNP:772275100
4460 4460 c, t dbSNP:551729599
4467 4467 a, g dbSNP:371322545
4531 4531 a, c dbSNP:562804703
4543 4543 a, g dbSNP:544510386
4564 4564 a, g dbSNP:10863130
4594 4594 a, g dbSNP:553993027
4598 4598 c, t dbSNP:73176276
4612 4612 a, c dbSNP:572087484
4618 4618 a, g dbSNP:142014376
4633 4633 a, t dbSNP:556032382
4704 4704 g, t dbSNP:777523702
4746 4746 a, g dbSNP:538596385
4806 4806 a, g dbSNP:577722283
4808 4808 c, g dbSNP:556450915
4822 4822 a, g dbSNP:542142385
4880 4880 a, g dbSNP:756093335
4914 4914 c, g dbSNP:543182248
4932 4932 g, t dbSNP:567606122

Target ORF information:

RefSeq Version XM_011538153
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens MGAT4 family, member C (MGAT4C), transcript variant X5, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu46462D
Sequence Information ORF Nucleotide Sequence (Length: 1524bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase C isoform X4
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_029419.13) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578823549. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)529..1356(+)
Position Chain Variation Link
11 11 a, g dbSNP:773558890
52 52 c, t dbSNP:370016958
53 53 a, g dbSNP:11103902
58 58 g, t dbSNP:558172404
68 68 a, g dbSNP:112895249
81 81 g, t dbSNP:569204614
115 115 a, t dbSNP:539021829
119 119 a, g dbSNP:551173542
124 124 c, t dbSNP:778211754
172 172 c, g dbSNP:61949048
188 188 c, t dbSNP:566302122
275 275 a, g dbSNP:759421317
296 296 c, t dbSNP:774378533
297 297 a, g dbSNP:564862144
310 310 g, t dbSNP:770566369
314 314 a, g dbSNP:756067228
322 322 c, g dbSNP:543297194
374 374 a, c dbSNP:759053090
375 375 a, c dbSNP:548807976
384 384 a, g dbSNP:770892207
388 388 a, t dbSNP:762868613
392 392 a, g dbSNP:201584077
397 397 c, t dbSNP:769763236
408 408 c, g, t dbSNP:370869346
413 413 a, g dbSNP:772217070
433 433 c, t dbSNP:745947947
434 434 a, g dbSNP:145205649
440 440 a, c dbSNP:757749414
441 441 a, g dbSNP:749807069
448 448 g, t dbSNP:749491204
450 450 c, t dbSNP:138787902
452 452 -, g dbSNP:36069674
457 457 a, g, t dbSNP:532825428
463 463 g, t dbSNP:767169663
475 475 c, g dbSNP:754687253
490 490 c, t dbSNP:751079600
494 494 c, t dbSNP:200641508
520 520 a, g dbSNP:149974845
524 524 a, g dbSNP:764027512
525 525 -, acaa dbSNP:761066259
533 533 g, t dbSNP:759753045
550 550 c, t dbSNP:774470064
552 552 -, c dbSNP:35652293
555 555 a, g dbSNP:770979746
568 568 c, t dbSNP:762956258
569 569 a, g, t dbSNP:200651947
572 572 a, c, g dbSNP:192255840
584 584 c, t dbSNP:781516891
614 614 c, t dbSNP:768927396
622 622 a, c dbSNP:746602295
629 629 a, g dbSNP:375819261
630 630 c, t dbSNP:758123335
634 634 c, g dbSNP:749945581
640 640 a, g dbSNP:200901180
642 642 c, t dbSNP:112983335
646 646 c, t dbSNP:757238970
648 648 c, t dbSNP:111495386
661 661 c, t dbSNP:753847188
666 666 c, t dbSNP:756857554
682 682 g, t dbSNP:190762233
690 690 a, g dbSNP:777587242
694 694 c, t dbSNP:139777686
695 695 a, g dbSNP:147418986
697 697 a, g dbSNP:752431991
716 716 c, t dbSNP:767389242
720 720 c, g dbSNP:763067361
722 722 a, c dbSNP:750669561
724 724 a, g dbSNP:765264406
729 729 a, g dbSNP:761892291
733 733 a, g dbSNP:776746849
753 753 c, t dbSNP:185118551
760 760 c, g dbSNP:761281614
