Email to GenScript

Human  Mouse  Rat  Other  

Search Help

Human  Mouse  Rat  Other  

  • THAT   AND
  • THAT   AND

NIPBL Nipped-B homolog (Drosophila) [Homo sapiens (human)]

Gene Symbol NIPBL
Entrez Gene ID 25836
Full Name Nipped-B homolog (Drosophila)
Synonyms CDLS, CDLS1, IDN3, IDN3-B, Scc2
General protein information
Preferred Names
nipped-B-like protein
nipped-B-like protein
SCC2 homolog
sister chromatid cohesion 2 homolog
Gene Type protein-coding
Organism Homo sapiens (human)



Summary This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]. lac of sum
Disorder MIM:


Disorder Html: Cornelia de Lange syndrome 1, 122470 (3)
CloneID RefSeq Accession Definition **Vector *Turnaround time Price
OHu39306 XM_006714467 PREDICTED: Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant X1, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu39307 XM_006714468 PREDICTED: Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant X2, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu39308 XM_005248280 PREDICTED: Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant X3, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu66528 XM_011514014 PREDICTED: Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant X4, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu66529 XM_005248282 PREDICTED: Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant X5, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu66530 XM_011514015 PREDICTED: Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant X6, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00
OHu26171 NM_133433 Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant A, mRNA. pcDNA3.1-C-(k)DYK In stock -1 Starting from $99.00
OHu26399 NM_015384 Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant B, mRNA. pcDNA3.1-C-(k)DYK Not in stock -1 Starting from $99.00

*Business Day
**You may select a custom vector to replace pcDNA3.1-C-(k)DYK after clone is added to cart.

