Home » Species Summary » Homo sapiens » NIPBL cDNA ORF clone
Email to GenScript

NIPBL cDNA ORF clone, Homo sapiens (human)

Gene Symbol NIPBL
Entrez Gene ID 25836
Full Name Nipped-B homolog (Drosophila)
Synonyms CDLS, CDLS1, IDN3, IDN3-B, Scc2
General protein information
Preferred Names
nipped-B-like protein
nipped-B-like protein
SCC2 homolog
sister chromatid cohesion 2 homolog
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Cornelia de Lange syndrome 1, 122470 (3)

mRNA and Protein(s)

mRNA Protein Name
XM_006714467 XP_006714530 nipped-B-like protein isoform X1
XM_006714468 XP_006714531 nipped-B-like protein isoform X2
XM_005248280 XP_005248337 nipped-B-like protein isoform X3
XM_011514014 XP_011512316 nipped-B-like protein isoform X4
XM_005248282 XP_005248339 nipped-B-like protein isoform X5
XM_011514015 XP_011512317 nipped-B-like protein isoform X6
NM_133433 NP_597677 nipped-B-like protein isoform A
NM_015384 NP_056199 nipped-B-like protein isoform B

R-HSA-1640170 Cell Cycle
R-HSA-69278 Cell Cycle, Mitotic
R-HSA-68886 M Phase
R-HSA-68884 Mitotic Telophase/Cytokinesis
R-HSA-2470946 Cohesin Loading onto Chromatin

Homo sapiens (human) NIPBL NP_597677.2
Pan troglodytes (chimpanzee) NIPBL XP_001146090.1
Macaca mulatta (Rhesus monkey) NIPBL XP_001096575.1
Canis lupus familiaris (dog) NIPBL XP_005619439.1
Bos taurus (cattle) NIPBL NP_001193513.1
Mus musculus (house mouse) Nipbl NP_081983.2
Rattus norvegicus (Norway rat) Nipbl XP_003749266.1
Gallus gallus (chicken) LOC427439 XP_425012.3
Gallus gallus (chicken) LOC427025 NP_001244277.1
Danio rerio (zebrafish) nipblb NP_001154919.2
Drosophila melanogaster (fruit fly) Nipped-B NP_001163052.1
Xenopus (Silurana) tropicalis (western clawed frog) nipbl XP_002938229.2


ID Name Evidence
GO:0005634 nucleus IDA
GO:0032116 SMC loading complex IDA


ID Name Evidence
GO:0005515 protein binding IPI
GO:0008022 protein C-terminus binding IPI
GO:0042826 histone deacetylase binding IPI
GO:0047485 protein N-terminus binding IPI
GO:0070087 chromo shadow domain binding IPI


ID Name Evidence
GO:0000122 negative regulation of transcription from RNA polymerase II promoter IDA
GO:0001656 metanephros development NAS
GO:0003007 heart morphogenesis IMP
GO:0003151 outflow tract morphogenesis IMP
GO:0006974 response to DNA damage stimulus IMP
GO:0007049 cell cycle IEA
GO:0007064 mitotic sister chromatid cohesion IMP
GO:0007420 brain development IMP
GO:0007605 sensory perception of sound IMP
GO:0031065 positive regulation of histone deacetylation IDA
GO:0034088 maintenance of mitotic sister chromatid cohesion IMP
GO:0034613 cellular protein localization IMP
GO:0035117 embryonic arm morphogenesis IMP
GO:0035140 arm morphogenesis IMP
GO:0035261 external genitalia morphogenesis IMP
GO:0040018 positive regulation of multicellular organism growth IEA
GO:0042471 ear morphogenesis IMP
GO:0042634 regulation of hair cycle IMP
GO:0045444 fat cell differentiation IEA
GO:0045778 positive regulation of ossification IEA
GO:0045995 regulation of embryonic development IMP
GO:0048557 embryonic digestive tract morphogenesis IMP
GO:0048589 developmental growth IMP
GO:0048592 eye morphogenesis IMP
GO:0048638 regulation of developmental growth IMP
GO:0048703 embryonic viscerocranium morphogenesis IEA
GO:0050890 cognition IMP
GO:0060325 face morphogenesis IMP
GO:0061010 gall bladder development IMP
GO:0061038 uterus morphogenesis IMP
GO:0071481 cellular response to X-ray IMP

GeneRIFs: Gene References Into Functions What's a GeneRIF?

The following NIPBL gene cDNA ORF clone sequences were retrieved from the NCBI Reference Sequence Database (RefSeq). These sequences represent the protein coding region of the NIPBL cDNA ORF which is encoded by the open reading frame (ORF) sequence. ORF sequences can be delivered in our standard vector, pcDNA3.1+/C-(K)DYK or the vector of your choice as an expression/transfection-ready ORF clone. Not the clone you want? Click here to find your clone.

CloneID RefSeq Accession Definition **Vector *Turnaround time Price Select
OHu39306 XM_006714467 PREDICTED: Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant X1, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu39307 XM_006714468 PREDICTED: Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant X2, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu39308 XM_005248280 PREDICTED: Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant X3, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu66528 XM_011514014 PREDICTED: Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant X4, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu66529 XM_005248282 PREDICTED: Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant X5, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu66530 XM_011514015 PREDICTED: Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant X6, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu26171 NM_133433 Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant A, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price
OHu26399 NM_015384 Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant B, mRNA. pcDNA3.1+/C-(K)DYK or customized vector TBD Quote Price

*Business Day

** You may select a custom vector to replace pcDNA3.1+/C-(K)DYK after clone is added to cart.

** GenScript guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories. In addition, please pay attention to the signal peptide, propeptide and transit peptide in target ORF, which may affect the choice of vector (N/C terminal tag vector).