762 762 a, g dbSNP:775693691
784 784 c, g dbSNP:536944591
787 787 a, c, g dbSNP:539968414
792 792 a, c dbSNP:774149822
811 811 c, t dbSNP:566418071
812 812 a, g dbSNP:748796788
818 818 a, c dbSNP:777409272
821 821 c, t dbSNP:755975066
822 822 a, g dbSNP:142839367
832 832 a, g dbSNP:748169936
837 837 a, g dbSNP:780805071
840 840 c, g dbSNP:754801625
848 848 c, t dbSNP:140499591
849 849 a, g dbSNP:765429825
852 852 a, c dbSNP:757539324
869 869 a, g dbSNP:566043053
870 870 a, g dbSNP:753826277
876 876 a, g dbSNP:113387514
894 894 a, g dbSNP:764279389
926 926 a, g dbSNP:150545721
933 933 c, t dbSNP:776093722
935 935 a, g dbSNP:141672136
940 940 a, c dbSNP:759994326
960 960 c, t dbSNP:770595521
961 961 c, t dbSNP:749782221
962 962 a, g, t dbSNP:770702724
976 976 a, g dbSNP:748989192
978 978 a, g dbSNP:772578702
994 994 c, t dbSNP:769372443
1004 1004 a, g dbSNP:747999039
1010 1010 a, g dbSNP:147998015
1026 1026 c, g, t dbSNP:372911876
1030 1030 a, g dbSNP:778384478
1032 1032 a, g dbSNP:143449252
1033 1033 c, t dbSNP:746800765
1042 1042 a, g dbSNP:779860939
1048 1048 c, t dbSNP:757444701
1049 1049 a, g dbSNP:754111075
1055 1055 a, c dbSNP:75276700
1083 1083 a, t dbSNP:764040141
1085 1085 g, t dbSNP:756220458
1091 1091 c, t dbSNP:753086343
1092 1092 a, c dbSNP:768126876
1094 1094 c, t dbSNP:199811466
1114 1114 a, g dbSNP:760188889
1118 1118 a, c dbSNP:547661699
1134 1134 a, g dbSNP:368524858
1146 1146 a, t dbSNP:766900187
1149 1149 c, t dbSNP:539250548
1152 1152 a, c dbSNP:772953057
1166 1166 a, g dbSNP:769121552
1170 1170 c, t dbSNP:375386863
1173 1173 c, t dbSNP:267603706
1175 1175 a, c dbSNP:141479653
1176 1176 a, g dbSNP:371453579
1177 1177 c, g dbSNP:765452856
1178 1178 a, g dbSNP:367612551
1192 1192 g, t dbSNP:776069370
1205 1205 a, c dbSNP:200155199
1215 1215 a, g dbSNP:768547952
1216 1216 a, c dbSNP:746994463
1222 1222 a, g dbSNP:374072925
1231 1231 c, t dbSNP:753925997
1243 1243 c, t dbSNP:771884299
1244 1244 a, g dbSNP:749402312
1251 1251 a, g dbSNP:374349115
1257 1257 c, t dbSNP:138500929
1259 1259 a, c dbSNP:752818848
1267 1267 g, t dbSNP:145889731
1273 1273 c, t dbSNP:114903783
1274 1274 a, g dbSNP:140682310
1287 1287 c, g, t dbSNP:766814115
1314 1314 a, g dbSNP:201179683
1317 1317 a, g dbSNP:749990047
1321 1321 a, g dbSNP:764935665
1328 1328 c, t dbSNP:145801611
1329 1329 a, g dbSNP:370614450
1334 1334 a, g dbSNP:768173767
1337 1337 a, c dbSNP:760563980
1339 1339 c, g dbSNP:775408430
1341 1341 a, g dbSNP:771796611
1343 1343 a, g dbSNP:745661909
1346 1346 a, g dbSNP:778640907
1360 1360 a, g dbSNP:770027343
1362 1362 a, g dbSNP:199528320
1369 1369 c, t dbSNP:180907536
1373 1373 a, g dbSNP:781372905
1375 1375 a, g dbSNP:376986836
1381 1381 -, g dbSNP:776059817
1389 1389 c, g dbSNP:755227553
1391 1391 -, c dbSNP:772624713
1399 1399 c, t dbSNP:752047649
1402 1402 c, t dbSNP:780724562
1406 1406 a, c dbSNP:758890049
1445 1445 c, t dbSNP:535303532
1454 1454 c, g dbSNP:750764518
1468 1468 -, t dbSNP:36020292
1489 1489 a, g dbSNP:34889924
1495 1495 c, g dbSNP:756883344
1497 1497 g, t dbSNP:753517104
1498 1498 a, c, g dbSNP:202157734
1501 1501 a, t dbSNP:775039626
1504 1504 a, g dbSNP:767487110
1511 1511 c, t dbSNP:759432736
1529 1529 a, t dbSNP:112713100
1533 1533 a, t dbSNP:559630993