CloneID OHu39306D
Sequence Information ORF Nucleotide Sequence (Length: 8268bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product nipped-B-like protein isoform X1
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_006576.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Mar 12, 2015 this sequence version replaced gi:578809900. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)3747..3971(+)
Misc Feature(2)5868..5993(+)
Misc Feature(3)7308..>7745(+)
Position Chain Variation Link
30 30 a, g dbSNP:373316900
54 54 c, t dbSNP:555162591
55 55 -, c dbSNP:376839773
156 156 c, t dbSNP:201682335
168 168 a, cc dbSNP:724159980
177 177 a, t dbSNP:540966156
182 182 c, t dbSNP:377354585
190 190 c, t dbSNP:577250117
246 246 a, c dbSNP:544681871
272 272 g, t dbSNP:538879560
330 330 -, c dbSNP:567891305
334 334 c, g dbSNP:563016602
335 335 a, c, g dbSNP:558867335
340 340 c, t dbSNP:760514809
356 356 c, t dbSNP:539146812
371 371 c, t dbSNP:768471026
381 381 c, t dbSNP:557864476
390 390 c, t dbSNP:1494625
411 411 g, t dbSNP:774378633
420 420 a, g dbSNP:759332784
448 448 a, t dbSNP:780575072
451 451 a, g dbSNP:747655593
455 455 a, g dbSNP:771632892
460 460 c, t dbSNP:772796853
464 464 c, g dbSNP:760252451
465 465 a, g dbSNP:770720531
468 468 a, g dbSNP:776315178
470 470 a, g, t dbSNP:759424370
471 471 c, g dbSNP:752738480
476 476 a, c dbSNP:763068661
490 490 a, t dbSNP:121918264
491 491 g, t dbSNP:587783937
502 502 g, t dbSNP:764272515
530 530 a, g dbSNP:727504045
533 533 c, g dbSNP:757439561
558 558 a, g dbSNP:775499754
574 574 -, c dbSNP:587784060
575 575 a, g dbSNP:587784061
591 591 a, g dbSNP:763015442
599 599 a, g dbSNP:576203422
611 611 c, t dbSNP:774269226
614 614 c, t dbSNP:727504046
621 621 c, t dbSNP:80358367
633 633 g, t dbSNP:587783886
638 638 a, g dbSNP:767626703
656 656 c, t dbSNP:750719198
657 657 a, g dbSNP:539552810
658 658 c, g dbSNP:756415457
664 664 a, g dbSNP:766738333
667 667 a, g dbSNP:142703446
677 677 a, c dbSNP:755503212
680 680 c, g dbSNP:769022116
680 680 -, g dbSNP:80358364
686 686 c, g dbSNP:146033170
689 689 -, tagcctcaacca dbSNP:587783893
692 692 c, t dbSNP:746472461
693 693 c, g dbSNP:776899302
694 694 c, t dbSNP:587783895
698 698 a, c dbSNP:756859262
699 699 c, g dbSNP:780649689
713 713 c, t dbSNP:745537254
716 716 c, g dbSNP:74401909
717 717 a, g dbSNP:376938430
738 738 a, g dbSNP:369249480
743 743 c, t dbSNP:765659128
750 750 c, t dbSNP:753307330
752 752 a, g dbSNP:750048518
762 762 a, g dbSNP:373268240
763 763 c, t dbSNP:780783113
765 765 c, t dbSNP:750047678
782 782 c, t dbSNP:142184978
783 783 a, g dbSNP:779888500
785 785 c, t dbSNP:749086242
788 788 a, g dbSNP:768550843
794 794 g, t dbSNP:778661285
796 796 c, g dbSNP:748123160
798 798 -, cctaatgt dbSNP:587783917
798 798 c, g dbSNP:772009624
800 800 c, t dbSNP:773368185
801 801 a, g dbSNP:376768802
809 809 c, g dbSNP:771111681
813 813 c, g dbSNP:537093279
820 820 a, g dbSNP:587783920
821 821 c, t dbSNP:199569761
827 827 a, g dbSNP:759882900
833 833 a, g dbSNP:587783922
873 873 c, t dbSNP:141976717
888 888 c, t dbSNP:752506384
891 891 a, g dbSNP:758194241
897 897 c, t dbSNP:777676457
898 898 c, g dbSNP:746963911
900 900 c, g dbSNP:757285737
901 901 c, t dbSNP:781270385
909 909 a, g dbSNP:745983858
916 916 a, c dbSNP:770025507
934 934 a, t dbSNP:775638112
939 939 c, t dbSNP:775486487
941 941 c, t dbSNP:769152836
944 944 -, c dbSNP:587783951
944 944 c, t dbSNP:577987003
948 948 a, c, t dbSNP:139514413
949 949 a, g dbSNP:200692598
950 950 c, g dbSNP:769203117
954 954 a, g dbSNP:146321563
961 961 c, t dbSNP:762615203
967 967 c, g dbSNP:763783306
971 971 c, t dbSNP:536895037
1007 1007 a, g dbSNP:761663409
1010 1010 g, t dbSNP:767425012
1016 1016 c, t dbSNP:750337367
1017 1017 c, t dbSNP:576458890
1019 1019 a, g dbSNP:780026320
1021 1021 a, t dbSNP:754045462
1022 1022 c, t dbSNP:148542094
1023 1023 a, g dbSNP:142923613
1026 1026 c, t dbSNP:748523012
1047 1047 a, g dbSNP:372605856
1052 1052 a, g dbSNP:778285743
1073 1073 c, g dbSNP:80358360
1074 1074 a, g dbSNP:747476219
1086 1086 c, g, t dbSNP:587783988
1090 1090 c, t dbSNP:774838495
1092 1092 c, g dbSNP:762487890
1102 1102 c, t dbSNP:576532771
1103 1103 a, g dbSNP:150678035
1104 1104 a, g dbSNP:772863009
1106 1106 a, g dbSNP:760562029
1114 1114 c, t dbSNP:766225351
1139 1139 c, t dbSNP:776772068
1151 1151 c, t dbSNP:759632105
1159 1159 c, t dbSNP:376219060
1165 1165 c, t dbSNP:562557528
1166 1166 a, g, t dbSNP:192822119
1172 1172 c, t dbSNP:111957845
1177 1177 a, g dbSNP:369282785
1185 1185 a, g dbSNP:727504038
1186 1186 -, atcatc dbSNP:779093227
1188 1188 c, t dbSNP:541789068
1192 1192 a, g dbSNP:757697960
1196 1196 g, t dbSNP:139894113
1225 1225 a, g dbSNP:587784042
1236 1236 a, g dbSNP:746374055
1237 1237 g, t dbSNP:754441425
1247 1247 g, t dbSNP:778413684
1256 1256 c, t dbSNP:747703764
1259 1259 c, t dbSNP:771594948
1261 1261 a, t dbSNP:757986074
1262 1262 a, t dbSNP:777233920
1269 1269 g, t dbSNP:16903425
1273 1273 c, t dbSNP:147963155
1278 1278 a, g dbSNP:781159621
1283 1283 a, g dbSNP:560445654
1285 1285 a, t dbSNP:141927128
1292 1292 a, g dbSNP:144238532
1310 1310 c, t dbSNP:200429152
1316 1316 a, g dbSNP:145501067
1317 1317 c, t dbSNP:762880452
1320 1320 a, g dbSNP:768781698
1322 1322 a, g, t dbSNP:377714862
1323 1323 c, t dbSNP:767774437
1324 1324 a, g dbSNP:754508684
1326 1326 g, t dbSNP:766956935
1336 1336 a, g dbSNP:766858952
1342 1342 a, g dbSNP:754382888
1345 1345 a, g dbSNP:148862607
1350 1350 a, c dbSNP:546188623
1351 1351 c, t dbSNP:777377733
1367 1367 a, c dbSNP:760114555
1368 1368 c, t dbSNP:765716048
1379 1379 a, c dbSNP:373684382
1380 1380 -, c dbSNP:587784063
1380 1380 c, t dbSNP:587784062
1381 1381 a, t dbSNP:756882182
1382 1382 a, g dbSNP:587784064
1390 1390 c, g, t dbSNP:780931147
1392 1392 c, g dbSNP:755928572
1402 1402 a, c dbSNP:727503770
1403 1403 a, g dbSNP:555224277
1410 1410 c, t dbSNP:587784065
1415 1415 c, t dbSNP:749085513
1429 1429 c, t dbSNP:368151265
1430 1430 c, t dbSNP:778781695
1436 1436 a, g dbSNP:201213428
1446 1446 a, g dbSNP:748215385
1449 1449 a, c dbSNP:138720101
1451 1451 a, g dbSNP:773356740
1476 1476 a, g dbSNP:747262673
1480 1480 c, t dbSNP:577606629
1491 1491 c, g dbSNP:777034854
1491 1491 -, g dbSNP:587783877
1499 1499 a, g dbSNP:759860290
1506 1506 a, g dbSNP:765758628
1507 1507 a, g dbSNP:111963024
1514 1514 a, g dbSNP:370389105
1521 1521 -, tatg dbSNP:587783878
1544 1544 c, t dbSNP:200440893
1545 1545 a, t dbSNP:587783879
1564 1564 a, c dbSNP:752690806
1565 1565 a, g dbSNP:767162047
1574 1574 -, tt dbSNP:587783880
1592 1592 a, c dbSNP:750047694
1595 1595 c, t dbSNP:755805311
1596 1596 a, g dbSNP:765985686
1599 1599 a, g dbSNP:530539139
1624 1624 g, t dbSNP:368272080
1632 1632 a, g dbSNP:778853918
1638 1638 a, g dbSNP:587783881
1639 1639 a, g dbSNP:2291703
1650 1650 a, t dbSNP:758432898
1652 1652 c, t dbSNP:768113851
1657 1657 c, t dbSNP:747144008
1666 1666 a, g dbSNP:777670369
1671 1671 c, t dbSNP:587783882
1677 1677 a, c dbSNP:771157592
1681 1681 a, g dbSNP:776787961
1690 1690 c, t dbSNP:531372615
1696 1696 c, t dbSNP:746183321
1698 1698 c, t dbSNP:560785308
1699 1699 c, t dbSNP:776021951
1700 1700 c, t dbSNP:80358349
1712 1712 a, g dbSNP:764746811
1716 1716 a, g dbSNP:141010980
1717 1717 g, t dbSNP:546539357
1722 1722 c, t dbSNP:571300383
1723 1723 a, g dbSNP:372266009
1731 1731 a, g dbSNP:375514857
1733 1733 c, t dbSNP:764973232
1742 1742 a, g dbSNP:538985170
1750 1750 c, t dbSNP:758313905
1751 1751 a, g dbSNP:777731868
1756 1756 a, c dbSNP:751637394
1763 1763 a, g dbSNP:202230820
1765 1765 c, t dbSNP:757295271
1766 1766 a, g dbSNP:781405794
1769 1769 a, g dbSNP:746104220
1772 1772 c, t dbSNP:770142130
1778 1778 a, g dbSNP:776187516
1781 1781 a, g dbSNP:749708797
1785 1785 c, t dbSNP:587783883
1790 1790 c, g dbSNP:769279620
1794 1794 c, g dbSNP:775053765
1809 1809 a, g dbSNP:144853101
1812 1812 -, c dbSNP:34453758
1813 1813 c, t dbSNP:138765912
1824 1824 a, c dbSNP:770354010
1829 1829 a, g dbSNP:776307994
1831 1831 c, t dbSNP:200785457
1837 1837 c, t dbSNP:759134070
1838 1838 g, t dbSNP:764993497
1849 1849 a, g dbSNP:752461981
1852 1852 a, t dbSNP:536363403
1854 1854 a, c dbSNP:141937865
1860 1860 c, t dbSNP:587783884
1864 1864 g, t dbSNP:150837768
1865 1865 a, c dbSNP:374905176
1880 1880 a, t dbSNP:555179389
1885 1885 a, g dbSNP:781150294
1922 1922 a, g dbSNP:750562280
1927 1927 c, t dbSNP:756257801
1933 1933 -, gaga dbSNP:80358382
1935 1935 -, ga dbSNP:587783885
1965 1965 a, g dbSNP:587783887
1976 1976 a, g dbSNP:188309267
1995 1995 -, a dbSNP:34314728
2002 2002 -, gaaa dbSNP:587783888
2014 2014 c, g dbSNP:80358352
2028 2028 g, t dbSNP:748595346
2032 2032 a, g dbSNP:758803599
2038 2038 c, t dbSNP:778416353
2040 2040 a, g dbSNP:745359483
2041 2041 c, g dbSNP:769310563
2043 2043 a, g dbSNP:775080703
2051 2051 c, t dbSNP:748959339
2060 2060 c, t dbSNP:768342988
2064 2064 c, t dbSNP:587783889
2066 2066 a, g dbSNP:772284751
2071 2071 c, t dbSNP:574981584
2079 2079 a, g dbSNP:587783890
2080 2080 c, t dbSNP:369473705
2081 2081 a, g dbSNP:760769176
2083 2083 g, t dbSNP:138210440
2092 2092 c, t dbSNP:754066837
2097 2097 c, t dbSNP:755229018
2100 2100 c, g, t dbSNP:28638115
2102 2102 a, g, t dbSNP:372732709
2117 2117 c, t dbSNP:778086908
2128 2128 a, g dbSNP:747558873