CloneID OHu39306
Accession Version XM_006714467.2 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 8268bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product nipped-B-like protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_006576.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578809900. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)3747..3971(+)
Misc Feature(2)5868..5993(+)
Misc Feature(3)7308..>7745(+)
Position Chain Variation Link
30 30 a, g dbSNP:373316900
54 54 c, t dbSNP:555162591
55 55 -, c dbSNP:376839773
156 156 c, t dbSNP:201682335
168 168 a, cc dbSNP:724159980
177 177 a, t dbSNP:540966156
182 182 c, t dbSNP:377354585
190 190 c, t dbSNP:577250117
246 246 a, c dbSNP:544681871
272 272 g, t dbSNP:538879560
330 330 -, c dbSNP:567891305
334 334 c, g dbSNP:563016602
335 335 a, c, g dbSNP:558867335
340 340 c, t dbSNP:760514809
356 356 c, t dbSNP:539146812
371 371 c, t dbSNP:768471026
381 381 c, t dbSNP:557864476
390 390 c, t dbSNP:1494625
411 411 g, t dbSNP:774378633
420 420 a, g dbSNP:759332784
448 448 a, t dbSNP:780575072
451 451 a, g dbSNP:747655593
455 455 a, g dbSNP:771632892
460 460 c, t dbSNP:772796853
464 464 c, g dbSNP:760252451
465 465 a, g dbSNP:770720531
468 468 a, g dbSNP:776315178
470 470 a, g, t dbSNP:759424370
471 471 c, g dbSNP:752738480
476 476 a, c dbSNP:763068661
490 490 a, t dbSNP:121918264
491 491 g, t dbSNP:587783937
502 502 g, t dbSNP:764272515
530 530 a, g dbSNP:727504045
533 533 c, g dbSNP:757439561
558 558 a, g dbSNP:775499754
574 574 -, c dbSNP:587784060
575 575 a, g dbSNP:587784061
591 591 a, g dbSNP:763015442
599 599 a, g dbSNP:576203422
611 611 c, t dbSNP:774269226
614 614 c, t dbSNP:727504046
621 621 c, t dbSNP:80358367
633 633 g, t dbSNP:587783886
638 638 a, g dbSNP:767626703
656 656 c, t dbSNP:750719198
657 657 a, g dbSNP:539552810
658 658 c, g dbSNP:756415457
664 664 a, g dbSNP:766738333
667 667 a, g dbSNP:142703446
677 677 a, c dbSNP:755503212
680 680 c, g dbSNP:769022116
680 680 -, g dbSNP:80358364
686 686 c, g dbSNP:146033170
689 689 -, tagcctcaacca dbSNP:587783893
692 692 c, t dbSNP:746472461
693 693 c, g dbSNP:776899302
694 694 c, t dbSNP:587783895
698 698 a, c dbSNP:756859262
699 699 c, g dbSNP:780649689
713 713 c, t dbSNP:745537254
716 716 c, g dbSNP:74401909
717 717 a, g dbSNP:376938430
738 738 a, g dbSNP:369249480
743 743 c, t dbSNP:765659128
750 750 c, t dbSNP:753307330
752 752 a, g dbSNP:750048518
762 762 a, g dbSNP:373268240
763 763 c, t dbSNP:780783113
765 765 c, t dbSNP:750047678
782 782 c, t dbSNP:142184978
783 783 a, g dbSNP:779888500
785 785 c, t dbSNP:749086242
788 788 a, g dbSNP:768550843
794 794 g, t dbSNP:778661285
796 796 c, g dbSNP:748123160
798 798 -, cctaatgt dbSNP:587783917
798 798 c, g dbSNP:772009624
800 800 c, t dbSNP:773368185
801 801 a, g dbSNP:376768802
809 809 c, g dbSNP:771111681
813 813 c, g dbSNP:537093279
820 820 a, g dbSNP:587783920
821 821 c, t dbSNP:199569761
827 827 a, g dbSNP:759882900
833 833 a, g dbSNP:587783922
873 873 c, t dbSNP:141976717
888 888 c, t dbSNP:752506384
891 891 a, g dbSNP:758194241
897 897 c, t dbSNP:777676457
898 898 c, g dbSNP:746963911
900 900 c, g dbSNP:757285737
901 901 c, t dbSNP:781270385
909 909 a, g dbSNP:745983858
916 916 a, c dbSNP:770025507
934 934 a, t dbSNP:775638112
939 939 c, t dbSNP:775486487
941 941 c, t dbSNP:769152836
944 944 -, c dbSNP:587783951
944 944 c, t dbSNP:577987003
948 948 a, c, t dbSNP:139514413
949 949 a, g dbSNP:200692598
950 950 c, g dbSNP:769203117
954 954 a, g dbSNP:146321563
961 961 c, t dbSNP:762615203
967 967 c, g dbSNP:763783306
971 971 c, t dbSNP:536895037
1007 1007 a, g dbSNP:761663409
1010 1010 g, t dbSNP:767425012
1016 1016 c, t dbSNP:750337367
1017 1017 c, t dbSNP:576458890
1019 1019 a, g dbSNP:780026320
1021 1021 a, t dbSNP:754045462
1022 1022 c, t dbSNP:148542094
1023 1023 a, g dbSNP:142923613
1026 1026 c, t dbSNP:748523012
1047 1047 a, g dbSNP:372605856
1052 1052 a, g dbSNP:778285743
1073 1073 c, g dbSNP:80358360
1074 1074 a, g dbSNP:747476219
1086 1086 c, g, t dbSNP:587783988
1090 1090 c, t dbSNP:774838495
1092 1092 c, g dbSNP:762487890
1102 1102 c, t dbSNP:576532771
1103 1103 a, g dbSNP:150678035
1104 1104 a, g dbSNP:772863009
1106 1106 a, g dbSNP:760562029
1114 1114 c, t dbSNP:766225351
1139 1139 c, t dbSNP:776772068
1151 1151 c, t dbSNP:759632105
1159 1159 c, t dbSNP:376219060
1165 1165 c, t dbSNP:562557528
1166 1166 a, g, t dbSNP:192822119
1172 1172 c, t dbSNP:111957845
1177 1177 a, g dbSNP:369282785
1185 1185 a, g dbSNP:727504038
1186 1186 -, atcatc dbSNP:779093227
1188 1188 c, t dbSNP:541789068
1192 1192 a, g dbSNP:757697960
1196 1196 g, t dbSNP:139894113
1225 1225 a, g dbSNP:587784042
1236 1236 a, g dbSNP:746374055
1237 1237 g, t dbSNP:754441425
1247 1247 g, t dbSNP:778413684
1256 1256 c, t dbSNP:747703764
1259 1259 c, t dbSNP:771594948
1261 1261 a, t dbSNP:757986074
1262 1262 a, t dbSNP:777233920
1269 1269 g, t dbSNP:16903425
1273 1273 c, t dbSNP:147963155
1278 1278 a, g dbSNP:781159621
1283 1283 a, g dbSNP:560445654
1285 1285 a, t dbSNP:141927128
1292 1292 a, g dbSNP:144238532
1310 1310 c, t dbSNP:200429152
1316 1316 a, g dbSNP:145501067
1317 1317 c, t dbSNP:762880452
1320 1320 a, g dbSNP:768781698
1322 1322 a, g, t dbSNP:377714862
1323 1323 c, t dbSNP:767774437
1324 1324 a, g dbSNP:754508684
1326 1326 g, t dbSNP:766956935
1336 1336 a, g dbSNP:766858952
1342 1342 a, g dbSNP:754382888
1345 1345 a, g dbSNP:148862607
1350 1350 a, c dbSNP:546188623
1351 1351 c, t dbSNP:777377733
1367 1367 a, c dbSNP:760114555
1368 1368 c, t dbSNP:765716048
1379 1379 a, c dbSNP:373684382
1380 1380 -, c dbSNP:587784063
1380 1380 c, t dbSNP:587784062
1381 1381 a, t dbSNP:756882182
1382 1382 a, g dbSNP:587784064
1390 1390 c, g, t dbSNP:780931147
1392 1392 c, g dbSNP:755928572
1402 1402 a, c dbSNP:727503770
1403 1403 a, g dbSNP:555224277
1410 1410 c, t dbSNP:587784065
1415 1415 c, t dbSNP:749085513
1429 1429 c, t dbSNP:368151265
1430 1430 c, t dbSNP:778781695
1436 1436 a, g dbSNP:201213428
1446 1446 a, g dbSNP:748215385
1449 1449 a, c dbSNP:138720101
1451 1451 a, g dbSNP:773356740
1476 1476 a, g dbSNP:747262673
1480 1480 c, t dbSNP:577606629
1491 1491 c, g dbSNP:777034854
1491 1491 -, g dbSNP:587783877
1499 1499 a, g dbSNP:759860290
1506 1506 a, g dbSNP:765758628
1507 1507 a, g dbSNP:111963024
1514 1514 a, g dbSNP:370389105
1521 1521 -, tatg dbSNP:587783878
1544 1544 c, t dbSNP:200440893
1545 1545 a, t dbSNP:587783879
1564 1564 a, c dbSNP:752690806
1565 1565 a, g dbSNP:767162047
1574 1574 -, tt dbSNP:587783880
1592 1592 a, c dbSNP:750047694
1595 1595 c, t dbSNP:755805311
1596 1596 a, g dbSNP:765985686
1599 1599 a, g dbSNP:530539139
1624 1624 g, t dbSNP:368272080
1632 1632 a, g dbSNP:778853918
1638 1638 a, g dbSNP:587783881
1639 1639 a, g dbSNP:2291703
1650 1650 a, t dbSNP:758432898
1652 1652 c, t dbSNP:768113851
1657 1657 c, t dbSNP:747144008
1666 1666 a, g dbSNP:777670369
1671 1671 c, t dbSNP:587783882
1677 1677 a, c dbSNP:771157592
1681 1681 a, g dbSNP:776787961
1690 1690 c, t dbSNP:531372615
1696 1696 c, t dbSNP:746183321
1698 1698 c, t dbSNP:560785308
1699 1699 c, t dbSNP:776021951
1700 1700 c, t dbSNP:80358349
1712 1712 a, g dbSNP:764746811
1716 1716 a, g dbSNP:141010980
1717 1717 g, t dbSNP:546539357
1722 1722 c, t dbSNP:571300383
1723 1723 a, g dbSNP:372266009
1731 1731 a, g dbSNP:375514857
1733 1733 c, t dbSNP:764973232
1742 1742 a, g dbSNP:538985170
1750 1750 c, t dbSNP:758313905