1534 1534 a, g dbSNP:770656314
1540 1540 -, a dbSNP:779025640
1540 1540 -, a dbSNP:746398787
1546 1546 -, gtaaa dbSNP:770864945
1568 1568 a, g dbSNP:751790011
1572 1572 a, c dbSNP:540843966
1590 1590 c, t dbSNP:373806118
1595 1595 a, c dbSNP:747076027
1599 1599 a, g dbSNP:7958826
1603 1603 a, g dbSNP:565196653
1604 1604 c, t dbSNP:746382301
1607 1607 c, g dbSNP:779294242
1614 1614 c, t dbSNP:34663658
1615 1615 a, g dbSNP:369051385
1618 1618 a, g dbSNP:142800914
1626 1626 a, c dbSNP:755830364
1632 1632 a, g dbSNP:752173498
1643 1643 c, g dbSNP:766985178
1648 1648 a, g dbSNP:759471267
1649 1649 c, g dbSNP:17855890
1664 1664 c, g dbSNP:766133859
1672 1672 a, g dbSNP:750521235
1677 1677 c, t dbSNP:762857247
1680 1680 a, g dbSNP:773203393
1711 1711 a, g dbSNP:144502445
1712 1712 a, t dbSNP:140537872
1721 1721 a, g dbSNP:775586689
1726 1726 c, t dbSNP:78521308
1738 1738 a, c dbSNP:746316239
1747 1747 a, g dbSNP:779299698
1761 1761 c, g dbSNP:572756292
1762 1762 c, g dbSNP:749648790
1764 1764 a, g dbSNP:778149917
1768 1768 a, c dbSNP:374295123
1770 1770 a, g dbSNP:144062899
1797 1797 c, t dbSNP:780715327
1817 1817 c, t dbSNP:754454532
1820 1820 g, t dbSNP:370622926
1832 1832 a, g dbSNP:766217087
1839 1839 -, t dbSNP:749399472
1844 1844 c, t dbSNP:554470708
1847 1847 c, t dbSNP:750217452
1850 1850 c, t dbSNP:144593863
1851 1851 a, g, t dbSNP:376457265
1853 1853 c, g dbSNP:772130957
1926 1926 a, g dbSNP:571819913
1928 1928 c, t dbSNP:558320764
1940 1940 c, t dbSNP:536744820
1988 1988 c, t dbSNP:190102027
1989 1989 a, g dbSNP:547766766
1999 1999 g, t dbSNP:529667272
2011 2011 a, g dbSNP:565806131
2103 2103 a, g dbSNP:760351772
2143 2143 a, c dbSNP:547682225
2205 2205 a, g dbSNP:140747359
2220 2220 -, t dbSNP:376872523
2228 2228 -, t dbSNP:63172860
2229 2229 -, t dbSNP:56135820
2229 2229 g, t dbSNP:201003713
2231 2231 -, tg dbSNP:201247976
2231 2231 g, t dbSNP:201747129
2232 2232 -, g dbSNP:200496066
2248 2248 g, t dbSNP:565088480
2263 2263 a, c dbSNP:543684623
2332 2332 a, t dbSNP:771881987
2356 2356 -, a dbSNP:34017217
2390 2390 c, t dbSNP:79372569
2450 2450 a, g dbSNP:147631754
2459 2459 a, c dbSNP:561397399
2485 2485 c, t dbSNP:543016942
2555 2555 a, g dbSNP:774012894
2557 2557 g, t dbSNP:572420244
2563 2563 c, g dbSNP:554130352
2583 2583 a, g dbSNP:111896557
2584 2584 c, t dbSNP:770361266
2600 2600 c, t dbSNP:570155284
2601 2601 a, g dbSNP:7300102
2674 2674 a, c, g dbSNP:747428458
2684 2684 c, t dbSNP:578220427
2732 2732 a, g dbSNP:556707181
2790 2790 c, t dbSNP:538082475
2822 2822 c, g dbSNP:758630271
2826 2826 c, t dbSNP:750433533
2882 2882 a, g dbSNP:202199482
2886 2886 c, t dbSNP:569388804
2899 2899 a, c dbSNP:550040127
2900 2900 c, t dbSNP:554263663
2953 2953 a, g dbSNP:535809406
2962 2962 a, g dbSNP:759842333
2977 2977 c, t dbSNP:774607729
2981 2981 -, a dbSNP:770585444
2987 2987 a, c dbSNP:148442794
3046 3046 a, g dbSNP:185784088
3068 3068 a, t dbSNP:201032692
3075 3075 a, g dbSNP:533441584
3110 3110 -, gaa dbSNP:371940109
3111 3111 -, aag dbSNP:372115717
3112 3112 -, aga dbSNP:201786449
3128 3128 c, t dbSNP:532429677
3129 3129 g, t dbSNP:144552823
3160 3160 -, gtttttt dbSNP:372134652
3166 3166 -, acagcaaaaactaagggatttattataaagggaaatggaagg dbSNP:375844704
3171 3171 a, g db