2130 2130 a, g dbSNP:755570564
2132 2132 a, g dbSNP:779513147
2136 2136 a, g dbSNP:748832811
2140 2140 c, t dbSNP:768292156
2145 2145 c, t dbSNP:774111235
2149 2149 a, g dbSNP:747837504
2157 2157 a, g dbSNP:201051655
2160 2160 a, g dbSNP:201295325
2171 2171 a, t dbSNP:147230401
2175 2175 g, t dbSNP:760712544
2181 2181 a, g dbSNP:766468798
2189 2189 g, t dbSNP:149578437
2190 2190 a, g dbSNP:540432059
2198 2198 c, t dbSNP:374086000
2202 2202 a, c dbSNP:765367412
2209 2209 a, g dbSNP:144289137
2216 2216 a, g dbSNP:752980414
2233 2233 a, g dbSNP:763163376
2240 2240 -, tat dbSNP:776403850
2241 2241 -, a dbSNP:587783891
2263 2263 c, t dbSNP:764538711
2271 2271 a, t dbSNP:751966925
2285 2285 a, g dbSNP:140891645
2289 2289 -, a dbSNP:727503767
2295 2295 a, c dbSNP:138828510
2296 2296 a, g dbSNP:753332902
2302 2302 a, g dbSNP:754496859
2304 2304 a, c dbSNP:147532293
2320 2320 a, g dbSNP:761864879
2321 2321 a, t dbSNP:199546324
2323 2323 a, g dbSNP:200774440
2335 2335 a, c, g dbSNP:371073215
2336 2336 g, t dbSNP:747296657
2347 2347 c, t dbSNP:770988712
2363 2363 a, c dbSNP:776770380
2365 2365 a, g dbSNP:373101913
2373 2373 c, t dbSNP:587783892
2374 2374 a, g dbSNP:768964587
2379 2379 a, g, t dbSNP:142820200
2381 2381 a, g dbSNP:764259165
2384 2384 c, g dbSNP:751913459
2401 2401 a, g dbSNP:374023722
2408 2408 a, g dbSNP:530214717
2418 2418 a, g dbSNP:750933664
2424 2424 a, g dbSNP:754405649
2425 2425 a, c dbSNP:778508612
2450 2450 a, t dbSNP:776871098
2453 2453 c, g, t dbSNP:80358350
2469 2469 c, t dbSNP:746789978
2473 2473 a, g dbSNP:140100861
2474 2474 a, c dbSNP:781213650
2476 2476 a, c dbSNP:149892167
2479 2479 a, g dbSNP:375510491
2480 2480 c, t dbSNP:116049172
2484 2484 a, g dbSNP:376032121
2490 2490 a, g dbSNP:773594857
2505 2505 a, c dbSNP:75088717
2509 2509 a, g dbSNP:3822471
2522 2522 a, g dbSNP:774567810
2523 2523 a, t dbSNP:762097133
2525 2525 c, t dbSNP:200173176
2534 2534 -, a dbSNP:587783894
2544 2544 a, g dbSNP:538183552
2553 2553 a, t dbSNP:201482152
2554 2554 a, c dbSNP:766835753
2560 2560 a, g dbSNP:752248884
2569 2569 a, g dbSNP:144812404
2575 2575 c, t dbSNP:763785383
2580 2580 c, t dbSNP:550141620
2581 2581 c, g dbSNP:587783896
2585 2585 g, t dbSNP:757081951
2588 2588 c, t dbSNP:781159758
2591 2591 a, g dbSNP:745686171
2593 2593 c, t dbSNP:372162252
2595 2595 -, cc dbSNP:587783897
2596 2596 -, c dbSNP:587783898
2596 2596 c, t dbSNP:779911564
2598 2598 a, g dbSNP:146756149
2608 2608 g, t dbSNP:768620796
2616 2616 c, t dbSNP:774516564
2618 2618 c, g dbSNP:748391164
2620 2620 c, g dbSNP:772330143
2625 2625 a, g dbSNP:773534683
2631 2631 a, c, g dbSNP:765931580
2635 2635 -, aa dbSNP:727503766
2648 2648 a, g dbSNP:373925592
2649 2649 c, t dbSNP:762460698
2652 2652 a, c dbSNP:763732540
2663 2663 a, g dbSNP:751211535
2675 2675 a, t dbSNP:756935314
2676 2676 a, g dbSNP:374380375
2677 2677 a, g dbSNP:767341646
2693 2693 c, t dbSNP:750217822
2698 2698 a, g dbSNP:377186258
2707 2707 a, g dbSNP:148420552
2711 2711 a, c, g dbSNP:751048321
2712 2712 a, c dbSNP:749213303
2716 2716 a, g dbSNP:755001260
2718 2718 c, t dbSNP:370823399
2744 2744 a, g dbSNP:148075057
2748 2748 c, t dbSNP:587783899
2749 2749 g, t dbSNP:748268539
2775 2775 a, g dbSNP:772277123
2778 2778 a, c, t dbSNP:773366068
2782 2782 a, g dbSNP:185678374
2802 2802 g, t dbSNP:572898488
2803 2803 a, c dbSNP:777159279
2813 2813 a, g dbSNP:587783900
2822 2822 a, c dbSNP:759987095
2825 2825 g, t dbSNP:770475786
2826 2826 g, t dbSNP:773990755
2832 2832 c, t dbSNP:761463091
2837 2837 a, g dbSNP:141851878
2840 2840 a, g dbSNP:61755038
2860 2860 c, t dbSNP:760476489
2862 2862 c, t dbSNP:766108812
2863 2863 a, c, g dbSNP:376912534
2864 2864 g, t dbSNP:778889561
2871 2871 a, t dbSNP:752762369
2877 2877 c, t dbSNP:587783901
2878 2878 a, g dbSNP:758488035
2883 2883 a, g dbSNP:777987450
2891 2891 a, g dbSNP:747228856
2892 2892 a, g dbSNP:558749457
2910 2910 c, t dbSNP:587783902
2911 2911 a, c, g dbSNP:142574933
2924 2924 a, g dbSNP:746297367
2934 2934 c, t dbSNP:770406356
2935 2935 a, g dbSNP:80358359
2936 2936 c, t dbSNP:139177541
2939 2939 c, t dbSNP:587783903
2940 2940 c, t dbSNP:772870207
2944 2944 -, ata dbSNP:769307619
2944 2944 a, g dbSNP:753898269
2946 2946 a, g dbSNP:188564740
2949 2949 a, g dbSNP:376990497
2957 2957 a, c, g dbSNP:293756
2958 2958 g, t dbSNP:765103108
2959 2959 c, t dbSNP:587783904
2967 2967 -, ag dbSNP:398124465
2968 2968 a, g dbSNP:372453541
2971 2971 a, g dbSNP:758436782
2977 2977 c, g, t dbSNP:587783905
2982 2982 c, t dbSNP:587783906
2983 2983 a, g dbSNP:150498581
2988 2988 c, t dbSNP:587783907
2989 2989 a, g, t dbSNP:757394370
2993 2993 g, t dbSNP:587783908
2999 2999 c, g dbSNP:201163469
3002 3002 c, g, t dbSNP:746173840
3003 3003 a, g dbSNP:780665254
3010 3010 a, g dbSNP:749833499
3025 3025 c, t dbSNP:769254029
3028 3028 g, t dbSNP:772566455
3034 3034 c, g dbSNP:746596330
3037 3037 a, g dbSNP:543684890
3041 3041 a, g dbSNP:770478485
3043 3043 a, g dbSNP:776280237
3048 3048 c, g dbSNP:759261898
3064 3064 a, t dbSNP:147522427
3067 3067 a, g dbSNP:376095079
3077 3077 c, t dbSNP:775361188
3080 3080 a, t dbSNP:80358365
3085 3085 c, t dbSNP:542244170
3086 3086 a, g dbSNP:764136312
3090 3090 c, t dbSNP:398124466
3091 3091 a, g dbSNP:149629686
3094 3094 a, g dbSNP:200189574
3097 3097 a, g dbSNP:767565592
3099 3099 a, g dbSNP:144392474
3104 3104 c, t dbSNP:750703789
3110 3110 a, g dbSNP:756495812
3113 3113 g, t dbSNP:192992005
3114 3114 -, g dbSNP:398124467
3121 3121 a, g dbSNP:374308470
3125 3125 a, c dbSNP:749708811
3127 3127 a, g dbSNP:755435047
3131 3131 a, g dbSNP:200496609
3132 3132 g, t dbSNP:746447744
3142 3142 a, t dbSNP:770481159
3156 3156 c, g dbSNP:776228768
3161 3161 c, t dbSNP:376637245
3168 3168 c, t dbSNP:769488387
3169 3169 a, g dbSNP:775238155
3170 3170 c, t dbSNP:762876279
3179 3179 a, g dbSNP:763876444
3191 3191 c, t dbSNP:774346043
3198 3198 a, c dbSNP:761756303
3199 3199 -, g dbSNP:587783909
3215 3215 c, t dbSNP:148394805
3226 3226 c, t dbSNP:750577499
3230 3230 c, t dbSNP:756373027
3238 3238 a, g dbSNP:766774397
3242 3242 c, t dbSNP:780317958
3244 3244 a, g dbSNP:755384710
3246 3246 a, g dbSNP:755271349
3248 3248 c, g dbSNP:753280932
3256 3256 g, t dbSNP:200991784
3260 3260 c, t dbSNP:188565385
3261 3261 -, aa dbSNP:587783910
3267 3267 a, g dbSNP:142517671
3270 3270 a, g dbSNP:780661057
3276 3276 a, g dbSNP:745426441
3279 3279 a, g dbSNP:769437048
3285 3285 a, g dbSNP:779691362
3286 3286 c, t dbSNP:139833594
3290 3290 a, c dbSNP:748966128
3291 3291 c, t dbSNP:768524222
3320 3320 a, t dbSNP:587783911
3331 3331 a, g dbSNP:774105561
3332 3332 c, t dbSNP:761786416
3335 3335 g, t dbSNP:772174282
3344 3344 a, g dbSNP:371566938
3356 3356 c, t dbSNP:760895817
3376 3376 a, g dbSNP:200249421
3389 3389 a, c dbSNP:765533064
3390 3390 a, g dbSNP:759781764
3391 3391 -, a dbSNP:587783912
3391 3391 a, g, t dbSNP:180747605
3392 3392 a, t dbSNP:758911512
3407 3407 a, g dbSNP:778323343
3414 3414 a, g dbSNP:749926228
3419 3419 a, g dbSNP:587783913
3421 3421 c, t dbSNP:779638068
3427 3427 a, g dbSNP:748989594
3434 3434 a, g dbSNP:200018885
3450 3450 a, g dbSNP:778735646
3454 3454 c, t dbSNP:747958576
3462 3462 g, t dbSNP:772121235
3464 3464 g, t dbSNP:773295913
3468 3468 g, t dbSNP:760771193
3503 3503 a, g dbSNP:1669445
3506 3506 a, g dbSNP:776669672
3509 3509 a, g dbSNP:143369211
3512 3512 a, g dbSNP:765421145
3531 3531 -, gt dbSNP:768074630
3535 3535 g, t dbSNP:753105098
3537 3537 a, c dbSNP:146714879
3548 3548 -, agag dbSNP:587783914
3554 3554 c, t dbSNP:764513488
3570 3570 a, c dbSNP:752087990
3589 3589 a, g dbSNP:755568891
3590 3590 a, g dbSNP:765887558
3591 3591 a, c, g dbSNP:587783915
3592 3592 c, t dbSNP:368526792
3596 3596 a, g dbSNP:566411488
3597 3597 a, g dbSNP:587783916
3598 3598 a, g dbSNP:113185324
3600 3600 a, t dbSNP:747918239
3604 3604 a, g dbSNP:758273343
3611 3611 g, t dbSNP:777678265
3612 3612 a, g dbSNP:746847096
3614 3614 c, t dbSNP:757245118
3615 3615 a, g dbSNP:781054477
3629 3629 a, g, t dbSNP:368762999
3648 3648 c, g dbSNP:371836944
3656 3656 g, t dbSNP:188021705
3662 3662 a, g dbSNP:749483452
3668 3668 a, g dbSNP:768918033
3671 3671 c, t dbSNP:774686438
3690 3690 c, t dbSNP:762234061
3692 3692 c, t dbSNP:768002739
3696 3696 a, t dbSNP:773606834
3719 3719 c, t dbSNP:759037419
3729 3729 c, g dbSNP:764683974
3748 3748 a, g dbSNP:374823114
3779 3779 -, g dbSNP:34422680
3783 3783 a, g dbSNP:752294556
3784 3784 c, t dbSNP:762670218
3796 3796 c, t dbSNP:773728177
3810 3810 a, t dbSNP:587783919
3828 3828 a, g dbSNP:534319970
3835 3835 a, g dbSNP:552620284
3846 3846 c, t dbSNP:775123425
3857 3857 a, c, g dbSNP:140344071
3865 3865 a, c, g dbSNP:751266555
3875 3875 a, g dbSNP:767189407
3880 3880 c, g dbSNP:368022392
3883 3883 a, g dbSNP:755995175
3886 3886 a, g dbSNP:780034900
3888 3888 a, t dbSNP:753849710
3890 3890 a, t dbSNP:755064416
3900 3900 a, c, g dbSNP:113698799
3911 3911 a, g dbSNP:571024836
3915 3915 g, t dbSNP:772377308
3917 3917 c, t dbSNP:777976223
3921 3921 c, t dbSNP:371871116
3926 3926 c, t dbSNP:376555033
3928 3928 a, g dbSNP:587783921
3933 3933 c, t dbSNP:80358374
3941 3941 a, c, g dbSNP:150369438
3949 3949 -, ct dbSNP:587783923
3954 3954 a, g dbSNP:201512479
3963 3963 g, t dbSNP:369496238
3967 3967 -, ctc dbSNP:750517408
3969 3969 c, t dbSNP:557147929