1751 1751 a, g dbSNP:777731868
1756 1756 a, c dbSNP:751637394
1763 1763 a, g dbSNP:202230820
1765 1765 c, t dbSNP:757295271
1766 1766 a, g dbSNP:781405794
1769 1769 a, g dbSNP:746104220
1772 1772 c, t dbSNP:770142130
1778 1778 a, g dbSNP:776187516
1781 1781 a, g dbSNP:749708797
1785 1785 c, t dbSNP:587783883
1790 1790 c, g dbSNP:769279620
1794 1794 c, g dbSNP:775053765
1809 1809 a, g dbSNP:144853101
1812 1812 -, c dbSNP:34453758
1813 1813 c, t dbSNP:138765912
1824 1824 a, c dbSNP:770354010
1829 1829 a, g dbSNP:776307994
1831 1831 c, t dbSNP:200785457
1837 1837 c, t dbSNP:759134070
1838 1838 g, t dbSNP:764993497
1849 1849 a, g dbSNP:752461981
1852 1852 a, t dbSNP:536363403
1854 1854 a, c dbSNP:141937865
1860 1860 c, t dbSNP:587783884
1864 1864 g, t dbSNP:150837768
1865 1865 a, c dbSNP:374905176
1880 1880 a, t dbSNP:555179389
1885 1885 a, g dbSNP:781150294
1922 1922 a, g dbSNP:750562280
1927 1927 c, t dbSNP:756257801
1933 1933 -, gaga dbSNP:80358382
1935 1935 -, ga dbSNP:587783885
1965 1965 a, g dbSNP:587783887
1976 1976 a, g dbSNP:188309267
1995 1995 -, a dbSNP:34314728
2002 2002 -, gaaa dbSNP:587783888
2014 2014 c, g dbSNP:80358352
2028 2028 g, t dbSNP:748595346
2032 2032 a, g dbSNP:758803599
2038 2038 c, t dbSNP:778416353
2040 2040 a, g dbSNP:745359483
2041 2041 c, g dbSNP:769310563
2043 2043 a, g dbSNP:775080703
2051 2051 c, t dbSNP:748959339
2060 2060 c, t dbSNP:768342988
2064 2064 c, t dbSNP:587783889
2066 2066 a, g dbSNP:772284751
2071 2071 c, t dbSNP:574981584
2079 2079 a, g dbSNP:587783890
2080 2080 c, t dbSNP:369473705
2081 2081 a, g dbSNP:760769176
2083 2083 g, t dbSNP:138210440
2092 2092 c, t dbSNP:754066837
2097 2097 c, t dbSNP:755229018
2100 2100 c, g, t dbSNP:28638115
2102 2102 a, g, t dbSNP:372732709
2117 2117 c, t dbSNP:778086908
2128 2128 a, g dbSNP:747558873
2130 2130 a, g dbSNP:755570564
2132 2132 a, g dbSNP:779513147
2136 2136 a, g dbSNP:748832811
2140 2140 c, t dbSNP:768292156
2145 2145 c, t dbSNP:774111235
2149 2149 a, g dbSNP:747837504
2157 2157 a, g dbSNP:201051655
2160 2160 a, g dbSNP:201295325
2171 2171 a, t dbSNP:147230401
2175 2175 g, t dbSNP:760712544
2181 2181 a, g dbSNP:766468798
2189 2189 g, t dbSNP:149578437
2190 2190 a, g dbSNP:540432059
2198 2198 c, t dbSNP:374086000
2202 2202 a, c dbSNP:765367412
2209 2209 a, g dbSNP:144289137
2216 2216 a, g dbSNP:752980414
2233 2233 a, g dbSNP:763163376
2240 2240 -, tat dbSNP:776403850
2241 2241 -, a dbSNP:587783891
2263 2263 c, t dbSNP:764538711
2271 2271 a, t dbSNP:751966925
2285 2285 a, g dbSNP:140891645
2289 2289 -, a dbSNP:727503767
2295 2295 a, c dbSNP:138828510
2296 2296 a, g dbSNP:753332902
2302 2302 a, g dbSNP:754496859
2304 2304 a, c dbSNP:147532293
2320 2320 a, g dbSNP:761864879
2321 2321 a, t dbSNP:199546324
2323 2323 a, g dbSNP:200774440
2335 2335 a, c, g dbSNP:371073215
2336 2336 g, t dbSNP:747296657
2347 2347 c, t dbSNP:770988712
2363 2363 a, c dbSNP:776770380
2365 2365 a, g dbSNP:373101913
2373 2373 c, t dbSNP:587783892
2374 2374 a, g dbSNP:768964587
2379 2379 a, g, t dbSNP:142820200
2381 2381 a, g dbSNP:764259165
2384 2384 c, g dbSNP:751913459
2401 2401 a, g dbSNP:374023722
2408 2408 a, g dbSNP:530214717
2418 2418 a, g dbSNP:750933664
2424 2424 a, g dbSNP:754405649
2425 2425 a, c dbSNP:778508612
2450 2450 a, t dbSNP:776871098
2453 2453 c, g, t dbSNP:80358350
2469 2469 c, t dbSNP:746789978
2473 2473 a, g dbSNP:140100861
2474 2474 a, c dbSNP:781213650
2476 2476 a, c dbSNP:149892167
2479 2479 a, g dbSNP:375510491
2480 2480 c, t dbSNP:116049172
2484 2484 a, g dbSNP:376032121
2490 2490 a, g dbSNP:773594857
2505 2505 a, c dbSNP:75088717
2509 2509 a, g dbSNP:3822471
2522 2522 a, g dbSNP:774567810
2523 2523 a, t dbSNP:762097133
2525 2525 c, t dbSNP:200173176
2534 2534 -, a dbSNP:587783894
2544 2544 a, g dbSNP:538183552
2553 2553 a, t dbSNP:201482152
2554 2554 a, c dbSNP:766835753
2560 2560 a, g dbSNP:752248884
2569 2569 a, g dbSNP:144812404
2575 2575 c, t dbSNP:763785383
2580 2580 c, t dbSNP:550141620
2581 2581 c, g dbSNP:587783896
2585 2585 g, t dbSNP:757081951
2588 2588 c, t dbSNP:781159758
2591 2591 a, g dbSNP:745686171
2593 2593 c, t dbSNP:372162252
2595 2595 -, cc dbSNP:587783897
2596 2596 -, c dbSNP:587783898
2596 2596 c, t dbSNP:779911564
2598 2598 a, g dbSNP:146756149
2608 2608 g, t dbSNP:768620796
2616 2616 c, t dbSNP:774516564
2618 2618 c, g dbSNP:748391164
2620 2620 c, g dbSNP:772330143
2625 2625 a, g dbSNP:773534683
2631 2631 a, c, g dbSNP:765931580
2635 2635 -, aa dbSNP:727503766
2648 2648 a, g dbSNP:373925592
2649 2649 c, t dbSNP:762460698
2652 2652 a, c dbSNP:763732540
2663 2663 a, g dbSNP:751211535
2675 2675 a, t dbSNP:756935314
2676 2676 a, g dbSNP:374380375
2677 2677 a, g dbSNP:767341646
2693 2693 c, t dbSNP:750217822
2698 2698 a, g dbSNP:377186258
2707 2707 a, g dbSNP:148420552
2711 2711 a, c, g dbSNP:751048321
2712 2712 a, c dbSNP:749213303
2716 2716 a, g dbSNP:755001260
2718 2718 c, t dbSNP:370823399
2744 2744 a, g dbSNP:148075057
2748 2748 c, t dbSNP:587783899
2749 2749 g, t dbSNP:748268539
2775 2775 a, g dbSNP:772277123
2778 2778 a, c, t dbSNP:773366068
2782 2782 a, g dbSNP:185678374
2802 2802 g, t dbSNP:572898488
2803 2803 a, c dbSNP:777159279
2813 2813 a, g dbSNP:587783900
2822 2822 a, c dbSNP:759987095
2825 2825 g, t dbSNP:770475786
2826 2826 g, t dbSNP:773990755
2832 2832 c, t dbSNP:761463091
2837 2837 a, g dbSNP:141851878
2840 2840 a, g dbSNP:61755038
2860 2860 c, t dbSNP:760476489
2862 2862 c, t dbSNP:766108812
2863 2863 a, c, g dbSNP:376912534
2864 2864 g, t dbSNP:778889561
2871 2871 a, t dbSNP:752762369
2877 2877 c, t dbSNP:587783901
2878 2878 a, g dbSNP:758488035
2883 2883 a, g dbSNP:777987450
2891 2891 a, g dbSNP:747228856
2892 2892 a, g dbSNP:558749457
2910 2910 c, t dbSNP:587783902
2911 2911 a, c, g dbSNP:142574933
2924 2924 a, g dbSNP:746297367
2934 2934 c, t dbSNP:770406356
2935 2935 a, g dbSNP:80358359
2936 2936 c, t dbSNP:139177541
2939 2939 c, t dbSNP:587783903
2940 2940 c, t dbSNP:772870207
2944 2944 -, ata dbSNP:769307619
2944 2944 a, g dbSNP:753898269
2946 2946 a, g dbSNP:188564740
2949 2949 a, g dbSNP:376990497
2957 2957 a, c, g dbSNP:293756
2958 2958 g, t dbSNP:765103108
2959 2959 c, t dbSNP:587783904
2967 2967 -, ag dbSNP:398124465
2968 2968 a, g dbSNP:372453541
2971 2971 a, g dbSNP:758436782
2977 2977 c, g, t dbSNP:587783905
2982 2982 c, t dbSNP:587783906
2983 2983 a, g dbSNP:150498581
2988 2988 c, t dbSNP:587783907
2989 2989 a, g, t dbSNP:757394370
2993 2993 g, t dbSNP:587783908
2999 2999 c, g dbSNP:201163469
3002 3002 c, g, t dbSNP:746173840
3003 3003 a, g dbSNP:780665254
3010 3010 a, g dbSNP:749833499
3025 3025 c, t dbSNP:769254029
3028 3028 g, t dbSNP:772566455
3034 3034 c, g dbSNP:746596330
3037 3037 a, g dbSNP:543684890
3041 3041 a, g dbSNP:770478485
3043 3043 a, g dbSNP:776280237
3048 3048 c, g dbSNP:759261898
3064 3064 a, t dbSNP:147522427
3067 3067 a, g dbSNP:376095079
3077 3077 c, t dbSNP:775361188
3080 3080 a, t dbSNP:80358365
3085 3085 c, t dbSNP:542244170
3086 3086 a, g dbSNP:764136312
3090 3090 c, t dbSNP:398124466
3091 3091 a, g dbSNP:149629686
3094 3094 a, g dbSNP:200189574
3097 3097 a, g dbSNP:767565592
3099 3099 a, g dbSNP:144392474
3104 3104 c, t dbSNP:750703789
3110 3110 a, g dbSNP:756495812
3113 3113 g, t dbSNP:192992005
3114 3114 -, g dbSNP:398124467
3121 3121 a, g dbSNP:374308470
3125 3125 a, c dbSNP:749708811
3127 3127 a, g dbSNP:755435047
3131 3131 a, g dbSNP:200496609
3132 3132 g, t dbSNP:746447744