3975 3975 c, t dbSNP:761353689
3981 3981 c, t dbSNP:540365485
4009 4009 a, g dbSNP:771559939
4014 4014 -, gaaaa dbSNP:587783925
4021 4021 a, g dbSNP:772932503
4025 4025 a, g dbSNP:544459951
4029 4029 a, c dbSNP:35748854
4030 4030 a, g dbSNP:776450648
4045 4045 a, g dbSNP:62654862
4056 4056 c, g dbSNP:759445904
4071 4071 a, g, t dbSNP:149134659
4099 4099 c, g dbSNP:762118494
4100 4100 c, t dbSNP:767920646
4103 4103 a, t dbSNP:369240129
4104 4104 -, ata dbSNP:121918266
4104 4104 a, g dbSNP:587783929
4118 4118 a, g dbSNP:372752190
4121 4121 c, t dbSNP:370889560
4135 4135 c, t dbSNP:756562931
4148 4148 a, g dbSNP:143252734
4154 4154 -, tga dbSNP:772674746
4156 4156 a, g dbSNP:775247210
4162 4162 a, g dbSNP:762912820
4163 4163 a, t dbSNP:768536990
4175 4175 a, g dbSNP:774573086
4178 4178 a, c dbSNP:761991838
4225 4225 c, g dbSNP:121918268
4257 4257 c, t dbSNP:753222256
4265 4265 c, t dbSNP:756713894
4273 4273 c, t dbSNP:766979302
4276 4276 -, tg dbSNP:587783930
4281 4281 a, g dbSNP:749981341
4292 4292 -, cttggagaagaatat dbSNP:587783931
4306 4306 g, t dbSNP:587783932
4314 4314 g, t dbSNP:755790180
4328 4328 c, t dbSNP:139137985
4329 4329 a, g dbSNP:749056969
4333 4333 c, t dbSNP:754755185
4339 4339 a, g dbSNP:143152112
4349 4349 c, t dbSNP:531615496
4350 4350 a, g dbSNP:758404835
4354 4354 -, ctga dbSNP:587783934
4356 4356 -, gaa dbSNP:773996562
4356 4356 a, g dbSNP:587783935
4361 4361 a, g dbSNP:777857860
4362 4362 g, t dbSNP:587783936
4365 4365 a, g dbSNP:747050519
4382 4382 c, g dbSNP:770936588
4385 4385 c, t dbSNP:80358354
4389 4389 a, t dbSNP:746043422
4404 4404 a, c dbSNP:770047320
4412 4412 a, g dbSNP:367925827
4417 4417 c, g dbSNP:763315761
4425 4425 a, g dbSNP:769095978
4427 4427 a, t dbSNP:774746577
4428 4428 a, g dbSNP:760196234
4431 4431 a, g dbSNP:563606953
4436 4436 c, t dbSNP:753438136
4455 4455 a, g dbSNP:758528908
4458 4458 c, t dbSNP:765051194
4478 4478 c, g dbSNP:376434880
4499 4499 a, t dbSNP:111521307
4503 4503 -, aaa dbSNP:761307264
4505 4505 a, c dbSNP:587783938
4507 4507 c, g dbSNP:752472468
4508 4508 c, t dbSNP:758279525
4513 4513 a, t dbSNP:776386128
4529 4529 a, g dbSNP:373206831
4533 4533 c, t dbSNP:770223945
4576 4576 a, g dbSNP:772696266
4578 4578 a, g dbSNP:372080833
4586 4586 -, aagt dbSNP:587783940
4587 4587 a, g dbSNP:113779525
4612 4612 c, g dbSNP:759120298
4621 4621 a, g dbSNP:764922800
4631 4631 -, ag dbSNP:587783941
4631 4631 a, g dbSNP:112616049
4649 4649 c, t dbSNP:752419634
4652 4652 c, t dbSNP:762796601
4692 4692 c, g dbSNP:61755039
4694 4694 a, g dbSNP:751416634
4698 4698 a, c dbSNP:79598279
4700 4700 a, g dbSNP:567328110
4715 4715 a, g dbSNP:757125850
4733 4733 a, c dbSNP:138440449
4763 4763 -, aaatgtcagtgaa dbSNP:587783944
4764 4764 a, g dbSNP:761684520
4773 4773 -, gaactacagt dbSNP:80358386
4778 4778 a, g dbSNP:767311814
4803 4803 a, g dbSNP:756050354
4805 4805 g, t dbSNP:746550826
4809 4809 a, g, t dbSNP:727503769
4823 4823 c, t dbSNP:767317539
4826 4826 a, g dbSNP:773043534
4832 4832 c, t dbSNP:760594320
4840 4840 c, t dbSNP:201882678
4850 4850 a, g dbSNP:370422740
4862 4862 g, t dbSNP:749296628
4868 4868 c, t dbSNP:765326455
4889 4889 a, g dbSNP:752992906
4894 4894 a, g dbSNP:758588654
4909 4909 c, g dbSNP:587783947
4910 4910 g, t dbSNP:80358358
4924 4924 a, t dbSNP:141956774
4927 4927 g, t dbSNP:587783948
4930 4930 a, t dbSNP:776570810
4937 4937 a, g dbSNP:759492239
4938 4938 c, t dbSNP:765328819
4941 4941 a, g dbSNP:764009294
4944 4944 c, t dbSNP:763219578
4981 4981 c, t dbSNP:199570957
4999 4999 a, t dbSNP:80358369
5001 5001 c, g dbSNP:377211455
5023 5023 a, t dbSNP:587783949
5028 5028 a, g dbSNP:536320603
5031 5031 g, t dbSNP:587783950
5038 5038 c, t dbSNP:751902505
5043 5043 -, aaa dbSNP:754929654
5055 5055 c, g dbSNP:762169826
5058 5058 a, g dbSNP:767975743
5064 5064 c, g dbSNP:377716907
5066 5066 c, t dbSNP:756639524
5072 5072 c, t dbSNP:539180409
5077 5077 c, t dbSNP:766801991
5081 5081 g, t dbSNP:587783952
5094 5094 c, t dbSNP:121918269
5104 5104 a, g dbSNP:752195607
5114 5114 c, t dbSNP:757927629
5123 5123 c, t dbSNP:777362486
5124 5124 -, c dbSNP:587783953
5138 5138 a, c, t dbSNP:760960982
5140 5140 a, c, g dbSNP:754335963
5144 5144 a, g dbSNP:763571035
5151 5151 -, g dbSNP:587783955
5162 5162 c, t dbSNP:587783956
5166 5166 c, t dbSNP:150683463
5171 5171 c, g dbSNP:756897581
5172 5172 -, tttg dbSNP:587783957
5187 5187 a, c dbSNP:780708835
5200 5200 a, c, t dbSNP:77632238
5201 5201 a, g dbSNP:745615007
5212 5212 a, c dbSNP:755880602
5213 5213 a, g dbSNP:779999171
5214 5214 a, c dbSNP:749218502
5219 5219 a, g dbSNP:140021654
5228 5228 c, t dbSNP:774573141
5231 5231 a, t dbSNP:186417615
5261 5261 g, t dbSNP:587783958
5276 5276 c, t dbSNP:753756758
5281 5281 a, g dbSNP:374279126
5289 5289 a, g dbSNP:779007826
5294 5294 -, ga dbSNP:80358372
5306 5306 -, ag dbSNP:587783959
5315 5315 c, t dbSNP:112128017
5337 5337 a, g dbSNP:748190130
5344 5344 a, g dbSNP:772077115
5345 5345 a, c, g dbSNP:777950633
5349 5349 a, g dbSNP:62654861
5371 5371 a, g dbSNP:771241543
5372 5372 a, c dbSNP:776975871
5388 5388 a, g dbSNP:759899214
5394 5394 c, t dbSNP:149451089
5420 5420 c, g dbSNP:747179198
5447 5447 a, g dbSNP:145952190
5448 5448 a, g dbSNP:781402189
5454 5454 c, t dbSNP:746181669
5455 5455 g, t dbSNP:770173799
5460 5460 c, t dbSNP:775870451
5474 5474 c, t dbSNP:754312670
5498 5498 a, g dbSNP:769274211
5504 5504 c, t dbSNP:776332291
5506 5506 a, g dbSNP:770286768
5515 5515 a, g dbSNP:559139612
5521 5521 -, cccagtg dbSNP:587783960
5539 5539 a, c dbSNP:774109272
5540 5540 a, g dbSNP:765047071
5542 5542 c, t dbSNP:775077572
5544 5544 c, t dbSNP:762816601
5551 5551 c, t dbSNP:763888888
5555 5555 a, g dbSNP:751545774
5573 5573 a, g dbSNP:545623030
5575 5575 a, g dbSNP:757224529
5589 5589 c, t dbSNP:139819353
5601 5601 c, t dbSNP:750570299
5604 5604 c, g dbSNP:575973361
5606 5606 c, t dbSNP:780337526
5625 5625 a, g dbSNP:749567855
5641 5641 a, g dbSNP:755405307
5646 5646 a, g dbSNP:779189164
5655 5655 c, t dbSNP:121918267
5662 5662 -, a dbSNP:587783961
5663 5663 a, g dbSNP:143222832
5670 5670 a, g dbSNP:772765625
5672 5672 a, t dbSNP:780843089
5676 5676 a, g dbSNP:745372802
5679 5679 a, g dbSNP:769510161
5683 5683 a, g dbSNP:775226349
5685 5685 a, t dbSNP:762616275
5686 5686 c, t dbSNP:200053064
5695 5695 c, t dbSNP:774062619
5698 5698 a, g dbSNP:761724507
5699 5699 a, g dbSNP:587783962
5700 5700 -, t dbSNP:730880331
5715 5715 a, g dbSNP:771949637
5718 5718 a, t dbSNP:773164199
5729 5729 c, g, t dbSNP:775399549
5733 5733 a, g dbSNP:528213483
5737 5737 a, g, t dbSNP:374265736
5742 5742 a, g dbSNP:765379536
5760 5760 a, c dbSNP:587783965
5762 5762 a, g dbSNP:753050851
5783 5783 a, g dbSNP:758853244
5794 5794 a, g dbSNP:778380312
5815 5815 a, t dbSNP:587783966
5818 5818 g, t dbSNP:587783970
5822 5822 a, g dbSNP:144979877
5823 5823 c, t dbSNP:587783971
5853 5853 c, t dbSNP:587783972
5854 5854 a, g dbSNP:80358380
5858 5858 a, g dbSNP:765446922
5863 5863 c, t dbSNP:775881994
5866 5866 g, t dbSNP:483353060
5877 5877 -, tctg dbSNP:587783973
5886 5886 a, g dbSNP:763307074
5901 5901 a, c dbSNP:771869795
5912 5912 a, g dbSNP:752026879
5928 5928 c, t dbSNP:80358362
5943 5943 c, t dbSNP:587783975
5944 5944 a, g dbSNP:80358366
5952 5952 g, t dbSNP:587783976
5953 5953 a, g dbSNP:587783977
5955 5955 a, c dbSNP:750864821
5960 5960 a, g dbSNP:369177620
5970 5970 c, g, t dbSNP:62654864
5971 5971 a, g dbSNP:587783978
5999 5999 a, g dbSNP:146702130
6013 6013 a, g dbSNP:148446678
6019 6019 a, g dbSNP:757982626
6024 6024 a, g dbSNP:777413835
6028 6028 a, t dbSNP:751316937
6038 6038 c, t dbSNP:757029751
6054 6054 a, g dbSNP:80358373
6059 6059 a, t dbSNP:781077369
6071 6071 c, t dbSNP:112125562
6119 6119 c, t dbSNP:369235309
6129 6129 a, g dbSNP:376084993
6171 6171 a, c dbSNP:562826277
6178 6178 a, g dbSNP:190086412
6200 6200 a, g dbSNP:545834258
6203 6203 a, g dbSNP:569762677
6220 6220 a, c dbSNP:587783982
6236 6236 c, t dbSNP:748268175
6240 6240 a, g dbSNP:199639172
6248 6248 c, t dbSNP:778081443
6250 6250 a, g dbSNP:587783983
6260 6260 a, c dbSNP:771252680
6269 6269 a, g dbSNP:142635202
6271 6271 a, g dbSNP:746357461
6274 6274 a, g dbSNP:374294679
6289 6289 c, t dbSNP:773668251
6290 6290 c, t dbSNP:761398208
6302 6302 a, g dbSNP:375622324
6308 6308 c, t dbSNP:772917259
6316 6316 c, g dbSNP:368584228
6322 6322 a, g dbSNP:766136878
6344 6344 a, t dbSNP:776513362
6350 6350 c, t dbSNP:759401891
6353 6353 a, g dbSNP:370179049
6362 6362 c, t dbSNP:61748200
6380 6380 c, t dbSNP:776458092
6394 6394 a, c dbSNP:759154614
6403 6403 c, t dbSNP:769605459
6407 6407 a, g dbSNP:375694876
6411 6411 g, t dbSNP:587783986
6412 6412 -, ttg dbSNP:587783987
6419 6419 c, t dbSNP:200548405
6432 6432 a, c dbSNP:370593530
6456 6456 a, g dbSNP:764022167
6467 6467 c, t dbSNP:761030463
6469 6469 a, g dbSNP:368028754
6525 6525 a, c dbSNP:587783989
6545 6545 c, t dbSNP:140907869
6555 6555 a, c dbSNP:587783990
6556 6556 a, g dbSNP:587783991
6559 6559 a, c, t dbSNP:587783992
6560 6560 a, g dbSNP:745516748
6595 6595 a, g dbSNP:769397450
6599 6599 a, g dbSNP:755732764
6612 6612 a, g dbSNP:779592620
6625 6625 a, g dbSNP:749041461
6628 6628 c, t dbSNP:768408469
6633 6633 a, g dbSNP:587783996
6635 6635 a, g dbSNP:774190237
6646 6646 c, t dbSNP:587783997
6658 6658 c, t dbSNP:587783998
6665 6665 a, g dbSNP:748074172
6669 6669 c, g dbSNP:772003089
6670 6670 c, t dbSNP:587783999
6677 6677 a, t dbSNP:773286952
6687 6687 g, t dbSNP:760694971
6697 6697 -, g dbSNP:34512595
6704 6704 c, t dbSNP:766586011
6707 6707 a, c, g, t dbSNP:149769284
6719 6719 c, t dbSNP:376800486
6730 6730 g, t dbSNP:587784000
6738 6738 g, t dbSNP:587784002
6754 6754 g, t dbSNP:587784003
6800 6800 a, g dbSNP:147865925
6804 6804 c, g dbSNP:587784004
6805 6805 -, tgtg dbSNP:587784005
6810 6810 a, g dbSNP:587784006
6820 6820 a, g dbSNP:374645420
6831 6831 a, g dbSNP:587784007
6850 6850 -, aaa dbSNP:587784008
6852 6852 a, g dbSNP:768026341
6857 6857 a, g dbSNP:369295272
6877 6877 a, g dbSNP:759079809
6878 6878 c, t dbSNP:141545751
6887 6887 c, t dbSNP:752327065
6888 6888 c, t dbSNP:372730081
6890 6890 a, g dbSNP:777430704
6926 6926 c, t dbSNP:376448686
6927 6927 a, g dbSNP:757080818
6943 6943 a, g dbSNP:781297222
6966 6966 g, t dbSNP:147054690
6987 6987 a, g dbSNP:750862610
7022 7022 c, g dbSNP:774665042
7031 7031 a, g dbSNP:138404850
7045 7045 a, g dbSNP:398124469
7053 7053 c, t dbSNP:587784013
7056 7056 a, g dbSNP:587784014
7059 7059 a, t dbSNP:587784015
7064 7064 c, t dbSNP:759147525
7078 7078 a, g dbSNP:587784017
7085 7085 c, t dbSNP:773628266
7094 7094 a, g dbSNP:544147349
7101 7101 a, g, t dbSNP:587784018
7112 7112 c, t dbSNP:371380435
7113 7113 a, g dbSNP:763610468
7119 7119 g, t dbSNP:80358363
7120 7120 -, aag dbSNP:587784019
7129 7129 -, atctata dbSNP:80358361
7133 7133 a, g dbSNP:149186951
7134 7134 c, t dbSNP:587784020
7136 7136 -, ta dbSNP:587784021
7140 7140 a, g dbSNP:761605563
7141 7141 -, ata dbSNP:587784022
7145 7145 c, t dbSNP:767406866
7162 7162 c, t dbSNP:750309699
7163 7163 c, t dbSNP:756057442
7172 7172 c, t dbSNP:766363037
7189 7189 g, t dbSNP:727504047
7193 7193 a, g dbSNP:753822274
7195 7195 a, t dbSNP:587784023
7211 7211 a, g dbSNP:187845879
7214 7214 a, g dbSNP:201215377
7228 7228 a, g dbSNP:752953852
7235 7235 a, g dbSNP:200322289
7283 7283 a, t dbSNP:781461880
7295 7295 c, t dbSNP:746375194
7301 7301 c, t dbSNP:770272272
7307 7307 a, g dbSNP:778420641
7323 7323 a, g dbSNP:747682655
7334 7334 c, t dbSNP:372139946
7367 7367 c, t dbSNP:772966461
7369 7369 a, g dbSNP:760452129
7376 7376 c, t dbSNP:201968259
7380 7380 c, g, t dbSNP:80358376
7381 7381 a, g dbSNP:587784024
7382 7382 c, t dbSNP:58424791
7392 7392 c, t dbSNP:770744719
7396 7396 a, g dbSNP:776353314
7423 7423 g, t dbSNP:587784025
7440 7440 c, t dbSNP:587784026
7451 7451 a, g dbSNP:762930515
7476 7476 c, g dbSNP:764147606
7479 7479 c, g dbSNP:774483696
7481 7481 a, g dbSNP:587784028
7488 7488 a, g dbSNP:751872913
7489 7489 c, t dbSNP:762029831
7493 7493 a, g dbSNP:767647337
7499 7499 -, gg dbSNP:587784029
7500 7500 c, g dbSNP:587784030
7502 7502 a, t dbSNP:750760089
7507 7507 a, t dbSNP:537134096
7511 7511 a, g dbSNP:781090000
7512 7512 c, t dbSNP:587784031
7524 7524 c, g dbSNP:754381730
7526 7526 c, t dbSNP:755606647
7535 7535 c, g, t dbSNP:398124470
7545 7545 a, g dbSNP:746511205
7565 7565 c, t dbSNP:765858277
7568 7568 g, t dbSNP:751036660
7585 7585 a, g dbSNP:528591545
7590 7590 c, t dbSNP:587784033
7594 7594 -, a dbSNP:587784034
7599 7599 a, g dbSNP:143355392
7605 7605 a, g dbSNP:369258718
7606 7606 c, t dbSNP:373666652
7607 7607 a, g dbSNP:779759181
7612 7612 g, t dbSNP:749095617
7617 7617 c, g dbSNP:200641062
7620 7620 c, g dbSNP:778747295
7629 7629 a, g dbSNP:587784035
7637 7637 a, g dbSNP:148375273
7643 7643 c, t dbSNP:772030142
7652 7652 a, c, t dbSNP:773405443
7654 7654 g, t dbSNP:371336448
7656 7656 a, g dbSNP:587784036
7661 7661 g, t dbSNP:777083356
7676 7676 c, t dbSNP:760006591
7686 7686 -, c dbSNP:587784037
7687 7687 a, g dbSNP:765741574
7690 7690 a, g dbSNP:78798978
7693 7693 -, c dbSNP:150935361
7700 7700 a, g dbSNP:753125341
7707 7707 c, t dbSNP:398124471
7723 7723 c, g dbSNP:763576119
7732 7732 a, g dbSNP:766934075
7758 7758 a, g dbSNP:750525831
7759 7759 c, t dbSNP:185745349
7763 7763 a, c, g dbSNP:143420538
7764 7764 a, g dbSNP:752391534
7766 7766 c, t dbSNP:146395325
7771 7771 a, g dbSNP:763839941
7772 7772 a, g dbSNP:751532481
7780 7780 -, ga dbSNP:587784043
7795 7795 c, g dbSNP:377715840
7801 7801 a, g dbSNP:781356422
7802 7802 a, c dbSNP:370397088
7803 7803 a, g dbSNP:756243240
7814 7814 c, t dbSNP:780356036
7815 7815 a, g dbSNP:749512949
7821 7821 -, gaa dbSNP:765215110
7823 7823 a, t dbSNP:769043360
7824 7824 a, g dbSNP:774763777
7826 7826 a, g dbSNP:748587506
7828 7828 a, t dbSNP:758391131
7829 7829 a, t dbSNP:780388411
7830 7830 g, t dbSNP:759115050
7840 7840 c, t dbSNP:769223635
7843 7843 a, g dbSNP:775181656
7847 7847 c, g dbSNP:762573705
7851 7851 c, t dbSNP:763980419
7852 7852 a, g dbSNP:578001374
7858 7858 a, g dbSNP:761787560
7861 7861 -, agattc dbSNP:762768404
7862 7862 -, agattc dbSNP:773170822
7883 7883 -, ttcaga dbSNP:587784044
7885 7885 c, t dbSNP:767586775
7890 7890 a, g dbSNP:189670249
7894 7894 a, g dbSNP:756187678
7897 7897 c, t dbSNP:780046822
7904 7904 a, g dbSNP:754086108
7910 7910 g, t dbSNP:755159074
7927 7927 a, g dbSNP:375928290
7934 7934 c, t dbSNP:113072270
7943 7943 c, t dbSNP:398124472
7952 7952 a, g dbSNP:772525236
7953 7953 a, g dbSNP:778219424
7954 7954 a, g dbSNP:747514959
7957 7957 c, t dbSNP:769331331
7966 7966 a, g dbSNP:587784045
7978 7978 c, t dbSNP:727503772
7980 7980 a, c dbSNP:774934420
7982 7982 c, t dbSNP:587784046
8042 8042 -, ctctccatctgaatctgcaaaagta dbSNP:587784047
8044 8044 c, g dbSNP:768384647
8060 8060 a, c dbSNP:774117227
8066 8066 a, g dbSNP:747852202
8068 8068 a, g dbSNP:80358351
8069 8069 c, t dbSNP:371347218
8077 8077 c, t dbSNP:148519494
8078 8078 a, g dbSNP:760603031
8079 8079 a, g dbSNP:191164620
8085 8085 a, c dbSNP:776731706
8089 8089 a, g dbSNP:759578329
8095 8095 a, g dbSNP:765346062
8098 8098 g, t dbSNP:752901099
8099 8099 g, t dbSNP:758683339
8114 8114 a, g dbSNP:371073065
8117 8117 a, g dbSNP:751886314
8121 8121 c, g dbSNP:757737158
8130 8130 -, c dbSNP:80358368
8134 8134 a, g dbSNP:199508078
8142 8142 a, g dbSNP:759275114
8147 8147 -, t dbSNP:80358371
8148 8148 a, t dbSNP:138514909
8155 8155 a, g dbSNP:754514853
8163 8163 a, g dbSNP:778625623
8168 8168 a, g dbSNP:747799106
8171 8171 c, g dbSNP:115668015
8190 8190 c, t dbSNP:587784050
8198 8198 a, g dbSNP:773008376
8206 8206 a, g dbSNP:746720769
8213 8213 c, t dbSNP:146209296
8234 8234 -, gaa dbSNP:752183727
8235 8235 -, gaa dbSNP:757786513
8241 8241 -, gaagaagaaggggaggtttcagctagcacaaatgctcg dbSNP:727503771
8249 8249 a, g dbSNP:781105857
8253 8253 a, g dbSNP:745734788
8265 8265 a, g dbSNP:769740056
8266 8266 a, g dbSNP:775502170
8295 8295 g, t dbSNP:370961382
8336 8336 a, c dbSNP:768824556
8340 8340 a, g dbSNP:201996196
8345 8345 a, t dbSNP:373944245
8348 8348 c, t dbSNP:774414570
8360 8360 c, t dbSNP:762153846
8366 8366 a, g dbSNP:757955910
8410 8410 a, g dbSNP:761090361
8425 8425 c, t dbSNP:766898203
8426 8426 a, g dbSNP:201036501
8438 8438 a, g dbSNP:570203387
8459 8459 c, t dbSNP:763443745
8460 8460 c, g dbSNP:747960326
8464 8464 c, g, t dbSNP:147110911
8474 8474 c, t dbSNP:780857060
8478 8478 a, c dbSNP:750120861
8494 8494 a, g dbSNP:755884239
8506 8506 -, cacaaattgcaagagtagt dbSNP:587784052
8507 8507 a, g dbSNP:727504048
8513 8513 -, t dbSNP:56110022
8514 8514 c, g dbSNP:587784053
8533 8533 c, g dbSNP:779883508
8559 8559 a, c dbSNP:749178582
8566 8566 g, t dbSNP:587784054
8574 8574 a, c dbSNP:754949542
8591 8591 a, g dbSNP:778802387
8598 8598 c, t dbSNP:186140730
8604 8604 a, g dbSNP:748290328
8614 8614 a, g dbSNP:772317129
8618 8618 -, ggtgcct dbSNP:587784055
8621 8621 a, g dbSNP:773545402
8634 8634 a, g dbSNP:747292472
8637 8637 a, g dbSNP:771413945
8641 8641 -, aa dbSNP:587784056
8642 8642 a, g dbSNP:777136404
8652 8652 a, g dbSNP:759899081
8654 8654 c, t dbSNP:765799258
8670 8670 g, t dbSNP:200872976
8677 8677 c, t dbSNP:587784057
8678 8678 a, g, t dbSNP:139108785
8691 8691 a, c dbSNP:750063692
8696 8696 c, t dbSNP:755832194
8718 8718 c, t dbSNP:398124474
8723 8723 c, t dbSNP:766097454
8726 8726 c, g dbSNP:753681684
8749 8749 c, g dbSNP:587784058
8752 8752 c, g dbSNP:199865449
8755 8755 a, g dbSNP:778876578
8779 8779 g, t dbSNP:368337347
8788 8788 a, t dbSNP:758539444
8800 8800 a, g dbSNP:202141454
8804 8804 a, g dbSNP:747157787
8810 8810 c, t dbSNP:535124662
8814 8814 a, t dbSNP:553340093
8831 8831 -, a dbSNP:553794254
8840 8840 -, a dbSNP:587783876
8876 8876 -, g dbSNP:34031034
8907 8907 a, t dbSNP:565669720
8926 8926 c, t dbSNP:773330481
8943 8943 a, g dbSNP:539494562
8951 8951 c, t dbSNP:3207732
8971 8971 a, c dbSNP:1065156
8983 8983 c, t dbSNP:763005114
9020 9020 c, t dbSNP:189382158
9036 9036 -, aaac dbSNP:535770794
9065 9065 -, a dbSNP:750914257
9090 9090 a, g dbSNP:181989563
9107 9107 a, g dbSNP:185780527
9112 9112 c, g dbSNP:555746936
9139 9139 a, g dbSNP:770949694
9153 9153 c, t dbSNP:573975118
9178 9178 -, t dbSNP:33999028
9204 9204 a, g dbSNP:74640019
9205 9205 -, a dbSNP:768908921
9205 9205 a, g dbSNP:78168072
9211 9211 a, c dbSNP:555727011
9230 9230 a, g dbSNP:541473248
9297 9297 c, t dbSNP:775433800
9307 9307 c, g dbSNP:760747084
9362 9362 -, tt dbSNP:758917129
9378 9378 c, t dbSNP:559677890
9399 9399 -, a dbSNP:35132212
9404 9404 a, c dbSNP:544288062
9645 9645 c, t dbSNP:190661162
9676 9676 a, g dbSNP:575588206
9678 9678 a, t dbSNP:545449231