3142 3142 a, t dbSNP:770481159
3156 3156 c, g dbSNP:776228768
3161 3161 c, t dbSNP:376637245
3168 3168 c, t dbSNP:769488387
3169 3169 a, g dbSNP:775238155
3170 3170 c, t dbSNP:762876279
3179 3179 a, g dbSNP:763876444
3191 3191 c, t dbSNP:774346043
3198 3198 a, c dbSNP:761756303
3199 3199 -, g dbSNP:587783909
3215 3215 c, t dbSNP:148394805
3226 3226 c, t dbSNP:750577499
3230 3230 c, t dbSNP:756373027
3238 3238 a, g dbSNP:766774397
3242 3242 c, t dbSNP:780317958
3244 3244 a, g dbSNP:755384710
3246 3246 a, g dbSNP:755271349
3248 3248 c, g dbSNP:753280932
3256 3256 g, t dbSNP:200991784
3260 3260 c, t dbSNP:188565385
3261 3261 -, aa dbSNP:587783910
3267 3267 a, g dbSNP:142517671
3270 3270 a, g dbSNP:780661057
3276 3276 a, g dbSNP:745426441
3279 3279 a, g dbSNP:769437048
3285 3285 a, g dbSNP:779691362
3286 3286 c, t dbSNP:139833594
3290 3290 a, c dbSNP:748966128
3291 3291 c, t dbSNP:768524222
3320 3320 a, t dbSNP:587783911
3331 3331 a, g dbSNP:774105561
3332 3332 c, t dbSNP:761786416
3335 3335 g, t dbSNP:772174282
3344 3344 a, g dbSNP:371566938
3356 3356 c, t dbSNP:760895817
3376 3376 a, g dbSNP:200249421
3389 3389 a, c dbSNP:765533064
3390 3390 a, g dbSNP:759781764
3391 3391 -, a dbSNP:587783912
3391 3391 a, g, t dbSNP:180747605
3392 3392 a, t dbSNP:758911512
3407 3407 a, g dbSNP:778323343
3414 3414 a, g dbSNP:749926228
3419 3419 a, g dbSNP:587783913
3421 3421 c, t dbSNP:779638068
3427 3427 a, g dbSNP:748989594
3434 3434 a, g dbSNP:200018885
3450 3450 a, g dbSNP:778735646
3454 3454 c, t dbSNP:747958576
3462 3462 g, t dbSNP:772121235
3464 3464 g, t dbSNP:773295913
3468 3468 g, t dbSNP:760771193
3503 3503 a, g dbSNP:1669445
3506 3506 a, g dbSNP:776669672
3509 3509 a, g dbSNP:143369211
3512 3512 a, g dbSNP:765421145
3531 3531 -, gt dbSNP:768074630
3535 3535 g, t dbSNP:753105098
3537 3537 a, c dbSNP:146714879
3548 3548 -, agag dbSNP:587783914
3554 3554 c, t dbSNP:764513488
3570 3570 a, c dbSNP:752087990
3589 3589 a, g dbSNP:755568891
3590 3590 a, g dbSNP:765887558
3591 3591 a, c, g dbSNP:587783915
3592 3592 c, t dbSNP:368526792
3596 3596 a, g dbSNP:566411488
3597 3597 a, g dbSNP:587783916
3598 3598 a, g dbSNP:113185324
3600 3600 a, t dbSNP:747918239
3604 3604 a, g dbSNP:758273343
3611 3611 g, t dbSNP:777678265
3612 3612 a, g dbSNP:746847096
3614 3614 c, t dbSNP:757245118
3615 3615 a, g dbSNP:781054477
3629 3629 a, g, t dbSNP:368762999
3648 3648 c, g dbSNP:371836944
3656 3656 g, t dbSNP:188021705
3662 3662 a, g dbSNP:749483452
3668 3668 a, g dbSNP:768918033
3671 3671 c, t dbSNP:774686438
3690 3690 c, t dbSNP:762234061
3692 3692 c, t dbSNP:768002739
3696 3696 a, t dbSNP:773606834
3719 3719 c, t dbSNP:759037419
3729 3729 c, g dbSNP:764683974
3748 3748 a, g dbSNP:374823114
3779 3779 -, g dbSNP:34422680
3783 3783 a, g dbSNP:752294556
3784 3784 c, t dbSNP:762670218
3796 3796 c, t dbSNP:773728177
3810 3810 a, t dbSNP:587783919
3828 3828 a, g dbSNP:534319970
3835 3835 a, g dbSNP:552620284
3846 3846 c, t dbSNP:775123425
3857 3857 a, c, g dbSNP:140344071
3865 3865 a, c, g dbSNP:751266555
3875 3875 a, g dbSNP:767189407
3880 3880 c, g dbSNP:368022392
3883 3883 a, g dbSNP:755995175
3886 3886 a, g dbSNP:780034900
3888 3888 a, t dbSNP:753849710
3890 3890 a, t dbSNP:755064416
3900 3900 a, c, g dbSNP:113698799
3911 3911 a, g dbSNP:571024836
3915 3915 g, t dbSNP:772377308
3917 3917 c, t dbSNP:777976223
3921 3921 c, t dbSNP:371871116
3926 3926 c, t dbSNP:376555033
3928 3928 a, g dbSNP:587783921
3933 3933 c, t dbSNP:80358374
3941 3941 a, c, g dbSNP:150369438
3949 3949 -, ct dbSNP:587783923
3954 3954 a, g dbSNP:201512479
3963 3963 g, t dbSNP:369496238
3967 3967 -, ctc dbSNP:750517408
3969 3969 c, t dbSNP:557147929
3975 3975 c, t dbSNP:761353689
3981 3981 c, t dbSNP:540365485
4009 4009 a, g dbSNP:771559939
4014 4014 -, gaaaa dbSNP:587783925
4021 4021 a, g dbSNP:772932503
4025 4025 a, g dbSNP:544459951
4029 4029 a, c dbSNP:35748854
4030 4030 a, g dbSNP:776450648
4045 4045 a, g dbSNP:62654862
4056 4056 c, g dbSNP:759445904
4071 4071 a, g, t dbSNP:149134659
4099 4099 c, g dbSNP:762118494
4100 4100 c, t dbSNP:767920646
4103 4103 a, t dbSNP:369240129
4104 4104 -, ata dbSNP:121918266
4104 4104 a, g dbSNP:587783929
4118 4118 a, g dbSNP:372752190
4121 4121 c, t dbSNP:370889560
4135 4135 c, t dbSNP:756562931
4148 4148 a, g dbSNP:143252734
4154 4154 -, tga dbSNP:772674746
4156 4156 a, g dbSNP:775247210
4162 4162 a, g dbSNP:762912820
4163 4163 a, t dbSNP:768536990
4175 4175 a, g dbSNP:774573086
4178 4178 a, c dbSNP:761991838
4225 4225 c, g dbSNP:121918268
4257 4257 c, t dbSNP:753222256
4265 4265 c, t dbSNP:756713894
4273 4273 c, t dbSNP:766979302
4276 4276 -, tg dbSNP:587783930
4281 4281 a, g dbSNP:749981341
4292 4292 -, cttggagaagaatat dbSNP:587783931
4306 4306 g, t dbSNP:587783932
4314 4314 g, t dbSNP:755790180
4328 4328 c, t dbSNP:139137985
4329 4329 a, g dbSNP:749056969
4333 4333 c, t dbSNP:754755185
4339 4339 a, g dbSNP:143152112
4349 4349 c, t dbSNP:531615496
4350 4350 a, g dbSNP:758404835
4354 4354 -, ctga dbSNP:587783934
4356 4356 -, gaa dbSNP:773996562
4356 4356 a, g dbSNP:587783935
4361 4361 a, g dbSNP:777857860
4362 4362 g, t dbSNP:587783936
4365 4365 a, g dbSNP:747050519
4382 4382 c, g dbSNP:770936588
4385 4385 c, t dbSNP:80358354
4389 4389 a, t dbSNP:746043422
4404 4404 a, c dbSNP:770047320
4412 4412 a, g dbSNP:367925827
4417 4417 c, g dbSNP:763315761
4425 4425 a, g dbSNP:769095978
4427 4427 a, t dbSNP:774746577
4428 4428 a, g dbSNP:760196234
4431 4431 a, g dbSNP:563606953
4436 4436 c, t dbSNP:753438136
4455 4455 a, g dbSNP:758528908
4458 4458 c, t dbSNP:765051194
4478 4478 c, g dbSNP:376434880
4499 4499 a, t dbSNP:111521307
4503 4503 -, aaa dbSNP:761307264
4505 4505 a, c dbSNP:587783938
4507 4507 c, g dbSNP:752472468
4508 4508 c, t dbSNP:758279525
4513 4513 a, t dbSNP:776386128
4529 4529 a, g dbSNP:373206831
4533 4533 c, t dbSNP:770223945
4576 4576 a, g dbSNP:772696266
4578 4578 a, g dbSNP:372080833
4586 4586 -, aagt dbSNP:587783940
4587 4587 a, g dbSNP:113779525
4612 4612 c, g dbSNP:759120298
4621 4621 a, g dbSNP:764922800
4631 4631 -, ag dbSNP:587783941
4631 4631 a, g dbSNP:112616049
4649 4649 c, t dbSNP:752419634
4652 4652 c, t dbSNP:762796601
4692 4692 c, g dbSNP:61755039
4694 4694 a, g dbSNP:751416634
4698 4698 a, c dbSNP:79598279
4700 4700 a, g dbSNP:567328110
4715 4715 a, g dbSNP:757125850
4733 4733 a, c dbSNP:138440449
4763 4763 -, aaatgtcagtgaa dbSNP:587783944
4764 4764 a, g dbSNP:761684520
4773 4773 -, gaactacagt dbSNP:80358386
4778 4778 a, g dbSNP:767311814
4803 4803 a, g dbSNP:756050354
4805 4805 g, t dbSNP:746550826
4809 4809 a, g, t dbSNP:727503769
4823 4823 c, t dbSNP:767317539
4826 4826 a, g dbSNP:773043534
4832 4832 c, t dbSNP:760594320
4840 4840 c, t dbSNP:201882678
4850 4850 a, g dbSNP:370422740
4862 4862 g, t dbSNP:749296628
4868 4868 c, t dbSNP:765326455
4889 4889 a, g dbSNP:752992906
4894 4894 a, g dbSNP:758588654
4909 4909 c, g dbSNP:587783947
4910 4910 g, t dbSNP:80358358
4924 4924 a, t dbSNP:141956774
4927 4927 g, t dbSNP:587783948
4930 4930 a, t dbSNP:776570810
4937 4937 a, g dbSNP:759492239
4938 4938 c, t dbSNP:765328819
4941 4941 a, g dbSNP:764009294
4944 4944 c, t dbSNP:763219578
4981 4981 c, t dbSNP:199570957
4999 4999 a, t dbSNP:80358369
5001 5001 c, g dbSNP:377211455
5023 5023 a, t dbSNP:587783949
5028 5028 a, g dbSNP:536320603
5031 5031 g, t dbSNP:587783950
5038 5038 c, t dbSNP:751902505
5043 5043 -, aaa dbSNP:754929654