Target ORF information:

RefSeq Version XM_006714467
Organism Homo sapiens (human)
Definition PREDICTED: Homo sapiens Nipped-B homolog (Drosophila) (NIPBL), transcript variant X1, mRNA.

Target ORF information:

Bacterial selection AMPR
Mammalian selection NeoR
Vector pcDNA3.1-C-(k)DYK

ORF Insert Sequence:


The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.

CloneID OHu39307D
Sequence Information ORF Nucleotide Sequence (Length: 8217bp)
Protein sequence
Vector pcDNA3.1-C-(k)DYK or customized vector
Clone information Clone Map
Tag on pcDNA3.1-C-(k)DYK C terminal DYKDDDDK tags
ORF Insert Method CloneEZ® Seamless cloning technology
Structure linear
Update Date 12-MAR-2015
Organism Homo sapiens (human)
Product nipped-B-like protein isoform X2
Comment MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_006576.17) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 107 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 6.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END##

The stop codons will be deleted if pcDNA3.1-C-(k)DYK vector is selected.
Misc Feature(1)5670..5795(+)
Misc Feature(2)7110..7661(+)
Position Chain Variation Link
30 30 a, g dbSNP:373316900
54 54 c, t dbSNP:555162591
55 55 -, c dbSNP:376839773
156 156 c, t dbSNP:201682335
168 168 a, cc dbSNP:724159980
177 177 a, t dbSNP:540966156
182 182 c, t dbSNP:377354585
190 190 c, t dbSNP:577250117
246 246 a, c dbSNP:544681871
272 272 g, t dbSNP:538879560
330 330 -, c dbSNP:567891305
334 334 c, g dbSNP:563016602
335 335 a, c, g dbSNP:558867335
340 340 c, t dbSNP:760514809
356 356 c, t dbSNP:539146812
371 371 c, t dbSNP:768471026
381 381 c, t dbSNP:557864476
390 390 c, t dbSNP:1494625
411 411 g, t dbSNP:774378633
420 420 a, g dbSNP:759332784
448 448 a, t dbSNP:780575072
451 451 a, g dbSNP:747655593
455 455 a, g dbSNP:771632892
460 460 c, t dbSNP:772796853
464 464 c, g dbSNP:760252451
465 465 a, g dbSNP:770720531
468 468 a, g dbSNP:776315178
470 470 a, g, t dbSNP:759424370
471 471 c, g dbSNP:752738480
476 476 a, c dbSNP:763068661
490 490 a, t dbSNP:121918264
491 491 g, t dbSNP:587783937
502 502 g, t dbSNP:764272515
530 530 a, g dbSNP:727504045
533 533 c, g dbSNP:757439561
558 558 a, g dbSNP:775499754
574 574 -, c dbSNP:587784060
575 575 a, g dbSNP:587784061
591 591 a, g dbSNP:763015442
599 599 a, g dbSNP:576203422
611 611 c, t dbSNP:774269226
614 614 c, t dbSNP:727504046
621 621 c, t dbSNP:80358367
633 633 g, t dbSNP:587783886
638 638 a, g dbSNP:767626703
656 656 c, t dbSNP:750719198
657 657 a, g dbSNP:539552810
658 658 c, g dbSNP:756415457
664 664 a, g dbSNP:766738333
667 667 a, g dbSNP:142703446
677 677 a, c dbSNP:755503212
680 680 c, g dbSNP:769022116
680 680 -, g dbSNP:80358364
686 686 c, g dbSNP:146033170
689 689 -, tagcctcaacca dbSNP:587783893
692 692 c, t dbSNP:746472461
693 693 c, g dbSNP:776899302
694 694 c, t dbSNP:587783895
698 698 a, c dbSNP:756859262
699 699 c, g dbSNP:780649689
713 713 c, t dbSNP:745537254
716 716 c, g dbSNP:74401909
717 717 a, g dbSNP:376938430
738 738 a, g dbSNP:369249480
743 743 c, t dbSNP:765659128
750 750 c, t dbSNP:753307330
752 752 a, g dbSNP:750048518
762 762 a, g dbSNP:373268240
763 763 c, t dbSNP:780783113
765 765 c, t dbSNP:750047678
782 782 c, t dbSNP:142184978
783 783 a, g dbSNP:779888500
785 785 c, t dbSNP:749086242
788 788 a, g dbSNP:768550843
794 794 g, t dbSNP:778661285
796 796 c, g dbSNP:748123160
798 798 -, cctaatgt dbSNP:587783917
798 798 c, g dbSNP:772009624
800 800 c, t dbSNP:773368185
801 801 a, g dbSNP:376768802
809 809 c, g dbSNP:771111681
813 813 c, g dbSNP:537093279
820 820 a, g dbSNP:587783920
821 821 c, t dbSNP:199569761
827 827 a, g dbSNP:759882900
833 833 a, g dbSNP:587783922
873 873 c, t dbSNP:141976717
888 888 c, t dbSNP:752506384
891 891 a, g dbSNP:758194241
897 897 c, t dbSNP:777676457
898 898 c, g dbSNP:746963911
900 900 c, g dbSNP:757285737
901 901 c, t dbSNP:781270385
909 909 a, g dbSNP:745983858
916 916 a, c dbSNP:770025507
934 934 a, t dbSNP:775638112
939 939 c, t dbSNP:775486487
941 941 c, t dbSNP:769152836
944 944 -, c dbSNP:587783951
944 944 c, t dbSNP:577987003
948 948 a, c, t dbSNP:139514413
949 949 a, g dbSNP:200692598
950 950 c, g dbSNP:769203117
954 954 a, g dbSNP:146321563
961 961 c, t dbSNP:762615203
967 967 c, g dbSNP:763783306
971 971 c, t dbSNP:536895037
1007 1007 a, g dbSNP:761663409
1010 1010 g, t dbSNP:767425012
1016 1016 c, t dbSNP:750337367
1017 1017 c, t dbSNP:576458890
1019 1019 a, g dbSNP:780026320
1021 1021 a, t dbSNP:754045462
1022 1022 c, t dbSNP:148542094
1023 1023 a, g dbSNP:142923613
1026 1026 c, t dbSNP:748523012
1047 1047 a, g dbSNP:372605856
1052 1052 a, g dbSNP:778285743
1073 1073 c, g dbSNP:80358360
1074 1074 a, g dbSNP:747476219
1086 1086 c, g, t dbSNP:587783988
1090 1090 c, t dbSNP:774838495
1092 1092 c, g dbSNP:762487890
1102 1102 c, t dbSNP:576532771
1103 1103 a, g dbSNP:150678035
1104 1104 a, g dbSNP:772863009
1106 1106 a, g dbSNP:760562029
1114 1114 c, t dbSNP:766225351
1139 1139 c, t dbSNP:776772068
1151 1151 c, t dbSNP:759632105
1159 1159 c, t dbSNP:376219060
1165 1165 c, t dbSNP:562557528
1166 1166 a, g, t dbSNP:192822119
1172 1172 c, t dbSNP:111957845
1177 1177 a, g dbSNP:369282785
1185 1185 a, g dbSNP:727504038
1186 1186 -, atcatc dbSNP:779093227
1188 1188 c, t dbSNP:541789068
1192 1192 a, g dbSNP:757697960
1196 1196 g, t dbSNP:139894113
1225 1225 a, g dbSNP:587784042
1236 1236 a, g dbSNP:746374055
1237 1237 g, t dbSNP:754441425
1247 1247 g, t dbSNP:778413684
1256 1256 c, t dbSNP:747703764
1259 1259 c, t dbSNP:771594948
1261 1261 a, t dbSNP:757986074
1262 1262 a, t dbSNP:777233920
1269 1269 g, t dbSNP:16903425
1273 1273 c, t dbSNP:147963155
1278 1278 a, g dbSNP:781159621
1283 1283 a, g dbSNP:560445654
1285 1285 a, t dbSNP:141927128
1292 1292 a, g dbSNP:144238532
1310 1310 c, t dbSNP:200429152
1316 1316 a, g dbSNP:145501067
1317 1317 c, t dbSNP:762880452
1320 1320 a, g dbSNP:768781698
1322 1322 a, g, t dbSNP:377714862
1323 1323 c, t dbSNP:767774437
1324 1324 a, g dbSNP:754508684
1326 1326 g, t dbSNP:766956935
1336 1336 a, g dbSNP:766858952
1342 1342 a, g dbSNP:754382888
1345 1345 a, g dbSNP:148862607
1350 1350 a, c dbSNP:546188623
1351 1351 c, t dbSNP:777377733
1367 1367 a, c dbSNP:760114555
1368 1368 c, t dbSNP:765716048
1379 1379 a, c dbSNP:373684382
1380 1380 -, c dbSNP:587784063
1380 1380 c, t dbSNP:587784062
1381 1381 a, t dbSNP:756882182
1382 1382 a, g dbSNP:587784064
1390 1390 c, g, t dbSNP:780931147
1392 1392 c, g dbSNP:755928572
1402 1402 a, c dbSNP:727503770
1403 1403 a, g dbSNP:555224277
1410 1410 c, t dbSNP:587784065
1415 1415 c, t dbSNP:749085513
1429 1429 c, t dbSNP:368151265
1430 1430 c, t dbSNP:778781695
1436 1436 a, g dbSNP:201213428
1446 1446 a, g dbSNP:748215385
1449 1449 a, c dbSNP:138720101
1451 1451 a, g dbSNP:773356740
1476 1476 a, g dbSNP:747262673
1480 1480 c, t dbSNP:577606629
1491 1491 c, g dbSNP:777034854
1491 1491 -, g dbSNP:587783877
1499 1499 a, g dbSNP:759860290
1506 1506 a, g dbSNP:765758628
1507 1507 a, g dbSNP:111963024
1514 1514 a, g dbSNP:370389105
1521 1521 -, tatg dbSNP:587783878
1544 1544 c, t dbSNP:200440893
1545 1545 a, t dbSNP:587783879
1564 1564 a, c dbSNP:752690806
1565 1565 a, g dbSNP:767162047
1574 1574 -, tt dbSNP:587783880
1592 1592 a, c dbSNP:750047694
1595 1595 c, t dbSNP:755805311
1596 1596 a, g dbSNP:765985686
1599 1599 a, g dbSNP:530539139
1624 1624 g, t dbSNP:368272080
1632 1632 a, g dbSNP:778853918
1638 1638 a, g dbSNP:587783881
1639 1639 a, g dbSNP:2291703
1650 1650 a, t dbSNP:758432898
1652 1652 c, t dbSNP:768113851
1657 1657 c, t dbSNP:747144008
1666 1666 a, g dbSNP:777670369
1671 1671 c, t dbSNP:587783882
1677 1677 a, c dbSNP:771157592
1681 1681 a, g dbSNP:776787961
1690 1690 c, t dbSNP:531372615
1696 1696 c, t dbSNP:746183321
1698 1698 c, t dbSNP:560785308
1699 1699 c, t dbSNP:776021951
1700 1700 c, t dbSNP:80358349
1712 1712 a, g dbSNP:764746811
1716 1716 a, g dbSNP:141010980
1717 1717 g, t dbSNP:546539357
1722 1722 c, t dbSNP:571300383
1723 1723 a, g dbSNP:372266009
1731 1731 a, g dbSNP:375514857
1733 1733 c, t dbSNP:764973232
1742 1742 a, g dbSNP:538985170
1750 1750 c, t dbSNP:758313905
1751 1751 a, g dbSNP:777731868
1756 1756 a, c dbSNP:751637394
1763 1763 a, g dbSNP:202230820
1765 1765 c, t dbSNP:757295271
1766 1766 a, g dbSNP:781405794
1769 1769 a, g dbSNP:746104220
1772 1772 c, t dbSNP:770142130
1778 1778 a, g dbSNP:776187516
1781 1781 a, g dbSNP:749708797
1785 1785 c, t dbSNP:587783883
1790 1790 c, g dbSNP:769279620
1794 1794 c, g dbSNP:775053765
1809 1809 a, g dbSNP:144853101
1812 1812 -, c dbSNP:34453758
1813 1813 c, t dbSNP:138765912
1824 1824 a, c dbSNP:770354010
1829 1829 a, g dbSNP:776307994
1831 1831 c, t dbSNP:200785457
1837 1837 c, t dbSNP:759134070
1838 1838 g, t dbSNP:764993497
1849 1849 a, g dbSNP:752461981
1852 1852 a, t dbSNP:536363403
1854 1854 a, c dbSNP:141937865
1860 1860 c, t dbSNP:587783884
1864 1864 g, t dbSNP:150837768
1865 1865 a, c dbSNP:374905176
1880 1880 a, t dbSNP:555179389
1885 1885 a, g dbSNP:781150294
1922 1922 a, g dbSNP:750562280
1927 1927 c, t dbSNP:756257801
1933 1933 -, gaga dbSNP:80358382
1935 1935 -, ga dbSNP:587783885
1965 1965 a, g dbSNP:587783887
1976 1976 a, g dbSNP:188309267
1995 1995 -, a dbSNP:34314728
2002 2002 -, gaaa dbSNP:587783888
2014 2014 c, g dbSNP:80358352
2028 2028 g, t dbSNP:748595346
2032 2032 a, g dbSNP:758803599
2038 2038 c, t dbSNP:778416353
2040 2040 a, g dbSNP:745359483
2041 2041 c, g dbSNP:769310563
2043 2043 a, g dbSNP:775080703
2051 2051 c, t dbSNP:748959339
2060 2060 c, t dbSNP:768342988
2064 2064 c, t dbSNP:587783889
2066 2066 a, g dbSNP:772284751
2071 2071 c, t dbSNP:574981584
2079 2079 a, g dbSNP:587783890
2080 2080 c, t dbSNP:369473705
2081 2081 a, g dbSNP:760769176
2083 2083 g, t dbSNP:138210440
2092 2092 c, t dbSNP:754066837
2097 2097 c, t dbSNP:755229018
2100 2100 c, g, t dbSNP:28638115
2102 2102 a, g, t dbSNP:372732709
2117 2117 c, t dbSNP:778086908
2128 2128 a, g dbSNP:747558873
2130 2130 a, g dbSNP:755570564
2132 2132 a, g dbSNP:779513147
2136 2136 a, g dbSNP:748832811
2140 2140 c, t dbSNP:768292156
2145 2145 c, t dbSNP:774111235
2149 2149 a, g dbSNP:747837504
2157 2157 a, g dbSNP:201051655
2160 2160 a, g dbSNP:201295325