5055 5055 c, g dbSNP:762169826
5058 5058 a, g dbSNP:767975743
5064 5064 c, g dbSNP:377716907
5066 5066 c, t dbSNP:756639524
5072 5072 c, t dbSNP:539180409
5077 5077 c, t dbSNP:766801991
5081 5081 g, t dbSNP:587783952
5094 5094 c, t dbSNP:121918269
5104 5104 a, g dbSNP:752195607
5114 5114 c, t dbSNP:757927629
5123 5123 c, t dbSNP:777362486
5124 5124 -, c dbSNP:587783953
5138 5138 a, c, t dbSNP:760960982
5140 5140 a, c, g dbSNP:754335963
5144 5144 a, g dbSNP:763571035
5151 5151 -, g dbSNP:587783955
5162 5162 c, t dbSNP:587783956
5166 5166 c, t dbSNP:150683463
5171 5171 c, g dbSNP:756897581
5172 5172 -, tttg dbSNP:587783957
5187 5187 a, c dbSNP:780708835
5200 5200 a, c, t dbSNP:77632238
5201 5201 a, g dbSNP:745615007
5212 5212 a, c dbSNP:755880602
5213 5213 a, g dbSNP:779999171
5214 5214 a, c dbSNP:749218502
5219 5219 a, g dbSNP:140021654
5228 5228 c, t dbSNP:774573141
5231 5231 a, t dbSNP:186417615
5261 5261 g, t dbSNP:587783958
5276 5276 c, t dbSNP:753756758
5281 5281 a, g dbSNP:374279126
5289 5289 a, g dbSNP:779007826
5294 5294 -, ga dbSNP:80358372
5306 5306 -, ag dbSNP:587783959
5315 5315 c, t dbSNP:112128017
5337 5337 a, g dbSNP:748190130
5344 5344 a, g dbSNP:772077115
5345 5345 a, c, g dbSNP:777950633
5349 5349 a, g dbSNP:62654861
5371 5371 a, g dbSNP:771241543
5372 5372 a, c dbSNP:776975871
5388 5388 a, g dbSNP:759899214
5394 5394 c, t dbSNP:149451089
5420 5420 c, g dbSNP:747179198
5447 5447 a, g dbSNP:145952190
5448 5448 a, g dbSNP:781402189
5454 5454 c, t dbSNP:746181669
5455 5455 g, t dbSNP:770173799
5460 5460 c, t dbSNP:775870451
5474 5474 c, t dbSNP:754312670
5498 5498 a, g dbSNP:769274211
5504 5504 c, t dbSNP:776332291
5506 5506 a, g dbSNP:770286768
5515 5515 a, g dbSNP:559139612
5521 5521 -, cccagtg dbSNP:587783960
5539 5539 a, c dbSNP:774109272
5540 5540 a, g dbSNP:765047071
5542 5542 c, t dbSNP:775077572
5544 5544 c, t dbSNP:762816601
5551 5551 c, t dbSNP:763888888
5555 5555 a, g dbSNP:751545774
5573 5573 a, g dbSNP:545623030
5575 5575 a, g dbSNP:757224529
5589 5589 c, t dbSNP:139819353
5601 5601 c, t dbSNP:750570299
5604 5604 c, g dbSNP:575973361
5606 5606 c, t dbSNP:780337526
5625 5625 a, g dbSNP:749567855
5641 5641 a, g dbSNP:755405307
5646 5646 a, g dbSNP:779189164
5655 5655 c, t dbSNP:121918267
5662 5662 -, a dbSNP:587783961
5663 5663 a, g dbSNP:143222832
5670 5670 a, g dbSNP:772765625
5672 5672 a, t dbSNP:780843089
5676 5676 a, g dbSNP:745372802
5679 5679 a, g dbSNP:769510161
5683 5683 a, g dbSNP:775226349
5685 5685 a, t dbSNP:762616275
5686 5686 c, t dbSNP:200053064
5695 5695 c, t dbSNP:774062619
5698 5698 a, g dbSNP:761724507
5699 5699 a, g dbSNP:587783962
5700 5700 -, t dbSNP:730880331
5715 5715 a, g dbSNP:771949637
5718 5718 a, t dbSNP:773164199
5729 5729 c, g, t dbSNP:775399549
5733 5733 a, g dbSNP:528213483
5737 5737 a, g, t dbSNP:374265736
5742 5742 a, g dbSNP:765379536
5760 5760 a, c dbSNP:587783965
5762 5762 a, g dbSNP:753050851
5783 5783 a, g dbSNP:758853244
5794 5794 a, g dbSNP:778380312
5815 5815 a, t dbSNP:587783966
5818 5818 g, t dbSNP:587783970
5822 5822 a, g dbSNP:144979877
5823 5823 c, t dbSNP:587783971
5853 5853 c, t dbSNP:587783972
5854 5854 a, g dbSNP:80358380
5858 5858 a, g dbSNP:765446922
5863 5863 c, t dbSNP:775881994
5866 5866 g, t dbSNP:483353060
5877 5877 -, tctg dbSNP:587783973
5886 5886 a, g dbSNP:763307074
5901 5901 a, c dbSNP:771869795
5912 5912 a, g dbSNP:752026879
5928 5928 c, t dbSNP:80358362
5943 5943 c, t dbSNP:587783975
5944 5944 a, g dbSNP:80358366
5952 5952 g, t dbSNP:587783976
5953 5953 a, g dbSNP:587783977
5955 5955 a, c dbSNP:750864821
5960 5960 a, g dbSNP:369177620
5970 5970 c, g, t dbSNP:62654864
5971 5971 a, g dbSNP:587783978
5999 5999 a, g dbSNP:146702130
6013 6013 a, g dbSNP:148446678
6019 6019 a, g dbSNP:757982626
6024 6024 a, g dbSNP:777413835
6028 6028 a, t dbSNP:751316937
6038 6038 c, t dbSNP:757029751
6054 6054 a, g dbSNP:80358373
6059 6059 a, t dbSNP:781077369
6071 6071 c, t dbSNP:112125562
6119 6119 c, t dbSNP:369235309
6129 6129 a, g dbSNP:376084993
6171 6171 a, c dbSNP:562826277
6178 6178 a, g dbSNP:190086412
6200 6200 a, g dbSNP:545834258
6203 6203 a, g dbSNP:569762677
6220 6220 a, c dbSNP:587783982
6236 6236 c, t dbSNP:748268175
6240 6240 a, g dbSNP:199639172
6248 6248 c, t dbSNP:778081443
6250 6250 a, g dbSNP:587783983
6260 6260 a, c dbSNP:771252680
6269 6269 a, g dbSNP:142635202
6271 6271 a, g dbSNP:746357461
6274 6274 a, g dbSNP:374294679
6289 6289 c, t dbSNP:773668251
6290 6290 c, t dbSNP:761398208
6302 6302 a, g dbSNP:375622324
6308 6308 c, t dbSNP:772917259
6316 6316 c, g dbSNP:368584228
6322 6322 a, g dbSNP:766136878
6344 6344 a, t dbSNP:776513362
6350 6350 c, t dbSNP:759401891
6353 6353 a, g dbSNP:370179049
6362 6362 c, t dbSNP:61748200
6380 6380 c, t dbSNP:776458092
6394 6394 a, c dbSNP:759154614
6403 6403 c, t dbSNP:769605459
6407 6407 a, g dbSNP:375694876
6411 6411 g, t dbSNP:587783986
6412 6412 -, ttg dbSNP:587783987
6419 6419 c, t dbSNP:200548405
6432 6432 a, c dbSNP:370593530
6456 6456 a, g dbSNP:764022167
6467 6467 c, t dbSNP:761030463
6469 6469 a, g dbSNP:368028754
6525 6525 a, c dbSNP:587783989
6545 6545 c, t dbSNP:140907869
6555 6555 a, c dbSNP:587783990
6556 6556 a, g dbSNP:587783991
6559 6559 a, c, t dbSNP:587783992
6560 6560 a, g dbSNP:745516748
6595 6595 a, g dbSNP:769397450
6599 6599 a, g dbSNP:755732764
6612 6612 a, g dbSNP:779592620
6625 6625 a, g dbSNP:749041461
6628 6628 c, t dbSNP:768408469
6633 6633 a, g dbSNP:587783996
6635 6635 a, g dbSNP:774190237
6646 6646 c, t dbSNP:587783997
6658 6658 c, t dbSNP:587783998
6665 6665 a, g dbSNP:748074172
6669 6669 c, g dbSNP:772003089
6670 6670 c, t dbSNP:587783999
6677 6677 a, t dbSNP:773286952
6687 6687 g, t dbSNP:760694971
6697 6697 -, g dbSNP:34512595
6704 6704 c, t dbSNP:766586011
6707 6707 a, c, g, t dbSNP:149769284
6719 6719 c, t dbSNP:376800486
6730 6730 g, t dbSNP:587784000
6738 6738 g, t dbSNP:587784002
6754 6754 g, t dbSNP:587784003
6800 6800 a, g dbSNP:147865925
6804 6804 c, g dbSNP:587784004
6805 6805 -, tgtg dbSNP:587784005
6810 6810 a, g dbSNP:587784006
6820 6820 a, g dbSNP:374645420
6831 6831 a, g dbSNP:587784007
6850 6850 -, aaa dbSNP:587784008
6852 6852 a, g dbSNP:768026341
6857 6857 a, g dbSNP:369295272
6877 6877 a, g dbSNP:759079809
6878 6878 c, t dbSNP:141545751
6887 6887 c, t dbSNP:752327065
6888 6888 c, t dbSNP:372730081
6890 6890 a, g dbSNP:777430704
6926 6926 c, t dbSNP:376448686
6927 6927 a, g dbSNP:757080818
6943 6943 a, g dbSNP:781297222
6966 6966 g, t dbSNP:147054690
6987 6987 a, g dbSNP:750862610
7022 7022 c, g dbSNP:774665042
7031 7031 a, g dbSNP:138404850
7045 7045 a, g dbSNP:398124469
7053 7053 c, t dbSNP:587784013
7056 7056 a, g dbSNP:587784014
7059 7059 a, t dbSNP:587784015
7064 7064 c, t dbSNP:759147525
7078 7078 a, g dbSNP:587784017
7085 7085 c, t dbSNP:773628266
7094 7094 a, g dbSNP:544147349
7101 7101 a, g, t dbSNP:587784018
7112 7112 c, t dbSNP:371380435
7113 7113 a, g dbSNP:763610468
7119 7119 g, t dbSNP:80358363
7120 7120 -, aag dbSNP:587784019
7129 7129 -, atctata dbSNP:80358361
7133 7133 a, g dbSNP:149186951
7134 7134 c, t dbSNP:587784020
7136 7136 -, ta dbSNP:587784021
7140 7140 a, g dbSNP:761605563
7141 7141 -, ata dbSNP:587784022
7145 7145 c, t dbSNP:767406866
7162 7162 c, t dbSNP:750309699
7163 7163 c, t dbSNP:756057442
7172 7172 c, t dbSNP:766363037
7189 7189 g, t dbSNP:727504047
7193 7193 a, g dbSNP:753822274
7195 7195 a, t dbSNP:587784023
7211 7211 a, g dbSNP:187845879
7214 7214 a, g dbSNP:201215377
7228 7228 a, g dbSNP:752953852
7235 7235 a, g dbSNP:200322289
7283 7283 a, t dbSNP:781461880
7295 7295 c, t dbSNP:746375194
7301 7301 c, t dbSNP:770272272
7307 7307 a, g dbSNP:778420641
7323 7323 a, g dbSNP:747682655
7334 7334 c, t dbSNP:372139946
7367 7367 c, t dbSNP:772966461
7369 7369 a, g dbSNP:760452129
7376 7376 c, t dbSNP:201968259
7380 7380 c, g, t dbSNP:80358376
7381 7381 a, g dbSNP:587784024
7382 7382 c, t dbSNP:58424791
7392 7392 c, t dbSNP:770744719
7396 7396 a, g dbSNP:776353314
7423 7423 g, t dbSNP:587784025
7440 7440 c, t dbSNP:587784026
7451 7451 a, g dbSNP:762930515
7476 7476 c, g dbSNP:764147606
7479 7479 c, g dbSNP:774483696
7481 7481 a, g dbSNP:587784028
7488 7488 a, g dbSNP:751872913
7489 7489 c, t dbSNP:762029831
7493 7493 a, g dbSNP:767647337
7499 7499 -, gg dbSNP:587784029
7500 7500 c, g dbSNP:587784030
7502 7502 a, t dbSNP:750760089
7507 7507 a, t dbSNP:537134096
7511 7511 a, g dbSNP:781090000
7512 7512 c, t dbSNP:587784031
7524 7524 c, g dbSNP:754381730
7526 7526 c, t dbSNP:755606647
7535 7535 c, g, t dbSNP:398124470
7545 7545 a, g dbSNP:746511205
7565 7565 c, t dbSNP:765858277
7568 7568 g, t dbSNP:751036660
7585 7585 a, g dbSNP:528591545
7590 7590 c, t dbSNP:587784033
7594 7594 -, a dbSNP:587784034
7599 7599 a, g dbSNP:143355392
7605 7605 a, g dbSNP:369258718
7606 7606 c, t dbSNP:373666652
7607 7607 a, g dbSNP:779759181
7612 7612 g, t dbSNP:749095617
7617 7617 c, g dbSNP:200641062
7620 7620 c, g dbSNP:778747295
7629 7629 a, g dbSNP:587784035
7637 7637 a, g dbSNP:148375273
7643 7643 c, t dbSNP:772030142
7652 7652 a, c, t dbSNP:773405443
7654 7654 g, t dbSNP:371336448
7656 7656 a, g dbSNP:587784036
7661 7661 g, t dbSNP:777083356
7676 7676 c, t dbSNP:760006591
7686 7686 -, c dbSNP:587784037
7687 7687 a, g dbSNP:765741574
7690 7690 a, g dbSNP:78798978
7693 7693 -, c dbSNP:150935361
7700 7700 a, g dbSNP:753125341
7707 7707 c, t dbSNP:398124471
7723 7723 c, g dbSNP:763576119
7732 7732 a, g dbSNP:766934075
7758 7758 a, g dbSNP:750525831
7759 7759 c, t dbSNP:185745349
7763 7763 a, c, g dbSNP:143420538
7764 7764 a, g dbSNP:752391534
7766 7766 c, t dbSNP:146395325
7771 7771 a, g dbSNP:763839941
7772 7772 a, g dbSNP:751532481
7780 7780 -, ga dbSNP:587784043
7795 7795 c, g dbSNP:377715840
7801 7801 a, g dbSNP:781356422
7802 7802 a, c dbSNP:370397088
7803 7803 a, g dbSNP:756243240
7814 7814 c, t dbSNP:780356036
7815 7815 a, g dbSNP:749512949
7821 7821 -, gaa dbSNP:765215110
7823 7823 a, t dbSNP:769043360
7824 7824 a, g dbSNP:774763777
7826 7826 a, g dbSNP:748587506
7828 7828 a, t dbSNP:758391131
7829 7829 a, t dbSNP:780388411
7830 7830 g, t dbSNP:759115050
7840 7840 c, t dbSNP:769223635
7843 7843 a, g dbSNP:775181656
7847 7847 c, g dbSNP:762573705
7851 7851 c, t dbSNP:763980419
7852 7852 a, g dbSNP:578001374
7858 7858 a, g dbSNP:761787560
7861 7861 -, agattc dbSNP:762768404
7862 7862 -, agattc dbSNP:773170822
7883 7883 -, ttcaga dbSNP:587784044
7885 7885 c, t dbSNP:767586775
7890 7890 a, g dbSNP:189670249
7894 7894 a, g dbSNP:756187678
7897 7897 c, t dbSNP:780046822
7904 7904 a, g dbSNP:754086108
7910 7910 g, t dbSNP:755159074
7927 7927 a, g dbSNP:375928290
7934 7934 c, t dbSNP:113072270
7943 7943 c, t dbSNP:398124472
7952 7952 a, g dbSNP:772525236
7953 7953 a, g dbSNP:778219424
7954 7954 a, g dbSNP:747514959
7957 7957 c, t dbSNP:769331331
7966 7966 a, g dbSNP:587784045
7978 7978 c, t dbSNP:727503772
7980 7980 a, c dbSNP:774934420
7982 7982 c, t dbSNP:587784046
8042 8042 -, ctctccatctgaatctgcaaaagta dbSNP:587784047
8044 8044 c, g dbSNP:768384647
8060 8060 a, c dbSNP:774117227
8066 8066 a, g dbSNP:747852202
8068 8068 a, g dbSNP:80358351
8069 8069 c, t dbSNP:371347218
8077 8077 c, t dbSNP:148519494
8078 8078 a, g dbSNP:760603031
8079 8079 a, g dbSNP:191164620
8085 8085 a, c dbSNP:776731706
8089 8089 a, g dbSNP:759578329
8095 8095 a, g dbSNP:765346062
8098 8098 g, t dbSNP:752901099
8099 8099 g, t dbSNP:758683339
8114 8114 a, g dbSNP:371073065
8117 8117 a, g dbSNP:751886314
8121 8121 c, g dbSNP:757737158
8130 8130 -, c dbSNP:80358368
8134 8134 a, g dbSNP:199508078
8142 8142 a, g dbSNP:759275114
8147 8147 -, t dbSNP:80358371
8148 8148 a, t dbSNP:138514909
8155 8155 a, g dbSNP:754514853
8163 8163 a, g dbSNP:778625623
8168 8168 a, g dbSNP:747799106
8171 8171 c, g dbSNP:115668015
8190 8190 c, t dbSNP:587784050
8198 8198 a, g dbSNP:773008376
8206 8206 a, g dbSNP:746720769
8213 8213 c, t dbSNP:146209296
8234 8234 -, gaa dbSNP:752183727
8235 8235 -, gaa dbSNP:757786513
8241 8241 -, gaagaagaaggggaggtttcagctagcacaaatgctcg dbSNP:727503771
8249 8249 a, g dbSNP:781105857
8253 8253 a, g dbSNP:745734788
8265 8265 a, g dbSNP:769740056
8266 8266 a, g dbSNP:775502170
8295 8295 g, t dbSNP:370961382
8336 8336 a, c dbSNP:768824556
8340 8340 a, g dbSNP:201996196
8345 8345 a, t dbSNP:373944245
8348 8348 c, t dbSNP:774414570
8360 8360 c, t dbSNP:762153846
8366 8366 a, g dbSNP:757955910
8410 8410 a, g dbSNP:761090361
8425 8425 c, t dbSNP:766898203
8426 8426 a, g dbSNP:201036501
8438 8438 a, g dbSNP:570203387
8459 8459 c, t dbSNP:763443745
8460 8460 c, g dbSNP:747960326
8464 8464 c, g, t dbSNP:147110911
8474 8474 c, t dbSNP:780857060
8478 8478 a, c dbSNP:750120861
8494 8494 a, g dbSNP:755884239
8506 8506 -, cacaaattgcaagagtagt dbSNP:587784052
8507 8507 a, g dbSNP:727504048
8513 8513 -, t dbSNP:56110022
8514 8514 c, g dbSNP:587784053
8533 8533 c, g dbSNP:779883508
8559 8559 a, c dbSNP:749178582
8566 8566 g, t dbSNP:587784054
8574 8574 a, c dbSNP:754949542
8591 8591 a, g dbSNP:778802387
8598 8598 c, t dbSNP:186140730
8604 8604 a, g dbSNP:748290328
8614 8614 a, g dbSNP:772317129
8618 8618 -, ggtgcct dbSNP:587784055
8621 8621 a, g dbSNP:773545402
8634 8634 a, g dbSNP:747292472
8637 8637 a, g dbSNP:771413945
8641 8641 -, aa dbSNP:587784056
8642 8642 a, g dbSNP:777136404
8652 8652 a, g dbSNP:759899081
8654 8654 c, t dbSNP:765799258
8670 8670 g, t dbSNP:200872976
8677 8677 c, t dbSNP:587784057
8678 8678 a, g, t dbSNP:139108785
8691 8691 a, c dbSNP:750063692
8696 8696 c, t dbSNP:755832194
8718 8718 c, t dbSNP:398124474
8723 8723 c, t dbSNP:766097454
8726 8726 c, g dbSNP:753681684
8749 8749 c, g dbSNP:587784058
8752 8752 c, g dbSNP:199865449
8755 8755 a, g dbSNP:778876578
8779 8779 g, t dbSNP:368337347
8788 8788 a, t dbSNP:758539444
8800 8800 a, g dbSNP:202141454
8804 8804 a, g dbSNP:747157787
8810 8810 c, t dbSNP:535124662
8814 8814 a, t dbSNP:553340093
8831 8831 -, a dbSNP:553794254
8840 8840 -, a dbSNP:587783876
8876 8876 -, g dbSNP:34031034
8907 8907 a, t dbSNP:565669720
8926 8926 c, t dbSNP:773330481
8943 8943 a, g dbSNP:539494562
8951 8951 c, t dbSNP:3207732
8971 8971 a, c dbSNP:1065156
8983 8983 c, t dbSNP:763005114
9020 9020 c, t dbSNP:189382158
9036 9036 -, aaac dbSNP:535770794
9065 9065 -, a dbSNP:750914257
9090 9090 a, g dbSNP:181989563
9107 9107 a, g dbSNP:185780527
9112 9112 c, g dbSNP:555746936
9139 9139 a, g dbSNP:770949694
9153 9153 c, t dbSNP:573975118
9178 9178 -, t dbSNP:33999028
9204 9204 a, g dbSNP:74640019
9205 9205 -, a dbSNP:768908921
9205 9205 a, g dbSNP:78168072
9211 9211 a, c dbSNP:555727011
9230 9230 a, g dbSNP:541473248
9297 9297 c, t dbSNP:775433800
9307 9307 c, g dbSNP:760747084
9362 9362 -, tt dbSNP:758917129
9378 9378 c, t dbSNP:559677890
9399 9399 -, a dbSNP:35132212
9404 9404 a, c dbSNP:544288062
9645 9645 c, t dbSNP:190661162
9676 9676 a, g dbSNP:575588206
9678 9678 a, t dbSNP:545449231