2171 2171 a, t dbSNP:147230401
2175 2175 g, t dbSNP:760712544
2181 2181 a, g dbSNP:766468798
2189 2189 g, t dbSNP:149578437
2190 2190 a, g dbSNP:540432059
2198 2198 c, t dbSNP:374086000
2202 2202 a, c dbSNP:765367412
2209 2209 a, g dbSNP:144289137
2216 2216 a, g dbSNP:752980414
2233 2233 a, g dbSNP:763163376
2240 2240 -, tat dbSNP:776403850
2241 2241 -, a dbSNP:587783891
2263 2263 c, t dbSNP:764538711
2271 2271 a, t dbSNP:751966925
2285 2285 a, g dbSNP:140891645
2289 2289 -, a dbSNP:727503767
2295 2295 a, c dbSNP:138828510
2296 2296 a, g dbSNP:753332902
2302 2302 a, g dbSNP:754496859
2304 2304 a, c dbSNP:147532293
2320 2320 a, g dbSNP:761864879
2321 2321 a, t dbSNP:199546324
2323 2323 a, g dbSNP:200774440
2335 2335 a, c, g dbSNP:371073215
2336 2336 g, t dbSNP:747296657
2347 2347 c, t dbSNP:770988712
2363 2363 a, c dbSNP:776770380
2365 2365 a, g dbSNP:373101913
2373 2373 c, t dbSNP:587783892
2374 2374 a, g dbSNP:768964587
2379 2379 a, g, t dbSNP:142820200
2381 2381 a, g dbSNP:764259165
2384 2384 c, g dbSNP:751913459
2401 2401 a, g dbSNP:374023722
2408 2408 a, g dbSNP:530214717
2418 2418 a, g dbSNP:750933664
2424 2424 a, g dbSNP:754405649
2425 2425 a, c dbSNP:778508612
2450 2450 a, t dbSNP:776871098
2453 2453 c, g, t dbSNP:80358350
2469 2469 c, t dbSNP:746789978
2473 2473 a, g dbSNP:140100861
2474 2474 a, c dbSNP:781213650
2476 2476 a, c dbSNP:149892167
2479 2479 a, g dbSNP:375510491
2480 2480 c, t dbSNP:116049172
2484 2484 a, g dbSNP:376032121
2490 2490 a, g dbSNP:773594857
2505 2505 a, c dbSNP:75088717
2509 2509 a, g dbSNP:3822471
2522 2522 a, g dbSNP:774567810
2523 2523 a, t dbSNP:762097133
2525 2525 c, t dbSNP:200173176
2534 2534 -, a dbSNP:587783894
2544 2544 a, g dbSNP:538183552
2553 2553 a, t dbSNP:201482152
2554 2554 a, c dbSNP:766835753
2560 2560 a, g dbSNP:752248884
2569 2569 a, g dbSNP:144812404
2575 2575 c, t dbSNP:763785383
2580 2580 c, t dbSNP:550141620
2581 2581 c, g dbSNP:587783896
2585 2585 g, t dbSNP:757081951
2588 2588 c, t dbSNP:781159758
2591 2591 a, g dbSNP:745686171
2593 2593 c, t dbSNP:372162252
2595 2595 -, cc dbSNP:587783897
2596 2596 -, c dbSNP:587783898
2596 2596 c, t dbSNP:779911564
2598 2598 a, g dbSNP:146756149
2608 2608 g, t dbSNP:768620796
2616 2616 c, t dbSNP:774516564
2618 2618 c, g dbSNP:748391164
2620 2620 c, g dbSNP:772330143
2625 2625 a, g dbSNP:773534683
2631 2631 a, c, g dbSNP:765931580
2635 2635 -, aa dbSNP:727503766
2648 2648 a, g dbSNP:373925592
2649 2649 c, t dbSNP:762460698
2652 2652 a, c dbSNP:763732540
2663 2663 a, g dbSNP:751211535
2675 2675 a, t dbSNP:756935314
2676 2676 a, g dbSNP:374380375
2677 2677 a, g dbSNP:767341646
2693 2693 c, t dbSNP:750217822
2698 2698 a, g dbSNP:377186258
2707 2707 a, g dbSNP:148420552
2711 2711 a, c, g dbSNP:751048321
2712 2712 a, c dbSNP:749213303
2716 2716 a, g dbSNP:755001260
2718 2718 c, t dbSNP:370823399
2744 2744 a, g dbSNP:148075057
2748 2748 c, t dbSNP:587783899
2749 2749 g, t dbSNP:748268539
2775 2775 a, g dbSNP:772277123
2778 2778 a, c, t dbSNP:773366068
2782 2782 a, g dbSNP:185678374
2802 2802 g, t dbSNP:572898488
2803 2803 a, c dbSNP:777159279
2813 2813 a, g dbSNP:587783900
2822 2822 a, c dbSNP:759987095
2825 2825 g, t dbSNP:770475786
2826 2826 g, t dbSNP:773990755
2832 2832 c, t dbSNP:761463091
2837 2837 a, g dbSNP:141851878
2840 2840 a, g dbSNP:61755038
2860 2860 c, t dbSNP:760476489
2862 2862 c, t dbSNP:766108812
2863 2863 a, c, g dbSNP:376912534
2864 2864 g, t dbSNP:778889561
2871 2871 a, t dbSNP:752762369
2877 2877 c, t dbSNP:587783901
2878 2878 a, g dbSNP:758488035
2883 2883 a, g dbSNP:777987450
2891 2891 a, g dbSNP:747228856
2892 2892 a, g dbSNP:558749457
2910 2910 c, t dbSNP:587783902
2911 2911 a, c, g dbSNP:142574933
2924 2924 a, g dbSNP:746297367
2934 2934 c, t dbSNP:770406356
2935 2935 a, g dbSNP:80358359
2936 2936 c, t dbSNP:139177541
2939 2939 c, t dbSNP:587783903
2940 2940 c, t dbSNP:772870207
2944 2944 -, ata dbSNP:769307619
2944 2944 a, g dbSNP:753898269
2946 2946 a, g dbSNP:188564740
2949 2949 a, g dbSNP:376990497
2957 2957 a, c, g dbSNP:293756
2958 2958 g, t dbSNP:765103108
2959 2959 c, t dbSNP:587783904
2967 2967 -, ag dbSNP:398124465
2968 2968 a, g dbSNP:372453541
2971 2971 a, g dbSNP:758436782
2977 2977 c, g, t dbSNP:587783905
2982 2982 c, t dbSNP:587783906
2983 2983 a, g dbSNP:150498581
2988 2988 c, t dbSNP:587783907
2989 2989 a, g, t dbSNP:757394370
2993 2993 g, t dbSNP:587783908
2999 2999 c, g dbSNP:201163469
3002 3002 c, g, t dbSNP:746173840
3003 3003 a, g dbSNP:780665254
3010 3010 a, g dbSNP:749833499
3025 3025 c, t dbSNP:769254029
3028 3028 g, t dbSNP:772566455
3034 3034 c, g dbSNP:746596330
3037 3037 a, g dbSNP:543684890
3041 3041 a, g dbSNP:770478485
3043 3043 a, g dbSNP:776280237
3048 3048 c, g dbSNP:759261898
3064 3064 a, t dbSNP:147522427
3067 3067 a, g dbSNP:376095079
3077 3077 c, t dbSNP:775361188
3080 3080 a, t dbSNP:80358365
3085 3085 c, t dbSNP:542244170
3086 3086 a, g dbSNP:764136312
3090 3090 c, t dbSNP:398124466
3091 3091 a, g dbSNP:149629686
3094 3094 a, g dbSNP:200189574
3097 3097 a, g dbSNP:767565592
3099 3099 a, g dbSNP:144392474
3104 3104 c, t dbSNP:750703789
3110 3110 a, g dbSNP:756495812
3113 3113 g, t dbSNP:192992005
3114 3114 -, g dbSNP:398124467
3121 3121 a, g dbSNP:374308470
3125 3125 a, c dbSNP:749708811
3127 3127 a, g dbSNP:755435047
3131 3131 a, g dbSNP:200496609
3132 3132 g, t dbSNP:746447744
3142 3142 a, t dbSNP:770481159
3156 3156 c, g dbSNP:776228768
3161 3161 c, t dbSNP:376637245
3168 3168 c, t dbSNP:769488387
3169 3169 a, g dbSNP:775238155
3170 3170 c, t dbSNP:762876279
3179 3179 a, g dbSNP:763876444
3191 3191 c, t dbSNP:774346043
3198 3198 a, c dbSNP:761756303
3199 3199 -, g dbSNP:587783909
3215 3215 c, t dbSNP:148394805
3226 3226 c, t dbSNP:750577499
3230 3230 c, t dbSNP:756373027
3238 3238 a, g dbSNP:766774397
3242 3242 c, t dbSNP:780317958
3244 3244 a, g dbSNP:755384710
3246 3246 a, g dbSNP:755271349
3248 3248 c, g dbSNP:753280932
3256 3256 g, t dbSNP:200991784
3260 3260 c, t dbSNP:188565385
3261 3261 -, aa dbSNP:587783910
3267 3267 a, g dbSNP:142517671
3270 3270 a, g dbSNP:780661057
3276 3276 a, g dbSNP:745426441
3279 3279 a, g dbSNP:769437048
3285 3285 a, g dbSNP:779691362
3286 3286 c, t dbSNP:139833594
3290 3290 a, c dbSNP:748966128
3291 3291 c, t dbSNP:768524222
3320 3320 a, t dbSNP:587783911
3331 3331 a, g dbSNP:774105561
3332 3332 c, t dbSNP:761786416
3335 3335 g, t dbSNP:772174282
3344 3344 a, g dbSNP:371566938
3356 3356 c, t dbSNP:760895817
3376 3376 a, g dbSNP:200249421
3389 3389 a, c dbSNP:765533064
3390 3390 a, g dbSNP:759781764
3391 3391 -, a dbSNP:587783912
3391 3391 a, g, t dbSNP:180747605
3392 3392 a, t dbSNP:758911512
3407 3407 a, g dbSNP:778323343
3414 3414 a, g dbSNP:749926228
3419 3419 a, g dbSNP:587783913
3421 3421 c, t dbSNP:779638068
3427 3427 a, g dbSNP:748989594
3434 3434 a, g dbSNP:200018885
3450 3450 a, g dbSNP:778735646
3454 3454 c, t dbSNP:747958576
3462 3462 g, t dbSNP:772121235
3464 3464 g, t dbSNP:773295913
3468 3468 g, t dbSNP:760771193
3503 3503 a, g dbSNP:1669445
3506 3506 a, g dbSNP:776669672
3509 3509 a, g dbSNP:143369211
3512 3512 a, g dbSNP:765421145
3531 3531 -, gt dbSNP:768074630
3535 3535 g, t dbSNP:753105098
3537 3537 a, c dbSNP:146714879
3548 3548 -, agag dbSNP:587783914
3554 3554 c, t dbSNP:764513488
3570 3570 a, c dbSNP:752087990
3589 3589 a, g dbSNP:755568891
3590 3590 a, g dbSNP:765887558
3591 3591 a, c, g dbSNP:587783915
3592 3592 c, t dbSNP:368526792
3596 3596 a, g dbSNP:566411488
3597 3597 a, g dbSNP:587783916
3598 3598 a, g dbSNP:113185324
3600 3600 a, t dbSNP:747918239
3604 3604 a, g dbSNP:758273343
3611 3611 g, t dbSNP:777678265
3612 3612 a, g dbSNP:746847096
3614 3614 c, t dbSNP:757245118
3615 3615 a, g dbSNP:781054477
3629 3629 a, g, t dbSNP:368762999
3648 3648 c, g dbSNP:371836944
3656 3656 g, t dbSNP:188021705
3662 3662 a, g dbSNP:749483452
3668 3668 a, g dbSNP:768918033
3671 3671 c, t dbSNP:774686438
3690 3690 c, t dbSNP:762234061
3692 3692 c, t dbSNP:768002739
3696 3696 a, t dbSNP:773606834
3719 3719 c, t dbSNP:759037419
3729 3729 c, g dbSNP:764683974
3748 3748 a, g dbSNP:374823114
3779 3779 -, g dbSNP:34422680
3783 3783 a, g dbSNP:752294556
3784 3784 c, t dbSNP:762670218
3811 3811 a, g dbSNP:771559939
3816 3816 -, gaaaa dbSNP:587783925
3823 3823 a, g dbSNP:772932503
3827 3827 a, g dbSNP:544459951
3831 3831 a, c dbSNP:35748854
3832 3832 a, g dbSNP:776450648
3847 3847 a, g dbSNP:62654862
3858 3858 c, g dbSNP:759445904
3873 3873 a, g, t dbSNP:149134659
3901 3901 c, g dbSNP:762118494
3902 3902 c, t dbSNP:767920646
3905 3905 a, t dbSNP:369240129
3906 3906 -, ata dbSNP:121918266
3906 3906 a, g dbSNP:587783929
3920 3920 a, g dbSNP:372752190
3923 3923 c, t dbSNP:370889560
3937 3937 c, t dbSNP:756562931
3950 3950 a, g dbSNP:143252734
3956 3956 -, tga dbSNP:772674746
3958 3958 a, g dbSNP:775247210
3964 3964 a, g dbSNP:762912820
3965 3965 a, t dbSNP:768536990
3977 3977 a, g dbSNP:774573086
3980 3980 a, c dbSNP:761991838
4027 4027 c, g dbSNP:121918268
4059 4059 c, t dbSNP:753222256
4067 4067 c, t dbSNP:756713894
4075 4075 c, t dbSNP:766979302
4078 4078 -, tg dbSNP:587783930
4083 4083 a, g dbSNP:749981341
4094 4094 -, cttggagaagaatat dbSNP:587783931
4108 4108 g, t dbSNP:587783932
4116 4116 g, t dbSNP:755790180
4130 4130 c, t dbSNP:139137985
4131 4131 a, g dbSNP:749056969
4135 4135 c, t dbSNP:754755185
4141 4141 a, g dbSNP:143152112
4151 4151 c, t dbSNP:531615496
4152 4152 a, g dbSNP:758404835
4156 4156 -, ctga dbSNP:587783934
4158 4158 -, gaa dbSNP:773996562
4158 4158 a, g dbSNP:587783935
4163 4163 a, g dbSNP:777857860
4164 4164 g, t dbSNP:587783936
4167 4167 a, g dbSNP:747050519
4184 4184 c, g dbSNP:770936588
4187 4187 c, t dbSNP:80358354
4191 4191 a, t dbSNP:746043422
4206 4206 a, c dbSNP:770047320
4214 4214 a, g dbSNP:367925827
4219 4219 c, g dbSNP:763315761
4227 4227 a, g dbSNP:769095978
4229 4229 a, t dbSNP:774746577
4230 4230 a, g dbSNP:760196234
4233 4233 a, g dbSNP:563606953
4238 4238 c, t dbSNP:753438136
4257 4257 a, g dbSNP:758528908
4260 4260 c, t dbSNP:765051194
4280 4280 c, g dbSNP:376434880
4301 4301 a, t dbSNP:111521307
4305 4305 -, aaa dbSNP:761307264
4307 4307 a, c dbSNP:587783938
4309 4309 c, g dbSNP:752472468
4310 4310 c, t dbSNP:758279525