Target ORF information:

RefSeq Version XM_006714467
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1+/C-(K)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

CloneID OHu39307
Accession Version XM_006714468.1 Documents for ORF clone product in dufault vector
Sequence Information ORF Nucleotide Sequence (Length: 8217bp)
Protein sequence
Vector pcDNA3.1+/C-(K)DYK or customized vector User Manual
Clone information Clone Map MSDS
Tag on pcDNA3.1+/C-(K)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product nipped-B-like protein isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_006576.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##


The stop codons will be deleted if pcDNA3.1+/C-(K)DYK vector is selected.

Misc Feature(1)5670..5795(+)
Misc Feature(2)7110..7661(+)
Position Chain Variation Link
30 30 a, g dbSNP:373316900
54 54 c, t dbSNP:555162591
55 55 -, c dbSNP:376839773
156 156 c, t dbSNP:201682335
168 168 a, cc dbSNP:724159980
177 177 a, t dbSNP:540966156
182 182 c, t dbSNP:377354585
190 190 c, t dbSNP:577250117
246 246 a, c dbSNP:544681871
272 272 g, t dbSNP:538879560
330 330 -, c dbSNP:567891305
334 334 c, g dbSNP:563016602
335 335 a, c, g dbSNP:558867335
340 340 c, t dbSNP:760514809
356 356 c, t dbSNP:539146812
371 371 c, t dbSNP:768471026
381 381 c, t dbSNP:557864476
390 390 c, t dbSNP:1494625
411 411 g, t dbSNP:774378633
420 420 a, g dbSNP:759332784
448 448 a, t dbSNP:780575072
451 451 a, g dbSNP:747655593
455 455 a, g dbSNP:771632892
460 460 c, t dbSNP:772796853
464 464 c, g dbSNP:760252451
465 465 a, g dbSNP:770720531
468 468 a, g dbSNP:776315178
470 470 a, g, t dbSNP:759424370
471 471 c, g dbSNP:752738480
476 476 a, c dbSNP:763068661
490 490 a, t dbSNP:121918264
491 491 g, t dbSNP:587783937
502 502 g, t dbSNP:764272515
530 530 a, g dbSNP:727504045
533 533 c, g dbSNP:757439561
558 558 a, g dbSNP:775499754
574 574 -, c dbSNP:587784060
575 575 a, g dbSNP:587784061
591 591 a, g dbSNP:763015442
599 599 a, g dbSNP:576203422
611 611 c, t dbSNP:774269226
614 614 c, t dbSNP:727504046
621 621 c, t dbSNP:80358367
633 633 g, t dbSNP:587783886
638 638 a, g dbSNP:767626703
656 656 c, t dbSNP:750719198
657 657 a, g dbSNP:539552810
658 658 c, g dbSNP:756415457
664 664 a, g dbSNP:766738333
667 667 a, g dbSNP:142703446
677 677 a, c dbSNP:755503212
680 680 c, g dbSNP:769022116
680 680 -, g dbSNP:80358364
686 686 c, g dbSNP:146033170
689 689 -, tagcctcaacca dbSNP:587783893
692 692 c, t dbSNP:746472461
693 693 c, g dbSNP:776899302
694 694 c, t dbSNP:587783895
698 698 a, c dbSNP:756859262
699 699 c, g dbSNP:780649689
713 713 c, t dbSNP:745537254
716 716 c, g dbSNP:74401909
717 717 a, g dbSNP:376938430
738 738 a, g dbSNP:369249480
743 743 c, t dbSNP:765659128
750 750 c, t dbSNP:753307330
752 752 a, g dbSNP:750048518
762 762 a, g dbSNP:373268240
763 763 c, t dbSNP:780783113
765 765 c, t dbSNP:750047678
782 782 c, t dbSNP:142184978
783 783 a, g dbSNP:779888500
785 785 c, t dbSNP:749086242
788 788 a, g dbSNP:768550843
794 794 g, t dbSNP:778661285
796 796 c, g dbSNP:748123160
798 798 -, cctaatgt dbSNP:587783917
798 798 c, g dbSNP:772009624
800 800 c, t dbSNP:773368185
801 801 a, g dbSNP:376768802
809 809 c, g dbSNP:771111681
813 813 c, g dbSNP:537093279
820 820 a, g dbSNP:587783920
821 821 c, t dbSNP:199569761
827 827 a, g dbSNP:759882900
833 833 a, g dbSNP:587783922
873 873 c, t dbSNP:141976717
888 888 c, t dbSNP:752506384
891 891 a, g dbSNP:758194241
897 897 c, t dbSNP:777676457
898 898 c, g dbSNP:746963911
900 900 c, g dbSNP:757285737
901 901 c, t dbSNP:781270385
909 909 a, g dbSNP:745983858
916 916 a, c dbSNP:770025507
934 934 a, t dbSNP:775638112
939 939 c, t dbSNP:775486487
941 941 c, t dbSNP:769152836
944 944 -, c dbSNP:587783951
944 944 c, t dbSNP:577987003
948 948 a, c, t dbSNP:139514413
949 949 a, g dbSNP:200692598
950 950 c, g dbSNP:769203117
954 954 a, g dbSNP:146321563
961 961 c, t dbSNP:762615203
967 967 c, g dbSNP:763783306
971 971 c, t dbSNP:536895037
1007 1007 a, g dbSNP:761663409
1010 1010 g, t dbSNP:767425012
1016 1016 c, t dbSNP:750337367
1017 1017 c, t dbSNP:576458890
1019 1019 a, g dbSNP:780026320
1021 1021 a, t dbSNP:754045462
1022 1022 c, t dbSNP:148542094
1023 1023 a, g dbSNP:142923613
1026 1026 c, t dbSNP:748523012
1047 1047 a, g dbSNP:372605856
1052 1052 a, g dbSNP:778285743
1073 1073 c, g dbSNP:80358360
1074 1074 a, g dbSNP:747476219
1086 1086 c, g, t dbSNP:587783988
1090 1090 c, t dbSNP:774838495
1092 1092 c, g dbSNP:762487890
1102 1102 c, t dbSNP:576532771
1103 1103 a, g dbSNP:150678035
1104 1104 a, g dbSNP:772863009
1106 1106 a, g dbSNP:760562029
1114 1114 c, t dbSNP:766225351
1139 1139 c, t dbSNP:776772068
1151 1151 c, t dbSNP:759632105
1159 1159 c, t dbSNP:376219060
1165 1165 c, t dbSNP:562557528
1166 1166 a, g, t dbSNP:192822119
1172 1172 c, t dbSNP:111957845
1177 1177 a, g dbSNP:369282785
1185 1185 a, g dbSNP:727504038
1186 1186 -, atcatc dbSNP:779093227
1188 1188 c, t dbSNP:541789068
1192 1192 a, g dbSNP:757697960
1196 1196 g, t dbSNP:139894113
1225 1225 a, g dbSNP:587784042
1236 1236 a, g dbSNP:746374055
1237 1237 g, t dbSNP:754441425
1247 1247 g, t dbSNP:778413684
1256 1256 c, t dbSNP:747703764
1259 1259 c, t dbSNP:771594948
1261 1261 a, t dbSNP:757986074
1262 1262 a, t dbSNP:777233920
1269 1269 g, t dbSNP:16903425
1273 1273 c, t dbSNP:147963155
1278 1278 a, g dbSNP:781159621
1283 1283 a, g dbSNP:560445654
1285 1285 a, t dbSNP:141927128
1292 1292 a, g dbSNP:144238532
1310 1310 c, t dbSNP:200429152
1316 1316 a, g dbSNP:145501067
1317 1317 c, t dbSNP:762880452
1320 1320 a, g dbSNP:768781698
1322 1322 a, g, t dbSNP:377714862
1323 1323 c, t dbSNP:767774437
1324 1324 a, g dbSNP:754508684
1326 1326 g, t dbSNP:766956935
1336 1336 a, g dbSNP:766858952
1342 1342 a, g dbSNP:754382888
1345 1345 a, g dbSNP:148862607
1350 1350 a, c dbSNP:546188623
1351 1351 c, t dbSNP:777377733
1367 1367 a, c dbSNP:760114555
1368 1368 c, t dbSNP:765716048
1379 1379 a, c dbSNP:373684382
1380 1380 -, c dbSNP:587784063
1380 1380 c, t dbSNP:587784062
1381 1381 a, t dbSNP:756882182
1382 1382 a, g dbSNP:587784064
1390 1390 c, g, t dbSNP:780931147
1392 1392 c, g dbSNP:755928572
1402 1402 a, c dbSNP:727503770
1403 1403 a, g dbSNP:555224277
1410 1410 c, t dbSNP:587784065
1415 1415 c, t dbSNP:749085513
1429 1429 c, t dbSNP:368151265
1430 1430 c, t dbSNP:778781695
1436 1436 a, g dbSNP:201213428
1446 1446 a, g dbSNP:748215385
1449 1449 a, c dbSNP:138720101
1451 1451 a, g dbSNP:773356740
1476 1476 a, g dbSNP:747262673
1480 1480 c, t dbSNP:577606629
1491 1491 c, g dbSNP:777034854
1491 1491 -, g dbSNP:587783877
1499 1499 a, g dbSNP:759860290
1506 1506 a, g dbSNP:765758628
1507 1507 a, g dbSNP:111963024
1514 1514 a, g dbSNP:370389105
1521 1521 -, tatg dbSNP:587783878
1544 1544 c, t dbSNP:200440893
1545 1545 a, t dbSNP:587783879
1564 1564 a, c dbSNP:752690806
1565 1565 a, g dbSNP:767162047
1574 1574 -, tt dbSNP:587783880
1592 1592 a, c dbSNP:750047694
1595 1595 c, t dbSNP:755805311
1596 1596 a, g dbSNP:765985686
1599 1599 a, g dbSNP:530539139
1624 1624 g, t dbSNP:368272080
1632 1632 a, g dbSNP:778853918
1638 1638 a, g dbSNP:587783881
1639 1639 a, g dbSNP:2291703
1650 1650 a, t dbSNP:758432898
1652 1652 c, t dbSNP:768113851
1657 1657 c, t dbSNP:747144008
1666 1666 a, g dbSNP:777670369
1671 1671 c, t dbSNP:587783882
1677 1677 a, c dbSNP:771157592
1681 1681 a, g dbSNP:776787961
1690 1690 c, t dbSNP:531372615
1696 1696 c, t dbSNP:746183321
1698 1698 c, t dbSNP:560785308
1699 1699 c, t dbSNP:776021951
1700 1700 c, t dbSNP:80358349
1712 1712 a, g dbSNP:764746811
1716 1716 a, g dbSNP:141010980
1717 1717 g, t dbSNP:546539357
1722 1722 c, t dbSNP:571300383
1723 1723 a, g dbSNP:372266009
1731 1731 a, g dbSNP:375514857
1733 1733 c, t dbSNP:764973232
1742 1742 a, g dbSNP:538985170
1750 1750 c, t dbSNP:758313905
1751 1751 a, g dbSNP:777731868
1756 1756 a, c dbSNP:751637394
1763 1763 a, g dbSNP:202230820
1765 1765 c, t dbSNP:757295271
1766 1766 a, g dbSNP:781405794
1769 1769 a, g dbSNP:746104220
1772 1772 c, t dbSNP:770142130
1778 1778 a, g dbSNP:776187516
1781 1781 a, g dbSNP:749708797
1785 1785 c, t dbSNP:587783883
1790 1790 c, g dbSNP:769279620
1794 1794 c, g dbSNP:775053765
1809 1809 a, g dbSNP:144853101
1812 1812 -, c dbSNP:34453758
1813 1813 c, t dbSNP:138765912
1824 1824 a, c dbSNP:770354010
1829 1829 a, g dbSNP:776307994
1831 1831 c, t dbSNP:200785457
1837 1837 c, t dbSNP:759134070
1838 1838 g, t dbSNP:764993497
1849 1849 a, g dbSNP:752461981
1852 1852 a, t dbSNP:536363403
1854 1854 a, c dbSNP:141937865
1860 1860 c, t dbSNP:587783884
1864 1864 g, t dbSNP:150837768
1865 1865 a, c dbSNP:374905176
1880 1880 a, t dbSNP:555179389
1885 1885 a, g dbSNP:781150294
1922 1922 a, g dbSNP:750562280
1927 1927 c, t dbSNP:756257801
1933 1933 -, gaga dbSNP:80358382
1935 1935 -, ga dbSNP:587783885
1965 1965 a, g dbSNP:587783887
1976 1976 a, g dbSNP:188309267
1995 1995 -, a dbSNP:34314728
2002 2002 -, gaaa dbSNP:587783888
2014 2014 c, g dbSNP:80358352
2028 2028 g, t dbSNP:748595346
2032 2032 a, g dbSNP:758803599
2038 2038 c, t dbSNP:778416353
2040 2040 a, g dbSNP:745359483
2041 2041 c, g dbSNP:769310563
2043 2043 a, g dbSNP:775080703
2051 2051 c, t dbSNP:748959339
2060 2060 c, t dbSNP:768342988
2064 2064 c, t dbSNP:587783889
2066 2066 a, g dbSNP:772284751
2071 2071 c, t dbSNP:574981584
2079 2079 a, g dbSNP:587783890
2080 2080 c, t dbSNP:369473705
2081 2081 a, g dbSNP:760769176
2083 2083 g, t dbSNP:138210440
2092 2092 c, t dbSNP:754066837
2097 2097 c, t dbSNP:755229018
2100 2100 c, g, t dbSNP:28638115
2102 2102 a, g, t dbSNP:372732709
2117 2117 c, t dbSNP:778086908
2128 2128 a, g dbSNP:747558873
2130 2130 a, g dbSNP:755570564
2132 2132 a, g dbSNP:779513147
2136 2136 a, g dbSNP:748832811
2140 2140 c, t dbSNP:768292156
2145 2145 c, t dbSNP:774111235
2149 2149 a, g dbSNP:747837504
2157 2157 a, g dbSNP:201051655
2160 2160 a, g dbSNP:201295325
2171 2171 a, t dbSNP:147230401
2175 2175 g, t dbSNP:760712544
2181 2181 a, g dbSNP:766468798
2189 2189 g, t dbSNP:149578437
2190 2190 a, g dbSNP:540432059
2198 2198 c, t dbSNP:374086000
2202 2202 a, c dbSNP:765367412
2209 2209 a, g dbSNP:144289137
2216 2216 a, g dbSNP:752980414
2233 2233 a, g dbSNP:763163376
2240 2240 -, tat dbSNP:776403850
2241 2241 -, a dbSNP:587783891
2263 2263 c, t dbSNP:764538711
2271 2271 a, t dbSNP:751966925
2285 2285 a, g dbSNP:140891645
2289 2289 -, a dbSNP:727503767
2295 2295 a, c dbSNP:138828510
2296 2296 a, g dbSNP:753332902
2302 2302 a, g dbSNP:754496859
2304 2304 a, c dbSNP:147532293
2320 2320 a, g dbSNP:761864879
2321 2321 a, t dbSNP:199546324
2323 2323 a, g dbSNP:200774440
2335 2335 a, c, g dbSNP:371073215
2336 2336 g, t dbSNP:747296657
2347 2347 c, t dbSNP:770988712
2363 2363 a, c dbSNP:776770380
2365 2365 a, g dbSNP:373101913