4315 4315 a, t dbSNP:776386128
4331 4331 a, g dbSNP:373206831
4335 4335 c, t dbSNP:770223945
4378 4378 a, g dbSNP:772696266
4380 4380 a, g dbSNP:372080833
4388 4388 -, aagt dbSNP:587783940
4389 4389 a, g dbSNP:113779525
4414 4414 c, g dbSNP:759120298
4423 4423 a, g dbSNP:764922800
4433 4433 -, ag dbSNP:587783941
4433 4433 a, g dbSNP:112616049
4451 4451 c, t dbSNP:752419634
4454 4454 c, t dbSNP:762796601
4494 4494 c, g dbSNP:61755039
4496 4496 a, g dbSNP:751416634
4500 4500 a, c dbSNP:79598279
4502 4502 a, g dbSNP:567328110
4517 4517 a, g dbSNP:757125850
4535 4535 a, c dbSNP:138440449
4565 4565 -, aaatgtcagtgaa dbSNP:587783944
4566 4566 a, g dbSNP:761684520
4575 4575 -, gaactacagt dbSNP:80358386
4580 4580 a, g dbSNP:767311814
4605 4605 a, g dbSNP:756050354
4607 4607 g, t dbSNP:746550826
4611 4611 a, g, t dbSNP:727503769
4625 4625 c, t dbSNP:767317539
4628 4628 a, g dbSNP:773043534
4634 4634 c, t dbSNP:760594320
4642 4642 c, t dbSNP:201882678
4652 4652 a, g dbSNP:370422740
4664 4664 g, t dbSNP:749296628
4670 4670 c, t dbSNP:765326455
4691 4691 a, g dbSNP:752992906
4696 4696 a, g dbSNP:758588654
4711 4711 c, g dbSNP:587783947
4712 4712 g, t dbSNP:80358358
4726 4726 a, t dbSNP:141956774
4729 4729 g, t dbSNP:587783948
4732 4732 a, t dbSNP:776570810
4739 4739 a, g dbSNP:759492239
4740 4740 c, t dbSNP:765328819
4743 4743 a, g dbSNP:764009294
4746 4746 c, t dbSNP:763219578
4783 4783 c, t dbSNP:199570957
4801 4801 a, t dbSNP:80358369
4803 4803 c, g dbSNP:377211455
4825 4825 a, t dbSNP:587783949
4830 4830 a, g dbSNP:536320603
4833 4833 g, t dbSNP:587783950
4840 4840 c, t dbSNP:751902505
4845 4845 -, aaa dbSNP:754929654
4857 4857 c, g dbSNP:762169826
4860 4860 a, g dbSNP:767975743
4866 4866 c, g dbSNP:377716907
4868 4868 c, t dbSNP:756639524
4874 4874 c, t dbSNP:539180409
4879 4879 c, t dbSNP:766801991
4883 4883 g, t dbSNP:587783952
4896 4896 c, t dbSNP:121918269
4906 4906 a, g dbSNP:752195607
4916 4916 c, t dbSNP:757927629
4925 4925 c, t dbSNP:777362486
4926 4926 -, c dbSNP:587783953
4940 4940 a, c, t dbSNP:760960982
4942 4942 a, c, g dbSNP:754335963
4946 4946 a, g dbSNP:763571035
4953 4953 -, g dbSNP:587783955
4964 4964 c, t dbSNP:587783956
4968 4968 c, t dbSNP:150683463
4973 4973 c, g dbSNP:756897581
4974 4974 -, tttg dbSNP:587783957
4989 4989 a, c dbSNP:780708835
5002 5002 a, c, t dbSNP:77632238
5003 5003 a, g dbSNP:745615007
5014 5014 a, c dbSNP:755880602
5015 5015 a, g dbSNP:779999171
5016 5016 a, c dbSNP:749218502
5021 5021 a, g dbSNP:140021654
5030 5030 c, t dbSNP:774573141
5033 5033 a, t dbSNP:186417615
5063 5063 g, t dbSNP:587783958
5078 5078 c, t dbSNP:753756758
5083 5083 a, g dbSNP:374279126
5091 5091 a, g dbSNP:779007826
5096 5096 -, ga dbSNP:80358372
5108 5108 -, ag dbSNP:587783959
5117 5117 c, t dbSNP:112128017
5139 5139 a, g dbSNP:748190130
5146 5146 a, g dbSNP:772077115
5147 5147 a, c, g dbSNP:777950633
5151 5151 a, g dbSNP:62654861
5173 5173 a, g dbSNP:771241543
5174 5174 a, c dbSNP:776975871
5190 5190 a, g dbSNP:759899214
5196 5196 c, t dbSNP:149451089
5222 5222 c, g dbSNP:747179198
5249 5249 a, g dbSNP:145952190
5250 5250 a, g dbSNP:781402189
5256 5256 c, t dbSNP:746181669
5257 5257 g, t dbSNP:770173799
5262 5262 c, t dbSNP:775870451
5276 5276 c, t dbSNP:754312670
5300 5300 a, g dbSNP:769274211
5306 5306 c, t dbSNP:776332291
5308 5308 a, g dbSNP:770286768
5317 5317 a, g dbSNP:559139612
5323 5323 -, cccagtg dbSNP:587783960
5341 5341 a, c dbSNP:774109272
5342 5342 a, g dbSNP:765047071
5344 5344 c, t dbSNP:775077572
5346 5346 c, t dbSNP:762816601
5353 5353 c, t dbSNP:763888888
5357 5357 a, g dbSNP:751545774
5375 5375 a, g dbSNP:545623030
5377 5377 a, g dbSNP:757224529
5391 5391 c, t dbSNP:139819353
5403 5403 c, t dbSNP:750570299
5406 5406 c, g dbSNP:575973361
5408 5408 c, t dbSNP:780337526
5427 5427 a, g dbSNP:749567855
5443 5443 a, g dbSNP:755405307
5448 5448 a, g dbSNP:779189164
5457 5457 c, t dbSNP:121918267
5464 5464 -, a dbSNP:587783961
5465 5465 a, g dbSNP:143222832
5472 5472 a, g dbSNP:772765625
5474 5474 a, t dbSNP:780843089
5478 5478 a, g dbSNP:745372802
5481 5481 a, g dbSNP:769510161
5485 5485 a, g dbSNP:775226349
5487 5487 a, t dbSNP:762616275
5488 5488 c, t dbSNP:200053064
5497 5497 c, t dbSNP:774062619
5500 5500 a, g dbSNP:761724507
5501 5501 a, g dbSNP:587783962
5502 5502 -, t dbSNP:730880331
5517 5517 a, g dbSNP:771949637
5520 5520 a, t dbSNP:773164199
5531 5531 c, g, t dbSNP:775399549
5535 5535 a, g dbSNP:528213483
5539 5539 a, g, t dbSNP:374265736
5544 5544 a, g dbSNP:765379536
5562 5562 a, c dbSNP:587783965
5564 5564 a, g dbSNP:753050851
5585 5585 a, g dbSNP:758853244
5596 5596 a, g dbSNP:778380312
5617 5617 a, t dbSNP:587783966
5620 5620 g, t dbSNP:587783970
5624 5624 a, g dbSNP:144979877
5625 5625 c, t dbSNP:587783971
5655 5655 c, t dbSNP:587783972
5656 5656 a, g dbSNP:80358380
5660 5660 a, g dbSNP:765446922
5665 5665 c, t dbSNP:775881994
5668 5668 g, t dbSNP:483353060
5679 5679 -, tctg dbSNP:587783973
5688 5688 a, g dbSNP:763307074
5703 5703 a, c dbSNP:771869795
5714 5714 a, g dbSNP:752026879
5730 5730 c, t dbSNP:80358362
5745 5745 c, t dbSNP:587783975
5746 5746 a, g dbSNP:80358366
5754 5754 g, t dbSNP:587783976
5755 5755 a, g dbSNP:587783977
5757 5757 a, c dbSNP:750864821
5762 5762 a, g dbSNP:369177620
5772 5772 c, g, t dbSNP:62654864
5773 5773 a, g dbSNP:587783978
5801 5801 a, g dbSNP:146702130
5815 5815 a, g dbSNP:148446678
5821 5821 a, g dbSNP:757982626
5826 5826 a, g dbSNP:777413835
5830 5830 a, t dbSNP:751316937
5840 5840 c, t dbSNP:757029751
5856 5856 a, g dbSNP:80358373
5861 5861 a, t dbSNP:781077369
5873 5873 c, t dbSNP:112125562
5921 5921 c, t dbSNP:369235309
5931 5931 a, g dbSNP:376084993
5973 5973 a, c dbSNP:562826277
5980 5980 a, g dbSNP:190086412
6002 6002 a, g dbSNP:545834258
6005 6005 a, g dbSNP:569762677
6022 6022 a, c dbSNP:587783982
6038 6038 c, t dbSNP:748268175
6042 6042 a, g dbSNP:199639172
6050 6050 c, t dbSNP:778081443
6052 6052 a, g dbSNP:587783983
6062 6062 a, c dbSNP:771252680
6071 6071 a, g dbSNP:142635202
6073 6073 a, g dbSNP:746357461
6076 6076 a, g dbSNP:374294679
6091 6091 c, t dbSNP:773668251
6092 6092 c, t dbSNP:761398208
6104 6104 a, g dbSNP:375622324
6110 6110 c, t dbSNP:772917259
6118 6118 c, g dbSNP:368584228
6124 6124 a, g dbSNP:766136878
6146 6146 a, t dbSNP:776513362
6152 6152 c, t dbSNP:759401891
6155 6155 a, g dbSNP:370179049
6164 6164 c, t dbSNP:61748200
6182 6182 c, t dbSNP:776458092
6196 6196 a, c dbSNP:759154614
6205 6205 c, t dbSNP:769605459
6209 6209 a, g dbSNP:375694876
6213 6213 g, t dbSNP:587783986
6214 6214 -, ttg dbSNP:587783987
6221 6221 c, t dbSNP:200548405
6234 6234 a, c dbSNP:370593530
6258 6258 a, g dbSNP:764022167
6269 6269 c, t dbSNP:761030463
6271 6271 a, g dbSNP:368028754
6327 6327 a, c dbSNP:587783989
6347 6347 c, t dbSNP:140907869
6357 6357 a, c dbSNP:587783990
6358 6358 a, g dbSNP:587783991
6361 6361 a, c, t dbSNP:587783992
6362 6362 a, g dbSNP:745516748
6397 6397 a, g dbSNP:769397450
6401 6401 a, g dbSNP:755732764
6414 6414 a, g dbSNP:779592620
6427 6427 a, g dbSNP:749041461
6430 6430 c, t dbSNP:768408469
6435 6435 a, g dbSNP:587783996
6437 6437 a, g dbSNP:774190237
6448 6448 c, t dbSNP:587783997
6460 6460 c, t dbSNP:587783998
6467 6467 a, g dbSNP:748074172
6471 6471 c, g dbSNP:772003089
6472 6472 c, t dbSNP:587783999
6479 6479 a, t dbSNP:773286952
6489 6489 g, t dbSNP:760694971
6499 6499 -, g dbSNP:34512595
6506 6506 c, t dbSNP:766586011
6509 6509 a, c, g, t dbSNP:149769284
6521 6521 c, t dbSNP:376800486
6532 6532 g, t dbSNP:587784000
6540 6540 g, t dbSNP:587784002
6556 6556 g, t dbSNP:587784003
6602 6602 a, g dbSNP:147865925
6606 6606 c, g dbSNP:587784004
6607 6607 -, tgtg dbSNP:587784005
6612 6612 a, g dbSNP:587784006
6622 6622 a, g dbSNP:374645420
6633 6633 a, g dbSNP:587784007
6652 6652 -, aaa dbSNP:587784008
6654 6654 a, g dbSNP:768026341
6659 6659 a, g dbSNP:369295272
6679 6679 a, g dbSNP:759079809
6680 6680 c, t dbSNP:141545751
6689 6689 c, t dbSNP:752327065
6690 6690 c, t dbSNP:372730081
6692 6692 a, g dbSNP:777430704
6728 6728 c, t dbSNP:376448686
6729 6729 a, g dbSNP:757080818
6745 6745 a, g dbSNP:781297222
6768 6768 g, t dbSNP:147054690
6789 6789 a, g dbSNP:750862610
6824 6824 c, g dbSNP:774665042
6833 6833 a, g dbSNP:138404850
6847 6847 a, g dbSNP:398124469
6855 6855 c, t dbSNP:587784013
6858 6858 a, g dbSNP:587784014
6861 6861 a, t dbSNP:587784015
6866 6866 c, t dbSNP:759147525
6880 6880 a, g dbSNP:587784017
6887 6887 c, t dbSNP:773628266
6896 6896 a, g dbSNP:544147349
6903 6903 a, g, t dbSNP:587784018
6914 6914 c, t dbSNP:371380435
6915 6915 a, g dbSNP:763610468
6921 6921 g, t dbSNP:80358363
6922 6922 -, aag dbSNP:587784019
6931 6931 -, atctata dbSNP:80358361
6935 6935 a, g dbSNP:149186951
6936 6936 c, t dbSNP:587784020
6938 6938 -, ta dbSNP:587784021
6942 6942 a, g dbSNP:761605563
6943 6943 -, ata dbSNP:587784022
6947 6947 c, t dbSNP:767406866
6964 6964 c, t dbSNP:750309699
6965 6965 c, t dbSNP:756057442
6974 6974 c, t dbSNP:766363037
6991 6991 g, t dbSNP:727504047
6995 6995 a, g dbSNP:753822274
6997 6997 a, t dbSNP:587784023
7013 7013 a, g dbSNP:187845879
7016 7016 a, g dbSNP:201215377
7030 7030 a, g dbSNP:752953852
7037 7037 a, g dbSNP:200322289
7085 7085 a, t dbSNP:781461880
7097 7097 c, t dbSNP:746375194
7103 7103 c, t dbSNP:770272272
7109 7109 a, g dbSNP:778420641
7125 7125 a, g dbSNP:747682655
7136 7136 c, t dbSNP:372139946
7169 7169 c, t dbSNP:772966461
7171 7171 a, g dbSNP:760452129
7178 7178 c, t dbSNP:201968259
7182 7182 c, g, t dbSNP:80358376
7183 7183 a, g dbSNP:587784024
7184 7184 c, t dbSNP:58424791
7194 7194 c, t dbSNP:770744719
7198 7198 a, g dbSNP:776353314
7225 7225 g, t dbSNP:587784025
7242 7242 c, t dbSNP:587784026
7253 7253 a, g dbSNP:762930515
7278 7278 c, g dbSNP:764147606
7281 7281 c, g dbSNP:774483696
7283 7283 a, g dbSNP:587784028
7290 7290 a, g dbSNP:751872913
7291 7291 c, t dbSNP:762029831
7295 7295 a, g dbSNP:767647337
7301 7301 -, gg dbSNP:587784029
7302 7302 c, g dbSNP:587784030
7304 7304 a, t dbSNP:750760089
7309 7309 a, t dbSNP:537134096
7313 7313 a, g dbSNP:781090000
7314 7314 c, t dbSNP:587784031
7326 7326 c, g dbSNP:754381730
7328 7328 c, t dbSNP:755606647
7337 7337 c, g, t dbSNP:398124470
7347 734