2373 2373 c, t dbSNP:587783892
2374 2374 a, g dbSNP:768964587
2379 2379 a, g, t dbSNP:142820200
2381 2381 a, g dbSNP:764259165
2384 2384 c, g dbSNP:751913459
2401 2401 a, g dbSNP:374023722
2408 2408 a, g dbSNP:530214717
2418 2418 a, g dbSNP:750933664
2424 2424 a, g dbSNP:754405649
2425 2425 a, c dbSNP:778508612
2450 2450 a, t dbSNP:776871098
2453 2453 c, g, t dbSNP:80358350
2469 2469 c, t dbSNP:746789978
2473 2473 a, g dbSNP:140100861
2474 2474 a, c dbSNP:781213650
2476 2476 a, c dbSNP:149892167
2479 2479 a, g dbSNP:375510491
2480 2480 c, t dbSNP:116049172
2484 2484 a, g dbSNP:376032121
2490 2490 a, g dbSNP:773594857
2505 2505 a, c dbSNP:75088717
2509 2509 a, g dbSNP:3822471
2522 2522 a, g dbSNP:774567810
2523 2523 a, t dbSNP:762097133
2525 2525 c, t dbSNP:200173176
2534 2534 -, a dbSNP:587783894
2544 2544 a, g dbSNP:538183552
2553 2553 a, t dbSNP:201482152
2554 2554 a, c dbSNP:766835753
2560 2560 a, g dbSNP:752248884
2569 2569 a, g dbSNP:144812404
2575 2575 c, t dbSNP:763785383
2580 2580 c, t dbSNP:550141620
2581 2581 c, g dbSNP:587783896
2585 2585 g, t dbSNP:757081951
2588 2588 c, t dbSNP:781159758
2591 2591 a, g dbSNP:745686171
2593 2593 c, t dbSNP:372162252
2595 2595 -, cc dbSNP:587783897
2596 2596 -, c dbSNP:587783898
2596 2596 c, t dbSNP:779911564
2598 2598 a, g dbSNP:146756149
2608 2608 g, t dbSNP:768620796
2616 2616 c, t dbSNP:774516564
2618 2618 c, g dbSNP:748391164
2620 2620 c, g dbSNP:772330143
2625 2625 a, g dbSNP:773534683
2631 2631 a, c, g dbSNP:765931580
2635 2635 -, aa dbSNP:727503766
2648 2648 a, g dbSNP:373925592
2649 2649 c, t dbSNP:762460698
2652 2652 a, c dbSNP:763732540
2663 2663 a, g dbSNP:751211535
2675 2675 a, t dbSNP:756935314
2676 2676 a, g dbSNP:374380375
2677 2677 a, g dbSNP:767341646
2693 2693 c, t dbSNP:750217822
2698 2698 a, g dbSNP:377186258
2707 2707 a, g dbSNP:148420552
2711 2711 a, c, g dbSNP:751048321
2712 2712 a, c dbSNP:749213303
2716 2716 a, g dbSNP:755001260
2718 2718 c, t dbSNP:370823399
2744 2744 a, g dbSNP:148075057
2748 2748 c, t dbSNP:587783899
2749 2749 g, t dbSNP:748268539
2775 2775 a, g dbSNP:772277123
2778 2778 a, c, t dbSNP:773366068
2782 2782 a, g dbSNP:185678374
2802 2802 g, t dbSNP:572898488
2803 2803 a, c dbSNP:777159279
2813 2813 a, g dbSNP:587783900
2822 2822 a, c dbSNP:759987095
2825 2825 g, t dbSNP:770475786
2826 2826 g, t dbSNP:773990755
2832 2832 c, t dbSNP:761463091
2837 2837 a, g dbSNP:141851878
2840 2840 a, g dbSNP:61755038
2860 2860 c, t dbSNP:760476489
2862 2862 c, t dbSNP:766108812
2863 2863 a, c, g dbSNP:376912534
2864 2864 g, t dbSNP:778889561
2871 2871 a, t dbSNP:752762369
2877 2877 c, t dbSNP:587783901
2878 2878 a, g dbSNP:758488035
2883 2883 a, g dbSNP:777987450
2891 2891 a, g dbSNP:747228856
2892 2892 a, g dbSNP:558749457
2910 2910 c, t dbSNP:587783902
2911 2911 a, c, g dbSNP:142574933
2924 2924 a, g dbSNP:746297367
2934 2934 c, t dbSNP:770406356
2935 2935 a, g dbSNP:80358359
2936 2936 c, t dbSNP:139177541
2939 2939 c, t dbSNP:587783903
2940 2940 c, t dbSNP:772870207
2944 2944 -, ata dbSNP:769307619
2944 2944 a, g dbSNP:753898269
2946 2946 a, g dbSNP:188564740
2949 2949 a, g dbSNP:376990497
2957 2957 a, c, g dbSNP:293756
2958 2958 g, t dbSNP:765103108
2959 2959 c, t dbSNP:587783904
2967 2967 -, ag dbSNP:398124465
2968 2968 a, g dbSNP:372453541
2971 2971 a, g dbSNP:758436782
2977 2977 c, g, t dbSNP:587783905
2982 2982 c, t dbSNP:587783906
2983 2983 a, g dbSNP:150498581
2988 2988 c, t dbSNP:587783907
2989 2989 a, g, t dbSNP:757394370
2993 2993 g, t dbSNP:587783908
2999 2999 c, g dbSNP:201163469
3002 3002 c, g, t dbSNP:746173840
3003 3003 a, g dbSNP:780665254
3010 3010 a, g dbSNP:749833499
3025 3025 c, t dbSNP:769254029
3028 3028 g, t dbSNP:772566455
3034 3034 c, g dbSNP:746596330
3037 3037 a, g dbSNP:543684890
3041 3041 a, g dbSNP:770478485
3043 3043 a, g dbSNP:776280237
3048 3048 c, g dbSNP:759261898
3064 3064 a, t dbSNP:147522427
3067 3067 a, g dbSNP:376095079
3077 3077 c, t dbSNP:775361188
3080 3080 a, t dbSNP:80358365
3085 3085 c, t dbSNP:542244170
3086 3086 a, g dbSNP:764136312
3090 3090 c, t dbSNP:398124466
3091 3091 a, g dbSNP:149629686
3094 3094 a, g dbSNP:200189574
3097 3097 a, g dbSNP:767565592
3099 3099 a, g dbSNP:144392474
3104 3104 c, t dbSNP:750703789
3110 3110 a, g dbSNP:756495812
3113 3113 g, t dbSNP:192992005
3114 3114 -, g dbSNP:398124467
3121 3121 a, g dbSNP:374308470
3125 3125 a, c dbSNP:749708811
3127 3127 a, g dbSNP:755435047
3131 3131 a, g dbSNP:200496609
3132 3132 g, t dbSNP:746447744
3142 3142 a, t dbSNP:770481159
3156 3156 c, g dbSNP:776228768
3161 3161 c, t dbSNP:376637245
3168 3168 c, t dbSNP:769488387
3169 3169 a, g dbSNP:775238155
3170 3170 c, t dbSNP:762876279
3179 3179 a, g dbSNP:763876444
3191 3191 c, t dbSNP:774346043
3198 3198 a, c dbSNP:761756303
3199 3199 -, g dbSNP:587783909
3215 3215 c, t dbSNP:148394805
3226 3226 c, t dbSNP:750577499
3230 3230 c, t dbSNP:756373027
3238 3238 a, g dbSNP:766774397
3242 3242 c, t dbSNP:780317958
3244 3244 a, g dbSNP:755384710
3246 3246 a, g dbSNP:755271349
3248 3248 c, g dbSNP:753280932
3256 3256 g, t dbSNP:200991784
3260 3260 c, t dbSNP:188565385
3261 3261 -, aa dbSNP:587783910
3267 3267 a, g dbSNP:142517671
3270 3270 a, g dbSNP:780661057
3276 3276 a, g dbSNP:745426441
3279 3279 a, g dbSNP:769437048
3285 3285 a, g dbSNP:779691362
3286 3286 c, t dbSNP:139833594
3290 3290 a, c dbSNP:748966128
3291 3291 c, t dbSNP:768524222
3320 3320 a, t dbSNP:587783911
3331 3331 a, g dbSNP:774105561
3332 3332 c, t dbSNP:761786416
3335 3335 g, t dbSNP:772174282
3344 3344 a, g dbSNP:371566938
3356 3356 c, t dbSNP:760895817
3376 3376 a, g dbSNP:200249421
3389 3389 a, c dbSNP:765533064
3390 3390 a, g dbSNP:759781764
3391 3391 -, a dbSNP:587783912
3391 3391 a, g, t dbSNP:180747605
3392 3392 a, t dbSNP:758911512
3407 3407 a, g dbSNP:778323343
3414 3414 a, g dbSNP:749926228
3419 3419 a, g dbSNP:587783913
3421 3421 c, t dbSNP:779638068
3427 3427 a, g dbSNP:748989594
3434 3434 a, g dbSNP:200018885
3450 3450 a, g dbSNP:778735646
3454 3454 c, t dbSNP:747958576
3462 3462 g, t dbSNP:772121235
3464 3464 g, t dbSNP:773295913
3468 3468 g, t dbSNP:760771193
3503 3503 a, g dbSNP:1669445
3506 3506 a, g dbSNP:776669672
3509 3509 a, g dbSNP:143369211
3512 3512 a, g dbSNP:765421145
3531 3531 -, gt dbSNP:768074630
3535 3535 g, t dbSNP:753105098
3537 3537 a, c dbSNP:146714879
3548 3548 -, agag dbSNP:587783914
3554 3554 c, t dbSNP:764513488
3570 3570 a, c dbSNP:752087990
3589 3589 a, g dbSNP:755568891
3590 3590 a, g dbSNP:765887558
3591 3591 a, c, g dbSNP:587783915
3592 3592 c, t dbSNP:368526792
3596 3596 a, g dbSNP:566411488
3597 3597 a, g dbSNP:587783916
3598 3598 a, g dbSNP:113185324
3600 3600 a, t dbSNP:747918239
3604 3604 a, g dbSNP:758273343
3611 3611 g, t dbSNP:777678265
3612 3612 a, g dbSNP:746847096
3614 3614 c, t dbSNP:757245118
3615 3615 a, g dbSNP:781054477
3629 3629 a, g, t dbSNP:368762999
3648 3648 c, g dbSNP:371836944
3656 3656 g, t dbSNP:188021705
3662 3662 a, g dbSNP:749483452
3668 3668 a, g dbSNP:768918033
3671 3671 c, t dbSNP:774686438
3690 3690 c, t dbSNP:762234061
3692 3692 c, t dbSNP:768002739
3696 3696 a, t dbSNP:773606834
3719 3719 c, t dbSNP:759037419
3729 3729 c, g dbSNP:764683974
3748 3748 a, g dbSNP:374823114
3779 3779 -, g dbSNP:34422680
3783 3783 a, g dbSNP:752294556
3784 3784 c, t dbSNP:762670218
3811 3811 a, g dbSNP:771559939
3816 3816 -, gaaaa dbSNP:587783925
3823 3823 a, g dbSNP:772932503
3827 3827 a, g dbSNP:544459951
3831 3831 a, c dbSNP:35748854
3832 3832 a, g dbSNP:776450648
3847 3847 a, g dbSNP:62654862
3858 3858 c, g dbSNP:759445904
3873 3873 a, g, t dbSNP:149134659
3901 3901 c, g dbSNP:762118494
3902 3902 c, t dbSNP:767920646
3905 3905 a, t dbSNP:369240129
3906 3906 -, ata dbSNP:121918266
3906 3906 a, g dbSNP:587783929
3920 3920 a, g dbSNP:372752190
3923 3923 c, t dbSNP:370889560
3937 3937 c, t dbSNP:756562931
3950 3950 a, g dbSNP:143252734
3956 3956 -, tga dbSNP:772674746
3958 3958 a, g dbSNP:775247210
3964 3964 a, g dbSNP:762912820
3965 3965 a, t dbSNP:768536990
3977 3977 a, g dbSNP:774573086
3980 3980 a, c dbSNP:761991838
4027 4027 c, g dbSNP:121918268
4059 4059 c, t dbSNP:753222256
4067 4067 c, t dbSNP:756713894
4075 4075 c, t dbSNP:766979302
4078 4078 -, tg dbSNP:587783930
4083 4083 a, g dbSNP:749981341
4094 4094 -, cttggagaagaatat dbSNP:587783931
4108 4108 g, t dbSNP:587783932
4116 4116 g, t dbSNP:755790180
4130 4130 c, t dbSNP:139137985
4131 4131 a, g dbSNP:749056969
4135 4135 c, t dbSNP:754755185
4141 4141 a, g dbSNP:143152112
4151 4151 c, t dbSNP:531615496
4152 4152 a, g dbSNP:758404835
4156 4156 -, ctga dbSNP:587783934
4158 4158 -, gaa dbSNP:773996562
4158 4158 a, g dbSNP:587783935
4163 4163 a, g dbSNP:777857860
4164 4164 g, t dbSNP:587783936
4167 4167 a, g dbSNP:747050519
4184 4184 c, g dbSNP:770936588
4187 4187 c, t dbSNP:80358354
4191 4191 a, t dbSNP:746043422
4206 4206 a, c dbSNP:770047320
4214 4214 a, g dbSNP:367925827
4219 4219 c, g dbSNP:763315761
4227 4227 a, g dbSNP:769095978
4229 4229 a, t dbSNP:774746577
4230 4230 a, g dbSNP:760196234
4233 4233 a, g dbSNP:563606953
4238 4238 c, t dbSNP:753438136
4257 4257 a, g dbSNP:758528908
4260 4260 c, t dbSNP:765051194
4280 4280 c, g dbSNP:376434880
4301 4301 a, t dbSNP:111521307
4305 4305 -, aaa dbSNP:761307264
4307 4307 a, c dbSNP:587783938
4309 4309 c, g dbSNP:752472468
4310 4310 c, t dbSNP:758279525
4315 4315 a, t dbSNP:776386128
4331 4331 a, g dbSNP:373206831
4335 4335 c, t dbSNP:770223945
4378 4378 a, g dbSNP:772696266
4380 4380 a, g dbSNP:372080833
4388 4388 -, aagt dbSNP:587783940
4389 4389 a, g dbSNP:113779525
4414 4414 c, g dbSNP:759120298
4423 4423 a, g dbSNP:764922800
4433 4433 -, ag dbSNP:587783941
4433 4433 a, g dbSNP:112616049
4451 4451 c, t dbSNP:752419634
4454 4454 c, t dbSNP:762796601
4494 4494 c, g dbSNP:61755039
4496 4496 a, g dbSNP:751416634
4500 4500 a, c dbSNP:79598279
4502 4502 a, g dbSNP:567328110
4517 4517 a, g dbSNP:757125850
4535 4535 a, c dbSNP:138440449
4565 4565 -, aaatgtcagtgaa dbSNP:587783944
4566 4566 a, g dbSNP:761684520
4575 4575 -, gaactacagt dbSNP:80358386
4580 4580 a, g dbSNP:767311814
4605 4605 a, g dbSNP:756050354
4607 4607 g, t dbSNP:746550826
4611 4611 a, g, t dbSNP:727503769
4625 4625 c, t dbSNP:767317539
4628 4628 a, g dbSNP:773043534
4634 4634 c, t dbSNP:760594320
4642 4642 c, t dbSNP:201882678
4652 4652 a, g dbSNP:370422740
4664 4664 g, t dbSNP:749296628
4670 4670 c, t dbSNP:765326455
4691 4691 a, g dbSNP:752992906
4696 4696 a, g dbSNP:758588654
4711 4711 c, g dbSNP:587783947
4712 4712 g, t dbSNP:80358358
4726 4726 a, t dbSNP:141956774
4729 4729 g, t dbSNP:587783948
4732 4732 a, t dbSNP:776570810
4739 4739 a, g dbSNP:759492239
4740 4740 c, t dbSNP:765328819
4743 4743 a, g dbSNP:764009294
4746 4746 c, t dbSNP:763219578
4783 4783 c, t dbSNP:199570957
4801 4801